WO2015034928A1 - Chimeric polynucleotides - Google Patents

Chimeric polynucleotides Download PDF

Info

Publication number
WO2015034928A1
WO2015034928A1 PCT/US2014/053907 US2014053907W WO2015034928A1 WO 2015034928 A1 WO2015034928 A1 WO 2015034928A1 US 2014053907 W US2014053907 W US 2014053907W WO 2015034928 A1 WO2015034928 A1 WO 2015034928A1
Authority
WO
WIPO (PCT)
Prior art keywords
region
chimeric polynucleotide
polynucleotide
chimeric
utp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/053907
Other languages
English (en)
French (fr)
Inventor
Stephen G. HOGE
Andrew FRALEY
Divakar RAMAKRISHNAN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Moderna Inc
Original Assignee
Moderna Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Moderna Therapeutics Inc filed Critical Moderna Therapeutics Inc
Priority to US14/915,959 priority Critical patent/US20160194625A1/en
Priority to EP14766339.7A priority patent/EP3041934A1/en
Priority to JP2016540348A priority patent/JP2016530294A/ja
Priority to AU2014315287A priority patent/AU2014315287A1/en
Priority to CA2923029A priority patent/CA2923029A1/en
Publication of WO2015034928A1 publication Critical patent/WO2015034928A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67General methods for enhancing the expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates
    • C12P19/28N-glycosides
    • C12P19/30Nucleotides
    • C12P19/34Polynucleotides, e.g. nucleic acids, oligoribonucleotides

Definitions

  • the invention relates to compositions, methods, processes, kits and devices for the design, preparation, manufacture and/or formulation of chimeric polynucleotides.
  • nucleic acid based compounds or chimeric polynucleotides both coding and non-coding and combinations thereof
  • nucleic acid based compounds or chimeric polynucleotides both coding and non-coding and combinations thereof
  • structural and/or chemical features that avoid one or more of the problems in the art, for example, features which are useful for optimizing nucleic acid-based therapeutics while retaining structural and functional integrity, overcoming the threshold of expression, improving expression rates, half life and/or protein concentrations, optimizing protein localization, and avoiding deleterious bio-responses such as the immune response and/or degradation pathways.
  • Each of these barriers may be reduced or eliminated using the present invention.
  • the present inventors have developed chimeric polynucleotides and methods of synthesizing these polynucleotides which allow for customized placement, position and percent load of chemical modifications, which improve, alter or optimize certain physicochemical and pharmaceutical properties of the polynucleotides.
  • compositions, methods, processes, kits and devices for the design, preparation, manufacture and/or formulation of chimeric polynucleotides are Described herein.
  • such chimeric polynucleotides take the form or or function as modified mRNA molecules which encode a polypeptide of interest.
  • such chimeric polynucleotides are substantially non-coding.
  • chimeric polynucleotides encoding a polypeptide, where the chimeric polynucleotide having a sequence or structure comprising Formula I, 5 ' [An]x-Ll-[Bo]y-L2-[Cp]z-L3 3 '
  • each of A and B independently comprise a region of linked nucleosides
  • C is an optional region of linked nucleosides
  • At least one of regions A, B, or C is positionally modified, wherein said positionally modified region comprises at least two chemically modified nucleosides of one or more of the same nucleoside type of adenosine, thymidine, guanosine, cytidine, or uridine, and wherein at least two of the chemical modifications of nucleosides of the same type are different chemical modifications;
  • n, o and p are independenty an integer between 15-1000;
  • x and y are independently 1-20;
  • LI and L2 are independently optional linker moieties, said linker moieties being either nucleic acid based or non-nucleic acid based; and
  • L3 is an optional conjugate or an optional linker moiety, said linker moiety being either nucleic acid based or non-nucleic acid based.
  • FIG. 1 comprises Figure 1A and Figure IB showing a schematic of a polynucleotide construct.
  • Figure 1 A is a schematic of a polynucleotide construct taught in commonly owned co-pending US Patent Application 13/791,922 filed March 9, 2013, the contents of which are incorporated herein by reference.
  • Figure IB is a schematic of a linear polynucleotide construct.
  • FIG. 2 is a schematic of a series of chimeric polynucleotides of the present invention.
  • FIG. 3 is a schematic of a series of chimeric polynucleotides illustrating various patterns of positional modifications and showing regions analogous to those regions of an m NA polynucleotide.
  • FIG. 4 is a schematic of a series of chimeric polynucleotides illustrating various patterns of positional modifications based on Formula I.
  • FIG. 5 is a is a schematic of a series of chimeric polynucleotides illustrating various patterns of positional modifications based on Formula I and further illustrating a blocked or structured 3 ' terminus.
  • FIG. 6 is a schematic of a circular construct of the present invention.
  • FIG. 7 is a schematic of a circular construct of the present invention.
  • FIG. 8 is a schematic of a circular construct of the present invention comprising at least one spacer region.
  • FIG. 9 is a schematic of a circular construct of the present invention comprising at least one sensor region.
  • FIG. 10 is a schematic of a circular construct of the present invention comprising at least one sensor region and a spacer region.
  • FIG. 11 is a schematic of a non-coding circular construct of the present invention.
  • FIG. 12 is a schematic of a non-coding circular construct of the present invention.
  • RNA ribonucleic acid
  • RNA ribonucleic acid
  • One beneficial outcome is to cause intracellular translation of the nucleic acid and production of an encoded polypeptide of interest.
  • non-coding RNA has become a focus of much study; and utilization of non-coding polynucleotides, alone and in conjunction with coding polynucleotides, could provide beneficial outcomes in therapeutic scenarios.
  • compositions including pharmaceutical compositions
  • polynucleotides specifically chimeric polynucleotides.
  • chimeric polynucleotides are preferably modified in a manner as to avoid the deficiencies of other molecules of the art.
  • modified polynucleotides encoding polypeptides i.e., modified mRNA
  • chimeric polynucleotides which, due to their chimeric nature, have been designed to improve one or more of the stability and/or clearance in tissues, receptor uptake and/or kinetics, cellular access, engagement with translational machinery, mRNA half-life, translation efficiency, immune evasion, immune induction (for vaccines), protein production capacity, secretion efficiency (when applicable), accessibility to circulation, protein half-life and/or modulation of a cell's status, function and/or activity.
  • nucleic acid molecules specifically polynucleotides which are chimeric and which, in some embodiments, encode one or more polypeptides of interest.
  • nucleic acid in its broadest sense, includes any compound and/or substance that comprise a polymer of nucleotides. These polymers are often referred to as polynucleotides.
  • nucleic acids or polynucleotides of the invention include, but are not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a ⁇ - D-ribo configuration, a-LNA having an a-L- ribo configuration (a diastereomer of LNA), 2'-amino-LNA having a 2 '-amino functionalization, and 2'-amino- a-LNA having a 2'-amino functionalization), ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) or hybrids or combinations thereof.
  • RNAs ribonucleic acids
  • DNAs deoxyribonucleic acids
  • TAAs threose nucle
  • the nucleic acid molecule is or functions as a messenger RNA (mRNA).
  • mRNA messenger RNA
  • the term "messenger RNA” (mRNA) refers to any polynucleotide which encodes a polypeptide of interest and which is capable of being translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ or ex vivo.
  • Figure 1 illustrates a representative polynucleotide 100 which may serve as a starting, parent or scaffold molecule for the design of chimeric polynucleotides of the invention which encode polypeptides.
  • the polynucleotide 100 here contains a first region of linked nucleotides 102 that is flanked by a first flanking region 104 and a second flaking region 106.
  • the polynucleotide may encode at its 5 ' terminus one or more signal sequences in the signal sequence region 103.
  • the flanking region 104 may comprise a region of linked nucleotides comprising one or more complete or incomplete 5' UTRs sequences which may be completely codon optimized or partially codon optimized.
  • the flanking region 104 may include at least one nucleic acid sequence including, but not limited to, miR sequences, TERZAKTM sequences and translation control sequences.
  • the flanking region 104 may also comprise a 5' terminal cap 108.
  • the 5' terminal capping region 108 may include a cap such as a naturally occurring cap, a synthetic cap or an optimized cap.
  • optimized caps include the caps taught by Rhoads in US Patent No. US7074596 and International Patent Publication No. WO2008157668, WO2009149253 and WO2013103659, the contents of each of which are herein incorporated by reference in its entirety.
  • the second flanking region 106 may comprise a region of linked nucleotides comprising one or more complete or incomplete 3' UTRs. The second flanking region 106 may be completely codon optimized or partially codon optimized.
  • the flanking region 106 may include at least one nucleic acid sequence including, but not limited to, miR sequences and translation control sequences.
  • the flanking region 106 may also comprise a 3' tailing sequence 110.
  • the 3 ' tailing sequence 110 may include a synthetic tailing region 112 and/or a chain
  • Non-liming examples of a synthetic tailing region include a polyA sequence, a polyC sequence, a polyA-G quartet.
  • Non-limiting examples of chain terminating nucleosides include 2 -0 methyl, F and locked nucleic acids (LNA).
  • first operational region 105 Bridging the 5' terminus of the first region 102 and the first flanking region 104 is a first operational region 105.
  • this operational region comprises a Start codon.
  • the operational region may alternatively comprise any translation initiation sequence or signal including a Start codon.
  • this operational region comprises a Stop codon.
  • the operational region may alternatively comprise any translation initiation sequence or signal including a Stop codon. Multiple serial stop codons may also be used.
  • the present invention expands the scope of functionality of traditional mRNA molecules as well as those produced via IVT in the art, by providing chimeric polynucleotides or RNA constructs which maintain a modular organization, but which comprise one or more structural and/or chemical modifications or alterations which impart useful properties to the polynucleotide.
  • the chimeric polynucleotides which are modified mRNA molecules of the present invention are termed "chimeric modified mRNA" or "chimeric mRNA.”
  • a “chimera” according to the present invention is an entity having two or more incongruous or heterogeneous parts or regions.
  • chimeric polynucleotides or “chimeric polynucleotides” are those nucleic acid polymers having portions or regions which differ in size and/or chemical modification pattern, chemical modification position, chemical modification percent or chemical modification population and combinations of the foregoing.
  • a "part" or “region” of a polynucleotide is defined as any portion of the polynucleotide which is less than the entire length of the polynucleotide.
  • Examples of parts or regions, where the chimeric polynucleotide functions as an mRNA and encodes a polypeptide of interest include, but are not limited to, untranslated regions (UTRs, such as the 5 ' UTR or 3 ' UTR), coding regions, cap regions, polyA tail regions, start regions, stop regions, signal sequence regions, and combinations thereof.
  • UTRs untranslated regions
  • Figure 2 illustrates certain embodiments of the chimeric polynucleotides of the invention which may be used as mRNA.
  • Figure 3 illustrates a schematic of a series of chimeric polynucleotides identifying various patterns of positional modifications and showing regions analogous to those regions of an mRNA polynucleotide. Regions or parts that join or lie between other regions may also be designed to have subregions. These are shown in the figure.
  • the chimeric polynucleotides of the invention have a structure comprising Formula I.
  • each of A and B independently comprise a region of linked nucleosides
  • C is an optional region of linked nucleosides
  • At least one of regions A, B, or C is positionally modified, wherein the
  • positionally modified region comprises at least two chemically modified nucleosides of one or more of the same nucleoside type of adenosine, thymidine, guanosine, cytidine, or uridine, and wherein at least two of the chemical modifications of nucleosides of the same type are different chemical modifications;
  • n, o and p are independenty an integer between 15-1000;
  • x and y are independently 1-20;
  • LI and L2 are independently optional linker moieties, the linker moieties being either nucleic acid based or non-nucleic acid based;
  • L3 is an optional conjugate or an optional linker moiety, the linker moiety being either nucleic acid based or non-nucleic acid based.
  • the chimeric polynucleotide of Formula I encodes one or more peptides or polypeptides of interest. Such encoded molecules may be encoded across two or more regions.
  • Figures 4 and 5 provide schematics of a series of chimeric polynucleotides illustrating various patterns of positional modifications based on Formula I as well as those having a blocked or structured 3 ' terminus.
  • Chimeric polynucleotides, including the parts or regions thereof, of the present invention may be classified as hemimers, gapmers, wingmers, or blockmers.
  • a "hemimer” is chimeric polynucleotide comprising a region or part which comprises half of one pattern, percent, position or population of a chemical modification(s) and half of a second pattern, percent, position or population of a chemical modification(s).
  • Chimeric polynucleotides of the present invention may also comprise hemimer subregions. In one embodiment, a part or region is 50% of one and 50% of another. [00066] In one embodiment the entire chimeric polynucleotide can be 50% of one and 50% of the other. Any region or part of any chimeric polynucleotide of the invention may be a hemimer. Types of hemimers include pattern hemimers, population hemimers or position hemimers. By definition, hemimers are 50:50 percent hemimers.
  • a “gapmer” is a chimeric polynucleotide having at least three parts or regions with a gap between the parts or regions.
  • the "gap” can comprise a region of linked nucleosides or a single nucleoside which differs from the chimeric nature of the two parts or regions flanking it.
  • the two parts or regions of a gapmer may be the same or different from each other.
  • a "wingmer” is a chimeric polynucleotide having at least three parts or regions with a gap between the parts or regions. Unlike a gapmer, the two flanking parts or regions surrounding the gap in a wingmer are the same in degree or kind. Such similiarity may be in the length of number of units of different modifications or in the number of modifications.
  • the wings of a wingmer may be longer or shorter than the gap.
  • the wing parts or regions may be 20, 30, 40, 50, 60 70, 80, 90 or 95% greater or shorter in length than the region which comprises the gap.
  • a "blockmer” is a patterned polynucleotide where parts or regions are of equivalent size or number and type of modifications. Regions or subregions in a blockmer may be 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124
  • Pattern chimeras Chimeric polynucleotides, including the parts or regions thereof, of the present invention having a chemical modification pattern are referred to as "pattern chimeras.” Pattern chimeras may also be referred to as blockmers. Pattern chimeras are those polynucleotides having a pattern of modifications within, across or among regions or parts.
  • Patterns of modifications within a part or region are those which start and stop within a defined region.
  • Patterns of modifcations across a part or region are those patterns which start in on part or region and end in another adjacent part or region.
  • Patterns of modifications among parts or regions are those which begin and end in one part or region and are repeated in a different part or region, which is not necessarily adjacent to the first region or part.
  • the regions or subregions of pattern chimeras or blockmers may have simple alternating patterns such as ABAB[AB]n where each "A" and each "B" represent different chemical modifications (at at least one of the base, sugar or backbone linker), different types of chemical modifications (e.g., naturally occurring and non-naturally occurring), different percentages of modifications or different populations of
  • Different patterns may also be mixed together to form a second order pattern.
  • a single alternating pattern may be combined with a triple alternating pattern to form a second order alternating pattern A'B'.
  • A'B' One example would be
  • Patterns may include three or more different modifications to form an
  • ABCABC[ABC]n pattern may also be multiples, such as AABBCCAABBCC[AABBCC]n and may be designed as combinations with other patterns such as ABCABCAABBCCABCABCAABBCC, and may be higher order patterns.
  • Regions or subregions of position, percent, and population modifications need not reflect an equal contribution from each modification type. They may form series such as "1-2-3-4", "1-2-4-8", where each integer represents the number of units of a particular modification type. Alternatively, they may be odd only, such as ' 1-3-3-1-3-1-5" or even only "2-4-2-4-6-4-8" or a mixuture of both odd and even number of units such as "1-3-4- 2-5-7-3-3-4".
  • Pattern chimeras may vary in their chemical modification by degree (such as those described above) or by kind (e.g., different modifications).
  • Chimeric polynucleotides, including the parts or regions thereof, of the present invention having at least one region with two or more different chemical modifications of two or more nucleoside members of the same nucleoside type (A, C, G, T, or U) are referred to as "positionally modified” chimeras.
  • Positionally modified chimeras are also referred to herein as “selective placement” chimeras or “selective placement polynucleotides”.
  • selective placement refers to the design of polynucleotides which, unlike polynucleotides in the art where the modification to any A, C, G, T or U is the same by virtue of the method of synthesis, can have different modifications to the individual As, Cs, Gs, Ts or Us in a polynucleotide or region thereof.
  • a positionally modified chimeric polynucleotide there may be two or more different chemical modifications to any of the nucleoside types of As, Cs, Gs, Ts, or Us. There may also be combinations of two or more to any two or more of the same nucleoside type.
  • a positionally modified or selective placement chimeric polynucleotide may comprise 3 different modifications to the population of adenines in the moleucle and also have 3 different modifications to the population of cytosines in the construct— all of which may have a unique, non-random, placement.
  • Percent chimeras Chimeric polynucleotides, including the parts or regions thereof, of the present invention having a chemical modification percent are referred to as "percent chimeras.”
  • Percent chimeras may have regions or parts which comprise at least 1%, at least 2%, at least 5%, at least 8%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% positional, pattern or population of modifications.
  • the percent chimera may be completely modified as to modification position, pattern, or population.
  • the percent of modification of a percent chimera may be split between naturally occurring and non-naturally occurring modifications.
  • Chimeric polynucleotides, including the parts or regions thereof, of the present invention having a chemical modification population are referred to as
  • a population chimera may comprise a region or part where nucleosides (their base, sugar or backbone linkage, or combination thereof) have a select population of modifications. Such modifications may be selected from functional populations such as modifications which induce, alter or modulate a phenotypic outcome.
  • a functional population may be a population or selection of chemical modifications which increase the level of a cytokine.
  • Other functional populations may individually or collectively function to decrease the level of one or more cytokines.
  • a “functional population chimera” may be one whose unique functional feature is defined by the population of modifications as described above or the term may apply to the overall function of the chimeric polynucleotide itself. For example, as a whole the chimeric polynucleotide may function in a different or superior way as compared to an unmodified or non-chimeric polynucleotide.
  • polynucleotides which have a uniform chemical modification of all of any of the same nucleoside type or a population of modifications produced by mere downward titration of the same starting modification in all of any of the same nucleoside type, or a measured percent of a chemical modification of all any of the same nucleoside type but with random incorporation, such as where all uridines are replaced by a uridine analog, e.g., pseudouridine, are not considred chimeric.
  • polynucleotides having a uniform chemical modification of two, three, or four of the same nucleoside type throughout the entire polynucleotide such as all uridines and all cytosines, etc.
  • polynucleotide which is not chimeric is the canonical pseudouridine/5 -methyl cytosine modified polynucleotide of the prior art.
  • IVT in vitro transcription
  • adenosine (A), thymidine (T), guanosine (G), cytidine (C) or uradine (U) found in the polynucleotide.
  • the chimeric polynucleotides of the present invention may be structurally modified or chemically modified.
  • a "structural" modification is one in which two or more linked nucleosides are inserted, deleted, duplicated, inverted or randomized in a chimeric polynucleotide without significant chemical modification to the nucleotides themselves. Because chemical bonds will necessarily be broken and reformed to effect a structural modification, structural modifications are of a chemical nature and hence are chemical modifications. However, structural modifications will result in a different sequence of nucleotides.
  • the polynucleotide "ATCG” may be chemically modified to "AT-5meC-G".
  • the same polynucleotide may be structurally modified from "ATCG” to "ATCCCG".
  • the dinucleotide "CC” has been inserted, resulting in a structural modification to the polynucleotide.
  • the chimeric polynucleotides may encode two or more proteins or peptides.
  • proteins or peptides include the heavy and light chains of antibodies, an enzyme and its substrate, a label and its binding molecule, a second messenger and its enzyme or the components of multimeric proteins or complexes.
  • the regions or parts of the chimeric polynucleotides of the present invention may be separated by a linker or spacer moiety.
  • linkers or spaces may be nucleic acid based or non-nucleosidic.
  • the chimeric polynucleotides of the present invention may include a sequence encoding a self-cleaving peptide.
  • the self-cleaving peptide may be, but is not limited to, a 2A peptide.
  • the 2A peptide may have the protein sequence: GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 1), fragments or variants thereof.
  • the 2A peptide cleaves between the last glycine and last proline.
  • the chimeric polynucleotides of the present invention may include a sequence encoding a self-cleaving peptide.
  • the self-cleaving peptide may be, but is not limited to, a 2A peptide.
  • the 2A peptide may have the protein sequence: GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 1), fragments or variants thereof.
  • the 2A peptide cleaves between the last glycine and last proline.
  • polynucleotides of the present invention may include a polynucleotide sequence encoding the 2A peptide having the protein sequence GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 1) fragments or variants thereof.
  • GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAG GAGAACCCTGGACCT SEQ ID NO: 2.
  • the polynucleotide sequence may be modified or codon optimized by the methods described herein and/or are known in the art.
  • this sequence may be used to separate the coding region of two or more polypeptides of interest.
  • the sequence encoding the 2A peptide may be between a first coding region A and a second coding region B (A-2Apep-B). The presence of the 2 A peptide would result in the cleavage of one long protein into protein A, protein B and the 2A peptide. Protein A and protein B may be the same or different polypeptides of interest.
  • the 2A peptide may be used in the chimeric polynucleotides of the present invention to produce two, three, four, five, six, seven, eight, nine, ten or more proteins.
  • chimeric polynucleotides of the present invention may comprise a region or part which is not positionally modified or not chimeric as defined herein.
  • a region or part of a chimeric polynucleotide may be uniformly modified at one ore more A, T, C, G, or U but according to the invention, the
  • polynucleotides will not be uniformly modified throughout the entire region or part.
  • Regions or parts of chimeric polynucleotides may be from 15-1000 nucleosides in length and a polynucleotide may have from 2-100 different regions or patterns of regions as described herein.
  • chimeric polynucleotides encode one or more
  • Figure 2 illustrates the design of certain chimeric polynucleotides of the present invention when based on the scaffold of the polynucleotide of Figure 1. Shown in the figure are the regions or parts of the chimeric polynucleotides where patterned regions represent those regions which are positionally modified and open regions illustrate regions which may or may not be modified but which are, when modified, uniformly modified. Chimeric polynucleotides of the present invention may be completely positionally modified or partially positionally modified. They may also have subregions which may be of any pattern or design. Shown in the figure are a chimeric subregion and a hemimer subregion.
  • polynucleotide of the present invention encoding a peptide can be the length that is sufficient to encode for a dipeptide, a tripeptide, a tetrapeptide, a pentapeptide, a hexapeptide, a heptapeptide, an octapeptide, a nonapeptide, or a decapeptide.
  • the length may be sufficient to encode a peptide of 2-30 amino acids, e.g. 5- 30, 10-30, 2-25, 5-25, 10-25, or 10-20 amino acids.
  • the length may be sufficient to encode for a peptide of at least 11, 12, 13, 14, 15, 17, 20, 25 or 30 amino acids, or a peptide that is no longer than 40 amino acids, e.g. no longer than 35, 30, 25, 20, 17, 15, 14, 13, 12, 11 or 10 amino acids.
  • the length of a region encoding the polypeptide of interest of the present invention is greater than about 30 nucleotides in length (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000 or up to and including 100,000 nucleotides).
  • a region may be referred to as a "coding region” or "region encoding.”
  • the chimeric polynucleotide includes from about 30 to about 100,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 1,000, from 30 to 1,500, from 30 to 3,000, from 30 to 5,000, from 30 to 7,000, from 30 to 10,000, from 30 to 25,000, from 30 to 50,000, from 30 to 70,000, from 100 to 250, from 100 to 500, from 100 to 1,000, from 100 to 1,500, from 100 to 3,000, from 100 to 5,000, from 100 to 7,000, from 100 to 10,000, from 100 to 25,000, from 100 to 50,000, from 100 to 70,000, from 100 to 100,000, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 3,000, from 500 to 5,000, from 500 to 7,000, from 500 to 10,000, from 500 to 25,000, from 500 to 50,000, from 500 to 70,000, from 500 to 100,000, from 1,000 to 1,500, from 1,000 to 2,000, from 500 to 3,000, from 500 to 5,000
  • regions or subregions of chimeric polynucleotides may also range independently from 15-1,000 nucleotides in length (e.g., greater than 30, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, and 900 nucleotides or at least 30, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, and 1,000 nucleotides).
  • regions or subregions of chimeric polynucleotides may range from absent to 500 nucleotides in length (e.g., at least 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, or 500 nucleotides).
  • the region is a polyA tail
  • the length may be determined in units of or as a function of polyA Binding Protein binding.
  • the polyA tail is long enough to bind at least 4 monomers of PolyA Binding Protein.
  • PolyA Binding Protein monomers bind to stretches of approximately 38 nucleotides.
  • polyA tails of about 80 nucleotides (SEQ ID NO: 4) and 160 nucleotides (SEQ ID NO: 5) are functional.
  • the chimeric polynucleotides of the present invention which function as an m NA need not comprise a polyA tail.
  • chimeric polynucleotides which function as an mRNA may have a capping region.
  • the capping region may comprise a single cap or a series of nucleotides forming the cap.
  • the capping region may be from 1 to 10, e.g. 2-9, 3-8, 4-7, 1-5, 5-10, or at least 2, or 10 or fewer nucleotides in length.
  • the cap is absent.
  • the present invention contemplates chimeric polynucleotides which are circular or cyclic.
  • circular polynucleotides are circular in nature meaning that the termini are joined in some fashion, whether by ligation, covalent bond, common association with the same protein or other molecule or complex or by hybridization.
  • Chimeric polynucleotides of the present invention may be designed according to the circular RNA construct scaffolds shown in Figures 6-12. Such polynucleotides are cicular chimeric polynucleotides or circular constructs.
  • circular polynucleotides or “circP” means a single stranded circular polynucleotide which acts substantially like, and has the properties of, an RNA.
  • the term “circular” is also meant to encompass and secondary or tertiary configuration of the circP.
  • the circPs of the present invention which encode at least one polypeptide of interest are known as circular RNAs or circRNA.
  • circular RNA or “circRNA” means a circular polynucleotide that can encode at least one polypeptide of interest.
  • the circPs of the present invention which comprise at least one sensor sequence and do not encode a polypeptide of interest are known as circular sponges or circSP.
  • circular sponges means a circular polynucleotide which comprises at least one sensor sequence and does not encode a polypeptide of interest.
  • sensor sequence means a receptor or pseudo-receptor for endogenous nucleic acid binding molecules.
  • sensor sequences include, microRNA binding sites, microRNA seed sequences, microRNA binding sites without the seed sequence, transcription factor binding sites and artificial binding sites engineered to act as pseudo-receptors and portions and fragments thereof.
  • the circPs of the present invention which comprise at least one sensor sequence and encode at least one polypeptide of interest are known as circular R A sponges or circR A-SP.
  • circular RNA sponges or “circRNA-SP” means a circular polynucleotide which comprises at least one sensor sequence and at least one region encoding at least one polypeptide of interest.
  • FIG. 6 shows a representative circular construct 200 of the present invention.
  • the term "circular construct” refers to a circular polynucleotide transcript which may act substantiatlly similar to and have properties of a RNA molecule.
  • the circular construct acts as an mRNA. If the circular construct encodes one or more polypeptides of interest (e.g., a circRNA or circRNA-SP) then the polynucleotide transcript retains sufficient structural and/or chemical features to allow the polypeptide of interest encoded therein to be translated.
  • Circular constructs may be polynucleotides of the invention. When structurally or chemically modified, the construct may be referred to as a modified circP, circSP, circRNA or circRNA-SP.
  • the circular construct 200 here contains a first region of linked nucleotides 202 that is flanked by a first flanking region 204 and a second flanking region 206.
  • first region may be referred to as a "coding region,” a “non-coding region” or “region encoding” or simply the "first region.”
  • this first region may comprise nucleotides such as, but not limited to, encoding the polypeptide of interest and/or nucleotides encodes or comprises a sensor region.
  • the polypeptide of interest may comprise at its 5 ' terminus one or more signal peptide sequences encoded by a signal sequence region 203.
  • the first flanking region 204 may comprise a region of linked nucleosides or portion thereof which may act similiarly to an untranslated region (UTR) in a mRNA and/or DNA sequence.
  • the first flanking region may also comprise a region of polarity 208.
  • the region of polarity 208 may include an IRES sequence or portion thereof.
  • this region when linearlized this region may be split to have a first portion be on the 5 ' terminus of the first region 202 and second portion be on the 3 ' terminus of the first region 202.
  • the second flanking region 206 may comprise a tailing sequence region 210 and may comprise a region of linked nucleotides or portion thereof 212 which may act similiarly to a UTR in a mRNA and/or DNA.
  • Bridging the 5' terminus of the first region 202 and the first flanking region 204 is a first operational region 205.
  • this operational region may comprise a start codon.
  • the operational region may alternatively comprise any translation initiation sequence or signal including a start codon.
  • this operational region comprises a stop codon.
  • the operational region may alternatively comprise any translation initiation sequence or signal including a stop codon. According to the present invention, multiple serial stop codons may also be used.
  • the operation region of the present invention may comprise two stop codons.
  • the first stop codon may be "TGA” or "UGA” and the second stop codon may be selected from the group consisting of "TAA,” “TGA,” “TAG,” “UAA,” “UGA” or "UAG.”
  • At least one non-nucleic acid moiety 201 may be used to prepare a circular polynucleotide 200 where the non-nucleic acid moiety 201 is used to bring the first flanking region 204 near the second flanking region 206.
  • Non-limiting examples of non-nucleic acid moieties which may be used in the present invention are described herein.
  • the circular polynucleotides 200 may comprise more than one non- nucleic acid moiety wherein the additional non-nucleic acid moeities may be
  • the first region of linked nucleosides 202 may comprise a spacer region 214.
  • This spacer region 214 may be used to separate the first region of linked nucleosides 202 so that the circular construct can include more than one open reading frame, non-coding region or an open reading frame and a non-coding region.
  • the second flanking region 206 may comprise one or more sensor regions 216 in the the 3 ' UTR 212. These sensor sequences as discussed herein operate as pseudo-receptors (or binding sites) for ligands of the local
  • microRNA bindng sites or miRNA seeds may be used as sensors such that they function as pseudoreceptors for any microRNAs present in the environment of the circular polynucleotide.
  • the one or more sensor regions 216 may be separated by a spacer region 214.
  • a circular construct 200 which includes one or more sensor regions 216, may also include a spacer region 214 in the first region of linked nucleosides 202. As discussed above for Figure 7, this spacer region 214 may be used to separate the first region of linked nucleosides 202 so that the circular construct can include more than one open reading frame and/or more than one non-coding region.
  • a circular construct 200 may be a non-coding construct known as a circSP comprising at least one non-coding region such as, but not limited to, a sensor region 216.
  • Each of the sensor regions 216 may include, but are not limited to, a miR sequence, a miR seed, a miR binding site and/or a miR sequence without the seed.
  • At least one non-nucleic acid moiety 201 may be used to prepare a circular polynucleotide 200 which is a non-coding construct.
  • the circular polynucleotides 200 which is a non-coding construct may comprise more than one non- nucleic acid moiety wherein the additional non-nucleic acid moeities may be
  • multiple distinct chimeric polynucleotides may be linked together through the 3 '-end using nucleotides which are modified at the 3'- terminus.
  • Chemical conjugation may be used to control the stoichiometry of delivery into cells.
  • the glyoxylate cycle enzymes isocitrate lyase and malate synthase, may be supplied into cells at a 1 : 1 ratio to alter cellular fatty acid metabolism.
  • This ratio may be controlled by chemically linking chimeric polynucleotides using a 3'- azido terminated nucleotide on one chimeric polynucleotides species and a C5-ethynyl or alkynyl-containing nucleotide on the opposite chimeric polynucleotide species.
  • the modified nucleotide is added post-transcriptionally using terminal transferase (New England Biolabs, Ipswich, MA) according to the manufacturer's protocol.
  • the two chimeric polynucleotides species may be combined in an aqueous solution, in the presence or absence of copper, to form a new covalent linkage via a click chemistry mechanism as described in the literature.
  • more than two polynucleotides may be linked together using a functionalized linker molecule.
  • a functionalized saccharide molecule may be chemically modified to contain multiple chemical reactive groups (SH-, ⁇ 2 -, N 3 , etc%) to react with the cognate moiety on a 3'-functionalized mR A molecule (i.e., a 3'-maleimide ester, 3'-NHS-ester, alkynyl).
  • the number of reactive groups on the modified saccharide can be controlled in a stoichiometric fashion to directly control the stoichiometric ratio of conjugated chimeric polynucleotides.
  • chimeric polynucleotides of the present invention can be designed to be conjugated to other polynucleotides, dyes, intercalating agents ⁇ e.g. acridines), cross-linkers ⁇ e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons ⁇ e.g., phenazine, dihydrophenazine), artificial endonucleases ⁇ e.g.
  • alkylating agents phosphate, amino, mercapto, PEG ⁇ e.g., PEG-40K
  • MPEG MPEG
  • [MPEG] 2 polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens ⁇ e.g. biotin)
  • transport/absorption facilitators ⁇ e.g., aspirin, vitamin E, folic acid), synthetic
  • ribonucleases proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell, hormones and hormone receptors, non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, or a drug.
  • proteins e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand
  • antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell
  • hormones and hormone receptors non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, or a drug.
  • Conjugation may result in increased stability and/or half life and may be particularly useful in targeting the chimeric polynucleotides to specific sites in the cell, tissue or organism.
  • the chimeric polynucleotides may be administered with, conjugated to or further encode one or more of RNAi agents, siRNAs, shRNAs, miRNAs, miRNA binding sites, antisense RNAs, ribozymes, catalytic DNA, tRNA, RNAs that induce triple helix formation, aptamers or vectors, and the like.
  • RNAi agents siRNAs, shRNAs, miRNAs, miRNA binding sites, antisense RNAs, ribozymes, catalytic DNA, tRNA, RNAs that induce triple helix formation, aptamers or vectors, and the like.
  • bifunctional polynucleotides e.g., bifunctional chimeric polynucleotides.
  • bifunctional polynucleotides e.g., bifunctional chimeric polynucleotides
  • polynucleotides are those having or capable of at least two functions. These molecules may also by convention be referred to as multi-functional.
  • the multiple functionalities of bifunctional polynucleotides may be encoded by the RNA (the function may not manifest until the encoded product is translated) or may be a property of the polynucleotide itself. It may be structural or chemical.
  • Bifunctional modified polynucleotides may comprise a function that is covalently or electrostatically associated with the polynucleotides. Further, the two functions may be provided in the context of a complex of a chimeric polynucleotide and another molecule.
  • Bifunctional polynucleotides may encode peptides which are antiproliferative. These peptides may be linear, cyclic, constrained or random coil. They may function as aptamers, signaling molecules, ligands or mimics or mimetics thereof. Anti-proliferative peptides may, as translated, be from 3 to 50 amino acids in length. They may be 5-40, 10-30, or approximately 15 amino acids long. They may be single chain, multichain or branched and may form complexes, aggregates or any multi-unit structure once translated.
  • chimeric polynucleotides having sequences that are partially or substantially not translatable, e.g., having a noncoding region.
  • Such noncoding region may be the "first region" of the chimeric polynucleotide.
  • the noncoding region may be a region other than the first region.
  • Such molecules are generally not translated, but can exert an effect on protein production by one or more of binding to and sequestering one or more translational machinery components such as a ribosomal protein or a transfer RNA (tRNA), thereby effectively reducing protein expression in the cell or modulating one or more pathways or cascades in a cell which in turn alters protein levels.
  • tRNA transfer RNA
  • the chimeric polynucleotide may contain or encode one or more long noncoding RNA (IncRNA, or lincRNA) or portion thereof, a small nucleolar RNA (sno-RNA), micro RNA (miRNA), small interfering RNA (siRNA) or Piwi- interacting RNA (piRNA).
  • RNAi-RNA small nucleolar RNA
  • miRNA micro RNA
  • siRNA small interfering RNA
  • piRNA Piwi- interacting RNA
  • Chimeric polynucleotides of the present invention may encode one or more peptides or polypeptides of interest. They may also affect the levels, signaling or function of one or more polypeptides.
  • Polypeptides of interest, according to the present invention include any of those taught in, for example, those listed in Table 6 of co-pending U.S. Provisional Patent Application Nos. 61/618,862,61/681,645, 61/737,130, 61/618,866, 61/681,647, No 61/737,134, 61/618,868, 61/681,648, 61/737,135, 61/618,873,
  • the chimeric polynucleotide may be designed to encode one or more polypeptides of interest or fragments thereof.
  • polypeptide of interest may include, but is not limited to, whole polypeptides, a plurality of polypeptides or fragments of polypeptides, which independently may be encoded by one or more regions or parts or the whole of a chimeric polynucleotide.
  • polypeptides of interest refer to any polypeptide which is selected to be encoded within, or whose function is affected by, the chimeric polnucleotides of the present invention.
  • polypeptide means a polymer of amino acid residues (natural or unnatural) linked together most often by peptide bonds.
  • polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing.
  • a polypeptide may be a single molecule or may be a multi-molecular complex such as a dimer, trimer or tetramer. They may also comprise single chain or multichain
  • polypeptides such as antibodies or insulin and may be associated or linked. Most commonly disulfide linkages are found in multichain polypeptides.
  • polypeptide may also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid.
  • polypeptide variant refers to molecules which differ in their amino acid sequence from a native or reference sequence.
  • the amino acid sequence variants may possess substitutions, deletions, and/or insertions at certain positions within the amino acid sequence, as compared to a native or reference sequence.
  • variants will possess at least about 50% identity (homology) to a native or reference sequence, and preferably, they will be at least about 80%, more preferably at least about 90% identical (homologous) to a native or reference sequence.
  • variant mimics are provided.
  • the term “variant mimic” is one which contains one or more amino acids which would mimic an activated sequence.
  • glutamate may serve as a mimic for phosphoro- threonine and/or phosphoro-serine.
  • variant mimics may result in deactivation or in an inactivated product containing the mimic, e.g., phenylalanine may act as an inactivating substitution for tyrosine; or alanine may act as an inactivating substitution for serine.
  • homology as it applies to amino acid sequences is defined as the percentage of residues in the candidate amino acid sequence that are identical with the residues in the amino acid sequence of a second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology. Methods and computer programs for the alignment are well known in the art. It is understood that homology depends on a calculation of percent identity but may differ in value due to gaps and penalties introduced in the calculation.
  • Analogs is meant to include polypeptide variants which differ by one or more amino acid alterations, e.g., substitutions, additions or deletions of amino acid residues that still maintain one or more of the properties of the parent or starting polypeptide.
  • compositions which are polypeptide based including variants and derivatives. These include substitutional, insertional, deletion and covalent variants and derivatives.
  • derivative is used synonymously with the term “variant” but generally refers to a molecule that has been modified and/or changed in any way relative to a reference molecule or starting molecule.
  • sequence tags or amino acids such as one or more lysines
  • Sequence tags can be used for peptide purification or localization.
  • Lysines can be used to increase peptide solubility or to allow for biotinylation.
  • amino acid residues located at the carboxy and amino terminal regions of the amino acid sequence of a peptide or protein may optionally be deleted providing for truncated sequences.
  • Certain amino acids e.g., C-terminal or N- terminal residues
  • substitutional variants when referring to polypeptides are those that have at least one amino acid residue in a native or starting sequence removed and a different amino acid inserted in its place at the same position.
  • the substitutions may be single, where only one amino acid in the molecule has been substituted, or they may be multiple, where two or more amino acids have been substituted in the same molecule.
  • conservative amino acid substitution refers to the substitution of an amino acid that is normally present in the sequence with a different amino acid of similar size, charge, or polarity.
  • conservative substitutions include the substitution of a non-polar (hydrophobic) residue such as isoleucine, valine and leucine for another non-polar residue.
  • conservative substitutions include the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between glutamine and asparagine, and between glycine and serine.
  • substitution of a basic residue such as lysine, arginine or histidine for another, or the substitution of one acidic residue such as aspartic acid or glutamic acid for another acidic residue are additional examples of conservative substitutions.
  • non-conservative substitutions include the substitution of a non-polar (hydrophobic) amino acid residue such as isoleucine, valine, leucine, alanine, methionine for a polar (hydrophilic) residue such as cysteine, glutamine, glutamic acid or lysine and/or a polar residue for a non-polar residue.
  • “Insertional variants” when referring to polypeptides are those with one or more amino acids inserted immediately adjacent to an amino acid at a particular position in a native or starting sequence. "Immediately adjacent" to an amino acid means connected to either the alpha-carboxy or alpha-amino functional group of the amino acid.
  • deletional variants when referring to polypeptides are those with one or more amino acids in the native or starting amino acid sequence removed. Ordinarily, deletional variants will have one or more amino acids deleted in a particular region of the molecule.
  • Covalent derivatives when referring to polypeptides include modifications of a native or starting protein with an organic proteinaceous or non-proteinaceous derivatizing agent, and/or post-translational modifications. Covalent modifications are traditionally introduced by reacting targeted amino acid residues of the protein with an organic derivatizing agent that is capable of reacting with selected side-chains or terminal residues, or by harnessing mechanisms of post-translational modifications that function in selected recombinant host cells. The resultant covalent derivatives are useful in programs directed at identifying residues important for biological activity, for immunoassays, or for the preparation of anti-protein antibodies for immunoaffinity purification of the recombinant glycoprotein. Such modifications are within the ordinary skill in the art and are performed without undue experimentation.
  • polypeptides when referring to polypeptides are defined as distinct amino acid sequence-based components of a molecule.
  • Features of the polypeptides encoded by the chimeric polynucleotides of the present invention include surface manifestations, local conformational shape, folds, loops, half-loops, domains, half-domains, sites, termini or any combination thereof.
  • manifestation refers to a polypeptide based component of a protein appearing on an outermost surface.
  • local conformational shape means a polypeptide based structural manifestation of a protein which is located within a definable space of the protein.
  • fold refers to the resultant conformation of an amino acid sequence upon energy minimization.
  • a fold may occur at the secondary or tertiary level of the folding process.
  • secondary level folds include beta sheets and alpha helices.
  • tertiary folds include domains and regions formed due to aggregation or separation of energetic forces.
  • Regions formed in this way include hydrophobic and hydrophilic pockets, and the like.
  • the term "turn” as it relates to protein conformation means a bend which alters the direction of the backbone of a peptide or polypeptide and may involve one, two, three or more amino acid residues.
  • loop refers to a structural feature of a polypeptide which may serve to reverse the direction of the backbone of a peptide or polypeptide. Where the loop is found in a polypeptide and only alters the direction of the backbone, it may comprise four or more amino acid residues. Oliva et al. have identified at least 5 classes of protein loops (J. Mol Biol 266 (4): 814- 830; 1997). Loops may be open or closed. Closed loops or "cyclic" loops may comprise 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids between the bridging moieties.
  • Such bridging moieties may comprise a cysteine-cysteine bridge (Cys-Cys) typical in polypeptides having disulfide bridges or alternatively bridging moieties may be non-protein based such as the dibromozylyl agents used herein.
  • Cys-Cys cysteine-cysteine bridge
  • bridging moieties may be non-protein based such as the dibromozylyl agents used herein.
  • domain refers to a motif of a polypeptide having one or more identifiable structural or functional characteristics or properties (e.g., binding capacity, serving as a site for protein-protein interactions).
  • sub- domains may be identified within domains or half-domains, these subdomains possessing less than all of the structural or functional properties identified in the domains or half domains from which they were derived. It is also understood that the amino acids that comprise any of the domain types herein need not be contiguous along the backbone of the polypeptide (i.e., nonadjacent amino acids may fold structurally to produce a domain, half-domain or subdomain).
  • site As used herein when referring to polypeptides the terms "site” as it pertains to amino acid based embodiments is used synonymously with "amino acid residue” and "amino acid side chain.”
  • a site represents a position within a peptide or polypeptide that may be modified, manipulated, altered, derivatized or varied within the polypeptide based molecules of the present invention.
  • terminal refers to an extremity of a peptide or polypeptide. Such extremity is not limited only to the first or final site of the peptide or polypeptide but may include additional amino acids in the terminal regions.
  • the polypeptide based molecules of the present invention may be characterized as having both an N-terminus (terminated by an amino acid with a free amino group (NH2)) and a C -terminus (terminated by an amino acid with a free carboxyl group (COOH)).
  • Proteins of the invention are in some cases made up of multiple polypeptide chains brought together by disulfide bonds or by non- covalent forces (multimers, oligomers). These sorts of proteins will have multiple N- and C-termini.
  • the termini of the polypeptides may be modified such that they begin or end, as the case may be, with a non-polypeptide based moiety such as an organic conjugate.
  • any of the features have been identified or defined as a desired component of a polypeptide to be encoded by the chimeric polynucleotide of the invention, any of several manipulations and/or modifications of these features may be performed by moving, swapping, inverting, deleting, randomizing or duplicating.
  • manipulation of features may result in the same outcome as a modification to the molecules of the invention.
  • a manipulation which involved deleting a domain would result in the alteration of the length of a molecule just as modification of a nucleic acid to encode less than a full length molecule would.
  • Modifications and manipulations can be accomplished by methods known in the art such as, but not limited to, site directed mutagenesis or a priori incorporation during chemical synthesis.
  • the resulting modified molecules may then be tested for activity using in vitro or in vivo assays such as those described herein or any other suitable screening assay known in the art.
  • the polypeptides may comprise a consensus sequence which is discovered through rounds of experimentation.
  • a "consensus" sequence is a single sequence which represents a collective population of sequences allowing for variability at one or more sites.
  • protein fragments, functional protein domains, and homologous proteins are also considered to be within the scope of polypeptides of interest of this invention.
  • any protein fragment meaning a polypeptide sequence at least one amino acid residue shorter than a reference polypeptide sequence but otherwise identical
  • a reference protein 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or greater than 100 amino acids in length.
  • any protein that includes a stretch of about 20, about 30, about 40, about 50, or about 100 amino acids which are about 40%, about 50%>, about 60%>, about 70%>, about 80%>, about 90%), about 95%o, or about 100% identical to any of the sequences described herein can be utilized in accordance with the invention.
  • a polypeptide to be utilized in accordance with the invention includes 2, 3, 4, 5, 6, 7, 8, 9, 10, or more mutations as shown in any of the sequences provided or referenced herein.
  • the chimeric polynucleotides of the present invention may be designed to encode polypeptides of interest selected from any of several target categories including, but not limited to, biologies, antibodies, vaccines, therapeutic proteins or peptides, cell penetrating peptides, secreted proteins, plasma membrane proteins, cytoplasmic or cytoskeletal proteins, intracellular membrane bound proteins, nuclear proteins, proteins associated with human disease, targeting moieties or those proteins encoded by the human genome for which no therapeutic indication has been identified but which nonetheless have utility in areas of research and discovery.
  • chimeric polynucleotides may encode variant
  • polypeptides which have a certain identity with a reference polypeptide sequence.
  • a "reference polypeptide sequence” refers to a starting polypeptide sequence. Reference sequences may be wild type sequences or any sequence to which reference is made in the design of another sequence. A “reference polypeptide sequence” may, e.g., be any one of those polypeptides disclosed in Table 6 of co-pending U.S. Provisional Patent Application Nos.
  • Reference molecules may share a certain identity with the designed molecules (polypeptides or polynucleotides).
  • identity refers to a relationship between the sequences of two or more peptides, polypeptides or polynucleotides, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between them as determined by the number of matches between strings of two or more amino acid residues or nucleosides. Identity measures the percent of identical matches between the smaller of two or more sequences with gap alignments (if any) addressed by a particular mathematical model or computer program (i.e., "algorithms"). Identity of related peptides can be readily calculated by known methods. Such methods include, but are not limited to, those described in Computational Molecular Biology, Lesk, A.
  • the encoded polypeptide variant may have the same or a similar activity as the reference polypeptide.
  • the variant may have an altered activity (e.g., increased or decreased) relative to a reference polypeptide.
  • variants of a particular polynucleotide or polypeptide of the invention will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% but less than 100% sequence identity to that particular reference polynucleotide or polypeptide as determined by sequence alignment programs and parameters described herein and known to those skilled in the art.
  • Such tools for alignment include those of the BLAST suite (Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.)
  • Other tools are described herein, specifically in the definition of "Identity.”
  • BLAST algorithm Default parameters in the BLAST algorithm include, for example, an expect threshold of 10, Word size of 28, Match/Mismatch Scores 1, -2, Gap costs Linear. Any filter can be applied as well as a selection for species specific repeats, e.g., Homo sapiens. Biologies
  • the chimeric polynucleotides disclosed herein may encode one or more biologies.
  • a "biologic” is a polypeptide-based molecule produced by the methods provided herein and which may be used to treat, cure, mitigate, prevent, or diagnose a serious or life-threatening disease or medical condition.
  • Biologies, according to the present invention include, but are not limited to, allergenic extracts (e.g. for allergy shots and tests), blood components, gene therapy products, human tissue or cellular products used in transplantation, vaccines, monoclonal antibodies, cytokines, growth factors, enzymes, thrombolytics, and immunomodulators, among others.
  • one or more biologies currently being marketed or in development may be encoded by the chimeric polynucleotides of the present invention. While not wishing to be bound by theory, it is believed that incorporation of the encoding polynucleotides of a known biologic into the chimeric polynucleotides of the invention will result in improved therapeutic efficacy due at least in part to the specificity, purity and/or selectivity of the construct designs.
  • the chimeric polynucleotides disclosed herein may encode one or more antibodies or fragments thereof.
  • antibody includes monoclonal antibodies (including full length antibodies which have an immunoglobulin Fc region), antibody compositions with polyepitopic specificity, multispecific antibodies (e.g., bispecific antibodies, diabodies, and single-chain molecules), as well as antibody fragments.
  • immunoglobulin Ig is used interchangeably with "antibody” herein.
  • the term "monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations and/or post- translation modifications (e.g., isomerizations, amidations) that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site.
  • the monoclonal antibodies herein specifically include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is(are) identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity.
  • chimeric antibodies immunoglobulins in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is(are) identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity.
  • Chimeric antibodies of interest herein include, but are not limited to, "primatized” antibodies comprising variable domain antigen-binding sequences derived from a non-human primate (e.g., Old World Monkey, Ape etc.) and human constant region sequences.
  • a non- human primate e.g., Old World Monkey, Ape etc.
  • human constant region sequences e.g., Old World Monkey, Ape etc.
  • an "antibody fragment” comprises a portion of an intact antibody, preferably the antigen binding and/or the variable region of the intact antibody.
  • antibody fragments include Fab, Fab', F(ab') 2 and Fv fragments; diabodies; linear antibodies; nanobodies; single-chain antibody molecules and multispecific antibodies formed from antibody fragments.
  • any of the five classes of immunoglobulins may be encoded by the chimeric polynucleotides of the invention, including the heavy chains designated alpha, delta, epsilon, gamma and mu, respectively. Also included are polynucleotide sequences encoding the subclasses, gamma and mu.
  • any of the subclasses of antibodies may be encoded in part or in whole and include the following subclasses: IgGl, IgG2, IgG3, IgG4, IgAl and IgA2.
  • one or more antibodies or fragments currently being marketed or in development may be encoded by the chimeric
  • polynucleotides of the present invention While not wishing to be bound by theory, it is believed that incorporation into the chimeric polynucleotides of the invention will result in improved therapeutic efficacy due at least in part to the specificity, purity and selectivity of the polynucleotide designs.
  • Antibodies encoded in the chimeric polynucleotides of the invention may be utilized to treat conditions or diseases in many therapeutic areas such as, but not limited to, blood, cardiovascular, CNS, poisoning (including antivenoms), dermatology, endocrinology, gastrointestinal, medical imaging, musculoskeletal, oncology, immunology, respiratory, sensory and anti-infective.
  • chimeric polynucleotides disclosed herein may encode monoclonal antibodies and/or variants thereof. Variants of antibodies may also include, but are not limited to, substitutional variants, conservative amino acid substitution, insertional variants, deletional variants and/or covalent derivatives.
  • the chimeric polynucleotide or regions thereof disclosed herein may encode an immunoglobulin Fc region.
  • the chimeric polynucleotide may encode a variant immunoglobulin Fc region.
  • the chimeric polynucleotide may encode an antibody having a variant immunoglobulin Fc region as described in U.S. Pat. No. 8,217,147 herein incorporated by reference in its entirety.
  • the chimeric polynucleotides disclosed herein may encode one or more vaccines.
  • a "vaccine” is a biological preparation that improves immunity to a particular disease or infectious agent.
  • one or more vaccines currently being marketed or in development may be encoded by the chimeric polynucleotides of the present invention. While not wishing to be bound by theory, it is believed that incorporation into the chimeric polynucleotides of the invention will result in improved therapeutic efficacy due at least in part to the specificity, purity and selectivity of the construct designs.
  • Vaccines encoded in the chimeric polynucleotides of the invention may be utilized to treat conditions or diseases in many therapeutic areas such as, but not limited to, cardiovascular, CNS, dermatology, endocrinology, oncology, immunology, respiratory, and anti-infective.
  • the chimeric polynucleotides disclosed herein may encode one or more validated or "in testing" therapeutic proteins or peptides.
  • one or more therapeutic proteins or peptides currently being marketed or in development may be encoded by the chimeric polynucleotides of the present invention. While not wishing to be bound by theory, it is believed that incorporation into the chimeric polynucleotides of the invention will result in improved therapeutic efficacy due at least in part to the specificity, purity and selectivity of the construct designs.
  • Therapeutic proteins and peptides encoded in the chimeric polynucleotides of the invention may be utilized to treat conditions or diseases in many therapeutic areas such as, but not limited to, blood, cardiovascular, CNS, poisoning (including
  • Cell-Penetrating Polypeptides may encode one or more cell- penetrating polypeptides.
  • “cell-penetrating polypeptide” or CPP refers to a polypeptide which may facilitate the cellular uptake of molecules.
  • a cell-penetrating polypeptide of the present invention may contain one or more detectable labels.
  • the polypeptides may be partially labeled or completely labeled throughout.
  • the chimeric polynucleotides may encode the detectable label completely, partially or not at all.
  • the cell-penetrating peptide may also include a signal sequence.
  • a signal sequence refers to a sequence of amino acid residues bound at the amino terminus of a nascent protein during protein translation. The signal sequence may be used to signal the secretion of the cell-penetrating polypeptide.
  • the chimeric polynucleotides may also encode a fusion protein.
  • the fusion protein may be created by operably linking a charged protein to a therapeutic protein.
  • “operably linked” refers to the therapeutic protein and the charged protein being connected in such a way to permit the expression of the complex when introduced into the cell.
  • “charged protein” refers to a protein that carries a positive, negative or overall neutral electrical charge.
  • the therapeutic protein may be covalently linked to the charged protein in the formation of the fusion protein.
  • the ratio of surface charge to total or surface amino acids may be approximately 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8 or 0.9.
  • the cell-penetrating polypeptide encoded by the chimeric polynucleotides may form a complex after being translated.
  • the complex may comprise a charged protein linked, e.g. covalently linked, to the cell-penetrating polypeptide.
  • “Therapeutic protein” refers to a protein that, when administered to a cell has a therapeutic, diagnostic, and/or prophylactic effect and/or elicits a desired biological and/or pharmacological effect.
  • the cell-penetrating polypeptide may comprise a first domain and a second domain.
  • the first domain may comprise a supercharged polypeptide.
  • the second domain may comprise a protein-binding partner.
  • protein-binding partner includes, but is not limited to, antibodies and functional fragments thereof, scaffold proteins, or peptides.
  • the cell-penetrating polypeptide may further comprise an intracellular binding partner for the protein-binding partner.
  • the cell-penetrating polypeptide may be capable of being secreted from a cell where the chimeric polynucleotides may be introduced.
  • the cell-penetrating polypeptide may also be capable of penetrating the first cell.
  • the cell-penetrating polypeptide is capable of penetrating a second cell.
  • the second cell may be from the same area as the first cell, or it may be from a different area.
  • the area may include, but is not limited to, tissues and organs.
  • the second cell may also be proximal or distal to the first cell.
  • the chimeric polynucleotides may encode a cell- penetrating polypeptide which may comprise a protein-binding partner.
  • the protein binding partner may include, but is not limited to, an antibody, a supercharged antibody or a functional fragment.
  • the chimeric polynucleotides may be introduced into the cell where a cell-penetrating polypeptide comprising the protein-binding partner is introduced.
  • One type of sorting signal called a signal sequence, a signal peptide, or a leader sequence, directs a class of proteins to an organelle called the endoplasmic reticulum (ER).
  • ER endoplasmic reticulum
  • Proteins targeted to the ER by a signal sequence can be released into the extracellular space as a secreted protein.
  • proteins residing on the cell membrane can also be secreted into the extracellular space by proteolytic cleavage of a "linker" holding the protein to the membrane.
  • the molecules of the present invention may be used to exploit the cellular trafficking described above. As such, in some embodiments of the invention, chimeric
  • polynucleotides are provided to express a secreted protein.
  • the secreted proteins may be selected from those described herein or those in US Patent Publication, 20100255574, the contents of which are incorporated herein by reference in their entirety. [000182] In one embodiment, these may be used in the manufacture of large quantities of human gene products.
  • chimeric polynucleotides are provided to express a protein of the plasma membrane.
  • chimeric polynucleotides are provided to express a cytoplasmic or cytoskeletal protein.
  • chimeric polynucleotides are provided to express an intracellular membrane bound protein.
  • chimeric polynucleotides are provided to express a nuclear protein.
  • chimeric polynucleotides are provided to express a protein associated with human disease.
  • chimeric polynucleotides are provided to express a protein with a presently unknown therapeutic function.
  • chimeric polynucleotides are provided to express a targeting moiety. These include a protein-binding partner or a receptor on the surface of the cell, which functions to target the cell to a specific tissue space or to interact with a specific moiety, either in vivo or in vitro. Suitable protein-binding partners include, but are not limited to, antibodies and functional fragments thereof, scaffold proteins, or peptides. Additionally, chimeric polynucleotides can be employed to direct the synthesis and extracellular localization of lipids, carbohydrates, or other biological moieties or biomolecules.
  • the chimeric polynucleotides may be used to produce polypeptide libraries. These libraries may arise from the production of a population of chimeric polynucleotides, each containing various structural or chemical modification designs.
  • a population of chimeric polynucleotides may comprise a plurality of encoded polypeptides, including but not limited to, an antibody or antibody fragment, protein binding partner, scaffold protein, and other polypeptides taught herein or known in the art.
  • the chimeric polynucleotides may be suitable for direct introduction into a target cell or culture which in turn may synthesize the encoded polypeptides.
  • multiple variants of a protein may be produced and tested to determine the best variant in terms of pharmacokinetics, stability, biocompatibility, and/or biological activity, or a biophysical property such as expression level.
  • a library may contain 10, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , or over 10 9 possible variants (including, but not limited to, substitutions, deletions of one or more residues, and insertion of one or more residues).
  • the chimeric polynucleotides of the present invention may be designed to encode on or more antimicrobial peptides (AMP) or antiviral peptides (A VP).
  • AMPs and AVPs have been isolated and described from a wide range of animals such as, but not limited to, microorganisms, invertebrates, plants, amphibians, birds, fish, and mammals (Wang et ah, Nucleic Acids Res. 2009; 37 (Database issue):D933-7).
  • Anti-microbial and anti-viral polypeptides are described in International Publication No. WO2013151666, the contents of which are herein incorporated by reference. As a non-limting example, anti-microbial polypeptides are described in paragraphs [000189] -[000199] of
  • chimeric polynucleotides may be designed to comprise regions, subregions or parts which function in a similar manner as known regions or parts of other nucleic acid based molecules. Such regions include those mRNA regions discussed herein as well as noncoding regions. Noncoding regions may be at the level of a single nucleoside such as the case when the region is or incorporates one or more cytotoxic nucleosides.
  • the chimeric polynucleotides of the present invention may incorporate one or more cytotoxic nucleosides.
  • cytotoxic nucleosides may be incorporated into chimeric polynucleotides such as bifunctional modified RNAs or mRNAs.
  • Cytotoxic nucleoside anti-cancer agents include, but are not limited to, adenosine arabinoside, cytarabine, cytosine arabinoside, 5-fluorouracil, fludarabine, floxuridine, FTORAFUR® (a combination of tegafur and uracil), tegafur ((RS)-5-fluoro- l-(tetrahydrofuran-2-yl)pyrimidine-2,4(lH,3H)-dione), and 6-mercaptopurine.
  • cytotoxic nucleoside analogues are in clinical use, or have been the subject of clinical trials, as anticancer agents.
  • examples of such analogues include, but are not limited to, cytarabine, gemcitabine, troxacitabine, decitabine, tezacitabine, 2'- deoxy-2'-methylidenecytidine (DMDC), cladribine, clofarabine, 5-azacytidine, 4 ' -thio- aracytidine, cyclopentenylcytosine and l-(2-C-cyano-2-deoxy-beta-D-arabino- pentofuranosyl)-cytosine.
  • Another example of such a compound is fludarabine phosphate.
  • cytotoxic nucleoside analogues examples include, but are not limited to, N4-behenoyl-l-beta-D- arabinofuranosylcytosine, N4-octadecyl- 1 -beta-D-arabinofuranosylcytosine, N4- palmitoyl-l-(2-C-cyano-2-deoxy-beta-D-arabino-pentofuranosyl) cytosine, and P-4055 (cytarabine 5 ' -elaidic acid ester).
  • these prodrugs may be converted into the active drugs mainly in the liver and systemic circulation and display little or no selective release of active drug in the tumor tissue.
  • active drug for example, capecitabine, a prodrug of 5 ' - deoxy-5-fluorocytidine (and eventually of 5-fluorouracil), is metabolized both in the liver and in the tumor tissue.
  • capecitabine analogues containing "an easily hydrolysable radical under physiological conditions" has been claimed by Fujiu et al. (U.S. Pat. No. 4,966,891) and is herein incorporated by reference.
  • Cytotoxic nucleotides which may be chemotherapeutic also include, but are not limited to, pyrazolo [3,4-D]-pyrimidines, allopurinol, azathioprine, capecitabine, cytosine arabinoside, fluorouracil, mercaptopurine, 6-thioguanine, acyclovir, ara- adenosine, ribavirin, 7-deaza-adenosine, 7-deaza-guanosine, 6-aza-uracil, 6-aza-cytidine, thymidine ribonucleotide, 5-bromodeoxyuridine, 2-chloro-purine, and inosine, or combinations thereof.
  • pyrazolo [3,4-D]-pyrimidines allopurinol, azathioprine, capecitabine, cytosine arabinoside, fluorouracil, mercaptopurine, 6-thioguanine,
  • the chimeric polynucleotides of the present invention may comprise one or more regions or parts which act or function as an untranslated region. Where chimeric polynucleotides are designed to encode a polypeptide of interest, they may comprise one or more of these untranslated regions.
  • UTRs wild type untranslated regions of a gene are transcribed but not translated.
  • the 5'UTR starts at the transcription start site and continues to the start codon but does not include the start codon; whereas, the 3'UTR starts immediately following the stop codon and continues until the transcriptional termination signal.
  • the regulatory features of a UTR can be incorporated into the chimeric polynucleotides of the present invention to, among other things, enhance the stability of the molecule.
  • the specific features can also be incorporated to ensure controlled down-regulation of the transcript in case they are misdirected to undesired organs sites.
  • Natural 5'UTRs bear features which play roles in translation initiation. They harbor signatures like Kozak sequences which are commonly known to be involved in the process by which the ribosome initiates translation of many genes. Kozak sequences have the consensus CCR(A/G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another 'G'. 5'UTR also have been known to form secondary structures which are involved in elongation factor binding.
  • liver- expressed mRNA such as albumin, serum amyloid A, Apolipoprotein A/B/E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII
  • introduction of 5' UTR of liver- expressed mRNA such as albumin, serum amyloid A, Apolipoprotein A/B/E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII, could be used to enhance expression of a nucleic acid molecule, such as a chimeric polynucleotides, in hepatic cell lines or liver.
  • tissue-specific mRNA to improve expression in that tissue is possible for muscle (MyoD, Myosin, Myoglobin, Myogenin, Herculin), for endothelial cells (Tie-1, CD36), for myeloid cells (C/EBP, AML1, G-CSF, GM-CSF, CD1 lb, MSR, Fr-1, i-NOS), for leukocytes (CD45, CD18), for adipose tissue (CD36, GLUT4, ACRP30, adiponectin) and for lung epithelial cells (SP-A/B/C/D).
  • Untranslated regions useful in the design and manufacture of chimeric polynucleotides include, but are not limited, to those disclosed in co-pending, co-owned US Serial Number (USSN) 61/829372 (Attorney Docket Number M42), the contents of which are incorporated herein by reference in its entirety.
  • non-UTR sequences may also be used as regions or subregions within the chimeric polynucleotides.
  • introns or portions of introns sequences may be incorporated into regions of the chimeric polynucleotides of the invention. Incorporation of intronic sequences may increase protein production as well as polynucletoide levels.
  • the ORF may be flanked by a 5 ' UTR which may contain a strong Kozak translational initiation signal and/or a 3 ' UTR which may include an oligo(dT) sequence for templated addition of a poly-A tail.
  • 5 'UTR may comprise a first polynucleotide fragment and a second polynucleotide fragment from the same and/or different genes such as the 5 'UTRs described in US Patent Application Publication No. 20100293625, herein incorporated by reference in its entirety.
  • Variants of 5 ' or 3 ' UTRs may be utilized wherein one or more nucleotides are added or removed to the termini, including A, T, C or G.
  • any UTR from any gene may be incorporated into the regions of the chimeric polynucleotide.
  • multiple wild-type UTRs of any known gene may be utilized. It is also within the scope of the present invention to provide artificial UTRs which are not variants of wild type regions. These UTRs or portions thereof may be placed in the same orientation as in the transcript from which they were selected or may be altered in orientation or location. Hence a 5 ' or 3' UTR may be inverted, shortened, lengthened, made chimeric with one or more other 5' UTRs or 3' UTRs.
  • the term "altered" as it relates to a UTR sequence means that the UTR has been changed in some way in relation to a reference sequence.
  • a 3' or 5' UTR may be altered relative to a wild type or native UTR by the change in orientation or location as taught above or may be altered by the inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. Any of these changes producing an "altered" UTR (whether 3' or 5') comprise a variant UTR.
  • a double, triple or quadruple UTR such as a 5' or 3' UTR may be used.
  • a "double" UTR is one in which two copies of the same UTR are encoded either in series or substantially in series.
  • a double beta- globin 3' UTR may be used as described in US Patent publication 20100129877, the contents of which are incorporated herein by reference in its entirety.
  • patterned UTRs are those UTRs which reflect a repeating or alternating pattern, such as ABABAB or AABBAABBAABB or ABCABCABC or variants thereof repeated once, twice, or more than 3 times. In these patterns, each letter, A, B, or C represent a different UTR at the nucleotide level.
  • flanking regions are selected from a family of transcripts whose proteins share a common function, structure, feature of property.
  • polypeptides of interest may belong to a family of proteins which are expressed in a particular cell, tissue or at some time during development.
  • the UTRs from any of these genes may be swapped for any other UTR of the same or different family of proteins to create a new chimeric polynucleotide.
  • a "family of proteins" is used in the broadest sense to refer to a group of two or more polypeptides of interest which share at least one function, structure, feature, localization, origin, or expression pattern.
  • the untranslated region may also include translation enhancer elements (TEE).
  • TEE translation enhancer elements
  • the TEE may include those described in US
  • AU rich elements can be separated into three classes (Chen et al, 1995): Class I AREs contain several dispersed copies of an AUUUA motif within U-rich regions. C- Myc and MyoD contain class I AREs. Class II AREs possess two or more overlapping UUAUUUA(U/A)(U/A) nonamers. Molecules containing this type of AREs include GM-CSF and TNF-a. Class III ARES are less well defined.
  • AREs 3' UTR AU rich elements
  • one or more copies of an ARE can be introduced to make chimeric polynucleotides of the invention less stable and thereby curtail translation and decrease production of the resultant protein.
  • AREs can be identified and removed or mutated to increase the intracellular stability and thus increase translation and production of the resultant protein.
  • Transfection experiments can be conducted in relevant cell lines, using chimeric polynucleotides of the invention and protein production can be assayed at various time points post-transfection. For example, cells can be transfected with different ARE-engineering molecules and by using an ELISA kit to the relevant protein and assaying protein produced at 6 hour, 12 hour, 24 hour, 48 hour, and 7 days post-transfection.
  • microRNAs are 19-25 nucleotide long noncoding RNAs that bind to the 3 'UTR of nucleic acid molecules and down-regulate gene expression either by reducing nucleic acid molecule stability or by inhibiting translation.
  • the chimeric polynucleotides of the invention may comprise one or more microRNA target sequences, microRNA seqences, or microRNA seeds. Such sequences may correspond to any known microRNA such as those taught in US Publication US2005/0261218 and US Publication US2005/0059005, the contents of which are incorporated herein by reference in their entirety.
  • a microRNA sequence comprises a "seed" region, i.e., a sequence in the region of positions 2-8 of the mature microRNA, which sequence has perfect Watson- Crick complementarity to the miRNA target sequence.
  • a microRNA seed may comprise positions 2-8 or 2-7 of the mature microRNA.
  • a microRNA seed may comprise 7 nucleotides (e.g., nucleotides 2-8 of the mature microRNA), wherein the seed-complementary site in the corresponding miRNA target is flanked by an adenine (A) opposed to microRNA position 1.
  • a microRNA seed may comprise 6 nucleotides (e.g., nucleotides 2-7 of the mature microRNA), wherein the seed-complementary site in the corresponding miRNA target is flanked byan adenine (A) opposed to microRNA position 1.
  • A an adenine
  • the bases of the microRNA seed have complete complementarity with the target sequence.
  • microRNA target sequences By engineering microRNA target sequences into the chimeric polynucleotides (e.g., in a 3 ' UTR like region or other region) of the invention one can target the molecule for degradation or reduced translation, provided the microRNA in question is available. This process will reduce the hazard of off target effects upon nucleic acid molecule delivery. Identification of microRNA, microRNA target regions, and their expression patterns and role in biology have been reported (Bonauer et al., Curr Drug Targets 2010 11 :943-949; Anand and Cheresh Curr Opin Hematol 2011 18: 171-176; Contreras and Rao Leukemia 2012 26:404-413 (2011 Dec 20. doi: 10.1038/leu.2011.356); Barrel Cell 2009 136:215-233; Landgraf et al, Cell, 2007 129: 1401-1414; each of which is herein incorporated by reference in its entirety).
  • the nucleic acid molecule is an mRNA and is not intended to be delivered to the liver but ends up there, then miR-122, a microRNA abundant in liver, can inhibit the expression of the gene of interest if one or multiple target sites of miR-122 are engineered into the 3' UTR region of the chimeric polynucleotides.
  • Introduction of one or multiple binding sites for different microRNA can be engineered to further decrease the longevity, stability, and protein translation of a chimeric polynucleotides.
  • microRNA site refers to a microRNA target site or a microRNA recognition site, or any nucleotide sequence to which a microRNA binds or associates. It should be understood that “binding” may follow traditional Watson-Crick hybridization rules or may reflect any stable association of the microRNA with the target sequence at or adjacent to the microRNA site.
  • microRNA binding sites can be engineered out of (i.e. removed from) sequences in which they occur, e.g., in order to increase protein expression in specific tissues.
  • miR-122 binding sites may be removed to improve protein expression in the liver. Regulation of expression in multiple tissues can be accomplished through introduction or removal or one or several microRNA binding sites.
  • tissues where microRNA are known to regulate mRNA, and thereby protein expression include, but are not limited to, liver (miR-122), muscle (miR- 133, miR-206, miR-208), endothelial cells (miR-17-92, miR-126), myeloid cells (miR- 142-3p, miR-142-5p, miR-16, miR-21, miR-223, miR-24, miR-27), adipose tissue (let-7, miR-30c), heart (miR-ld, miR-149), kidney (miR-192, miR-194, miR-204), and lung epithelial cells (let-7, miR-133, miR-126).
  • MicroRNA can also regulate complex biological processes such as angiogenesis (miR- 132) (Anand and Cheresh Curr Opin Hematol 2011 18: 171-176; herein incorporated by reference in its entirety).
  • Expression profiles, microRNA and cell lines useful in the present invention include those taught in for example,U.S. Provisional Application Nos 61/857,436 (Attorney Docket Number M39) and 61/857,304 (Attorney Docket Number M37) each filed July 23, 2013, the contents of which are incorporated by reference in their entirety.
  • binding sites for microRNAs that are involved in such processes may be removed or introduced, in order to tailor the expression of the chimeric polynucleotides expression to biologically relevant cell types or to the context of relevant biological processes.
  • a listing of microRNA, miR sequences and miR binding sites is listed in Table 9 of U.S. Provisional Application No. 61/753,661 filed January 17, 2013, in Table 9 of U.S. Provisional Application No. 61/754,159 filed January 18, 2013, and in Table 7 of U.S. Provisional Application No. 61/758,921 filed January 31, 2013, each of which are herein
  • microRNA seed sites can be incorporated into mRNA to decrease expression in certain cells which results in a biological improvement.
  • An example of this is incorporation of miR- 142 sites into a UGT1A1 -expressing lentiviral vector.
  • miR-142 seed sites reduced expression in hematopoietic cells, and as a consequence reduced expression in antigen- presentating cells, leading to the absence of an immune response against the virally expressed UGT1A1 (Schmitt et al, Gastroenterology 2010; 139:999-1007; Gonzalez- Asequinolaza et al. Gastroenterology 2010, 139:726-729; both herein incorporated by reference in its entirety) .
  • Incorporation of miR-142 sites into modified mRNA could not only reduce expression of the encoded protein in hematopoietic cells, but could also reduce or abolish immune responses to the mRNA-encoded protein.
  • chimeric polynucleotides can be engineered for more targeted expression in specific cell types or only under specific biological conditions. Through introduction of tissue-specific microRNA binding sites, chimeric polynucleotides could be designed that would be optimal for protein expression in a tissue or in the context of a biological condition.
  • Transfection experiments can be conducted in relevant cell lines, using engineered chimeric polynucleotides and protein production can be assayed at various time points post-transfection.
  • cells can be transfected with different microRNA binding site-engineering chimeric polynucleotides and by using an ELISA kit to the relevant protein and assaying protein produced at 6 hour, 12 hour, 24 hour, 48 hour, 72 hour and 7 days post-transfection.
  • In vivo experiments can also be conducted using microRNA-binding site-engineered molecules to examine changes in tissue- specific expression of formulated chimeric polynucleotides.
  • the 5' cap structure of a natural mRNA is involved in nuclear export, increasing mRNA stability and binds the mRNA Cap Binding Protein (CBP), which is responsibile for mRNA stability in the cell and translation competency through the association of CBP with poly(A) binding protein to form the mature cyclic mRNA species.
  • CBP mRNA Cap Binding Protein
  • the cap further assists the removal of 5' proximal introns removal during mRNA splicing.
  • Endogenous mRNA molecules may be 5 '-end capped generating a 5'-ppp-5'- triphosphate linkage between a terminal guanosine cap residue and the 5 '-terminal transcribed sense nucleotide of the mR A molecule.
  • This 5'-guanylate cap may then be methylated to generate an N7-methyl-guanylate residue.
  • the ribose sugars of the terminal and/or anteterminal transcribed nucleotides of the 5' end of the mRNA may optionally also be 2'-0-methylated.
  • 5'-decapping through hydrolysis and cleavage of the guanylate cap structure may target a nucleic acid molecule, such as an mRNA molecule, for degradation.
  • chimeric polynucleotides may be designed to incorporate a cap moiety. Modifications to the chimeric polynucleotides of the present invention may generate a non-hydrolyzable cap structure preventing decapping and thus increasing mRNA half-life. Because cap structure hydrolysis requires cleavage of 5'- ppp-5' phosphorodiester linkages, modified nucleotides may be used during the capping reaction. For example, a Vaccinia Capping Enzyme from New England Biolabs
  • guanosine nucleotides may be used with a-thio-guanosine nucleotides according to the manufacturer's instructions to create a phosphorothioate linkage in the 5'-ppp-5' cap. Additional modified guanosine nucleotides may be used such as a-methyl-phosphonate and seleno-phosphate nucleotides.
  • Additional modifications include, but are not limited to, 2'-0-methylation of the ribose sugars of 5 '-terminal and/or 5 '-anteterminal nucleotides of the chimeric polynucleotide (as mentioned above) on the 2'-hydroxyl group of the sugar ring.
  • Multiple distinct 5 '-cap structures can be used to generate the 5 '-cap of a nucleic acid molecule, such as a chimeric polynucleotide which functions as an mRNA molecule.
  • Cap analogs which herein are also referred to as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ from natural (i.e. endogenous, wild-type or physiological) 5'-caps in their chemical structure, while retaining cap function. Cap analogs may be chemically (i.e. non-enzymatically) or enzymatically synthesized and/or linked to the chimeric polynucleotides of the invention.
  • the Anti-Reverse Cap Analog (ARCA) cap contains two guanines linked by a 5 '-5 '-triphosphate group, wherein one guanine contains an N7 methyl group as well as a 3'-0-methyl group (i.e., N7,3'-0-dimethyl-guanosine-5'- triphosphate-5 '-guanosine (m 7 G-3'mppp-G; which may equivaliently be designated 3' O- Me-m7G(5 ' )ppp(5 ' )G).
  • N7,3'-0-dimethyl-guanosine-5'- triphosphate-5 '-guanosine m 7 G-3'mppp-G; which may equivaliently be designated 3' O- Me-m7G(5 ' )ppp(5 ' )G.
  • the 3'-0 atom of the other, unmodified, guanine becomes linked to the 5 '-terminal nucleotide of the capped chimeric polynucleotide.
  • the N7- and 3'-0- methlyated guanine provides the terminal moiety of the capped chimeric polynucleotide.
  • mCAP which is similar to ARCA but has a 2'-0- methyl group on guanosine (i.e., N7,2'-0-dimethyl-guanosine-5'-triphosphate-5'- guanosine, m 7 Gm-ppp-G).
  • cap analogs allow for the concomitant capping of a chimeric
  • polynucleotide or a region thereof, in an in vitro transcription reaction up to 20% of transcripts can remain uncapped. This, as well as the structural differences of a cap analog from an endogenous 5 '-cap structures of nucleic acids produced by the
  • endogenous, cellular transcription machinery may lead to reduced translational competency and reduced cellular stability.
  • Chimeric polynucleotides of the invention may also be capped post- manufacture (whether IVT or chemical synthesis), using enzymes, in order to generate more authentic 5 '-cap structures.
  • the phrase "more authentic” refers to a feature that closely mirrors or mimics, either structurally or functionally, an endogenous or wild type feature. That is, a "more authentic" feature is better representative of an endogenous, wild-type, natural or physiological cellular function and/or structure as compared to synthetic features or analogs, etc., of the prior art, or which outperforms the corresponding endogenous, wild-type, natural or physiological feature in one or more respects.
  • Non- limiting examples of more authentic 5 'cap structures of the present invention are those which, among other things, have enhanced binding of cap binding proteins, increased half life, reduced susceptibility to 5' endonucleases and/or reduced 5'decapping, as compared to synthetic 5 'cap structures known in the art (or to a wild-type, natural or physiological 5 'cap structure).
  • recombinant Vaccinia Virus Capping Enzyme and recombinant 2'-0-methyltransferase enzyme can create a canonical 5 '-5 '-triphosphate linkage between the 5 '-terminal nucleotide of a chimeric
  • Capl structure a structure wherein the cap guanine contains an N7 methylation and the 5 '-terminal nucleotide of the mRNA contains a 2'-0-methyl.
  • Capl structure Such a structure is termed the Capl structure. This cap results in a higher translational- competency and cellular stability and a reduced activation of cellular pro-inflammatory cytokines, as compared, e.g., to other 5 'cap analog structures known in the art.
  • Cap structures include, but are not limited to, 7mG(5 ' ) ⁇ (5 ' )N,pN2p (cap 0), 7mG(5 ')ppp(5 ')NlmpNp (cap 1), and 7mG(5 ')-ppp(5 ')NlmpN2mp (cap 2).
  • the chimeric polynucleotides may be capped post-manufacture, and because this process is more efficient, nearly 100% of the chimeric polynucleotides may be capped. This is in contrast to -80% when a cap analog is linked to a chimeric polynucleotide in the course of an in vitro transcription reaction.
  • 5' terminal caps may include endogenous caps or cap analogs.
  • a 5' terminal cap may comprise a guanine analog.
  • Useful guanine analogs include, but are not limited to, inosine, Nl- methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino- guanosine, LNA-guanosine, and 2-azido-guanosine.
  • Additional viral sequences such as, but not limited to, the translation enhancer sequence of the barley yellow dwarf virus (BYDV-PAV), the Jaagsiekte sheep retrovirus (JSRV) and/or the Enzootic nasal tumor virus (See e.g., International Pub. No.
  • WO2012129648 can be engineered and inserted in the chimeric polynucleotides of the invention and can stimulate the translation of the construct in vitro and in vivo.
  • Trans fection experiments can be conducted in relevant cell lines at and protein production can be assayed by ELISA at 12hr, 24hr, 48hr, 72 hr and day 7 post-transfection.
  • chimeric polynucleotides which may contain an internal ribosome entry site (IRES).
  • IRES internal ribosome entry site
  • An IRES may act as the sole ribosome binding site, or may serve as one of multiple ribosome binding sites of an mRNA.
  • Chimeric polynucleotides containing more than one functional ribosome binding site may encode several peptides or polypeptides that are translated independently by the ribosomes ("multicistronic nucleic acid molecules").
  • IRES sequences that can be used according to the invention include without limitation, those from picornaviruses (e.g. FMDV), pest viruses (CFFV), polio viruses (PV), encephalomyocarditis viruses (ECMV), foot-and- mouth disease viruses (FMDV), hepatitis C viruses (HCV), classical swine fever viruses (CSFV), murine leukemia virus (MLV), simian immune deficiency viruses (SIV) or cricket paralysis viruses (CrPV).
  • picornaviruses e.g. FMDV
  • CFFV pest viruses
  • PV polio viruses
  • ECMV encephalomyocarditis viruses
  • FMDV foot-and- mouth disease viruses
  • HCV hepatitis C viruses
  • CSFV classical swine fever viruses
  • MLV murine leukemia virus
  • SIV simian immune deficiency viruses
  • CrPV cricket paralysis viruses
  • a long chain of adenine nucleotides may be added to a polynucleotide such as an mR A molecule in order to increase stability.
  • a polynucleotide such as an mR A molecule
  • poly-A polymerase adds a chain of adenine nucleotides to the RNA.
  • the process called polyadenylation, adds a poly-A tail that can be between, for example, approximately 100 and 250 residues long (SEQ ID NO: 6).
  • PolyA tails may also be added after the construct is exported from the nucleus.
  • terminal groups on the poly A tail may be incorporated for stabilization.
  • Chimeric polynucleotides of the present invention may incude des-3 ' hydroxyl tails. They may also include structural moieties or 2 ' -Omethyl modifications as taught by Junjie Li, et al.(Current Biology, Vol. 15, 1501-1507, August 23, 2005), the contents of which are incorporated herein by reference in its entirety.
  • the chimeric polynucleotides of the present invention may be desiged to encode transcripts with alternative polyA tail structures including histone mRNA.
  • SLBP stem-loop binding protein
  • Unique poly-A tail lengths provide certain advantages to the chimeric polynucleotides of the present invention.
  • the length of a poly-A tail, when present, is greater than 30 nucleotides in length (SEQ ID NO: 7).
  • the poly-A tail is greater than 35 nucleotides in length (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides).
  • the chimeric polynucleotide or region thereof includes from about 30 to about 3,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 750, from 30 to 1,000, from 30 to 1,500, from 30 to 2,000, from 30 to 2,500, from 50 to 100, from 50 to 250, from 50 to 500, from 50 to 750, from 50 to 1 ,000, from 50 to 1,500, from 50 to 2,000, from 50 to 2,500, from 50 to 3,000, from 100 to 500, from 100 to 750, from 100 to 1,000, from 100 to 1,500, from 100 to 2,000, from 100 to 2,500, from 100 to 3,000, from 500 to 750, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 2,500, from 500 to 3,000, from 1,000 to 1,500, from 1,000 to 2,000, from 1,000 to 2,500, from 1,000 to 3,000, from 1,500 to 2,000, from 1,500 to 2,500, from 1,500 to 2,500
  • the poly-A tail is designed relative to the length of the overall chimeric polynucleotides or the length of a particular region of the chimeric polynucleotide. This design may be based on the length of a coding region, the length of a particular feature or region or based on the length of the ultimate product expressed from the chimeric polynucleotides.
  • the poly-A tail may be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% greater in length than the chimeric polynucleotides or feature thereof.
  • the poly-A tail may also be designed as a fraction of chimeric polynucleotides to which it belongs.
  • the poly-A tail may be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct, a construct region or the total length of the construct minus the poly-A tail.
  • polynucleotides for Poly-A binding protein may enhance expression.
  • multiple distinct chimeric polynucleotides may be linked together via the PABP (Poly-A binding protein) through the 3 '-end using modified nucleotides at the 3 '-terminus of the poly-A tail.
  • Transfection experiments can be conducted in relevant cell lines at and protein production can be assayed by ELISA at 12hr, 24hr, 48hr, 72 hr and day 7 post-transfection.
  • the chimeric polynucleotides of the present invention are designed to include a polyA-G quartet region.
  • the G-quartet is a cyclic hydrogen bonded array of four guanine nucleotides that can be formed by G-rich sequences in both DNA and RNA.
  • the G-quartet is incorporated at the end of the poly-A tail.
  • the resultant polynucleotide is assayed for stability, protein production and other parameters including half-life at various time points. It has been discovered that the polyA-G quartet results in protein production from an mRNA equivalent to at least 75% of that seen using a poly-A tail of 120 nucleotides alone (SEQ ID NO: 8).
  • chimeric polynucleotides of the present invention may have regions that are analogous to or function like a start codon region.
  • translation of a chimeric polynucleotide may initiate on a codon which is not the start codon AUG.
  • Translation of the chimeric polynucleotide may initiate on an alternative start codon such as, but not limited to, ACG, AGG, AAG, CTG/CUG, GTG/GUG, ATA/AUA, ATT/AUU, TTG/UUG (see Touriol et al. Biology of the Cell 95 (2003) 169-178 and Matsuda and Mauro PLoS ONE, 2010 5: 11; the contents of each of which are herein incorporated by reference in its entirety).
  • the translation of a chimeric polynucleotide begins on the alternative start codon ACG.
  • chimeric polynucleotide translation begins on the alternative start codon CTG/CUG.
  • the translation of a chimeric polynucleotide begins on the alternative start codon
  • Nucleotides flanking a codon that initiates translation such as, but not limited to, a start codon or an alternative start codon, are known to effect the translation efficiency, the length and/or the structure of the polynucleotide. (See e.g., Matsuda and Mauro PLoS ONE, 2010 5: 11; the contents of which are herein incorporated by reference in its entirety). Masking any of the nucleotides flanking a codon that initiates translation may be used to alter the position of translation initiation, translation efficiency, length and/or structure of a polynucleotide.
  • a masking agent may be used near the start codon or alternative start codon in order to mask or hide the codon to reduce the probability of translation initiation at the masked start codon or alternative start codon.
  • masking agents include antisense locked nucleic acids (LNA)
  • EJCs exon-junction complexes
  • a masking agent may be used to mask a start codon of a chimeric polynucleotide in order to increase the likelihood that translation will initiate on an alternative start codon.
  • a masking agent may be used to mask a first start codon or alternative start codon in order to increase the chance that translation will initiate on a start codon or alternative start codon downstream to the masked start codon or alternative start codon.
  • a start codon or alternative start codon may be located within a perfect complement for a miR binding site.
  • the perfect complement of a miR binding site may help control the translation, length and/or structure of the chimeric polynucleotide similar to a masking agent.
  • the start codon or alternative start codon may be located in the middle of a perfect complement for a miR- 122 binding site.
  • the start codon or alternative start codon may be located after the first nucleotide, second nucleotide, third nucleotide, fourth nucleotide, fifth nucleotide, sixth nucleotide, seventh nucleotide, eighth nucleotide, ninth nucleotide, tenth nucleotide, eleventh nucleotide, twelfth nucleotide, thirteenth nucleotide, fourteenth nucleotide, fifteenth nucleotide, sixteenth nucleotide, seventeenth nucleotide, eighteenth nucleotide, nineteenth nucleotide, twentieth nucleotide or twenty-first nucleotide.
  • the start codon of a chimeric polynucleotide may be removed from the chimeric polynucleotide sequence in order to have the translation of the chimeric polynucleotide begin on a codon which is not the start codon. Translation of the chimeric polynucleotide may begin on the codon following the removed start codon or on a downstream start codon or an alternative start codon.
  • the start codon ATG/AUG is removed as the first 3 nucleotides of the chimeric polynucleotide sequence in order to have translation initiate on a downstream start codon or alternative start codon.
  • the chimeric polynucleotide sequence where the start codon was removed may further comprise at least one masking agent for the downstream start codon and/or alternative start codons in order to control or attempt to control the initiation of translation, the length of the chimeric polynucleotide and/or the structure of the chimeric polynucleotide.
  • the chimeric polynucleotides of the present invention may include at least two stop codons before the 3 ' untranslated region (UTR).
  • the stop codon may be selected from TGA, TAA and TAG.
  • the chimeric polynucleotides of the present invention include the stop codon TGA and one additional stop codon.
  • the addition stop codon may be TAA.
  • the chimeric polynucleotides of the present invention include three stop codons.
  • the chimeric polynucleotides may also encode additional features which facilitate trafficking of the polypeptides to therapeutically relevant sites.
  • One such feature which aids in protein trafficking is the signal sequence.
  • a "signal sequence” or “signal peptide” is a polynucleotide or polypeptide, respectively, which is from about 9 to 200 nucleotides (3-60 amino acids) in length which is incorporated at the 5' (or N-terminus) of the coding region or polypeptide encoded, respectively. Addition of these sequences result in trafficking of the encoded polypeptide to the endoplasmic reticulum through one or more secretory pathways. Some signal peptides are cleaved from the protein by signal peptidase after the proteins are transported.
  • the polypeptides of the present invention may include at least one protein cleavage signal containing at least one protein cleavage site.
  • the protein cleavage site may be located at the N-terminus, the C-terminus, at any space between the N- and the C- termini such as, but not limited to, half-way between the N- and C-termini, between the N-terminus and the half way point, between the half way point and the C-terminus, and combinations thereof.
  • the polypeptides of the present invention may include, but is not limited to, a proprotein convertase (or prohormone convertase), thrombin or Factor Xa protein cleavage signal.
  • Proprotein convertases are a family of nine proteinases, comprising seven basic amino acid-specific subtilisin-like serine proteinases related to yeast kexin, known as prohormone convertase 1/3 (PC 1/3), PC2, furin, PC4, PC5/6, paired basic amino-acid cleaving enzyme 4 (PACE4) and PC7, and two other subtilases that cleave at non-basic residues, called subtilisin kexin isozyme 1 (SKI-1) and proprotein convertase subtilisin kexin 9 (PCSK9).
  • PC 1/3 prohormone convertase 1/3
  • PC2 furin
  • PC4 paired basic amino-acid cleaving enzyme 4
  • PC7 subtilisin kexin isozyme 1
  • the chimeric polynucleotides of the present invention may be engineered such that the chimeric polynucleotide contains at least one encoded protein cleavage signal.
  • the encoded protein cleavage signal may be located in any region including but not limited to before the start codon, after the start codon, before the coding region, within the coding region such as, but not limited to, half way in the coding region, between the start codon and the half way point, between the half way point and the stop codon, after the coding region, before the stop codon, between two stop codons, after the stop codon and combinations thereof.
  • the chimeric polynucleotides of the present invention may include at least one encoded protein cleavage signal containing at least one protein cleavage site.
  • the encoded protein cleavage signal may include, but is not limited to, a proprotein convertase (or prohormone convertase), thrombin and/or Factor Xa protein cleavage signal.
  • the polypeptides of the present invention include at least one protein cleavage signal and/or site with the proviso that the polypeptide is not GLP-1.
  • the 5 ' UTR of the chimeric polynucleotide may be replaced by the insertion of at least one region and/or string of nucleosides of the same base.
  • the region and/or string of nucleotides may include, but is not limited to, at least 3, at least 4, at least 5, at least 6, at least 7 or at least 8 nucleotides and the nucleotides may be natural and/or unnatural.
  • the group of nucleotides may include 5-8 adenine, cytosine, thymine, a string of any of the other nucleotides disclosed herein and/or combinations thereof.
  • the 5 ' UTR of the chimeric polynucleotide may be replaced by the insertion of at least two regions and/or strings of nucleotides of two different bases such as, but not limited to, adenine, cytosine, thymine, any of the other nucleotides disclosed herein and/or combinations thereof.
  • the 5 ' UTR may be replaced by inserting 5-8 adenine bases followed by the insertion of 5-8 cytosine bases.
  • the 5 ' UTR may be replaced by inserting 5-8 cytosine bases followed by the insertion of 5-8 adenine bases.
  • the chimeric polynucleotide may include at least one substitution and/or insertion downstream of the transcription start site which may be recognized by an RNA polymerase.
  • at least one substitution and/or insertion may occur downstream the transcription start site by substituting at least one nucleic acid in the region just downstream of the transcription start site (such as, but not limited to, +1 to +6). Changes to region of nucleotides just downstream of the transcription start site may affect initiation rates, increase apparent nucleotide
  • NTP triphosphate
  • the chimeric polynucleotide may include the substitution of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12 or at least 13 guanine bases downstream of the transcription start site.
  • the chimeric polynucleotide may include the substitution of at least 1, at least 2, at least 3, at least 4, at least 5 or at least 6 guanine bases in the region just downstream of the transcription start site.
  • the guanine bases may be substituted by at least 1, at least 2, at least 3 or at least 4 adenine nucleotides.
  • the nucleotides in the region are GGGAGA the guanine bases may be substituted by at least 1, at least 2, at least 3 or at least 4 cytosine bases.
  • the guanine bases in the region are GGGAGA the guanine bases may be substituted by at least 1, at least 2, at least 3 or at least 4 thymine, and/or any of the nucleotides described herein.
  • the chimeric polynucleotide may include at least one substitution and/or insertion upstream of the start codon.
  • the start codon is the first codon of the protein coding region whereas the transcription start site is the site where transcription begins.
  • the chimeric polynucleotide may include, but is not limited to, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 or at least 8 substitutions and/or insertions of nucleotide bases.
  • the nucleotide bases may be inserted or substituted at 1, at least 1, at least 2, at least 3, at least 4 or at least 5 locations upstream of the start codon.
  • the nucleotides inserted and/or substituted may be the same base (e.g., all A or all C or all T or all G), two different bases (e.g., A and C, A and T, or C and T), three different bases (e.g., A, C and T or A, C and T) or at least four different bases.
  • the guanine base upstream of the coding region in the chimeric polynucleotide may be substituted with adenine, cytosine, thymine, or any of the nucleotides described herein.
  • the substitution of guanine bases in the chimeric polynucleotide may be designed so as to leave one guanine base in the region
  • At least 5 nucleotides may be inserted at 1 location downstream of the transcription start site but upstream of the start codon and the at least 5 nucleotides may be the same base type.
  • the chimeric polynucleotides of the present invention may include at least one post transcriptional control modulator. These post
  • transcriptional control modulators may be, but are not limited to, small molecules, compounds and regulatory sequences.
  • post transcriptional control may be achieved using small molecules identified by PTC Therapeutics Inc. (South Plainfield, NJ) using their GEMSTM (Gene Expression Modulation by Small- Moleclues) screening technology.
  • the chimeric polynucleotides of the present invention may include at least one post transcriptional control modulator as described in
  • the chimeric polynucleotides, their regions or parts or subregions may be codon optimized. Codon optimization methods are known in the art and may be useful in efforts to achieve one or more of several goals. These goals include to match codon frequencies in target and host organisms to ensure proper folding, bias GC content to increase mRNA stability or reduce secondary structures, minimize tandem repeat codons or base runs that may impair gene construction or expression, customize transcriptional and translational control regions, insert or remove protein trafficking sequences, remove/add post translation modification sites in encoded protein (e.g.
  • Codon optimization tools, algorithms and services are known in the art, non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and/or proprietary methods.
  • the ORF sequence is optimized using optimization algorithms. Codon options for each amino acid are given in Table 1.
  • regions of the chimeric polynucleotide may be upstream (5 ') or downstream (3 ') to a region which encodes a polypeptide. These regions may be incorporated into the chimeric polynucleotide before and/or after codon optimization of the protein encoding region or open reading frame (ORF). It is not required that a chimeric polynucleotide contain both a 5' and 3' flanking region.
  • a 5' UTR and/or a 3' UTR region may be provided as flanking regions. Multiple 5 ' or 3' UTRs may be included in the flanking regions and may be the same or of different sequences. Any portion of the flanking regions, including none, may be codon optimized and any may independently contain one or more different structural or chemical modifications, before and/or after codon optimization.
  • the chimeric polynucleotides components are reconstituted and transformed into a vector such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes.
  • a vector such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes.
  • the optimized polynculeotide may be reconstituted and transformed into chemically competent E. coli, yeast, neurospora, maize, drosophila, etc. where high copy plasmid-like or chromosome structures occur by methods described herein.
  • Synthetic polynucleotides and their nucleic acid analogs play an important role in the research and studies of biochemical processes.
  • Various enzyme-assisted and chemical-based methods have been developed to synthesize polynucleotides and nucleic acids.
  • cDNA encoding chimeric polynucleotides may be transcribed using an in vitro transcription (IVT) system.
  • the system typically comprises a transcription buffer, nucleotide triphosphates (NTPs), an RNase inhibitor and a polymerase.
  • NTPs may be manufactured in house, may be selected from a supplier, or may be synthesized as described herein.
  • the NTPs may be selected from, but are not limited to, those described herein including natural and unnatural (modified) NTPs.
  • the polymerase may be selected from, but is not limited to, T7 RNA polymerase, T3 RNA polymerase and mutant polymerases such as, but not limited to, polymerases able to incorporate chimeric polynucleotides (e.g., modified nucleic acids).
  • RNA polymerases or variants may be used in the synthesis of the chimeric polynucleotides of the present invention.
  • RNA polymerases may be modified by inserting or deleting amino acids of the RNA polymerase sequence.
  • the RNA polymerase may be modified to exhibit an increased ability to incorporate a 2 ' -modified nucleotide triphosphate compared to an unmodified RNA polymerase (see International Publication WO2008078180 and U.S. Patent 8,101,385; herein incorporated by reference in their entireties).
  • Variants may be obtained by evolving an RNA polymerase, optimizing the RNA polymerase amino acid and/or nucleic acid sequence and/or by using other methods known in the art.
  • T7 RNA polymerase variants may be evolved using the continuous directed evolution system set out by Esvelt et al.
  • T7 RNA polymerase may encode at least one mutation such as, but not limited to, lysine at position 93 substituted for threonine (K93T), I4M, A7T, E63V, V64D, A65E, D66Y, T76N, C125R, S128R, A136T, N165S, G175R, H176L, Y178H, F182L, L196F, G198V, D208Y, E222K, S228A, Q239R, T243N, G259D, M267I, G280C, H300R, D351A, A354S, E356D, L360P, A383V, Y385C, D388Y, S397R, M401T, N410S, K450R, P451T, G452V, E484A, H5
  • T7 RNA polymerase variants may encode at least mutation as described in U.S. Pub. Nos. 20100120024 and 20070117112; herein incorporated by reference in their entireties.
  • Variants of RNA polymerase may also include, but are not limited to, substitutional variants, conservative amino acid substitution, insertional variants, deletional variants and/or covalent derivatives.
  • the chimeric polynucleotide may be designed to be recognized by the wild type or variant RNA polymerases. In doing so, the chimeric polynucleotide may be modified to contain sites or regions of sequence changes from the wild type or parent chimeric polynucleotide.
  • Polynucleotide or nucleic acid synthesis reactions may be carried out by enzymatic methods utilizing polymerases.
  • Polymerases catalyze the creation of phosphodiester bonds between nucleotides in a polynucleotide or nucleic acid chain.
  • DNA polymerase I polymerase I
  • a polymerase family including the Klenow fragments of E. Coli, Bacillus DNA polymerase I, Thermus aquaticus (Taq) DNA polymerases, and the T7 RNA and DNA polymerases, is among the best studied of these families.
  • DNA polymerase a or B polymerase family, including all eukaryotic replicating DNA polymerases and polymerases from phages T4 and RB69. Although they employ similar catalytic mechanism, these families of polymerases differ in substrate specificity, substrate analog-incorporating efficiency, degree and rate for primer extension, mode of DNA synthesis, exonuclease activity, and sensitivity against inhibitors.
  • DNA polymerases are also selected based on the optimum reaction conditions they require, such as reaction temperature, pH, and template and primer concentrations. Sometimes a combination of more than one DNA polymerases is employed to achieve the desired DNA fragment size and synthesis efficiency. For example, Cheng et al. increase pH, add glycerol and dimethyl sulfoxide, decrease denaturation times, increase extension times, and utilize a secondary thermostable DNA polymerase that possesses a 3 ' to 5 ' exonuclease activity to effectively amplify long targets from cloned inserts and human genomic DNA. (Cheng et al, PNAS, Vol.
  • RNA polymerases from bacteriophage T3, T7, and SP6 have been widely used to prepare RNAs for biochemical and biophysical studies.
  • RNA polymerases, capping enzymes, and poly-A polymerases are disclosed in the co-pending International Publication No. WO2014028429, the contents of which are incorporated herein by reference in their entirety.
  • the RNA polymerase which may be used in the synthesis of the chimeric polynucleotides described herein is a Syn5 RNA polymerase (see Zhu et al. Nucleic Acids Research 2013, the contents of which is herein incorporated by reference in its entirety).
  • the Syn5 RNA polymerase was recently characterized from marine cyanophage Syn5 by Zhu et al. where they also identified the promoter sequence (see Zhu et al. Nucleic Acids Research 2013, the contents of which is herein incorporated by reference in its entirety). Zhu et al.
  • a Syn5 RNA polymerase catalyzed RNA synthesis over a wider range of temperatures and salinity as compared to T7 RNA polymerase. Additionally, the requirement for the initiating nucleotide at the promoter was found to be less stringent for Syn5 RNA polymerase as compared to the T7 RNA polymerase making Syn5 RNA polymerase promising for RNA synthesis.
  • a Syn5 RNA polymerase may be used in the synthesis of the chimeric polynucleotides described herein. As a non-limiting example, a Syn5 RNA polymerase may be used in the synthesis of the chimeric polynucleotide requiring a precise 3 '-termini.
  • a Syn5 promoter may be used in the synthesis of the chimeric polynucleotides.
  • the Syn5 promoter may be 5 ' - ATTGGGCACCCGTAAGGG-3 ' (SEQ ID NO: 3) as described by Zhu et al. (Nucleic Acids Research 2013, the contents of which is herein incorporated by reference in its entirety).
  • a Syn5 RNA polymerase may be used in the synthesis of chimeric polynucleotides comprising at least one chemical modification described herein and/or known in the art. (see e.g., the incorporation of pseudo-UTP and 5Me-CTP described in Zhu et al. Nucleic Acids Research 2013, the contents of which is herein incorporated by reference in its entirety).
  • the chimeric polynucleotides described herein may be synthesized using a Syn5 RNA polymerase which has been purified using modified and improved purification procedure described by Zhu et al. (Nucleic Acids Research 2013, the contents of which is herein incorporated by reference in its entirety).
  • PCR Polymerase chain reaction
  • PCR PCR
  • dNTPs deoxynucleoside triphosphates
  • DNA polymerase a DNA polymerase that binds to the ends of target DNA strands.
  • dNTPs deoxynucleoside triphosphates
  • PCR requires a cycle of heating and cooling for denaturation and annealing.
  • Variations of the basic PCR include asymmetric PCR [Innis et al., PNAS, vol. 85, 9436-9440 (1988)], inverse PCR [Ochman et al, Genetics, vol.
  • RT-PCR reverse transcription PCR
  • SDA displacement amplification
  • Nucleic acid sequence-based amplification also called transcription mediated amplification (TMA) is also an isothermal amplification method that utilizes a combination of DNA polymerase, reverse transcriptase, RNAse H, and T7 RNA polymerase.
  • a target RNA is used as a template and a reverse transcriptase synthesizes its complementary DNA strand.
  • RNAse H hydrolyzes the RNA template, making space for a DNA polymerase to synthesize a DNA strand complementary to the first DNA strand which is complementary to the RNA target, forming a DNA duplex.
  • T7 RNA polymerase continuously generates complementary RNA strands of this DNA duplex. These RNA strands act as templates for new cycles of DNA synthesis, resulting in amplification of the target gene.
  • Rolling-circle amplification amplifies a single stranded circular polynucleotide and involves numerous rounds of isothermal enzymatic synthesis where ⁇ 29 DNA polymerase extends a primer by continuously progressing around the polynucleotide circle to replicate its sequence over and over again. Therefore, a linear copy of the circular template is achieved. A primer can then be annealed to this linear copy and its complementary chain can be synthesized. [Lizardi et al., Nature Genetics, vol. 19, 225-232 (1998)] the contents of which are incorporated herein by reference in their entirety. A single stranded circular DNA can also serve as a template for RNA synthesis in the presence of an RNA polymerase.
  • RACE inverse rapid amplification of cDNA ends
  • CircLigase into a circular DNA The amplification of the resulting circular DNA is achived with RCA. (Polidoros et al, BioTechniques, vol. 41, 35-42 (2006), the contents of which are incorporated herein by reference in their entirety).
  • Ligase chain reaction is a promising diagnosing technique based on the principle that two adjacent polynucleotide probes hybridize to one strand of a target gene and couple to each other by a ligase. If a target gene is not present, or if there is a mismatch at the target gene, such as a single-nucleotide polymorphism (SNP), the probes cannot ligase.
  • SNP single-nucleotide polymorphism
  • LCR may be combined with various amplification techniques to increase sensitivity of detection or to increase the amount of products if it is used in synthesizing polynucleotides and nucleic acids.
  • DNA fragments may be placed in a NEBNEXT® ULTRATM DNA Library Prep Kit by NewEngland BioLabs® for end preparation, ligation, size selection, clean-up, PCR amplification and final clean-up.
  • RNA-dependent RNA polymerases RNA-dependent RNA polymerases
  • Oligonucleotides with non-standard nucleotides may be synthesized with enzymatic polymerization by contacting a template compring non-standard nucleotides with a mixture of nucleotides that are complementary to the nucleotides of the template as disclosed in US Pat. No. 6,617,106 to Benner, the contents of which are incorporated herein by reference in their entirety.
  • Chimeric polynucleotides of the invention may be manufactured in whole or in part using solid phase techniques.
  • Solid-phase chemical synthesis of polynucleotides or nucleic acids is an automated method wherein molecules are immobilized on a solid support and synthesized step by step in a reactant solution. Impurities and excess reagents are washed away and no purification is required after each step. The automation of the process is amenable on a computer-controlled solid-phase synthesizer. Solid-phase synthesis allows rapid production of polynucleotides or nucleic acids in a relatively large scale that leads to the commercial availability of some polynucleotides or nucleic acids. Furthermore, it is useful in site-specific introduction of chemical modifications in the polynucleotide or nucleic acid sequences. It is an indispensable tool in designing modified derivatives of natural nucleic acids.
  • nucleoside building blocks are synthesized in 3 ' to 5 ' direction.
  • the hydroxyl group in the 3 ' end of a nucleoside is tethered to a solid support via a chemically cleavable or light-cleavable linker.
  • Activated nucleoside monomers such as 2 ' -deoxynucleosides (dA, dC, dG and T), ribonucleosides (A, C, G, and U), or chemically modified nucleosides, are added to the support-bound nucleoside sequentially.
  • monomers are the 3 ' -phophoramidite derivatives of nucleoside building blocks.
  • the 3 ' phosphorus atom of the activated monomer couples with the 5 ' oxygen atom of the support-bound nucleoside to form a phosphite triester.
  • all functional groups not involved in the coupling reaction such as the 5 ' hydroxyl group, the hydroxyl group on the 3 ' phosphorus atom, the 2 ' hydroxyl group in ribonucleosides monomers, and the amino groups on the purine or pyrimidine bases, are all blocked with protection groups.
  • the next step involves oxidation of the phosphite triester to form a phosphate triester or phosphotriester, where the phosphorus atom is pentavalent.
  • the protection group on the 5 ' hydroxyl group at the end of the growing chain is then removed, ready to couple with an incoming activated monomer building block.
  • a cleaving agent such as ammonia or ammonium hydroxide is added to remove all the protecting groups and release the polynucleotide chains from the solid support.
  • Light may also be applied to cleave the polynucleotide chain.
  • the product can then be further purified with high pressure liquid chromatography (HPLC) or electrophoresis.
  • the polynucleotide chain is covalently bound to the solid support via its 3 ' hydroxyl group.
  • the solid supports are insoluble particles also called resins, typically 50-200 ⁇ in diameter.
  • resins typically 50-200 ⁇ in diameter.
  • Many different kinds of resins are now available, as reviewed in "Solid-phase supports for polynucleotide synthesis” by Guzaev [Guzaev, Current Protocols in Nucleic Acid Chemistry, 3.1.1-3.1.60 (2013)], the contents of which are incorporated herein by reference in their entirety.
  • the most common materials for the resins include highly cross-linked polystyrene beads and controlled pore glass (CPG) beads.
  • the surface of the beads may be treated to have functional groups, such as amino or aminomethyl groups that can be used as anchoring points for linkers to tether nucleosides.
  • They can be implemented in columns, multi-well plates, microarrays or microchips.
  • the column-based format allows relatively large scale synthesis of the polynucleotides or nucleic acids.
  • the resins are held between filters in columns that enable all reagents and solvents to pass through freely.
  • Multi-well plates, microarrays, or microchips are designed specifically for cost-effective small scale synthesis. Up to a million polynucleotides can be produced on a single microarray chip. However, the error rates of microchip-based synthesis are higher than traditional column-based methods.
  • Linkers are attached to the solid support for further extension of the chain. They are stable to all the reagents used in the synthesis process, except in the end of the synthesis when the chain is detached from the solid support.
  • Solid supports with a specific nucleoside linker i.e., A, C, dT, G, or U
  • A, C, dT, G, or U can be used to prepare polynucleotides with A, C, T, G, or U as the first nucleotide in the sequence, respectively.
  • Universal solid supports with non-nucleoside linkers can be used for all polynucleotide sequences. (US Pat. 6,653,468 to Guzaev et al., the contents of which are incorporated herein by reference in their entirety).
  • Various non-nucleoside linkers have been developed for universal supports, a lot of them with two vicinal hydroxyl groups. For example, a succinyl group is a frequently used linker.
  • a linker refers to a group of atoms, e.g., 10-1,000 atoms, and can be comprised of the atoms or groups such as, but not limited to, carbon, amino, alkylamino, oxygen, sulfur, sulfoxide, sulfonyl, carbonyl, and imine.
  • the linker can be attached to a modified nucleoside or nucleotide on the nucleobase or sugar moiety.
  • a linker may be nucleic acid based or non-nucleosidic. The linker may be of sufficient length as to not interfere with incorporation into a nucleic acid sequence.
  • the linker can be used for any useful purpose, such as to form multimers (e.g., through linkage of two or more chimeric polynucleotides molecules) or conjugates, as well as to administer a therapeutic molecule or incorporate a label, as described herein.
  • Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amido, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted, as described herein.
  • linkers include, but are not limited to, unsaturated alkanes, polyethylene glycols (e.g., ethylene or propylene glycol monomeric units, e.g., diethylene glycol, dipropylene glycol, triethylene glycol, tripropylene glycol, tetraethylene glycol, or tetraethylene glycol), and dextran polymers and derivatives thereof,
  • Non-limiting examples of a selectively cleavable bond include an amido bond can be cleaved for example by the use of tris(2-carboxyethyl)phosphine (TCEP), or other reducing agents, and/or photolysis, as well as an ester bond can be cleaved for example by acidic or basic hydrolysis.
  • TCEP tris(2-carboxyethyl)phosphine
  • the 5 ' hydroxyl group on the activated nucleoside phosphoramidite monomers may be protected with 4,4'-dimethoxytrityl (DMT) and the hydroxyl group on the phosphorus atom may be protected with 2-cyanoethyl.
  • DMT 4,4'-dimethoxytrityl
  • the exocyclic amino groups on the A, C, G bases may be protected with acyl groups.
  • Novel protecting groups for solid- phase synthesis monomers include, but are not limited to, carbonate protecting group disclosed in US Pat. No. 8,309,706 to Dellinger et al, orthoester-type 2 ' hydroxyl protecting group and an acyl carbonate-type hydroxyl protecting group disclosed in US Pat. No.
  • Short polynucleotide chains with 2-4 nucleotides may be prepared in liquid phase followed by binding to a solid support for extension reactions by solid phase synthesis.
  • a high efficiency liquid phase (HELP) synthesis is developed that uses monomethyl ether of polyethylene glycol (MPEG) beads as a support for the monomer building blocks.
  • MPEG polyethylene glycol
  • MPEG is soluble in methylene chloride and pyridine solvents but precipitates in a diethyl ether solvent.
  • the coupling reaction between monomers or between a growing chain and an incoming monomer bound on MPEG can be carried out in a homogenous liquid phase system. The mixture can then be washed with a diethyl ether solvent to easily precipitate and purify the product.
  • a solid-phase synthesizer may produce enough polynucleotides or nucleic acids with good purity to preform PCR and other amplification techniques.
  • Agilent Technologies have developed microarrays that are commercially available.
  • Polynucleotides may be synthesized on a microarray substrate, cleaved by a strong base or light, followed by PCR amplification to generate a library of polynucleotides.
  • Regions or subregions of the chimeric polynucleotides of the present invention may comprise small RNA molecules such as siRNA, and therefore may be synthesized in the same manner.
  • siRNA molecules such as siRNA
  • UFPD Deprotection
  • siRNA construction kit produces siRNA by in vitro transcription of DNA templates and contains the enzymes, buffers, primers needed. Such methods may be used to synthesize regions or subregions of chimeric polynucleotides.
  • Ligation is an indispensable tool for assembling polynucleotide or nucleic acid fragments into larger constructs.
  • DNA fragments can be joined by a ligase catalyzed reaction to create recombinant DNA with different functions.
  • Oligodexoynucleotides with fluorescent or chemiluminescent labels may also serve as DNA ligase substrates.
  • RNA ligases such as T4 RNA ligase catalyze the formation of a phosphodiester bond between two single stranded
  • Ligases may be used with other enzymes to prepare desired chimeric polynucleotide or nucleic acid molecules and to perform genome analysis.
  • ligation-mediated selective PCR amplification is disclosed in EP Pat. Pub. No. 0735144 to Kato.
  • Complementary DNAs (cDNAs) reverse-transcribed from tissue- or cell-derived RNA or DNA are digested into fragments with type IIS restriction enzymes the contents of which are incorporated herein by reference in their entirety.
  • Biotinylated adapter sequences are attached to the fragments by E. coli DNA ligases. The biotin-labeled DNA fragments are then immobilized onto streptavidin-coated beads for downstream analysis.
  • a ligation splint or a ligation splint oligo is an oligonucleotide that is used to provide an annealing site or a ligation template for joining two ends of one nucleic acid, i.e., intramolecular joining, or two ends of two nucleic acids, i.e., intermolecular joining, using a ligase or another enzyme with ligase activity.
  • the ligation splint holds the ends adjacent to each other and creates a ligation junction between the 5'-phosphorylated and a 3'-hydroxylated ends that are to be ligated.
  • enzymes such as, but not limited to, T4 DNA ligase, Ampligase® DNA Ligase (Epicentre® Technologies), Tth DNA ligase, Tfl DNA ligase, or Tsc DNA Ligase (Prokaria) can be used.
  • T4 DNA ligase Ampligase® DNA Ligase (Epicentre® Technologies)
  • Tth DNA ligase Tfl DNA ligase
  • Tsc DNA Ligase Prokaria
  • T4 RNA ligase can efficiently ligate ends of RNA molecules that are adjacent to each other when hybridized to an RNA splint, the contents of which are incorporated herein by reference in their entirety.
  • T4 RNA ligase is a suitable ligase for joining DNA ends with
  • RNA splints include modified RNA containing 2'-fluorine-CTP (2'-F-dCTP) and 2'-fluorine-UTP (2'- F-dUTP) made using the DuraScribe® T7 Transcription Kit (Epicentre® Technologies) disclosed in US Pat. No. 8,137,911 and US Pat. Publication 2012/0156679 to Dahl et al, the contents of which are incorporated herein by reference in their entirety.
  • the modified RNA produced from DuraScribe® T7 Transcription kit is completely resistant to RNase A digestion.
  • DNA splint and DNA ligase may be used to generate RNA-protein fusions disclosed in US Pat. No. 6,258,558 to Szostak et al, the contents of which are
  • ThermoPhageTM ssDNA ligase (Prokazyme), which is derived from phage TS2126 that infects Thermus scotoductus, catalyzes ATP-dependent intra- and inter-molecular ligation of DNA and RNA.
  • the solid-phase chemical synthesis method that uses phosphoramidite monomers is limited to produce DNA molecules with short strands.
  • the purity of the DNA products and the yield of reactions become poor when the length exceeds 150 bases.
  • Moore and Sharp describe preparing RNA fragments 10- to 20-nt long by chemical synthesis, to which site-specific modifications may be introduced, annealing the fragments to a cDNAsplint, and then assemble the fragments with T4 DNA ligase. (Moore et al., Science, vol.
  • RNA ligase Ligation reactions of oligoribonucleotides with T4 RNA ligase and a DNA splint or a polyribonucleotide to generate large, synthetic RNAs are described in Bain et al, Nucleic Acids Research, vol. 20(16), 4372 (1992), Stark et al, RNA, vol. 12, 2014-2019 (2006), and US Pat. Application No. 2005/0130201 to Deras et al., the contents of which are incorporated herein by reference in their entirety.
  • 5 ' -cap and 3 ' -polyA tail are often added by enzymatic addition to an oligonucleotide synthesized with solid-phase methods.
  • a synthetic capped 42-mer mRNA has been synthesized in three fragments enzymatically ligated as described by Iwase et al. ⁇ Nucleic Acids Research, vol. 20, 1643-1648 (1992), the contents of which are incorporated herein by reference in their entirety).
  • a 16.3-kilobase mouse mitochondrial genome has been produced from 600 overlapping 60-mer polynucleotides. The method cycles between in vitro recombination and amplification until the desired length is reached.
  • Sequential ligation can be performed on a solid substrate.
  • initial linker DNA molecules modified with biotin at the end are attached to streptavidin-coated beads.
  • the 3 ' -ends of the linker DNA molecules are complimentary with the 5 ' -ends of the incoming DNA fragments.
  • the beads are washed and collected after each ligation step and the final linear constructs are released by a meganuclease.
  • This method allows rapid and efficient assembly of genes in an optimized order and orientation. (Takita, DNA Research, vol. 20(4), 1-10 (2013), the contents of which are incorporated herein by reference in their entirety).
  • Labeled polynucleotides synthesized on solid-supports are disclosed in US Pat. Pub. No. 2001/0014753 to Soloveichik et al. and US Pat. Pub. No. 2003/0191303 to Vinayak et al, the contents of which are incorporated herein by reference for their entirety.
  • Non-natural modified nucleotides may be introduced to chimeric
  • HNAs hexitol nucleic acids
  • mRNAs Short messenger RNAs
  • Either enzymatic or chemical ligation methods can be used to conjugate chimeric polynucleotides or their regions with different functional blocks, such as fluorescent labels, liquids, nanoparticles, delivery agents, etc.
  • the conjugates of polynucleotides and modified polynucleotides are reviewed by Goodchild in
  • the chimeric polynucleotides of the present invention may be quantified in exosomes or when derived from one or more bodily fluid.
  • bodily fluids include peripheral blood, serum, plasma, ascites, urine,
  • cerebrospinal fluid CSF
  • sputum saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or pre-ejaculatory fluid, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates, blastocyl cavity fluid, and umbilical cord blood.
  • CSF cerebrospinal fluid
  • saliva saliva
  • bone marrow synovial fluid
  • aqueous humor amniotic fluid
  • cerumen cerumen
  • breast milk broncheoalveolar lavage fluid
  • semen
  • exosomes may be retrieved from an organ selected from the group consisting of lung, heart, pancreas, stomach, intestine, bladder, kidney, ovary, testis, skin, colon, breast, prostate, brain, esophagus, liver, and placenta.
  • the exosome quantification method a sample of not more than 2mL is obtained from the subject and the exosomes isolated by size exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunoabsorbent capture, affinity purification, microfluidic separation, or combinations thereof.
  • the level or concentration of a chimeric polynucleotide may be an expression level, presence, absence, truncation or alteration of the administered construct. It is advantageous to correlate the level with one or more clinical phenotypes or with an assay for a human disease biomarker.
  • the assay may be performed using construct specific probes, cytometry, qRT-PCR, real-time PCR, PCR, flow cytometry,
  • exosomes may be isolated using immunohistochemical methods such as enzyme linked immunosorbent assay (ELISA) methods. Exosomes may also be isolated by size exclusion
  • nanomembrane ultrafiltration immunoabsorbent capture, affinity purification, microfluidic separation, or combinations thereof.
  • the chimeric polynucleotide may be quantified using methods such as, but not limited to, ultraviolet visible spectroscopy (UV/Vis).
  • UV/Vis ultraviolet visible spectroscopy
  • a non- limiting example of a UV/Vis spectrometer is a NANODROP® spectrometer
  • the quantified chimeric polynucleotide may be analyzed in order to determine if the chimeric polynucleotide may be of proper size, check that no degradation of the chimeric polynucleotide has occurred.
  • Degradation of the chimeric polynucleotide may be checked by methods such as, but not limited to, agarose gel electrophoresis, HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP- HPLC), and hydrophobic interaction HPLC (HIC-HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE) and capillary gel electrophoresis (CGE).
  • HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP- HPLC), and hydrophobic interaction HPLC (HIC-HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE) and capillary gel electrophoresis (CGE).
  • Chimeric polynucleotide purification may include, but is not limited to, polynucleotide clean-up, quality assurance and quality control. Clean-up may be performed by methods known in the arts such as, but not limited to, AGENCOURT® beads (Beckman Coulter Genomics, Danvers, MA), poly-T beads, LNATM oligo-T capture probes (EXIQON® Inc, Vedbaek, Denmark) or HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC- HPLC).
  • HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC- HPLC).
  • purification when used in relation to a polynucleotide such as a
  • purified chimeric polynucleotide refers to one that is separated from at least one contaminant.
  • a "contaminant” is any substance which makes another unfit, impure or inferior.
  • a purified polynucleotide e.g., DNA and RNA
  • a quality assurance and/or quality control check may be conducted using methods such as, but not limited to, gel electrophoresis, UV absorbance, or analytical HPLC.
  • the chimeric polynucleotide may be sequenced by methods including, but not limited to reverse-transcriptase-PCR.
  • a polynucleotide such as a chimeric polynucleotide, whether coding or noncoding
  • the terms "chemical modification” or, as appropriate, “chemically modified” refer to modification with respect to adenosine (A), guanosine (G), uridine (U), thymidine (T) or cytidine (C) ribo- or deoxyribnucleosides in one or more of their position, pattern, percent or population.
  • A adenosine
  • G guanosine
  • U uridine
  • T thymidine
  • C cytidine
  • modification refers to a modification as compared to the canonical set of 20 amino acids.
  • the regions may contain one, two, or more (optionally different) nucleoside or nucleotide modifications.
  • a modified chimeric polynucleotide, introduced to a cell may exhibit reduced degradation in the cell, as compared to an unmodified polynucleotide.
  • Modifications which are useful in the present invention include, but are not limted to those in Table 2. Noted in the table are the symbol of the modification, the nucleobase type and whether the modification is naturally occurring or not.
  • 6-(azo)cytosine -- c NO 6-aza-cytidine - C NO aza cytosine - C NO deaza cytosine - c NO

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Saccharide Compounds (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2014/053907 2013-09-03 2014-09-03 Chimeric polynucleotides Ceased WO2015034928A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US14/915,959 US20160194625A1 (en) 2013-09-03 2014-09-03 Chimeric polynucleotides
EP14766339.7A EP3041934A1 (en) 2013-09-03 2014-09-03 Chimeric polynucleotides
JP2016540348A JP2016530294A (ja) 2013-09-03 2014-09-03 キメラポリヌクレオチド
AU2014315287A AU2014315287A1 (en) 2013-09-03 2014-09-03 Chimeric polynucleotides
CA2923029A CA2923029A1 (en) 2013-09-03 2014-09-03 Chimeric polynucleotides

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201361873034P 2013-09-03 2013-09-03
US61/873,034 2013-09-03
US201361877582P 2013-09-13 2013-09-13
US61/877,582 2013-09-13

Publications (1)

Publication Number Publication Date
WO2015034928A1 true WO2015034928A1 (en) 2015-03-12

Family

ID=51541368

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/053907 Ceased WO2015034928A1 (en) 2013-09-03 2014-09-03 Chimeric polynucleotides

Country Status (6)

Country Link
US (1) US20160194625A1 (https=)
EP (1) EP3041934A1 (https=)
JP (1) JP2016530294A (https=)
AU (1) AU2014315287A1 (https=)
CA (1) CA2923029A1 (https=)
WO (1) WO2015034928A1 (https=)

Cited By (58)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9095552B2 (en) 2012-04-02 2015-08-04 Moderna Therapeutics, Inc. Modified polynucleotides encoding copper metabolism (MURR1) domain containing 1
US9107886B2 (en) 2012-04-02 2015-08-18 Moderna Therapeutics, Inc. Modified polynucleotides encoding basic helix-loop-helix family member E41
US9181319B2 (en) 2010-08-06 2015-11-10 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9186372B2 (en) 2011-12-16 2015-11-17 Moderna Therapeutics, Inc. Split dose administration
WO2016014846A1 (en) 2014-07-23 2016-01-28 Moderna Therapeutics, Inc. Modified polynucleotides for the production of intrabodies
US9283287B2 (en) 2012-04-02 2016-03-15 Moderna Therapeutics, Inc. Modified polynucleotides for the production of nuclear proteins
US9533047B2 (en) 2011-03-31 2017-01-03 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9572897B2 (en) 2012-04-02 2017-02-21 Modernatx, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9597380B2 (en) 2012-11-26 2017-03-21 Modernatx, Inc. Terminally modified RNA
US9701965B2 (en) 2010-10-01 2017-07-11 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
WO2017120612A1 (en) 2016-01-10 2017-07-13 Modernatx, Inc. Therapeutic mrnas encoding anti ctla-4 antibodies
WO2018009838A1 (en) 2016-07-07 2018-01-11 Rubius Therapeutics, Inc. Compositions and methods related to therapeutic cell systems expressing exogenous rna
EP3157572A4 (en) * 2014-06-19 2018-02-14 Moderna Therapeutics, Inc. Alternative nucleic acid molecules and uses thereof
EP3157573A4 (en) * 2014-06-19 2018-02-21 Moderna Therapeutics, Inc. Alternative nucleic acid molecules and uses thereof
US10023626B2 (en) 2013-09-30 2018-07-17 Modernatx, Inc. Polynucleotides encoding immune modulating polypeptides
WO2018165547A1 (en) * 2017-03-10 2018-09-13 University Of Louisville Research Foundation, Inc. Fasl-engineered biomaterials with immunomodulatory function
US10077439B2 (en) 2013-03-15 2018-09-18 Modernatx, Inc. Removal of DNA fragments in mRNA production process
US10106800B2 (en) 2005-09-28 2018-10-23 Biontech Ag Modification of RNA, producing an increased transcript stability and translation efficiency
US10138507B2 (en) 2013-03-15 2018-11-27 Modernatx, Inc. Manufacturing methods for production of RNA transcripts
US10155031B2 (en) 2012-11-28 2018-12-18 Biontech Rna Pharmaceuticals Gmbh Individualized vaccines for cancer
WO2019008335A1 (en) 2017-07-07 2019-01-10 Avacta Life Sciences Limited SCAFFOLD PROTEINS
US10258698B2 (en) 2013-03-14 2019-04-16 Modernatx, Inc. Formulation and delivery of modified nucleoside, nucleotide, and nucleic acid compositions
CN109796769A (zh) * 2018-12-27 2019-05-24 李新虹 一种医学护理手套
US10385088B2 (en) 2013-10-02 2019-08-20 Modernatx, Inc. Polynucleotide molecules and uses thereof
US10407683B2 (en) 2014-07-16 2019-09-10 Modernatx, Inc. Circular polynucleotides
CN110366557A (zh) * 2016-12-23 2019-10-22 威特拉公司 结合多肽及其制备方法
US10485884B2 (en) 2012-03-26 2019-11-26 Biontech Rna Pharmaceuticals Gmbh RNA formulation for immunotherapy
WO2020047394A1 (en) * 2018-08-31 2020-03-05 The Trustees Of The University Of Pennsylvania Injectable hydrogels for local delivery to the heart
US10590161B2 (en) 2013-03-15 2020-03-17 Modernatx, Inc. Ion exchange purification of mRNA
US10738355B2 (en) 2011-05-24 2020-08-11 Tron-Translationale Onkologie An Der Universitätsmedizin Der Johannes Gutenberg-Universität Mainz Ggmbh Individualized vaccines for cancer
WO2020233706A1 (zh) * 2019-05-22 2020-11-26 华东理工大学 一种治疗躁狂型精神障碍及精神分裂症的药物
US10849920B2 (en) 2015-10-05 2020-12-01 Modernatx, Inc. Methods for therapeutic administration of messenger ribonucleic acid drugs
CN112162052A (zh) * 2020-11-06 2021-01-01 深圳市格物正源质量标准系统有限公司 一种水产品中兽药多残留的测定方法
WO2021074695A1 (en) 2019-10-16 2021-04-22 Avacta Life Sciences Limited PD-L1 INHIBITOR - TGFβ INHIBITOR BISPECIFIC DRUG MOIETIES.
US11027025B2 (en) 2013-07-11 2021-06-08 Modernatx, Inc. Compositions comprising synthetic polynucleotides encoding CRISPR related proteins and synthetic sgRNAs and methods of use
US11156617B2 (en) 2015-02-12 2021-10-26 BioNTech RNA Pharmaceuticals GbmH Predicting T cell epitopes useful for vaccination
US11173120B2 (en) 2014-09-25 2021-11-16 Biontech Rna Pharmaceuticals Gmbh Stable formulations of lipids and liposomes
WO2021249786A1 (en) 2020-06-09 2021-12-16 Avacta Life Sciences Limited Sars-cov2 diagnostic polypeptides and methods
US11222711B2 (en) 2013-05-10 2022-01-11 BioNTech SE Predicting immunogenicity of T cell epitopes
US11298426B2 (en) 2003-10-14 2022-04-12 BioNTech SE Recombinant vaccines and use thereof
US11377470B2 (en) 2013-03-15 2022-07-05 Modernatx, Inc. Ribonucleic acid purification
US11434486B2 (en) 2015-09-17 2022-09-06 Modernatx, Inc. Polynucleotides containing a morpholino linker
US11492628B2 (en) 2015-10-07 2022-11-08 BioNTech SE 3′-UTR sequences for stabilization of RNA
WO2022234003A1 (en) 2021-05-07 2022-11-10 Avacta Life Sciences Limited Cd33 binding polypeptides with stefin a protein
JP2023024669A (ja) * 2015-10-22 2023-02-16 モデルナティエックス インコーポレイテッド 癌ワクチン
US11603399B2 (en) 2013-03-13 2023-03-14 Modernatx, Inc. Long-lived polynucleotide molecules
EP4159741A1 (en) 2014-07-16 2023-04-05 ModernaTX, Inc. Method for producing a chimeric polynucleotide encoding a polypeptide having a triazole-containing internucleotide linkage
WO2023057567A1 (en) 2021-10-07 2023-04-13 Avacta Life Sciences Limited Pd-l1 binding affimers
WO2023057946A1 (en) 2021-10-07 2023-04-13 Avacta Life Sciences Limited Serum half-life extended pd-l1 binding polypeptides
WO2023153876A1 (ko) 2022-02-10 2023-08-17 주식회사 아피셀테라퓨틱스 Cd40l에 특이적으로 결합하는 스테핀 a 단백질 변이체 및 이의 용도
WO2023218243A1 (en) 2022-05-12 2023-11-16 Avacta Life Sciences Limited Lag-3/pd-l1 binding fusion proteins
US12109274B2 (en) 2015-09-17 2024-10-08 Modernatx, Inc. Polynucleotides containing a stabilizing tail region
US12115230B2 (en) 2020-04-09 2024-10-15 Verve Therapeutics, Inc. Base editing of ANGPTL3 and methods of using same for treatment of disease
CN118878604A (zh) * 2024-09-27 2024-11-01 北京炫景瑞医药科技有限公司 磷酯骨架修饰的核苷酸及寡核苷酸
US12139617B2 (en) 2017-12-22 2024-11-12 North Carolina State University Polymeric fluorophores, compositions comprising the same, and methods of preparing and using the same
US12270813B2 (en) 2017-06-09 2025-04-08 BioNTech SE Methods for predicting the usefulness of disease specific amino acid modifications for immunotherapy
US12385034B2 (en) 2016-06-24 2025-08-12 Modernatx, Inc. Methods and apparatus for filtration
WO2025194138A1 (en) 2024-03-14 2025-09-18 Tessera Therapeutics, Inc. St1cas9 compositions and methods for modulating a genome

Families Citing this family (56)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2340499T3 (es) 2001-06-05 2010-06-04 Curevac Gmbh Arnm de antigeno tumoral estabilizado con un contenido de g/c aumentado.
EP3318248B1 (en) 2009-12-01 2019-04-10 Translate Bio, Inc. Delivery of mrna for the augmentation of proteins and enzymes in human genetic diseases
US8853377B2 (en) 2010-11-30 2014-10-07 Shire Human Genetic Therapies, Inc. mRNA for use in treatment of human genetic diseases
RU2013154295A (ru) 2011-06-08 2015-07-20 Шир Хьюман Дженетик Терапис, Инк. КОМПОЗИЦИИ ЛИПИДНЫХ НАНОЧАСТИЦ И СПОСОБЫ ДЛЯ ДОСТАВКИ мРНК
EP2858679B2 (en) 2012-06-08 2024-06-05 Translate Bio, Inc. Pulmonary delivery of mrna to non-lung target cells
RS57739B1 (sr) 2013-03-14 2018-12-31 Translate Bio Inc Kompozicije cftr irnk i postupci i upotrebe u vezi sa njima
JP6586075B2 (ja) 2013-03-14 2019-10-02 トランスレイト バイオ, インコーポレイテッド メッセンジャーrnaの精製方法
BR112015022855A2 (pt) 2013-03-14 2017-11-07 Shire Human Genetic Therapies composições e método para produção de um anticorpo in vitro
EP3388834B1 (en) 2013-03-15 2020-04-15 Translate Bio, Inc. Synergistic enhancement of the delivery of nucleic acids via blended formulations
CN106413811A (zh) 2013-10-22 2017-02-15 夏尔人类遗传性治疗公司 精氨基琥珀酸合成酶缺乏症的mrna疗法
ES3032935T3 (en) 2013-10-22 2025-07-29 Translate Bio Inc Lipid formulations for delivery of messenger rna
JP6506749B2 (ja) 2013-10-22 2019-04-24 シャイアー ヒューマン ジェネティック セラピーズ インコーポレイテッド フェニルケトン尿症のためのmRNA療法
AU2014340149B2 (en) 2013-10-22 2020-12-24 Shire Human Genetic Therapies, Inc. CNS delivery of mRNA and uses thereof
US9850269B2 (en) 2014-04-25 2017-12-26 Translate Bio, Inc. Methods for purification of messenger RNA
JP6557722B2 (ja) 2014-05-30 2019-08-07 シャイアー ヒューマン ジェネティック セラピーズ インコーポレイテッド 核酸の送達のための生分解性脂質
KR102559979B1 (ko) 2014-06-24 2023-07-25 샤이어 휴먼 지네틱 테라피즈 인크. 핵산의 전달용 입체화학적으로 풍부한 조성물
BR112016030852A2 (pt) 2014-07-02 2018-01-16 Shire Human Genetic Therapies encapsulação de rna mensageiro
WO2016149508A1 (en) 2015-03-19 2016-09-22 Shire Human Genetic Therapies, Inc. Mrna therapy for pompe disease
MA42543A (fr) 2015-07-30 2018-06-06 Modernatx Inc Arn épitope peptidiques concatémériques
CA3001312A1 (en) 2015-10-08 2017-04-13 Dna2.0, Inc. Dna vectors, transposons and transposases for eukaryotic genome modification
JP6997704B2 (ja) 2015-10-14 2022-02-04 トランスレイト バイオ, インコーポレイテッド 生産性向上のためのrna関連酵素の修飾
EP4011451A1 (en) 2015-10-22 2022-06-15 ModernaTX, Inc. Metapneumovirus mrna vaccines
EP3825400B1 (en) 2016-04-08 2024-12-25 Translate Bio, Inc. Multimeric coding nucleic acid and uses thereof
EP3469074B1 (en) 2016-06-13 2020-12-09 Translate Bio, Inc. Messenger rna therapy for the treatment of ornithine transcarbamylase deficiency
CA3036831A1 (en) 2016-09-14 2018-03-22 Modernatx, Inc. High purity rna compositions and methods for preparation thereof
WO2018057812A2 (en) 2016-09-21 2018-03-29 The Broad Institute, Inc. Constructs for continuous monitoring of live cells
MA46766A (fr) 2016-11-11 2019-09-18 Modernatx Inc Vaccin antigrippal
EA201991747A1 (ru) 2017-02-27 2020-06-04 Транслейт Био, Инк. НОВАЯ КОДОН-ОПТИМИЗИРОВАННАЯ мРНК CFTR
RU2734900C1 (ru) 2017-03-31 2020-10-26 Фуджифилм Корпорэйшн Липосомальная композиция и фармацевтическая композиция
MX2019013752A (es) 2017-05-16 2020-07-20 Translate Bio Inc Tratamiento de la fibrosis quística mediante el suministro de arnm que codifica cftr optimizado en codones.
WO2019018561A1 (en) * 2017-07-19 2019-01-24 The Scripps Research Institute GENOMIC LIBRARY GENERATION IN SOLID PHASE FOR HIGH FLOW SEQUENCING
US11167043B2 (en) 2017-12-20 2021-11-09 Translate Bio, Inc. Composition and methods for treatment of ornithine transcarbamylase deficiency
CN120310791A (zh) 2018-01-12 2025-07-15 百时美施贵宝公司 靶向α-突触核蛋白的反义寡核苷酸及其用途
SG11202006528XA (en) 2018-01-12 2020-08-28 Bristol Myers Squibb Co Antisense oligonucleotides targeting alpha-synuclein and uses thereof
EP3746090A4 (en) 2018-01-29 2021-11-17 ModernaTX, Inc. RSV RNA Vaccines
PL3811931T3 (pl) 2018-06-20 2024-11-18 Fujifilm Corporation Skojarzony środek leczniczy zawierający kompozycję liposomową z kapsułkowanym lekiem i inhibitor punktu kontroli immunologicznej
KR102950141B1 (ko) 2018-08-24 2026-04-07 트랜슬레이트 바이오 인코포레이티드 전령 rna의 정제 방법
WO2020056323A1 (en) * 2018-09-13 2020-03-19 The Brigham And Women's Hospital, Inc. Nanoparticle formulations and methods of their use
WO2020061295A1 (en) 2018-09-19 2020-03-26 Modernatx, Inc. High-purity peg lipids and uses thereof
CA3113025A1 (en) 2018-09-19 2020-03-26 Modernatx, Inc. Peg lipids and uses thereof
TWI837189B (zh) 2018-10-01 2024-04-01 日商富士軟片股份有限公司 包含內含藥物之脂質體組成物及鉑製劑之組合醫藥
US12331320B2 (en) 2018-10-10 2025-06-17 The Research Foundation For The State University Of New York Genome edited cancer cell vaccines
WO2020106946A1 (en) 2018-11-21 2020-05-28 Translate Bio, Inc. TREATMENT OF CYSTIC FIBROSIS BY DELIVERY OF NEBULIZED mRNA ENCODING CFTR
CN113631764A (zh) * 2019-02-21 2021-11-09 斯特拉托斯基因公司 用于固态合成在单分子测序中使用的可扩展聚合物的方法、组合物和装置
CN113874502A (zh) 2019-03-11 2021-12-31 摩登纳特斯有限公司 补料分批体外转录方法
US20220195514A1 (en) * 2019-03-29 2022-06-23 The Broad Institute, Inc. Construct for continuous monitoring of live cells
EP4031662A1 (en) 2019-09-20 2022-07-27 Translate Bio, Inc. Mrna encoding engineered cftr
US20220098616A1 (en) * 2020-09-29 2022-03-31 NeuExcell Therapeutics Inc. ISL1 and LHX3 VECTOR
CA3203975A1 (en) 2020-12-03 2022-06-09 Battelle Memorial Institute Polymer nanoparticle and dna nanostructure compositions and methods for non-viral delivery
EP4274607A1 (en) 2021-01-11 2023-11-15 ModernaTX, Inc. Seasonal rna influenza virus vaccines
CA3216359A1 (en) 2021-04-07 2022-10-13 Battelle Memorial Institute Rapid design, build, test, and learn technologies for identifying and using non-viral carriers
US20220363937A1 (en) 2021-05-14 2022-11-17 Armstrong World Industries, Inc. Stabilization of antimicrobial coatings
CN114569628A (zh) * 2022-03-11 2022-06-03 四川大学 Dna四面体框架纳米核酸在美容中的用途
WO2023183466A1 (en) * 2022-03-24 2023-09-28 The Regents Of The University Of California Hydrogel formulations for vlp therapeutics
AU2024353375A1 (en) 2023-09-29 2026-04-09 Battelle Memorial Institute Polymer nanoparticle compositions for in vivo expression of polypeptides
WO2025122954A1 (en) 2023-12-08 2025-06-12 Battelle Memorial Institute Use of dna origami nanostructures for molecular information based data storage systems

Citations (459)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US845948A (en) 1906-11-22 1907-03-05 Raymond A Hall Soldering compound.
US2103001A (en) 1933-08-28 1937-12-21 E S Evans And Sons Windshield wiper mechanism
US4587044A (en) 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US4605735A (en) 1983-02-14 1986-08-12 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4667025A (en) 1982-08-09 1987-05-19 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4762779A (en) 1985-06-13 1988-08-09 Amgen Inc. Compositions and methods for functionalizing nucleic acids
US4824941A (en) 1983-03-10 1989-04-25 Julian Gordon Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems
US4828979A (en) 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
US4835263A (en) 1983-01-27 1989-05-30 Centre National De La Recherche Scientifique Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use
US4876335A (en) 1986-06-30 1989-10-24 Wakunaga Seiyaku Kabushiki Kaisha Poly-labelled oligonucleotide derivative
US4904582A (en) 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US4948882A (en) 1983-02-22 1990-08-14 Syngene, Inc. Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis
US4958013A (en) 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
US4966891A (en) 1987-11-17 1990-10-30 Hoffmann-La Roche Inc. Fluorocytidine derivatives
US4981957A (en) 1984-07-19 1991-01-01 Centre National De La Recherche Scientifique Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5082830A (en) 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
US5109124A (en) 1988-06-01 1992-04-28 Biogen, Inc. Nucleic acid probe linked to a label having a terminal cysteine
US5112963A (en) 1987-11-12 1992-05-12 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Modified oligonucleotides
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US5118802A (en) 1983-12-20 1992-06-02 California Institute Of Technology DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
US5138045A (en) 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5208020A (en) 1989-10-25 1993-05-04 Immunogen Inc. Cytotoxic agents comprising maytansinoids and their therapeutic use
US5214136A (en) 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5218105A (en) 1990-07-27 1993-06-08 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5245022A (en) 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
US5254469A (en) 1989-09-12 1993-10-19 Eastman Kodak Company Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures
US5258506A (en) 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US5262536A (en) 1988-09-15 1993-11-16 E. I. Du Pont De Nemours And Company Reagents for the preparation of 5'-tagged oligonucleotides
US5272250A (en) 1992-07-10 1993-12-21 Spielvogel Bernard F Boronated phosphoramidate compounds
US5292873A (en) 1989-11-29 1994-03-08 The Research Foundation Of State University Of New York Nucleic acids labeled with naphthoquinone probe
US5317098A (en) 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
US5319080A (en) 1991-10-17 1994-06-07 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5371241A (en) 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
US5391723A (en) 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US5414077A (en) 1990-02-20 1995-05-09 Gilead Sciences Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods
US5446137A (en) 1993-12-09 1995-08-29 Syntex (U.S.A.) Inc. Oligonucleotides containing 4'-substituted nucleotides
US5451463A (en) 1989-08-28 1995-09-19 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
US5466786A (en) 1989-10-24 1995-11-14 Gilead Sciences 2'modified nucleoside and nucleotide compounds
US5475092A (en) 1992-03-25 1995-12-12 Immunogen Inc. Cell binding agent conjugates of analogues and derivatives of CC-1065
US5486603A (en) 1990-01-08 1996-01-23 Gilead Sciences, Inc. Oligonucleotide having enhanced binding affinity
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5505931A (en) 1993-03-04 1996-04-09 The Dow Chemical Company Acid cleavable compounds, their preparation and use as bifunctional acid-labile crosslinking agents
US5510475A (en) 1990-11-08 1996-04-23 Hybridon, Inc. Oligonucleotide multiple reporter precursors
US5512667A (en) 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US5512439A (en) 1988-11-21 1996-04-30 Dynal As Oligonucleotide-linked magnetic particles and uses thereof
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5525465A (en) 1987-10-28 1996-06-11 Howard Florey Institute Of Experimental Physiology And Medicine Oligonucleotide-polyamide conjugates and methods of production and applications of the same
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5545730A (en) 1984-10-16 1996-08-13 Chiron Corporation Multifunctional nucleic acid monomer
EP0735144A1 (en) 1995-03-28 1996-10-02 Research Development Corporation Of Japan Method for molecular indexing categorising of expressed genes using restriction enzymes
US5563250A (en) 1987-12-02 1996-10-08 Neorx Corporation Cleavable conjugates for the delivery and release of agents in native form
US5565552A (en) 1992-01-21 1996-10-15 Pharmacyclics, Inc. Method of expanded porphyrin-oligonucleotide conjugate synthesis
US5567811A (en) 1990-05-03 1996-10-22 Amersham International Plc Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
US5574142A (en) 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
US5576427A (en) 1993-03-30 1996-11-19 Sterling Winthrop, Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
US5578718A (en) 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5580731A (en) 1994-08-25 1996-12-03 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
US5585108A (en) 1994-12-30 1996-12-17 Nanosystems L.L.C. Formulations of oral gastrointestinal therapeutic agents in combination with pharmaceutically acceptable clays
US5587371A (en) 1992-01-21 1996-12-24 Pharmacyclics, Inc. Texaphyrin-oligonucleotide conjugates
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5595726A (en) 1992-01-21 1997-01-21 Pharmacyclics, Inc. Chromophore probe for detection of nucleic acid
US5597696A (en) 1994-07-18 1997-01-28 Becton Dickinson And Company Covalent cyanine dye oligonucleotide conjugates
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5599928A (en) 1994-02-15 1997-02-04 Pharmacyclics, Inc. Texaphyrin compounds having improved functionalization
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5610300A (en) 1992-07-01 1997-03-11 Ciba-Geigy Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5637459A (en) * 1990-06-11 1997-06-10 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: chimeric selex
US5639873A (en) 1992-02-05 1997-06-17 Centre National De La Recherche Scientifique (Cnrs) Oligothionucleotides
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5658873A (en) 1993-04-10 1997-08-19 Degussa Aktiengesellschaft Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them
WO1997030064A1 (en) 1996-02-16 1997-08-21 Stichting Rega Vzw Hexitol containing oligonucleotides and their use in antisense strategies
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5688941A (en) 1990-07-27 1997-11-18 Isis Pharmaceuticals, Inc. Methods of making conjugated 4' desmethyl nucleoside analog compounds
US5714331A (en) 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5719262A (en) 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5889136A (en) 1995-06-09 1999-03-30 The Regents Of The University Of Colorado Orthoester protecting groups in RNA synthesis
US6004573A (en) 1997-10-03 1999-12-21 Macromed, Inc. Biodegradable low molecular weight triblock poly(lactide-co-glycolide) polyethylene glycol copolymers having reverse thermal gelation properties
WO2000050032A1 (en) 1999-02-25 2000-08-31 Pharmacia & Upjohn S.P.A. Antitumour synergistic composition
US6177274B1 (en) 1998-05-20 2001-01-23 Expression Genetics, Inc. Hepatocyte targeting polyethylene glyco-grafted poly-L-lysine polymeric gene carrier
US6190315B1 (en) 1998-01-08 2001-02-20 Sontra Medical, Inc. Sonophoretic enhanced transdermal transport
US6217912B1 (en) 1998-07-13 2001-04-17 Expression Genetics, Inc. Polyester analogue of poly-L-lysine as a soluble, biodegradable gene delivery carrier
US6234990B1 (en) 1996-06-28 2001-05-22 Sontra Medical, Inc. Ultrasound enhancement of transdermal transport
US6258558B1 (en) 1997-01-21 2001-07-10 The General Hospital Corporation Method for selection of proteins using RNA-protein fusions
US6265389B1 (en) 1995-08-31 2001-07-24 Alkermes Controlled Therapeutics, Inc. Microencapsulation and sustained release of oligonucleotides
US6268490B1 (en) 1997-03-07 2001-07-31 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogues
US6267987B1 (en) 1997-12-12 2001-07-31 Samyang Corporation Positively charged poly[alpha-(omega-aminoalkyl) glycolic acid] for the delivery of a bioactive agent via tissue and cellular uptake
US20010014753A1 (en) 1999-12-20 2001-08-16 Soloveichik Grigorii Lev Catalyst composition and method for producing diaryl carbonates, using bisphosphines
US6294664B1 (en) 1993-07-29 2001-09-25 Isis Pharmaceuticals, Inc. Synthesis of oligonucleotides
US6320017B1 (en) 1997-12-23 2001-11-20 Inex Pharmaceuticals Corp. Polyamide oligomers
US6368801B1 (en) 2000-04-12 2002-04-09 Molecular Staging, Inc. Detection and amplification of RNA using target-mediated ligation of DNA by RNA ligase
US6426086B1 (en) 1998-02-03 2002-07-30 The Regents Of The University Of California pH-sensitive, serum-stable liposomes
WO2002098443A2 (de) 2001-06-05 2002-12-12 Curevac Gmbh Stabilisierte mrna mit erhöhtem g/ c- gehalt und otimierter codon usage für die gentherapie
US6517869B1 (en) 1997-12-12 2003-02-11 Expression Genetics, Inc. Positively charged poly(alpha-(omega-aminoalkyl)lycolic acid) for the delivery of a bioactive agent via tissue and cellular uptake
US6525183B2 (en) 1999-02-22 2003-02-25 Pe Corporation (Ny) Multiple-labelled oligonucleotides synthesized on solid-supports
US20030073619A1 (en) 2000-09-14 2003-04-17 Mahato Ram I. Novel cationic lipopolymer as biocompatible gene delivery agent
US6576752B1 (en) 1997-02-14 2003-06-10 Isis Pharmaceuticals, Inc. Aminooxy functionalized oligomers
WO2003051401A2 (de) 2001-12-19 2003-06-26 Curevac Gmbh Stabilisierte mrna tumor-vakzine
US6586524B2 (en) 2001-07-19 2003-07-01 Expression Genetics, Inc. Cellular targeting poly(ethylene glycol)-grafted polymeric gene carrier
US6617106B1 (en) 1990-10-09 2003-09-09 Steven Albert Benner Methods for preparing oligonucleotides containing non-standard nucleotides
US6653468B1 (en) 2002-07-31 2003-11-25 Isis Pharmaceuticals, Inc. Universal support media for synthesis of oligomeric compounds
US6652886B2 (en) 2001-02-16 2003-11-25 Expression Genetics Biodegradable cationic copolymers of poly (alkylenimine) and poly (ethylene glycol) for the delivery of bioactive agents
US6670461B1 (en) 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
WO2004041203A2 (en) 2002-11-04 2004-05-21 Xenoport, Inc. Gemcitabine prodrugs, pharmaceutical compositions and uses thereof
US20040142474A1 (en) 2000-09-14 2004-07-22 Expression Genetics, Inc. Novel cationic lipopolymer as a biocompatible gene delivery agent
US6783931B1 (en) 1990-01-11 2004-08-31 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US20040171980A1 (en) 1998-12-18 2004-09-02 Sontra Medical, Inc. Method and apparatus for enhancement of transdermal transport
US20040236268A1 (en) 1998-01-08 2004-11-25 Sontra Medical, Inc. Method and apparatus for enhancement of transdermal transport
US6835393B2 (en) 1998-01-05 2004-12-28 University Of Washington Enhanced transport using membrane disruptive agents
US20040262223A1 (en) 2001-07-27 2004-12-30 President And Fellows Of Harvard College Laminar mixing apparatus and methods
WO2005005622A2 (en) 2003-07-09 2005-01-20 Ribostem Limited Method of altering cell properties by administering rna
US20050059005A1 (en) 2001-09-28 2005-03-17 Thomas Tuschl Microrna molecules
US6897196B1 (en) 2001-02-07 2005-05-24 The Regents Of The University Of California pH sensitive lipids based on ortho ester linkers, composition and method
US20050130201A1 (en) 2003-10-14 2005-06-16 Dharmacon, Inc. Splint-assisted enzymatic synthesis of polyribounucleotides
US20050222064A1 (en) 2002-02-20 2005-10-06 Sirna Therapeutics, Inc. Polycationic compositions for cellular delivery of polynucleotides
US20050261218A1 (en) 2003-07-31 2005-11-24 Christine Esau Oligomeric compounds and compositions for use in modulation small non-coding RNAs
US6998484B2 (en) 2000-10-04 2006-02-14 Santaris Pharma A/S Synthesis of purine locked nucleic acid analogues
US7037646B1 (en) 1990-01-11 2006-05-02 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US7053207B2 (en) 1999-05-04 2006-05-30 Exiqon A/S L-ribo-LNA analogues
WO2006063249A2 (en) 2004-12-10 2006-06-15 Justin Hanes Functionalized poly (ether-anhydride) block copolymers
US7074596B2 (en) 2002-03-25 2006-07-11 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Synthesis and use of anti-reverse mRNA cap analogues
US7084125B2 (en) 1999-03-18 2006-08-01 Exiqon A/S Xylo-LNA analogues
US7098032B2 (en) 2001-01-02 2006-08-29 Mirus Bio Corporation Compositions and methods for drug delivery using pH sensitive molecules
US7138382B2 (en) 1999-06-07 2006-11-21 Mirus Bio Corporation Compositions and methods for drug delivery using pH sensitive molecules
WO2006122828A2 (de) 2005-05-19 2006-11-23 Curevac Gmbh Optimierte injektionsformulierung für mrna
WO2007024708A2 (en) 2005-08-23 2007-03-01 The Trustees Of The University Of Pennsylvania Rna containing modified nucleosides and methods of use thereof
WO2007024323A2 (en) 2005-06-17 2007-03-01 The University Of North Carolina At Chapel Hill Nanoparticle fabrication methods, systems, and materials
DE102005046490A1 (de) 2005-09-28 2007-03-29 Johannes-Gutenberg-Universität Mainz Modifikationen von RNA, die zu einer erhöhten Transkriptstabilität und Translationseffizienz führen
US20070117112A1 (en) 2005-06-30 2007-05-24 Diener John L Materials and methods for the generation of fully 2'-modified nucleic acid transcripts
WO2007064952A2 (en) 2005-12-02 2007-06-07 University Of Rochester TARGETED PRE-mRNA/mRNA MODIFICATION AND GENE REGULATION
WO2008052770A2 (en) 2006-10-31 2008-05-08 Curevac Gmbh (base-)modified rna for increasing the expression of a protein
US7374930B2 (en) 2002-05-21 2008-05-20 Expression Genetics, Inc. GLP-1 gene delivery for the treatment of type 2 diabetes
US20080119645A1 (en) 2004-05-05 2008-05-22 Isis Pharmaceuticals, Inc. Amidites and Methods of Rna Synthesis
US7378262B2 (en) 2001-12-03 2008-05-27 Roche Molecular Systems, Inc. Reversibly modified thermostable enzymes for DNA synthesis and amplification in vitro
US7385034B2 (en) 1998-12-22 2008-06-10 Serono Genetics Institute S.A. Complementary DNAs encoding proteins with signal peptides
US7384739B2 (en) 2001-11-14 2008-06-10 Toyo Boseki Kabushiki Kaisha Compositions for enhancing DNA synthesis, DNA polymerase-related factors and utilization thereof
WO2008078180A2 (en) 2006-12-22 2008-07-03 Archemix Corp. Materials and methods for the generation of transcripts comprising modified nucleotides
US20080166414A1 (en) 2004-01-28 2008-07-10 Johns Hopkins University Drugs And Gene Carrier Particles That Rapidly Move Through Mucous Barriers
US7399845B2 (en) 2006-01-27 2008-07-15 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
WO2008083949A2 (en) 2007-01-09 2008-07-17 Curevac Gmbh Rna-coded antibody
US7404969B2 (en) 2005-02-14 2008-07-29 Sirna Therapeutics, Inc. Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules
US7413875B2 (en) 1999-08-05 2008-08-19 Serono Genetics Institute S.A. ESTs and encoded human proteins
WO2008103276A2 (en) 2007-02-16 2008-08-28 Merck & Co., Inc. Compositions and methods for potentiated activity of biologicaly active molecules
WO2008121949A1 (en) 2007-03-30 2008-10-09 Bind Biosciences, Inc. Cancer cell targeting using nanoparticles
US20080261905A1 (en) 2004-11-08 2008-10-23 K.U. Leuven Research And Development Modified Nucleosides for Rna Interference
US20080275468A1 (en) 2007-04-27 2008-11-06 Echo Therapeutics, Inc. Skin permeation device for analyte sensing or transdermal drug delivery
WO2008140615A2 (en) 2006-12-21 2008-11-20 Novozymes, Inc. Modified messenger rna stabilizing sequences for expressing genes in bacterial cells
WO2008157668A2 (en) 2007-06-21 2008-12-24 American Power Conversion Corporation Method and system for determining physical location of network equipment
US7476709B2 (en) 2002-04-26 2009-01-13 Avecia Biotechnology Inc. Process for preparing oligonucleotides
US20090042829A1 (en) 2007-08-06 2009-02-12 Majed Matar Nucleic Acid-Lipopolymer Compositions
US7550264B2 (en) 2005-06-10 2009-06-23 Datascope Investment Corporation Methods and kits for sense RNA synthesis
WO2009077134A2 (en) 2007-12-14 2009-06-25 Johannes Gutenberg-Universität Mainz Use of rna for reprogramming somatic cells
US20090170090A1 (en) 2005-11-18 2009-07-02 Bioline Limited Method for Enhancing Enzymatic DNA Polymerase Reactions
US20090226470A1 (en) 2007-12-11 2009-09-10 Mauro Vincent P Compositions and methods related to mRNA translational enhancer elements
WO2009127230A1 (en) 2008-04-16 2009-10-22 Curevac Gmbh MODIFIED (m)RNA FOR SUPPRESSING OR AVOIDING AN IMMUNOSTIMULATORY RESPONSE AND IMMUNOSUPPRESSIVE COMPOSITION
WO2009149253A2 (en) 2008-06-06 2009-12-10 Uniwersytet Warszawski Mrna cap analogs
US20100004315A1 (en) 2008-03-14 2010-01-07 Gregory Slobodkin Biodegradable Cross-Linked Branched Poly(Alkylene Imines)
US20100004313A1 (en) 2008-02-29 2010-01-07 Tbd Modified Poloxamers for Gene Expression and Associated Methods
WO2010005726A2 (en) 2008-06-16 2010-01-14 Bind Biosciences Inc. Therapeutic polymeric nanoparticles with mtor inhibitors and methods of making and using same
WO2010005721A2 (en) 2008-06-16 2010-01-14 Bind Biosciences, Inc. Drug loaded polymeric nanoparticles and methods of making and using same
US20100009424A1 (en) 2008-07-14 2010-01-14 Natasha Forde Sonoporation systems and methods
WO2010005740A2 (en) 2008-06-16 2010-01-14 Bind Biosciences, Inc. Methods for the preparation of targeting agent functionalized diblock copolymers for use in fabrication of therapeutic targeted nanoparticles
US20100009865A1 (en) 2006-09-29 2010-01-14 Katholieke Universiteit Leuven Oligonucleotide arrays
WO2010005725A2 (en) 2008-06-16 2010-01-14 Bind Biosciences, Inc. Therapeutic polymeric nanoparticles comprising vinca alkaloids and methods of making and using same
US20100036115A1 (en) 1997-07-23 2010-02-11 Sirna Therapeutics, Inc. Novel Compositions for the Delivery of Negatively Charged Molecules
US7667033B2 (en) 2002-09-27 2010-02-23 Syngen, Inc. Compositions and methods for the use of FMOC derivatives in DNA/RNA synthesis
WO2010021865A1 (en) 2008-08-18 2010-02-25 Merck Sharp & Dohme Corp. Novel lipid nanoparticles and novel components for delivery of nucleic acids
WO2010030763A2 (en) 2008-09-10 2010-03-18 Bind Biosciences, Inc. High throughput fabrication of nanoparticles
US20100075072A1 (en) 2008-09-25 2010-03-25 Tsung-Wei Chen Decorative structure of tree-shaped bells
WO2010047839A1 (en) 2008-10-25 2010-04-29 Aura Biosciences Modified plant virus particles and uses therefor
US20100120024A1 (en) 2005-06-30 2010-05-13 Sharon Cload Materials and methods for the generation of transcripts comprising modified nucleotides
US7737108B1 (en) 2000-01-07 2010-06-15 University Of Washington Enhanced transport using membrane disruptive agents
WO2010080724A1 (en) 2009-01-12 2010-07-15 Merck Sharp & Dohme Corp. Novel lipid nanoparticles and novel components for delivery of nucleic acids
WO2010087791A1 (en) 2009-01-27 2010-08-05 Utc Power Corporation Distributively cooled, integrated water-gas shift reactor and vaporizer
US20100196983A1 (en) 2009-02-05 2010-08-05 Ut-Battelle, Llc Transformation of gram positive bacteria by sonoporation
US20100215580A1 (en) 2006-09-08 2010-08-26 The Johns Hopkins University Compositions and methods for enhancing transport through mucus
US20100216804A1 (en) 2008-12-15 2010-08-26 Zale Stephen E Long Circulating Nanoparticles for Sustained Release of Therapeutic Agents
US20100255574A1 (en) 1999-03-12 2010-10-07 Human Genome Sciences, Inc. Human Secreted Proteins
US20100260817A1 (en) 2009-03-20 2010-10-14 Egen, Inc. Polyamine Derivatives
WO2010120266A1 (en) 2009-04-13 2010-10-21 Inserm, Institut National De La Sante Et De La Recherche Medicale Hpv particles and uses thereof
WO2010123569A2 (en) 2009-04-21 2010-10-28 Selecta Biosciences, Inc. Immunonanotherapeutics providing a th1-biased response
WO2010129709A1 (en) 2009-05-05 2010-11-11 Alnylam Pharmaceuticals, Inc. Lipid compositions
US7833992B2 (en) 2001-05-18 2010-11-16 Merck Sharpe & Dohme Conjugates and compositions for cellular delivery
US20100293625A1 (en) 2007-09-26 2010-11-18 Interexon Corporation Synthetic 5'UTRs, Expression Vectors, and Methods for Increasing Transgene Expression
WO2010138192A2 (en) 2009-05-27 2010-12-02 Selecta Biosciences, Inc. Nanocarriers possessing components with different rates of release
US20100324120A1 (en) 2009-06-10 2010-12-23 Jianxin Chen Lipid formulation
WO2011012316A2 (de) 2009-07-31 2011-02-03 Ludwig-Maximilians-Universität Rna mit einer kombination aus unmodifizierten und modifizierten nucleotiden zur proteinexpression
WO2011013062A1 (en) 2009-07-30 2011-02-03 Koninklijke Philips Electronics N.V. Distributed image retargeting
WO2011015312A1 (en) 2009-08-01 2011-02-10 Roche Diagnostics Gmbh Improved detection of bacterial (mollicutes) contamination
WO2011014973A2 (en) 2009-08-05 2011-02-10 Polyphor Ag Conformationally constrained, fully synthetic macrocyclic compounds
US7893302B2 (en) 2005-02-14 2011-02-22 Sirna Therapeutics, Inc. Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules
WO2011022460A1 (en) 2009-08-20 2011-02-24 Merck Sharp & Dohme Corp. Novel cationic lipids with various head groups for oligonucleotide delivery
US7906490B2 (en) 1993-04-15 2011-03-15 University Of Rochester Circular DNA vectors for synthesis of RNA and DNA
WO2011043913A2 (en) 2009-10-08 2011-04-14 Merck Sharp & Dohme Corp. Novel cationic lipids with short lipid chains for oligonucleotide delivery
WO2011062965A2 (en) 2009-11-18 2011-05-26 University Of Washington Through Its Center For Commercialization Targeting monomers and polymers having targeting blocks
US20110143436A1 (en) 2009-12-07 2011-06-16 Gary Dahl Compositions and methods for reprogramming eukaryotic cells
US20110143397A1 (en) 2005-08-23 2011-06-16 Katalin Kariko Rna preparations comprising purified modified rna for reprogramming cells
WO2011072218A2 (en) 2009-12-11 2011-06-16 Bind Biosciences Stable formulations for lyophilizing therapeutic particles
US7964578B2 (en) 2001-05-18 2011-06-21 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US7964571B2 (en) 2004-12-09 2011-06-21 Egen, Inc. Combination of immuno gene therapy and chemotherapy for treatment of cancer and hyperproliferative diseases
WO2011076807A2 (en) 2009-12-23 2011-06-30 Novartis Ag Lipids, lipid compositions, and methods of using them
WO2011084521A2 (en) 2009-12-15 2011-07-14 Bind Biosciences, Inc. Therapeutic polymeric nanoparticles comprising epothilone and methods of making and using same
US20110171248A1 (en) 2010-01-08 2011-07-14 Selecta Biosciences, Inc. Synthetic virus-like particles conjugated to human papillomavirus capsid peptides for use as vaccines
WO2011084518A2 (en) 2009-12-15 2011-07-14 Bind Biosciences, Inc. Therapeutic polymeric nanoparticles comprising corticosteroids and methods of making and using same
WO2011084513A2 (en) 2009-12-15 2011-07-14 Bind Biosciences, Inc. Therapeutic polymeric nanoparticle compositions with high glass transition temperature or high molecular weight copolymers
WO2011090965A1 (en) 2010-01-22 2011-07-28 Merck Sharp & Dohme Corp. Novel cationic lipids for oligonucleotide delivery
US7994304B2 (en) 2005-11-22 2011-08-09 Helicos Biosciences Corporation Methods and compositions for sequencing a nucleic acid
US7999087B2 (en) 2006-11-15 2011-08-16 Agilent Technologies, Inc. 2′-silyl containing thiocarbonate protecting groups for RNA synthesis
WO2011115862A1 (en) 2010-03-18 2011-09-22 Merck Sharp & Dohme Corp. Endosomolytic poly(amidoamine) disulfide polymers for the delivery of oligonucleotides
WO2011120053A1 (en) 2010-03-26 2011-09-29 Mersana Therapeutics, Inc. Modified polymers for delivery of polynucleotides, method of manufacture, and methods of use thereof
US20110244026A1 (en) 2009-12-01 2011-10-06 Braydon Charles Guild Delivery of mrna for the augmentation of proteins and enzymes in human genetic diseases
WO2011127255A1 (en) 2010-04-08 2011-10-13 Merck Sharp & Dohme Corp. Preparation of lipid nanoparticles
US8039214B2 (en) 2007-06-29 2011-10-18 Cellscript, Inc. Synthesis of tagged nucleic acids
US20110262491A1 (en) 2010-04-12 2011-10-27 Selecta Biosciences, Inc. Emulsions and methods of making nanocarriers
US20110275793A1 (en) 2008-05-29 2011-11-10 Debart Francoise Chemical RNA Synthesis Method
US8057821B2 (en) 2004-11-03 2011-11-15 Egen, Inc. Biodegradable cross-linked cationic multi-block copolymers for gene delivery and methods of making thereof
WO2011150249A1 (en) 2010-05-26 2011-12-01 Selecta Biosciences, Inc. Multivalent synthetic nanocarrier vaccines
WO2012001875A1 (en) 2010-07-01 2012-01-05 Canon Kabushiki Kaisha Image forming apparatus
WO2012002629A1 (ko) 2010-07-02 2012-01-05 연세대학교 산학협력단 발광다이오드 모듈
WO2012006378A1 (en) 2010-07-06 2012-01-12 Novartis Ag Liposomes with lipids having an advantageous pka- value for rna delivery
WO2012006376A2 (en) 2010-07-06 2012-01-12 Novartis Ag Virion-like delivery particles for self-replicating rna molecules
WO2012006380A2 (en) 2010-07-06 2012-01-12 Novartis Ag Cationic oil-in-water emulsions
US20120024422A1 (en) 2009-03-12 2012-02-02 Illinois Tool Works Inc. Mis-fuel inhibitor
WO2012013501A1 (de) 2010-07-29 2012-02-02 Fujitsu Technology Solutions Intellectual Property Gmbh Computersystem, verfahren zum programmieren einer echtzeituhr und computerprogrammprodukt
WO2012013326A1 (en) 2010-07-30 2012-02-02 Curevac Gmbh Complexation of nucleic acids with disulfide-crosslinked cationic components for transfection and immunostimulation
US20120028342A1 (en) 2009-03-24 2012-02-02 Ismagilov Rustem F Slip chip device and methods
WO2012018881A2 (en) 2010-08-03 2012-02-09 Alnylam Pharmaceuticals, Inc. Methods and compositions for the regulation of rna
WO2012018718A1 (en) 2010-08-02 2012-02-09 Advanced Technologies And Regenerative Medicine, Llc Absorbable peg-based hydrogels
WO2012016269A1 (en) 2010-08-02 2012-02-09 Curtin University Of Technology Determining location of, and imaging, a subsurface boundary
US20120046346A1 (en) 2010-04-16 2012-02-23 Immune Disease Institute, Inc. Sustained polypeptide expression from synthetic, modified rnas and uses thereof
WO2012022512A1 (en) 2010-08-18 2012-02-23 International Business Machines Corporation Solar cell and battery 3d integration
WO2012024632A2 (en) 2010-08-20 2012-02-23 Selecta Biosciences, Inc. Synthetic nanocarrier vaccines comprising peptides obtained or derived from human influenza a virus m2e
WO2012024526A2 (en) 2010-08-20 2012-02-23 Cerulean Pharma Inc. Conjugates, particles, compositions, and related methods
US8124379B2 (en) 2004-06-14 2012-02-28 Novozymes A/S Signal peptide for producing a polypeptide
WO2012030901A1 (en) 2010-08-31 2012-03-08 Novartis Ag Small liposomes for delivery of immunogen-encoding rna
WO2012030683A2 (en) 2010-08-31 2012-03-08 Merck Sharp & Dohme Corp. Novel single chemical entities and methods for delivery of oligonucleotides
WO2012031046A2 (en) 2010-08-31 2012-03-08 Novartis Ag Lipids suitable for liposomal delivery of protein-coding rna
WO2012031043A1 (en) 2010-08-31 2012-03-08 Novartis Ag Pegylated liposomes for delivery of immunogen-encoding rna
US20120060293A1 (en) 2009-05-18 2012-03-15 Amoena Medizin-Orthopädie-Technik GmbH Anti-decubitus cushion
US8137911B2 (en) 2001-05-22 2012-03-20 Cellscript, Inc. Preparation and use of single-stranded transcription substrates for synthesis of transcription products corresponding to target sequences
WO2012040184A2 (en) 2010-09-20 2012-03-29 Merck Sharp & Dohme Corp. Novel low molecular weight cationic lipids for oligonucleotide delivery
WO2012040623A2 (en) 2010-09-24 2012-03-29 The Brigham And Women's Hospital, Inc. Nanostructured gels capable of controlled release of encapsulated agents
WO2012040524A1 (en) 2010-09-24 2012-03-29 Mallinckrodt Llc Aptamer conjugates for targeting of therapeutic and/or diagnostic nanocarriers
US20120076836A1 (en) 2009-03-31 2012-03-29 The University Of Tokyo Polyion complex of double-stranded ribonucleic acid
WO2012044638A1 (en) 2010-09-30 2012-04-05 Merck Sharp & Dohme Corp. Low molecular weight cationic lipids for oligonucleotide delivery
WO2012049366A1 (en) 2010-10-14 2012-04-19 Timo Vesikari Norovirus capsid and rotavirus vp6 protein for use as combined vaccine
WO2012054365A2 (en) 2010-10-21 2012-04-26 Merck Sharp & Dohme Corp. Novel low molecular weight cationic lipids for oligonucleotide delivery
WO2012054923A2 (en) 2010-10-22 2012-04-26 Bind Biosciences, Inc. Therapeutic nanoparticles with high molecular weight copolymers
WO2012061259A2 (en) 2010-11-05 2012-05-10 Merck Sharp & Dohme Corp. Novel low molecular weight cyclic amine containing cationic lipids for oligonucleotide delivery
US20120121718A1 (en) 2010-11-05 2012-05-17 The Johns Hopkins University Compositions and methods relating to reduced mucoadhesion
WO2012068187A1 (en) 2010-11-19 2012-05-24 Merck Sharp & Dohme Corp. Poly(amide) polymers for the delivery of oligonucleotides
US8202983B2 (en) 2007-05-10 2012-06-19 Agilent Technologies, Inc. Thiocarbon-protecting groups for RNA synthesis
WO2012082574A1 (en) 2010-12-17 2012-06-21 Merck Sharp & Dohme Corp. Membrane lytic poly(amido amine) polymers for the delivery of oligonucleotides
WO2012082165A1 (en) 2010-01-24 2012-06-21 Novartis Ag Irradiated biodegradable polymer microparticles
US20120156679A1 (en) 2002-11-21 2012-06-21 Epicentre Technologies Methods for making transcription products
US8206749B1 (en) 1999-02-26 2012-06-26 Novartis Vaccines And Diagnostics, Inc. Microemulsions with adsorbed macromolecules and microparticles
US20120171229A1 (en) 2010-12-30 2012-07-05 Selecta Biosciences, Inc. Synthetic nanocarriers with reactive groups that release biologically active agents
US8217147B2 (en) 2005-08-10 2012-07-10 Macrogenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
WO2012094304A1 (en) 2011-01-04 2012-07-12 Brown University Nanotubes as carriers of nucleic acids into cells
US20120177724A1 (en) 2010-03-19 2012-07-12 Massachusetts Institute Of Technology Lipid vesicle compositions and methods of use
US20120178702A1 (en) 1995-01-23 2012-07-12 University Of Pittsburgh Stable lipid-comprising drug delivery complexes and methods for their production
WO2012095255A1 (de) 2011-01-13 2012-07-19 Evonik Oxeno Gmbh Verfahren zur aufreinigung von biphephos
WO2012099755A1 (en) 2011-01-11 2012-07-26 Alnylam Pharmaceuticals, Inc. Pegylated lipids and their use for drug delivery
US20120189700A1 (en) 2011-01-19 2012-07-26 Zoraida Aguilar Nanoparticle Based Immunological Stimulation
US8236280B2 (en) 2003-12-19 2012-08-07 University Of Cincinnati Polyamides for nucleic acid delivery
US20120201859A1 (en) 2002-05-02 2012-08-09 Carrasquillo Karen G Drug Delivery Systems and Use Thereof
US20120202871A1 (en) 2009-07-01 2012-08-09 Protiva Biotherapeutics, Inc. Cationic lipids and methods for the delivery of therapeutic agents
US8241670B2 (en) 2004-04-15 2012-08-14 Chiasma Inc. Compositions capable of facilitating penetration across a biological barrier
US8242258B2 (en) 2006-12-03 2012-08-14 Agilent Technologies, Inc. Protecting groups for RNA synthesis
US8241610B2 (en) 2003-07-09 2012-08-14 Statens Serum Institut Adjuvant combinations of liposomes and mycobacterial lipids for immunization compositions and vaccines
US20120207845A1 (en) 2005-01-04 2012-08-16 Hsing-Wen Sung Pharmaceutical composition of nanoparticles
US20120207840A1 (en) 2011-02-10 2012-08-16 Aura Biosciences, Inc. Virion Derived Protein Nanoparticles For Delivering Diagnostic Or Therapeutic Agents For The Treatment Of Non-Melanoma Skin Cancer
WO2012109121A1 (en) 2011-02-07 2012-08-16 Purdue Research Foundation Carbohydrate nanoparticles for prolonged efficacy of antimicrobial peptide
US8246995B2 (en) 2005-05-10 2012-08-21 The Board Of Trustees Of The Leland Stanford Junior University Hydrophobic nanotubes and nanoparticles as transporters for the delivery of drugs into cells
WO2012110636A2 (en) 2011-02-18 2012-08-23 Instituto Nacional De Investigación Y Tecnología Agraria Y Alimentaria (Inia) Carrier peptides for cell delivery
US8257685B2 (en) 2006-04-04 2012-09-04 Stc.Unm Swellable particles for drug delivery
US8257745B2 (en) 2001-12-21 2012-09-04 Novartis Ag Use of synthetic inorganic nanoparticles as carriers for ophthalmic and otic drugs
US8263665B2 (en) 2005-04-01 2012-09-11 Intezyne Technologies, Inc. Polymeric micelles for drug delivery
US20120228565A1 (en) 2000-10-13 2012-09-13 Life Technologies Corporation Method for preparing surface-modified semiconductive and metallic nanoparticles having enhanced dispersibility in aqueous media
US20120237565A1 (en) 2011-03-14 2012-09-20 Intezyne Technologies, Incorporated Pegylated polyplexes containing two or more different polymers for polynucleotide delivery
WO2012125987A2 (en) 2011-03-17 2012-09-20 Massachusetts Institute Of Technology Delivery system
US20120244222A1 (en) 2011-03-25 2012-09-27 Selecta Biosciences, Inc. Osmotic mediated release synthetic nanocarriers
WO2012131104A2 (en) 2011-03-31 2012-10-04 Ingell Technologies Holding B.V. Biodegradable compositions suitable for controlled release
WO2012131106A1 (en) 2011-03-31 2012-10-04 Ingell Technologies Holding B.V. Biodegradable compositions suitable for controlled release
WO2012129648A1 (en) 2011-03-25 2012-10-04 University Of Guelph Enhancing protein expression of adeno-associated virus vectors
US8283333B2 (en) 2009-07-01 2012-10-09 Protiva Biotherapeutics, Inc. Lipid formulations for nucleic acid delivery
US20120258176A1 (en) 2005-01-04 2012-10-11 Hsing-Wen Sung Nanoparticles for protein drug delivery
US8287910B2 (en) 2009-04-30 2012-10-16 Intezyne Technologies, Inc. Polymeric micelles for polynucleotide encapsulation
US8287849B2 (en) 2000-10-10 2012-10-16 Massachusetts Institute Of Technology Biodegradable poly(beta-amino esters) and uses thereof
US20120265001A1 (en) 2010-10-11 2012-10-18 Wichita State University Composite magnetic nanoparticle drug delivery system
US20120269761A1 (en) 2006-01-12 2012-10-25 Massachusetts Institute Of Technology Biodegradable elastomers
WO2012149259A1 (en) 2011-04-29 2012-11-01 Selecta Biosciences, Inc. Tolerogenic synthetic nanocarriers to reduce antibody responses
US20120276209A1 (en) 2009-11-04 2012-11-01 The University Of British Columbia Nucleic acid-containing lipid particles and related methods
WO2012148684A1 (en) 2011-04-27 2012-11-01 President And Fellows Of Harvard College Cell-friendly inverse opal hydrogels for cell encapsulation, drug and protein delivery, and functional nanoparticle encapsulation
US8304532B2 (en) 2002-07-31 2012-11-06 Girindus Ag Method for preparing oligonucleotides
US20120282343A1 (en) 2001-10-03 2012-11-08 Johns Hopkins University Compositions for oral gene therapy and methods of using same
WO2012150467A2 (en) 2011-05-04 2012-11-08 The University Of Nottingham Novel polymers which resist bacterial attachment
US20120283503A1 (en) 2011-04-29 2012-11-08 The Johns Hopkins University Nanoparticle loaded stem cells and their use in mri guided hyperthermia
US20120283427A1 (en) 2009-11-13 2012-11-08 Bend Research, Inc. Cationic dextran polymer derivatives
WO2012151438A1 (en) 2011-05-05 2012-11-08 Celacare Technologies, Llc Antimicrobial silver hydrogel composition for the treatment of burns and wounds
US8309706B2 (en) 1998-08-03 2012-11-13 Agilent Technologies, Inc. Methods of synthesizing oligonucleotides using carbonate protecting groups and alpha-effect nucleophile deprotection
US8309707B2 (en) 2008-09-06 2012-11-13 Chemgenes Corporation RNA synthesis-phosphoramidites for synthetic RNA in the reverse direction, and application in convenient introduction of ligands, chromophores and modifications of synthetic RNA at the 3′-end
US8313777B2 (en) 2006-10-05 2012-11-20 The Johns Hopkins University Water-dispersible oral, parenteral, and topical formulations for poorly water soluble drugs using smart polymeric nanoparticles
US20120295832A1 (en) 2011-05-17 2012-11-22 Arrowhead Research Corporation Novel Lipids and Compositions for Intracellular Delivery of Biologically Active Compounds
US20120302940A1 (en) 2011-05-26 2012-11-29 Jackson State University Popcorn Shape Gold Nanoparticle For Targeted Diagnosis, Photothermal Treatment and In-Situ Monitoring Therapy Response for Cancer and Multiple Drug Resistance Bacteria
WO2012166923A2 (en) 2011-05-31 2012-12-06 Bind Biosciences Drug loaded polymeric nanoparticles and methods of making and using same
WO2012170889A1 (en) 2011-06-08 2012-12-13 Shire Human Genetic Therapies, Inc. Cleavable lipids
WO2012170930A1 (en) 2011-06-08 2012-12-13 Shire Human Genetic Therapies, Inc Lipid nanoparticle compositions and methods for mrna delivery
US20120321719A1 (en) 2010-02-25 2012-12-20 The Johns Hopkins University Sustained Delivery of Therapeutic Agents to an Eye Compartment
WO2013001168A1 (en) 2011-06-30 2013-01-03 Ionphase Oy Halogen-free polymer blend
WO2013003343A2 (en) 2011-06-27 2013-01-03 Adelphi Technology, Inc. Neutron source for neutron capture therapy
WO2013001198A1 (fr) 2011-06-27 2013-01-03 E.Itec Cable pour systeme d'alimentation electrique
WO2013001166A1 (en) 2011-06-30 2013-01-03 Wärtsilä Finland Oy Method and arrangement for minimizing need for safety gases
WO2013006825A1 (en) 2011-07-06 2013-01-10 Novartis Ag Liposomes having useful n:p ratio for delivery of rna molecules
US20130012450A1 (en) 2011-07-10 2013-01-10 Aura Biosciences, Inc. Virion Derived Protein Nanoparticles For Delivering Diagnostic Or Therapeutic Agents For The Treatment Of Dermatology Related Genetic Diseases
WO2013009717A1 (en) 2011-07-10 2013-01-17 Elisabet De Los Pinos Virion derived protein nanoparticles for delivering diagnostic or therapeutic agents for the treatment of skin-related diseases
WO2013009736A2 (en) 2011-07-10 2013-01-17 President And Fellows Of Harvard College Compositions and methods for self-assembly of polymers with complementary macroscopic and microscopic scale units
WO2013007604A1 (de) 2011-07-08 2013-01-17 Bayer Intellectual Property Gmbh Verfahren zur herstellung von tetrazol-substituierten anthranilsäurediamid-derivaten durch umsetzung von pyrazolsäuren mit anthranilsäureestern
WO2013008825A1 (ja) 2011-07-11 2013-01-17 株式会社トクヤマ フォトクロミック硬化性組成物
WO2013012476A2 (en) 2011-07-21 2013-01-24 Arizona Chemical Company, Llc Branched polyether-polyamide block copolymers and methods of making and using the same
WO2013012226A2 (ko) 2011-07-18 2013-01-24 이화다이아몬드공업 주식회사 Cmp 패드 컨디셔너
WO2013012680A1 (en) 2011-07-15 2013-01-24 3M Innovative Properties Company An electrical connector
US8367328B2 (en) 1998-04-23 2013-02-05 Takara Bio Inc. Method for synthesizing DNA
WO2013019669A2 (en) 2011-07-29 2013-02-07 Selecta Biosciences, Inc. Synthetic nanocarriers that generate humoral and cytotoxic t lymphocyte (ctl) immune responses
US20130059360A1 (en) 2005-04-12 2013-03-07 Nektar Therapeutics Polymer-based compositions and conjugates of antimicrobial agents
WO2013032829A1 (en) 2011-08-26 2013-03-07 Arrowhead Research Corporation Poly(vinyl ester) polymers for in vivo nucleic acid delivery
US20130065942A1 (en) 2007-08-06 2013-03-14 Egen, Inc. Nucleic Acid-Lipopolymer Compositions
US20130064894A1 (en) 2011-08-31 2013-03-14 Protiva Biotherapeutics, Inc. Novel cationic lipids and methods of use thereof
US8399007B2 (en) 2006-12-05 2013-03-19 Landec Corporation Method for formulating a controlled-release pharmaceutical formulation
US20130071450A1 (en) 2010-03-18 2013-03-21 Covidien Lp Gels for transdermal delivery
US20130072709A1 (en) 2006-02-21 2013-03-21 Nektar Therapeutics Segmented Degradable Polymers and Conjugates Made Therefrom
US8404799B2 (en) 2010-03-26 2013-03-26 Cerulean Pharma Inc. Methods and systems for generating nanoparticles
US8404222B2 (en) 1996-09-26 2013-03-26 Nektar Therapeutics Soluble, degradable poly(ethylene glycol) derivatives for controllable release of bound molecules into solution
WO2013044219A1 (en) 2011-09-22 2013-03-28 Bind Biosciences Methods of treating cancers with therapeutic nanoparticles
WO2013049328A1 (en) 2011-09-27 2013-04-04 Alnylam Pharmaceuticals, Inc. Di-aliphatic substituted pegylated lipids
US8415325B2 (en) 2005-03-31 2013-04-09 University Of Delaware Cell-mediated delivery and targeted erosion of noncovalently crosslinked hydrogels
US8414927B2 (en) 2006-11-03 2013-04-09 Boston Scientific Scimed, Inc. Cross-linked polymer particles
WO2013052167A2 (en) 2011-06-02 2013-04-11 The Regents Of The University Of California Membrane encapsulated nanoparticles and method of use
US20130090372A1 (en) 2010-06-04 2013-04-11 Brian W. Budzik Novel Low Molecular Weight Cationic Lipids for Oligonucleotide Delivery
WO2013052523A1 (en) 2011-10-03 2013-04-11 modeRNA Therapeutics Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US8420605B2 (en) 2005-09-07 2013-04-16 The University Of Strathclyde Hydrogel compositions
WO2013055331A1 (en) 2011-10-12 2013-04-18 The Curators Of The University Of Missouri Pentablock polymers
WO2013055971A1 (en) 2011-10-11 2013-04-18 Arizona Board Of Regents For And On Behalf Of Arizona State University Polymers for delivering a substance into a cell
WO2013056132A2 (en) 2011-10-14 2013-04-18 Stc.Unm Porous nanoparticle-supported lipid bilayers (protocells) for targeted delivery including transdermal delivery of cargo and methods thereof
WO2013059496A1 (en) 2011-10-18 2013-04-25 Dicerna Pharmaceuticals, Inc. Amine cationic lipids and uses thereof
US20130102545A1 (en) 2009-12-16 2013-04-25 Magforce Ag Temperature dependent activation of catalytic nucleic acids for controlled active substance release
WO2013063468A1 (en) 2011-10-27 2013-05-02 Massachusetts Institute Of Technology Amino acid derivates functionalized on the n- terminal capable of forming drug incapsulating microspheres
WO2013059922A1 (en) 2011-10-25 2013-05-02 The University Of British Columbia Limit size lipid nanoparticles and related methods
WO2013063530A2 (en) 2011-10-28 2013-05-02 Presage Biosciences, Inc. Methods for drug delivery
US20130115247A1 (en) 2011-11-05 2013-05-09 Aura Biosciences, Inc. Virion Derived Protein Nanoparticles For Delivering Radioisotopes For The Diagnosis And Treatment Of Malignant And Systemic Disease And The Monitoring Of Therapy
US20130116408A1 (en) 2011-11-05 2013-05-09 Aura Biosciences, Inc. Virion Derived Protein Nanoparticles For Delivering Radioisotopes For The Diagnosis And Treatment Of Malignant And Systemic Disease And The Monitoring Of Therapy
US8440614B2 (en) 2000-12-29 2013-05-14 Aphios Corporation Polymer microspheres/nanospheres and encapsulating therapeutic proteins therein
US20130123338A1 (en) 2010-05-12 2013-05-16 Protiva Biotherapeutics, Inc. Novel cationic lipids and methods of use thereof
US8444992B2 (en) 2005-09-01 2013-05-21 Novartis Vaccines And Diagnostics Gmbh Multiple vaccination including serogroup C meningococcus
US20130130348A1 (en) 2006-05-15 2013-05-23 The Brigham And Women's Hospital, Inc. Polymers for Functional Particles
US20130129627A1 (en) 2009-10-22 2013-05-23 James B. Delehanty Delivery of Nanoparticles to Neurons
US20130129636A1 (en) 2009-11-20 2013-05-23 Imperial Innovations Limited Novel Liposome Nanoparticles for Tumor Magnetic Resonance Imaging
US20130129830A1 (en) 2011-11-18 2013-05-23 Regeneron Pharmaceuticals, Inc. Polymer Protein Microparticles
US20130129785A1 (en) 2010-05-10 2013-05-23 Alnylam Pharmaceuticals, Inc Methods and compositions for delivery of active agents
US20130129726A1 (en) 2006-02-20 2013-05-23 Kyunglim Lee Peptide having cell membrane penetrating activity
WO2013072929A2 (en) 2011-09-23 2013-05-23 Indian Institute Of Technology Nanop article based cosmetic composition
US8449916B1 (en) 2009-11-06 2013-05-28 Iowa State University Research Foundation, Inc. Antimicrobial compositions and methods
US8450298B2 (en) 2008-11-07 2013-05-28 Massachusetts Institute Of Technology Aminoalcohol lipidoids and uses thereof
US20130138032A1 (en) 2010-04-15 2013-05-30 Sungjee Kim ANTICANCER AGENT DELIVERY SYSTEM USING pH-SENSITIVE METAL NANOPARTICLES
US20130133483A1 (en) 2010-03-08 2013-05-30 University Of Rochester Synthesis of Nanoparticles Using Reducing Gases
US20130137644A1 (en) 2005-12-16 2013-05-30 Cellectis Cell penetrating peptide conjugates for delivering of nucleic acids into a cell
US8454946B2 (en) 2000-02-22 2013-06-04 Nektar Therapeutics N-maleimidyl polymer derivatives
WO2013082590A1 (en) 2011-12-02 2013-06-06 Invivo Therapeutics Corporation Peg based hydrogel for peripheral nerve injury applications and compositions and method of use of synthetic hydrogel sealants
WO2013082470A1 (en) 2011-12-02 2013-06-06 Pegasus Laboratories, Inc. Amphipathic lipid-based sustained release compositions
WO2013082111A2 (en) 2011-11-29 2013-06-06 The University Of North Carolina At Chapel Hill Geometrically engineered particles and methods for modulating macrophage or immune responses
WO2013082529A1 (en) 2011-12-02 2013-06-06 Yale University Enzymatic synthesis of poly(amine-co-esters) and methods of use thereof for gene delivery
US8460709B2 (en) 2002-03-13 2013-06-11 Novartis Ag Pharmaceutical microparticles
US8461132B2 (en) 2003-05-05 2013-06-11 Ben Gurion University Of The Negev Research And Development Authority Injectable cross-linked polymeric preparations and uses thereof
WO2013086322A1 (en) 2011-12-07 2013-06-13 Alnylam Pharmaceuticals, Inc. Branched alkyl and cycloalkyl terminated biodegradable lipids for the delivery of active agents
US20130150295A1 (en) 2006-12-21 2013-06-13 Stryker Corporation Sustained-Release Formulations Comprising Crystals, Macromolecular Gels, and Particulate Suspensions of Biologic Agents
WO2013084000A2 (en) 2011-12-07 2013-06-13 Isis Innovation Limited Exosomes for delivery of biotherapeutics
WO2013086526A1 (en) 2011-12-09 2013-06-13 The Regents Of The University Of California Liposomal drug encapsulation
WO2013086354A1 (en) 2011-12-07 2013-06-13 Alnylam Pharmaceuticals, Inc. Biodegradable lipids for the delivery of active agents
WO2013086373A1 (en) 2011-12-07 2013-06-13 Alnylam Pharmaceuticals, Inc. Lipids for the delivery of active agents
US20130149783A1 (en) 2010-03-16 2013-06-13 James William Yockman Cleavable modifications to reducible poly (amido ethylenimines)s to enhance nucleotide delivery
US20130149318A1 (en) 2011-12-13 2013-06-13 Invivo Therapeutics Corporation Painting the pia, arachnoid, and spinal cord parenchyma
US20130150625A1 (en) 2010-05-24 2013-06-13 Brian W. Budzik Novel Amino Alcohol Cationic Lipids for Oligonucleotide Delivery
US8466122B2 (en) 2010-09-17 2013-06-18 Protiva Biotherapeutics, Inc. Trialkyl cationic lipids and methods of use thereof
WO2013090861A1 (en) 2011-12-16 2013-06-20 Massachusetts Institute Of Technology Alpha-aminoamidine polymers and uses thereof
WO2013090601A2 (en) 2011-12-16 2013-06-20 Massachusetts Institute Of Technology Compact nanoparticles for biological applications
US20130156721A1 (en) 2002-09-06 2013-06-20 Cerulean Pharma Inc. Cyclodextrin-based polymers for therapeutics delivery
WO2013090648A1 (en) 2011-12-16 2013-06-20 modeRNA Therapeutics Modified nucleoside, nucleotide, and nucleic acid compositions
US20130156845A1 (en) 2010-04-29 2013-06-20 Alnylam Pharmaceuticals, Inc. Lipid formulated single stranded rna
US20130164219A1 (en) 2010-06-14 2013-06-27 Hoffmann-La Roche Inc. Cell-penetrating peptides and uses thereof
WO2013093648A2 (en) 2011-11-04 2013-06-27 Nitto Denko Corporation Method of producing lipid nanoparticles for drug delivery
WO2013091001A1 (en) 2011-12-19 2013-06-27 The University Of Sydney A peptide-hydrogel composite
US20130172600A1 (en) 2006-07-12 2013-07-04 Novartis Ag Novel Polymers
US20130171646A1 (en) 2010-08-09 2013-07-04 So Jung PARK Nanop article-oligonucleotide hybrid structures and methods of use thereof
US20130177637A1 (en) 2010-04-09 2013-07-11 Pacira Pharmaceuticals, Inc. Method for formulating large diameter synthetic membrane vesicles
US20130177499A1 (en) 2011-12-13 2013-07-11 Engenelc Molecular Delivery Pty Ltd Bacterially derived, intact minicells for delivery of therapeutic agents to brain tumors
WO2013103659A1 (en) 2012-01-04 2013-07-11 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Stabilizing rna by incorporating chain-terminating nucleosides at the 3'-terminus
US20130177587A1 (en) 2003-07-11 2013-07-11 Novavax, Inc. Functional influenza virus-like particles (vlps)
US20130177523A1 (en) 2010-07-13 2013-07-11 University Of Utah Research Foundation Gold particles and methods of making and using the same in cancer treatment
US20130177611A1 (en) 2004-06-11 2013-07-11 Eidgenossisches Technische Hochschule (The Swiss Federal Institute of Technology) Silk-based drug delivery system
WO2013106072A1 (en) 2012-01-10 2013-07-18 Sorbent Therapeutics, Inc. Compositions comprising crosslinked cation-binding polymers and uses thereof
WO2013106525A1 (en) 2012-01-12 2013-07-18 Stc.Unm Immunogenic hpv l2-containing vlps and related compositions and methods
WO2013106073A1 (en) 2012-01-10 2013-07-18 Sorbent Therapeutics, Inc. Compositions comprising crosslinked cation-binding polymers and uses thereof
US20130183718A1 (en) 2010-09-21 2013-07-18 RibpxX GmbH Method for Synthesizing RNA using DNA Template
WO2013105101A1 (en) 2012-01-13 2013-07-18 Department Of Biotechnology Solid lipid nanoparticles entrapping hydrophilic/ amphiphilic drug and a process for preparing the same
US20130184453A1 (en) 1998-07-01 2013-07-18 California Institute Of Technology Linear cyclodextrin copolymers
US20130183244A1 (en) 2010-09-10 2013-07-18 The Johns Hopkins University Rapid Diffusion of Large Polymeric Nanoparticles in the Mammalian Brain
WO2013106715A1 (en) 2012-01-13 2013-07-18 Allergan, Inc. Crosslinked hyaluronic acid-collagen gels for improving tissue graft viability and soft tissue augmentation
WO2013106086A1 (en) 2012-01-10 2013-07-18 Sorbent Therapeutics, Inc. Compositions comprising crosslinked cation-binding polymers and uses thereof
US20130184443A1 (en) 2005-06-16 2013-07-18 Nektar Therapeutics Methods for Preparing Conjugates
US8492359B2 (en) 2008-04-15 2013-07-23 Protiva Biotherapeutics, Inc. Lipid formulations for nucleic acid delivery
WO2013110028A1 (en) 2012-01-19 2013-07-25 The Johns Hopkins University Nanoparticle formulations with enhanced mucosal penetration
US20130189241A1 (en) 2007-12-10 2013-07-25 The Trustees Of The University Of Pennsylvania Regulated delivery systems for inner ear drug application and uses thereof
US8496945B2 (en) 2007-03-05 2013-07-30 Washington University Nanoparticle delivery systems for membrane-integrating peptides
US8497357B2 (en) 1998-01-07 2013-07-30 Nektar Therapeutics Degradable heterobifunctional poly(ethylene glycol) acrylates and gels and conjugates derived therefrom
US20130196948A1 (en) 2010-06-25 2013-08-01 Massachusetts Insitute Of Technology Polymers for biomaterials and therapeutics
US20130196915A1 (en) 2010-01-23 2013-08-01 Yong Wang Affinity hydrogels for controlled protein release
US20130195799A1 (en) 2010-08-19 2013-08-01 Peg Biosciences, Inc. Synergistic biomolecule-polymer conjugates
US20130197100A1 (en) 2010-06-15 2013-08-01 Instituto De Pesquisas Technologicas Do Estado De Sao Paulo Colloidal nanoscale carriers for active hydrophilic substances and method for producing same
US8501824B2 (en) 2007-05-04 2013-08-06 Marina Biotech, Inc. Amino acid lipids and uses thereof
US8501478B2 (en) 2006-06-15 2013-08-06 University Of Cincinnati Trehalose click polymers for delivery of biologically active molecules
EP2623121A1 (en) 2012-01-31 2013-08-07 Bayer Innovation GmbH Pharmaceutical composition comprising a polymeric carrier cargo complex and an antigen
WO2013113325A1 (en) 2012-01-31 2013-08-08 Curevac Gmbh Negatively charged nucleic acid comprising complexes for immunostimulation
WO2013113071A1 (en) 2012-02-03 2013-08-08 Commonwealth Scientific And Industrial Research Organisation Branched polymers
WO2013116126A1 (en) 2012-02-01 2013-08-08 Merck Sharp & Dohme Corp. Novel low molecular weight, biodegradable cationic lipids for oligonucleotide delivery
WO2013113501A1 (en) 2012-01-31 2013-08-08 Curevac Gmbh Pharmaceutical composition comprising a polymeric carrier cargo complex and at least one protein or pepide antigen
WO2013116656A1 (en) 2012-02-03 2013-08-08 Emory University Immunostimulatory compositions, particles, and uses related thereto
US8507653B2 (en) 2006-12-27 2013-08-13 Nektar Therapeutics Factor IX moiety-polymer conjugates having a releasable linkage
US8506967B2 (en) 2003-07-11 2013-08-13 Novavax, Inc. Functional influenza virus like particles (VLPs)
WO2013120052A1 (en) 2012-02-10 2013-08-15 E. I. Du Pont De Nemours And Company Preparation, purification and use of high-x diblock copolymers
WO2013119602A1 (en) 2012-02-06 2013-08-15 President And Fellows Of Harvard College Arrdc1-mediated microvesicles (armms) and uses thereof
US20130209544A1 (en) 2010-05-26 2013-08-15 Micromedmark Biotech Co., Ltd. Microvesicles carrying small interfering rnas, preparation methods and uses thereof
WO2013119936A2 (en) 2012-02-09 2013-08-15 Life Technologies Corporation Hydrophilic polymeric particles and methods for making same
US20130211249A1 (en) 2010-07-22 2013-08-15 The Johns Hopkins University Drug eluting hydrogels for catheter delivery
WO2013123125A1 (en) 2012-02-17 2013-08-22 President And Fellows Of Harvard College Assembly of nucleic acid sequences in emulsions
US20130217753A1 (en) 2011-02-22 2013-08-22 Rutgers, The State University Of New Jersey Amphiphilic macromolecules for nucleic acid delivery
WO2013123407A1 (en) 2012-02-17 2013-08-22 Celsion Corporation Thermosensitive nanoparticle formulations and method of making the same
US20130216607A1 (en) 2010-08-14 2013-08-22 The Regents Of The University Of California Zwitterionic lipids
WO2013122262A1 (en) 2012-02-16 2013-08-22 Vlp Therapeutics, Llc Virus like particle composition
WO2013123298A1 (en) 2012-02-17 2013-08-22 University Of Georgia Research Foundation, Inc. Nanoparticles for mitochondrial trafficking of agents
WO2013123491A1 (en) 2012-02-17 2013-08-22 Massachusetts Institute Of Technology Self-regulated peptide hydrogel for insulin delivery
WO2013123492A2 (en) 2012-02-17 2013-08-22 Massachusetts Institute Of Technology Glucose-responsive microgels for closed loop insulin delivery
US20130216612A1 (en) 2007-03-23 2013-08-22 Bbb Holding B.V. Targeted intracellular delivery of antiviral agents
WO2013123523A1 (en) 2012-02-19 2013-08-22 Nvigen, Inc. Uses of porous nanostructure in delivery
US8518907B2 (en) 2010-08-02 2013-08-27 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of catenin (cadherin-associated protein), beta 1 (CTNNB1) gene expression using short interfering nucleic acid (siNA)
WO2013124620A1 (en) 2012-02-22 2013-08-29 The University Of Manchester Method of making a hydrogel
WO2013124654A1 (en) 2012-02-20 2013-08-29 Cambridge Enterprise Limited Cucurbituril-based hydrogels
WO2013124855A1 (en) 2012-02-21 2013-08-29 Ben-Gurion University Of The Negev Research And Development Authority Hydrogel system comprising spatially separated bioactive polypeptides
WO2013124867A1 (en) 2012-02-21 2013-08-29 Amrita Vishwa Vidyapeetham University Polymer - polymer or polymer - protein core - shell nano medicine loaded with multiple drug molecules
US8524259B2 (en) 2006-12-05 2013-09-03 Landec Corporation Systems and methods for delivery of materials
US8524368B2 (en) 2003-07-09 2013-09-03 Wisconsin Alumni Research Foundation Charge-dynamic polymers and delivery of anionic compounds
US20130231287A1 (en) 2010-02-25 2013-09-05 Parimala Nacharaju Pegylated albumin polymers and uses thereof
WO2013151666A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of biologics and proteins associated with human disease
WO2013151668A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of secreted proteins
WO2014028429A2 (en) 2012-08-14 2014-02-20 Moderna Therapeutics, Inc. Enzymes and polymerases for the synthesis of rna

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3131222B2 (ja) * 1991-12-24 2001-01-31 アイシス・ファーマシューティカルス・インコーポレーテッド ギャップを有する2′修飾オリゴヌクレオチド
CA2512484A1 (en) * 2003-01-16 2004-05-08 Hybridon, Inc. Modulation of immunostimulatory properties of oligonucleotide-based compounds by utilizing modified immunostimulatory dinucleotides
WO2007089607A2 (en) * 2006-01-26 2007-08-09 University Of Massachusetts Rna silencing agents for use in therapy and nanotransporters for efficient delivery of same
JP2011130725A (ja) * 2009-12-25 2011-07-07 Contig I:Kk Lnaオリゴヌクレオチドとそれを含有する化粧品
CN104968354A (zh) * 2011-12-21 2015-10-07 现代治疗公司 增加器官或器官外植体的活力或寿命的方法

Patent Citations (620)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US845948A (en) 1906-11-22 1907-03-05 Raymond A Hall Soldering compound.
US2103001A (en) 1933-08-28 1937-12-21 E S Evans And Sons Windshield wiper mechanism
US4789737A (en) 1982-08-09 1988-12-06 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives and production thereof
US4667025A (en) 1982-08-09 1987-05-19 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4835263A (en) 1983-01-27 1989-05-30 Centre National De La Recherche Scientifique Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use
US4605735A (en) 1983-02-14 1986-08-12 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4948882A (en) 1983-02-22 1990-08-14 Syngene, Inc. Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis
US5541313A (en) 1983-02-22 1996-07-30 Molecular Biosystems, Inc. Single-stranded labelled oligonucleotides of preselected sequence
US4824941A (en) 1983-03-10 1989-04-25 Julian Gordon Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems
US4587044A (en) 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US5118802A (en) 1983-12-20 1992-06-02 California Institute Of Technology DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US4981957A (en) 1984-07-19 1991-01-01 Centre National De La Recherche Scientifique Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini
US5578717A (en) 1984-10-16 1996-11-26 Chiron Corporation Nucleotides for introducing selectably cleavable and/or abasic sites into oligonucleotides
US5258506A (en) 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US5545730A (en) 1984-10-16 1996-08-13 Chiron Corporation Multifunctional nucleic acid monomer
US5552538A (en) 1984-10-16 1996-09-03 Chiron Corporation Oligonucleotides with cleavable sites
US4828979A (en) 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US4762779A (en) 1985-06-13 1988-08-09 Amgen Inc. Compositions and methods for functionalizing nucleic acids
US5317098A (en) 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
US4876335A (en) 1986-06-30 1989-10-24 Wakunaga Seiyaku Kabushiki Kaisha Poly-labelled oligonucleotide derivative
US4904582A (en) 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
US5525465A (en) 1987-10-28 1996-06-11 Howard Florey Institute Of Experimental Physiology And Medicine Oligonucleotide-polyamide conjugates and methods of production and applications of the same
US5112963A (en) 1987-11-12 1992-05-12 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Modified oligonucleotides
US4966891A (en) 1987-11-17 1990-10-30 Hoffmann-La Roche Inc. Fluorocytidine derivatives
US5563250A (en) 1987-12-02 1996-10-08 Neorx Corporation Cleavable conjugates for the delivery and release of agents in native form
US5082830A (en) 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
US5109124A (en) 1988-06-01 1992-04-28 Biogen, Inc. Nucleic acid probe linked to a label having a terminal cysteine
US5262536A (en) 1988-09-15 1993-11-16 E. I. Du Pont De Nemours And Company Reagents for the preparation of 5'-tagged oligonucleotides
US5512439A (en) 1988-11-21 1996-04-30 Dynal As Oligonucleotide-linked magnetic particles and uses thereof
US5599923A (en) 1989-03-06 1997-02-04 Board Of Regents, University Of Tx Texaphyrin metal complexes having improved functionalization
US5391723A (en) 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US5416203A (en) 1989-06-06 1995-05-16 Northwestern University Steroid modified oligonucleotides
US4958013A (en) 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
US5451463A (en) 1989-08-28 1995-09-19 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
US5254469A (en) 1989-09-12 1993-10-19 Eastman Kodak Company Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5466786A (en) 1989-10-24 1995-11-14 Gilead Sciences 2'modified nucleoside and nucleotide compounds
US5466786B1 (en) 1989-10-24 1998-04-07 Gilead Sciences 2' Modified nucleoside and nucleotide compounds
US5208020A (en) 1989-10-25 1993-05-04 Immunogen Inc. Cytotoxic agents comprising maytansinoids and their therapeutic use
US5292873A (en) 1989-11-29 1994-03-08 The Research Foundation Of State University Of New York Nucleic acids labeled with naphthoquinone probe
US5486603A (en) 1990-01-08 1996-01-23 Gilead Sciences, Inc. Oligonucleotide having enhanced binding affinity
US7037646B1 (en) 1990-01-11 2006-05-02 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5578718A (en) 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US6783931B1 (en) 1990-01-11 2004-08-31 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US6900297B1 (en) 1990-01-11 2005-05-31 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US5214136A (en) 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5414077A (en) 1990-02-20 1995-05-09 Gilead Sciences Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods
US5567811A (en) 1990-05-03 1996-10-22 Amersham International Plc Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5637459A (en) * 1990-06-11 1997-06-10 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: chimeric selex
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5688941A (en) 1990-07-27 1997-11-18 Isis Pharmaceuticals, Inc. Methods of making conjugated 4' desmethyl nucleoside analog compounds
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5218105A (en) 1990-07-27 1993-06-08 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5138045A (en) 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5245022A (en) 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
US5567810A (en) 1990-08-03 1996-10-22 Sterling Drug, Inc. Nuclease resistant compounds
US5512667A (en) 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US6617106B1 (en) 1990-10-09 2003-09-09 Steven Albert Benner Methods for preparing oligonucleotides containing non-standard nucleotides
US5510475A (en) 1990-11-08 1996-04-23 Hybridon, Inc. Oligonucleotide multiple reporter precursors
US5714331A (en) 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5371241A (en) 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
US5319080A (en) 1991-10-17 1994-06-07 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5393878A (en) 1991-10-17 1995-02-28 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5587371A (en) 1992-01-21 1996-12-24 Pharmacyclics, Inc. Texaphyrin-oligonucleotide conjugates
US5595726A (en) 1992-01-21 1997-01-21 Pharmacyclics, Inc. Chromophore probe for detection of nucleic acid
US5565552A (en) 1992-01-21 1996-10-15 Pharmacyclics, Inc. Method of expanded porphyrin-oligonucleotide conjugate synthesis
US5639873A (en) 1992-02-05 1997-06-17 Centre National De La Recherche Scientifique (Cnrs) Oligothionucleotides
US5846545A (en) 1992-03-25 1998-12-08 Immunogen, Inc. Targeted delivery of cyclopropylbenzindole-containing cytotoxic drugs
US5585499A (en) 1992-03-25 1996-12-17 Immunogen Inc. Cyclopropylbenzindole-containing cytotoxic drugs
US5475092A (en) 1992-03-25 1995-12-12 Immunogen Inc. Cell binding agent conjugates of analogues and derivatives of CC-1065
US5610300A (en) 1992-07-01 1997-03-11 Ciba-Geigy Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5700920A (en) 1992-07-01 1997-12-23 Novartis Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5272250A (en) 1992-07-10 1993-12-21 Spielvogel Bernard F Boronated phosphoramidate compounds
US5574142A (en) 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
US5505931A (en) 1993-03-04 1996-04-09 The Dow Chemical Company Acid cleavable compounds, their preparation and use as bifunctional acid-labile crosslinking agents
US5576427A (en) 1993-03-30 1996-11-19 Sterling Winthrop, Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
US5658873A (en) 1993-04-10 1997-08-19 Degussa Aktiengesellschaft Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them
US7906490B2 (en) 1993-04-15 2011-03-15 University Of Rochester Circular DNA vectors for synthesis of RNA and DNA
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US6294664B1 (en) 1993-07-29 2001-09-25 Isis Pharmaceuticals, Inc. Synthesis of oligonucleotides
US5719262A (en) 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
US5446137A (en) 1993-12-09 1995-08-29 Syntex (U.S.A.) Inc. Oligonucleotides containing 4'-substituted nucleotides
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5599928A (en) 1994-02-15 1997-02-04 Pharmacyclics, Inc. Texaphyrin compounds having improved functionalization
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5597696A (en) 1994-07-18 1997-01-28 Becton Dickinson And Company Covalent cyanine dye oligonucleotide conjugates
US5580731A (en) 1994-08-25 1996-12-03 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5591584A (en) 1994-08-25 1997-01-07 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5585108A (en) 1994-12-30 1996-12-17 Nanosystems L.L.C. Formulations of oral gastrointestinal therapeutic agents in combination with pharmaceutically acceptable clays
US20120178702A1 (en) 1995-01-23 2012-07-12 University Of Pittsburgh Stable lipid-comprising drug delivery complexes and methods for their production
EP0735144A1 (en) 1995-03-28 1996-10-02 Research Development Corporation Of Japan Method for molecular indexing categorising of expressed genes using restriction enzymes
US5889136A (en) 1995-06-09 1999-03-30 The Regents Of The University Of Colorado Orthoester protecting groups in RNA synthesis
US6265389B1 (en) 1995-08-31 2001-07-24 Alkermes Controlled Therapeutics, Inc. Microencapsulation and sustained release of oligonucleotides
US6555525B2 (en) 1995-08-31 2003-04-29 Alkermes Controlled Therapeutics, Inc. Microencapsulation and sustained release of oligonucleotides
WO1997030064A1 (en) 1996-02-16 1997-08-21 Stichting Rega Vzw Hexitol containing oligonucleotides and their use in antisense strategies
US6234990B1 (en) 1996-06-28 2001-05-22 Sontra Medical, Inc. Ultrasound enhancement of transdermal transport
US6491657B2 (en) 1996-06-28 2002-12-10 Sontra Medical, Inc. Ultrasound enhancement of transdermal transport
US8404222B2 (en) 1996-09-26 2013-03-26 Nektar Therapeutics Soluble, degradable poly(ethylene glycol) derivatives for controllable release of bound molecules into solution
US6258558B1 (en) 1997-01-21 2001-07-10 The General Hospital Corporation Method for selection of proteins using RNA-protein fusions
US6576752B1 (en) 1997-02-14 2003-06-10 Isis Pharmaceuticals, Inc. Aminooxy functionalized oligomers
US6268490B1 (en) 1997-03-07 2001-07-31 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogues
US20100036115A1 (en) 1997-07-23 2010-02-11 Sirna Therapeutics, Inc. Novel Compositions for the Delivery of Negatively Charged Molecules
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
US6670461B1 (en) 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
US6004573A (en) 1997-10-03 1999-12-21 Macromed, Inc. Biodegradable low molecular weight triblock poly(lactide-co-glycolide) polyethylene glycol copolymers having reverse thermal gelation properties
US6517869B1 (en) 1997-12-12 2003-02-11 Expression Genetics, Inc. Positively charged poly(alpha-(omega-aminoalkyl)lycolic acid) for the delivery of a bioactive agent via tissue and cellular uptake
US6267987B1 (en) 1997-12-12 2001-07-31 Samyang Corporation Positively charged poly[alpha-(omega-aminoalkyl) glycolic acid] for the delivery of a bioactive agent via tissue and cellular uptake
US6320017B1 (en) 1997-12-23 2001-11-20 Inex Pharmaceuticals Corp. Polyamide oligomers
US8003129B2 (en) 1998-01-05 2011-08-23 University Of Washington Enhanced transport using membrane disruptive agents
US7374778B2 (en) 1998-01-05 2008-05-20 University Of Washington Enhanced transport using membrane disruptive agents
US6835393B2 (en) 1998-01-05 2004-12-28 University Of Washington Enhanced transport using membrane disruptive agents
US8497357B2 (en) 1998-01-07 2013-07-30 Nektar Therapeutics Degradable heterobifunctional poly(ethylene glycol) acrylates and gels and conjugates derived therefrom
US6190315B1 (en) 1998-01-08 2001-02-20 Sontra Medical, Inc. Sonophoretic enhanced transdermal transport
US20040236268A1 (en) 1998-01-08 2004-11-25 Sontra Medical, Inc. Method and apparatus for enhancement of transdermal transport
US6426086B1 (en) 1998-02-03 2002-07-30 The Regents Of The University Of California pH-sensitive, serum-stable liposomes
US8367328B2 (en) 1998-04-23 2013-02-05 Takara Bio Inc. Method for synthesizing DNA
US6177274B1 (en) 1998-05-20 2001-01-23 Expression Genetics, Inc. Hepatocyte targeting polyethylene glyco-grafted poly-L-lysine polymeric gene carrier
US20130184453A1 (en) 1998-07-01 2013-07-18 California Institute Of Technology Linear cyclodextrin copolymers
US6217912B1 (en) 1998-07-13 2001-04-17 Expression Genetics, Inc. Polyester analogue of poly-L-lysine as a soluble, biodegradable gene delivery carrier
US8309706B2 (en) 1998-08-03 2012-11-13 Agilent Technologies, Inc. Methods of synthesizing oligonucleotides using carbonate protecting groups and alpha-effect nucleophile deprotection
US20040171980A1 (en) 1998-12-18 2004-09-02 Sontra Medical, Inc. Method and apparatus for enhancement of transdermal transport
US7385034B2 (en) 1998-12-22 2008-06-10 Serono Genetics Institute S.A. Complementary DNAs encoding proteins with signal peptides
US6525183B2 (en) 1999-02-22 2003-02-25 Pe Corporation (Ny) Multiple-labelled oligonucleotides synthesized on solid-supports
US6835827B2 (en) 1999-02-22 2004-12-28 Applera Corporation Labelled oligonucleotides synthesized on solid-supports
US20030191303A1 (en) 1999-02-22 2003-10-09 Applera Corporation Labelled oligonucleotides synthesized on solid-supports
WO2000050032A1 (en) 1999-02-25 2000-08-31 Pharmacia & Upjohn S.P.A. Antitumour synergistic composition
US8206749B1 (en) 1999-02-26 2012-06-26 Novartis Vaccines And Diagnostics, Inc. Microemulsions with adsorbed macromolecules and microparticles
US20130195923A1 (en) 1999-02-26 2013-08-01 Novartis Vaccines And Diagnostics, Inc. Microemulsions with adsorbed macromolecules and microparticles
US20130195898A1 (en) 1999-02-26 2013-08-01 Novartis Vaccines And Diagnostics, Inc. Microemulsions with adsorbed macromolecules and microparticles
US8309139B2 (en) 1999-02-26 2012-11-13 Novartis Vaccines And Diagnostics, Inc. Microemulsions with adsorbed macromolecules and microparticles
US20100255574A1 (en) 1999-03-12 2010-10-07 Human Genome Sciences, Inc. Human Secreted Proteins
US7084125B2 (en) 1999-03-18 2006-08-01 Exiqon A/S Xylo-LNA analogues
US7053207B2 (en) 1999-05-04 2006-05-30 Exiqon A/S L-ribo-LNA analogues
US7138382B2 (en) 1999-06-07 2006-11-21 Mirus Bio Corporation Compositions and methods for drug delivery using pH sensitive molecules
US7413875B2 (en) 1999-08-05 2008-08-19 Serono Genetics Institute S.A. ESTs and encoded human proteins
US20010014753A1 (en) 1999-12-20 2001-08-16 Soloveichik Grigorii Lev Catalyst composition and method for producing diaryl carbonates, using bisphosphines
US7737108B1 (en) 2000-01-07 2010-06-15 University Of Washington Enhanced transport using membrane disruptive agents
US8454946B2 (en) 2000-02-22 2013-06-04 Nektar Therapeutics N-maleimidyl polymer derivatives
US6368801B1 (en) 2000-04-12 2002-04-09 Molecular Staging, Inc. Detection and amplification of RNA using target-mediated ligation of DNA by RNA ligase
US20030073619A1 (en) 2000-09-14 2003-04-17 Mahato Ram I. Novel cationic lipopolymer as biocompatible gene delivery agent
US6696038B1 (en) 2000-09-14 2004-02-24 Expression Genetics, Inc. Cationic lipopolymer as biocompatible gene delivery agent
US20040142474A1 (en) 2000-09-14 2004-07-22 Expression Genetics, Inc. Novel cationic lipopolymer as a biocompatible gene delivery agent
US6998484B2 (en) 2000-10-04 2006-02-14 Santaris Pharma A/S Synthesis of purine locked nucleic acid analogues
US8287849B2 (en) 2000-10-10 2012-10-16 Massachusetts Institute Of Technology Biodegradable poly(beta-amino esters) and uses thereof
US20120228565A1 (en) 2000-10-13 2012-09-13 Life Technologies Corporation Method for preparing surface-modified semiconductive and metallic nanoparticles having enhanced dispersibility in aqueous media
US8440614B2 (en) 2000-12-29 2013-05-14 Aphios Corporation Polymer microspheres/nanospheres and encapsulating therapeutic proteins therein
US7098032B2 (en) 2001-01-02 2006-08-29 Mirus Bio Corporation Compositions and methods for drug delivery using pH sensitive molecules
US6897196B1 (en) 2001-02-07 2005-05-24 The Regents Of The University Of California pH sensitive lipids based on ortho ester linkers, composition and method
US6652886B2 (en) 2001-02-16 2003-11-25 Expression Genetics Biodegradable cationic copolymers of poly (alkylenimine) and poly (ethylene glycol) for the delivery of bioactive agents
US7833992B2 (en) 2001-05-18 2010-11-16 Merck Sharpe & Dohme Conjugates and compositions for cellular delivery
US7964578B2 (en) 2001-05-18 2011-06-21 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US8137911B2 (en) 2001-05-22 2012-03-20 Cellscript, Inc. Preparation and use of single-stranded transcription substrates for synthesis of transcription products corresponding to target sequences
US20100239608A1 (en) 2001-06-05 2010-09-23 Curevac Gmbh PHARMACEUTICAL COMPOSITION CONTAINING A STABILISED mRNA OPTIMISED FOR TRANSLATION IN ITS CODING REGIONS
US20110269950A1 (en) 2001-06-05 2011-11-03 Curevac Gmbh PHARMACEUTICAL COMPOSITION CONTAINING A STABILISED mRNA OPTIMISED FOR TRANSLATION IN ITS CODING REGIONS
EP1392341A2 (de) 2001-06-05 2004-03-03 Curevac GmbH Stabilisierte mrna mit erhöhtem g/c-gehalt und optimierter codon usage für die gentherapie
WO2002098443A2 (de) 2001-06-05 2002-12-12 Curevac Gmbh Stabilisierte mrna mit erhöhtem g/ c- gehalt und otimierter codon usage für die gentherapie
US20050032730A1 (en) 2001-06-05 2005-02-10 Florian Von Der Mulbe Pharmaceutical composition containing a stabilised mRNA optimised for translation in its coding regions
US20110077287A1 (en) 2001-06-05 2011-03-31 Curevac Gmbh Pharmaceutical composition containing a stabilised mrna optimised for translation in its coding regions
US6586524B2 (en) 2001-07-19 2003-07-01 Expression Genetics, Inc. Cellular targeting poly(ethylene glycol)-grafted polymeric gene carrier
US20040262223A1 (en) 2001-07-27 2004-12-30 President And Fellows Of Harvard College Laminar mixing apparatus and methods
US20050059005A1 (en) 2001-09-28 2005-03-17 Thomas Tuschl Microrna molecules
US20120282343A1 (en) 2001-10-03 2012-11-08 Johns Hopkins University Compositions for oral gene therapy and methods of using same
US7384739B2 (en) 2001-11-14 2008-06-10 Toyo Boseki Kabushiki Kaisha Compositions for enhancing DNA synthesis, DNA polymerase-related factors and utilization thereof
US7378262B2 (en) 2001-12-03 2008-05-27 Roche Molecular Systems, Inc. Reversibly modified thermostable enzymes for DNA synthesis and amplification in vitro
US20050059624A1 (en) 2001-12-19 2005-03-17 Ingmar Hoerr Application of mRNA for use as a therapeutic against tumour diseases
WO2003051401A2 (de) 2001-12-19 2003-06-26 Curevac Gmbh Stabilisierte mrna tumor-vakzine
EP1458410A2 (de) 2001-12-19 2004-09-22 Curevac GmbH Stabilisierte mrna tumor-vakzine
US20110311472A1 (en) 2001-12-19 2011-12-22 Curevac Gmbh Application of mrna for use as a therapeutic against tumour diseases
US8257745B2 (en) 2001-12-21 2012-09-04 Novartis Ag Use of synthetic inorganic nanoparticles as carriers for ophthalmic and otic drugs
US20050222064A1 (en) 2002-02-20 2005-10-06 Sirna Therapeutics, Inc. Polycationic compositions for cellular delivery of polynucleotides
US8460709B2 (en) 2002-03-13 2013-06-11 Novartis Ag Pharmaceutical microparticles
US7074596B2 (en) 2002-03-25 2006-07-11 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Synthesis and use of anti-reverse mRNA cap analogues
US7476709B2 (en) 2002-04-26 2009-01-13 Avecia Biotechnology Inc. Process for preparing oligonucleotides
US20120201859A1 (en) 2002-05-02 2012-08-09 Carrasquillo Karen G Drug Delivery Systems and Use Thereof
US20090227660A1 (en) 2002-05-21 2009-09-10 Seungjoon Oh GLP-1 gene delivery for the treatment of type 2 diabetes
US7374930B2 (en) 2002-05-21 2008-05-20 Expression Genetics, Inc. GLP-1 gene delivery for the treatment of type 2 diabetes
US6653468B1 (en) 2002-07-31 2003-11-25 Isis Pharmaceuticals, Inc. Universal support media for synthesis of oligomeric compounds
US8304532B2 (en) 2002-07-31 2012-11-06 Girindus Ag Method for preparing oligonucleotides
US20130156721A1 (en) 2002-09-06 2013-06-20 Cerulean Pharma Inc. Cyclodextrin-based polymers for therapeutics delivery
US7667033B2 (en) 2002-09-27 2010-02-23 Syngen, Inc. Compositions and methods for the use of FMOC derivatives in DNA/RNA synthesis
WO2004041203A2 (en) 2002-11-04 2004-05-21 Xenoport, Inc. Gemcitabine prodrugs, pharmaceutical compositions and uses thereof
US20120156679A1 (en) 2002-11-21 2012-06-21 Epicentre Technologies Methods for making transcription products
US8461132B2 (en) 2003-05-05 2013-06-11 Ben Gurion University Of The Negev Research And Development Authority Injectable cross-linked polymeric preparations and uses thereof
EP1646714A2 (en) 2003-07-09 2006-04-19 Ribostem Limited Method of altering cell properties by administering rna
US8241610B2 (en) 2003-07-09 2012-08-14 Statens Serum Institut Adjuvant combinations of liposomes and mycobacterial lipids for immunization compositions and vaccines
US20060247195A1 (en) 2003-07-09 2006-11-02 Ribostem Limited Method of altering cell properties by administering rna
US8524368B2 (en) 2003-07-09 2013-09-03 Wisconsin Alumni Research Foundation Charge-dynamic polymers and delivery of anionic compounds
WO2005005622A2 (en) 2003-07-09 2005-01-20 Ribostem Limited Method of altering cell properties by administering rna
US20130177587A1 (en) 2003-07-11 2013-07-11 Novavax, Inc. Functional influenza virus-like particles (vlps)
US8506967B2 (en) 2003-07-11 2013-08-13 Novavax, Inc. Functional influenza virus like particles (VLPs)
US20050261218A1 (en) 2003-07-31 2005-11-24 Christine Esau Oligomeric compounds and compositions for use in modulation small non-coding RNAs
US20050130201A1 (en) 2003-10-14 2005-06-16 Dharmacon, Inc. Splint-assisted enzymatic synthesis of polyribounucleotides
US8236280B2 (en) 2003-12-19 2012-08-07 University Of Cincinnati Polyamides for nucleic acid delivery
US20120270927A1 (en) 2003-12-19 2012-10-25 Reineke Theresa M Polyamides For Nucleic Acid Delivery
US20080166414A1 (en) 2004-01-28 2008-07-10 Johns Hopkins University Drugs And Gene Carrier Particles That Rapidly Move Through Mucous Barriers
US8241670B2 (en) 2004-04-15 2012-08-14 Chiasma Inc. Compositions capable of facilitating penetration across a biological barrier
US20080119645A1 (en) 2004-05-05 2008-05-22 Isis Pharmaceuticals, Inc. Amidites and Methods of Rna Synthesis
US20130177611A1 (en) 2004-06-11 2013-07-11 Eidgenossisches Technische Hochschule (The Swiss Federal Institute of Technology) Silk-based drug delivery system
US8124379B2 (en) 2004-06-14 2012-02-28 Novozymes A/S Signal peptide for producing a polypeptide
US20120009145A1 (en) 2004-11-03 2012-01-12 Gregory Slobodkin Biodegradable Cross-Linked Cationic Multi-block Copolymers for Gene Delivery and Methods of Making Thereof
US8057821B2 (en) 2004-11-03 2011-11-15 Egen, Inc. Biodegradable cross-linked cationic multi-block copolymers for gene delivery and methods of making thereof
US20080261905A1 (en) 2004-11-08 2008-10-23 K.U. Leuven Research And Development Modified Nucleosides for Rna Interference
US20110218231A1 (en) 2004-12-09 2011-09-08 Egen, Inc. Combination of Immuno Gene Therapy and Chemotherapy for Treatment of Cancer and Hyperproliferative Diseases
US7964571B2 (en) 2004-12-09 2011-06-21 Egen, Inc. Combination of immuno gene therapy and chemotherapy for treatment of cancer and hyperproliferative diseases
WO2006063249A2 (en) 2004-12-10 2006-06-15 Justin Hanes Functionalized poly (ether-anhydride) block copolymers
US20100003337A1 (en) 2004-12-10 2010-01-07 Justin Hanes Functionalized poly(ether-anhydride) block copolymers
US20120207845A1 (en) 2005-01-04 2012-08-16 Hsing-Wen Sung Pharmaceutical composition of nanoparticles
US20120258176A1 (en) 2005-01-04 2012-10-11 Hsing-Wen Sung Nanoparticles for protein drug delivery
US7893302B2 (en) 2005-02-14 2011-02-22 Sirna Therapeutics, Inc. Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules
US7404969B2 (en) 2005-02-14 2008-07-29 Sirna Therapeutics, Inc. Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules
US8415325B2 (en) 2005-03-31 2013-04-09 University Of Delaware Cell-mediated delivery and targeted erosion of noncovalently crosslinked hydrogels
US8263665B2 (en) 2005-04-01 2012-09-11 Intezyne Technologies, Inc. Polymeric micelles for drug delivery
US20130195987A1 (en) 2005-04-01 2013-08-01 Intezyne Technologies, Inc. Polymeric micelles for drug delivery
US20130059360A1 (en) 2005-04-12 2013-03-07 Nektar Therapeutics Polymer-based compositions and conjugates of antimicrobial agents
US8246995B2 (en) 2005-05-10 2012-08-21 The Board Of Trustees Of The Leland Stanford Junior University Hydrophobic nanotubes and nanoparticles as transporters for the delivery of drugs into cells
US20080267873A1 (en) 2005-05-19 2008-10-30 Curevac Gmbh Injection Solution for Rna
WO2006122828A2 (de) 2005-05-19 2006-11-23 Curevac Gmbh Optimierte injektionsformulierung für mrna
US7550264B2 (en) 2005-06-10 2009-06-23 Datascope Investment Corporation Methods and kits for sense RNA synthesis
US20130184443A1 (en) 2005-06-16 2013-07-18 Nektar Therapeutics Methods for Preparing Conjugates
WO2007024323A2 (en) 2005-06-17 2007-03-01 The University Of North Carolina At Chapel Hill Nanoparticle fabrication methods, systems, and materials
US20100120024A1 (en) 2005-06-30 2010-05-13 Sharon Cload Materials and methods for the generation of transcripts comprising modified nucleotides
US8101385B2 (en) 2005-06-30 2012-01-24 Archemix Corp. Materials and methods for the generation of transcripts comprising modified nucleotides
US20070117112A1 (en) 2005-06-30 2007-05-24 Diener John L Materials and methods for the generation of fully 2'-modified nucleic acid transcripts
US8217147B2 (en) 2005-08-10 2012-07-10 Macrogenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
WO2007024708A2 (en) 2005-08-23 2007-03-01 The Trustees Of The University Of Pennsylvania Rna containing modified nucleosides and methods of use thereof
US20090286852A1 (en) 2005-08-23 2009-11-19 Katalin Kariko RNA containing modified nucleosides and methods of use thereof
US20110143397A1 (en) 2005-08-23 2011-06-16 Katalin Kariko Rna preparations comprising purified modified rna for reprogramming cells
US8444992B2 (en) 2005-09-01 2013-05-21 Novartis Vaccines And Diagnostics Gmbh Multiple vaccination including serogroup C meningococcus
US8420605B2 (en) 2005-09-07 2013-04-16 The University Of Strathclyde Hydrogel compositions
US20100129877A1 (en) 2005-09-28 2010-05-27 Ugur Sahin Modification of RNA, Producing an Increased Transcript Stability and Translation Efficiency
DE102005046490A1 (de) 2005-09-28 2007-03-29 Johannes-Gutenberg-Universität Mainz Modifikationen von RNA, die zu einer erhöhten Transkriptstabilität und Translationseffizienz führen
WO2007036366A2 (de) 2005-09-28 2007-04-05 Johannes Gutenberg-Universität Mainz, Vertreten Durch Den Präsidenten Modifikationen von rna, die zu einer erhöhten transkriptstabilität und translationseffizienz führen
EP1934345A2 (de) 2005-09-28 2008-06-25 Johannes Gutenberg-Universität Mainz, vertreten durch den Präsidenten Modifikationen von rna, die zu einer erhöhten transkriptstabilität und translationseffizienz führen
US20090170090A1 (en) 2005-11-18 2009-07-02 Bioline Limited Method for Enhancing Enzymatic DNA Polymerase Reactions
US7994304B2 (en) 2005-11-22 2011-08-09 Helicos Biosciences Corporation Methods and compositions for sequencing a nucleic acid
US20070141030A1 (en) 2005-12-02 2007-06-21 Yi-Tao Yu Targeted pre-mRNA/mRNA modification and gene regulation
WO2007064952A2 (en) 2005-12-02 2007-06-07 University Of Rochester TARGETED PRE-mRNA/mRNA MODIFICATION AND GENE REGULATION
US20130137644A1 (en) 2005-12-16 2013-05-30 Cellectis Cell penetrating peptide conjugates for delivering of nucleic acids into a cell
US20120269761A1 (en) 2006-01-12 2012-10-25 Massachusetts Institute Of Technology Biodegradable elastomers
US7399845B2 (en) 2006-01-27 2008-07-15 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
US20130129726A1 (en) 2006-02-20 2013-05-23 Kyunglim Lee Peptide having cell membrane penetrating activity
US20130072709A1 (en) 2006-02-21 2013-03-21 Nektar Therapeutics Segmented Degradable Polymers and Conjugates Made Therefrom
US8257685B2 (en) 2006-04-04 2012-09-04 Stc.Unm Swellable particles for drug delivery
US8440231B2 (en) 2006-04-04 2013-05-14 Stc.Unm Swellable particles for drug delivery
US20130130348A1 (en) 2006-05-15 2013-05-23 The Brigham And Women's Hospital, Inc. Polymers for Functional Particles
US8501478B2 (en) 2006-06-15 2013-08-06 University Of Cincinnati Trehalose click polymers for delivery of biologically active molecules
US20130172600A1 (en) 2006-07-12 2013-07-04 Novartis Ag Novel Polymers
US20100215580A1 (en) 2006-09-08 2010-08-26 The Johns Hopkins University Compositions and methods for enhancing transport through mucus
US20130164343A1 (en) 2006-09-08 2013-06-27 The Johns Hopkins University Compositions and methods for enhancing transport through mucus
US20100009865A1 (en) 2006-09-29 2010-01-14 Katholieke Universiteit Leuven Oligonucleotide arrays
EP2073848B1 (en) 2006-10-05 2013-08-28 The Johns Hopkins University Water-dispersible oral, parenteral, and topical formulations for poorly water soluble drugs using smart polymeric nanoparticles
US8313777B2 (en) 2006-10-05 2012-11-20 The Johns Hopkins University Water-dispersible oral, parenteral, and topical formulations for poorly water soluble drugs using smart polymeric nanoparticles
US20100047261A1 (en) 2006-10-31 2010-02-25 Curevac Gmbh Base-modified rna for increasing the expression of a protein
WO2008052770A2 (en) 2006-10-31 2008-05-08 Curevac Gmbh (base-)modified rna for increasing the expression of a protein
US8414927B2 (en) 2006-11-03 2013-04-09 Boston Scientific Scimed, Inc. Cross-linked polymer particles
US7999087B2 (en) 2006-11-15 2011-08-16 Agilent Technologies, Inc. 2′-silyl containing thiocarbonate protecting groups for RNA synthesis
US8242258B2 (en) 2006-12-03 2012-08-14 Agilent Technologies, Inc. Protecting groups for RNA synthesis
US8524259B2 (en) 2006-12-05 2013-09-03 Landec Corporation Systems and methods for delivery of materials
US8399007B2 (en) 2006-12-05 2013-03-19 Landec Corporation Method for formulating a controlled-release pharmaceutical formulation
US20100028943A1 (en) 2006-12-21 2010-02-04 Novozymes, Inc. Modified Messenger RNA Stabilizing Sequences for Expressing Genes in Bacterial Cells
US20130150295A1 (en) 2006-12-21 2013-06-13 Stryker Corporation Sustained-Release Formulations Comprising Crystals, Macromolecular Gels, and Particulate Suspensions of Biologic Agents
WO2008140615A2 (en) 2006-12-21 2008-11-20 Novozymes, Inc. Modified messenger rna stabilizing sequences for expressing genes in bacterial cells
EP2104739A2 (en) 2006-12-21 2009-09-30 Novozymes Inc. Modified messenger rna stabilizing sequences for expressing genes in bacterial cells
WO2008078180A2 (en) 2006-12-22 2008-07-03 Archemix Corp. Materials and methods for the generation of transcripts comprising modified nucleotides
US8507653B2 (en) 2006-12-27 2013-08-13 Nektar Therapeutics Factor IX moiety-polymer conjugates having a releasable linkage
WO2008083949A2 (en) 2007-01-09 2008-07-17 Curevac Gmbh Rna-coded antibody
US20100189729A1 (en) 2007-01-09 2010-07-29 Curvac Gmbh Rna-coded antibody
WO2008103276A2 (en) 2007-02-16 2008-08-28 Merck & Co., Inc. Compositions and methods for potentiated activity of biologicaly active molecules
US8496945B2 (en) 2007-03-05 2013-07-30 Washington University Nanoparticle delivery systems for membrane-integrating peptides
US20130216612A1 (en) 2007-03-23 2013-08-22 Bbb Holding B.V. Targeted intracellular delivery of antiviral agents
WO2008121949A1 (en) 2007-03-30 2008-10-09 Bind Biosciences, Inc. Cancer cell targeting using nanoparticles
US8246968B2 (en) 2007-03-30 2012-08-21 Bind Biosciences, Inc. Cancer cell targeting using nanoparticles
US20080275468A1 (en) 2007-04-27 2008-11-06 Echo Therapeutics, Inc. Skin permeation device for analyte sensing or transdermal drug delivery
US8501824B2 (en) 2007-05-04 2013-08-06 Marina Biotech, Inc. Amino acid lipids and uses thereof
US8202983B2 (en) 2007-05-10 2012-06-19 Agilent Technologies, Inc. Thiocarbon-protecting groups for RNA synthesis
WO2008157668A2 (en) 2007-06-21 2008-12-24 American Power Conversion Corporation Method and system for determining physical location of network equipment
US8039214B2 (en) 2007-06-29 2011-10-18 Cellscript, Inc. Synthesis of tagged nucleic acids
US20120009649A1 (en) 2007-06-29 2012-01-12 Cellscript, Inc. Synthesis of tagged nucleic acids
US20090042829A1 (en) 2007-08-06 2009-02-12 Majed Matar Nucleic Acid-Lipopolymer Compositions
US20090042825A1 (en) 2007-08-06 2009-02-12 Majed Matar Composition, method of preparation & application of concentrated formulations of condensed nucleic acids with a cationic lipopolymer
US20130065942A1 (en) 2007-08-06 2013-03-14 Egen, Inc. Nucleic Acid-Lipopolymer Compositions
US20100293625A1 (en) 2007-09-26 2010-11-18 Interexon Corporation Synthetic 5'UTRs, Expression Vectors, and Methods for Increasing Transgene Expression
US20130172406A1 (en) 2007-09-28 2013-07-04 Bind Biosciences, Inc. Cancer Cell Targeting Using Nanoparticles
US8273363B2 (en) 2007-09-28 2012-09-25 Bind Biosciences, Inc. Cancer cell targeting using nanoparticles
US20120004293A1 (en) 2007-09-28 2012-01-05 Zale Stephen E Cancer Cell Targeting Using Nanoparticles
US8236330B2 (en) 2007-09-28 2012-08-07 Bind Biosciences, Inc. Cancer cell targeting using nanoparticles
US20130189241A1 (en) 2007-12-10 2013-07-25 The Trustees Of The University Of Pennsylvania Regulated delivery systems for inner ear drug application and uses thereof
US20090226470A1 (en) 2007-12-11 2009-09-10 Mauro Vincent P Compositions and methods related to mRNA translational enhancer elements
US20110065103A1 (en) 2007-12-14 2011-03-17 Ugur Sahin Use of rna for reprogramming somatic cells
EP2240572A2 (en) 2007-12-14 2010-10-20 BioNTech AG Use of rna for reprogramming somatic cells
WO2009077134A2 (en) 2007-12-14 2009-06-25 Johannes Gutenberg-Universität Mainz Use of rna for reprogramming somatic cells
US20100004313A1 (en) 2008-02-29 2010-01-07 Tbd Modified Poloxamers for Gene Expression and Associated Methods
US20100004315A1 (en) 2008-03-14 2010-01-07 Gregory Slobodkin Biodegradable Cross-Linked Branched Poly(Alkylene Imines)
US8492359B2 (en) 2008-04-15 2013-07-23 Protiva Biotherapeutics, Inc. Lipid formulations for nucleic acid delivery
WO2009127230A1 (en) 2008-04-16 2009-10-22 Curevac Gmbh MODIFIED (m)RNA FOR SUPPRESSING OR AVOIDING AN IMMUNOSTIMULATORY RESPONSE AND IMMUNOSUPPRESSIVE COMPOSITION
US20110275793A1 (en) 2008-05-29 2011-11-10 Debart Francoise Chemical RNA Synthesis Method
WO2009149253A2 (en) 2008-06-06 2009-12-10 Uniwersytet Warszawski Mrna cap analogs
US20100104655A1 (en) 2008-06-16 2010-04-29 Zale Stephen E Therapeutic Polymeric Nanoparticles Comprising Vinca Alkaloids and Methods of Making and Using Same
US8318211B2 (en) 2008-06-16 2012-11-27 Bind Biosciences, Inc. Therapeutic polymeric nanoparticles comprising vinca alkaloids and methods of making and using same
US20100068286A1 (en) 2008-06-16 2010-03-18 Greg Troiano Drug Loaded Polymeric Nanoparticles and Methods of Making and Using Same
WO2010005726A2 (en) 2008-06-16 2010-01-14 Bind Biosciences Inc. Therapeutic polymeric nanoparticles with mtor inhibitors and methods of making and using same
WO2010005723A2 (en) 2008-06-16 2010-01-14 Bind Biosciences, Inc. Drug loaded polymeric nanoparticles and methods of making and using same
WO2010005740A2 (en) 2008-06-16 2010-01-14 Bind Biosciences, Inc. Methods for the preparation of targeting agent functionalized diblock copolymers for use in fabrication of therapeutic targeted nanoparticles
US20130230567A1 (en) 2008-06-16 2013-09-05 Bind Therapeutics, Inc. Drug Loaded Polymeric Nanoparticles and Methods of Making and Using Same
US8420123B2 (en) 2008-06-16 2013-04-16 Bind Biosciences, Inc. Drug loaded polymeric nanoparticles and methods of making and using same
US8206747B2 (en) 2008-06-16 2012-06-26 Bind Biosciences, Inc. Drug loaded polymeric nanoparticles and methods of making and using same
US8318208B1 (en) 2008-06-16 2012-11-27 Bind Biosciences, Inc. Drug loaded polymeric nanoparticles and methods of making and using same
WO2010005725A2 (en) 2008-06-16 2010-01-14 Bind Biosciences, Inc. Therapeutic polymeric nanoparticles comprising vinca alkaloids and methods of making and using same
US20110274759A1 (en) 2008-06-16 2011-11-10 Greg Troiano Drug Loaded Polymeric Nanoparticles and Methods of Making and Using Same
US8293276B2 (en) 2008-06-16 2012-10-23 Bind Biosciences, Inc. Drug loaded polymeric nanoparticles and methods of making and using same
US20100069426A1 (en) 2008-06-16 2010-03-18 Zale Stephen E Therapeutic polymeric nanoparticles with mTor inhibitors and methods of making and using same
WO2010005721A2 (en) 2008-06-16 2010-01-14 Bind Biosciences, Inc. Drug loaded polymeric nanoparticles and methods of making and using same
US20100104645A1 (en) 2008-06-16 2010-04-29 Bind Biosciences, Inc. Methods for the preparation of targeting agent functionalized diblock copolymers for use in fabrication of therapeutic targeted nanoparticles
US20100068285A1 (en) 2008-06-16 2010-03-18 Zale Stephen E Drug Loaded Polymeric Nanoparticles and Methods of Making and Using Same
US20120288541A1 (en) 2008-06-16 2012-11-15 Zale Stephen E Drug Loaded Polymeric Nanoparticles and Methods of Making and Using Same
US20100009424A1 (en) 2008-07-14 2010-01-14 Natasha Forde Sonoporation systems and methods
WO2010021865A1 (en) 2008-08-18 2010-02-25 Merck Sharp & Dohme Corp. Novel lipid nanoparticles and novel components for delivery of nucleic acids
US8309707B2 (en) 2008-09-06 2012-11-13 Chemgenes Corporation RNA synthesis-phosphoramidites for synthetic RNA in the reverse direction, and application in convenient introduction of ligands, chromophores and modifications of synthetic RNA at the 3′-end
US20130072670A1 (en) 2008-09-06 2013-03-21 Chemgenes Corporation Rna synthesis-phosphoramidites for synthetic rna in the reverse direction, and application in convenient introduction of ligands, chromophores and modifications of synthetic rna at the 3'-end
US20100087337A1 (en) 2008-09-10 2010-04-08 Bind Biosciences, Inc. High Throughput Fabrication of Nanoparticles
US20130123351A1 (en) 2008-09-10 2013-05-16 Bind Biosciences, Inc. High throughput fabrication of nanoparticles
WO2010030763A2 (en) 2008-09-10 2010-03-18 Bind Biosciences, Inc. High throughput fabrication of nanoparticles
US20100075072A1 (en) 2008-09-25 2010-03-25 Tsung-Wei Chen Decorative structure of tree-shaped bells
WO2010047839A1 (en) 2008-10-25 2010-04-29 Aura Biosciences Modified plant virus particles and uses therefor
US20120015899A1 (en) 2008-10-25 2012-01-19 Plant Bioscience, Limited Modified plant virus particles and uses therefor
US8450298B2 (en) 2008-11-07 2013-05-28 Massachusetts Institute Of Technology Aminoalcohol lipidoids and uses thereof
US20110217377A1 (en) 2008-12-15 2011-09-08 Zale Stephen E Long Circulating Nanoparticles for Sustained Release of Therapeutic Agents
US20100216804A1 (en) 2008-12-15 2010-08-26 Zale Stephen E Long Circulating Nanoparticles for Sustained Release of Therapeutic Agents
WO2010080724A1 (en) 2009-01-12 2010-07-15 Merck Sharp & Dohme Corp. Novel lipid nanoparticles and novel components for delivery of nucleic acids
WO2010087791A1 (en) 2009-01-27 2010-08-05 Utc Power Corporation Distributively cooled, integrated water-gas shift reactor and vaporizer
US20100196983A1 (en) 2009-02-05 2010-08-05 Ut-Battelle, Llc Transformation of gram positive bacteria by sonoporation
US20120024422A1 (en) 2009-03-12 2012-02-02 Illinois Tool Works Inc. Mis-fuel inhibitor
US20100260817A1 (en) 2009-03-20 2010-10-14 Egen, Inc. Polyamine Derivatives
US8460696B2 (en) 2009-03-20 2013-06-11 Egen, Inc. Polyamine derivatives
US20120028342A1 (en) 2009-03-24 2012-02-02 Ismagilov Rustem F Slip chip device and methods
US20120076836A1 (en) 2009-03-31 2012-03-29 The University Of Tokyo Polyion complex of double-stranded ribonucleic acid
US20120171290A1 (en) 2009-04-13 2012-07-05 Coursaget Pierre L Hpv particles and uses thereof
WO2010120266A1 (en) 2009-04-13 2010-10-21 Inserm, Institut National De La Sante Et De La Recherche Medicale Hpv particles and uses thereof
US20110223201A1 (en) 2009-04-21 2011-09-15 Selecta Biosciences, Inc. Immunonanotherapeutics Providing a Th1-Biased Response
WO2010123569A2 (en) 2009-04-21 2010-10-28 Selecta Biosciences, Inc. Immunonanotherapeutics providing a th1-biased response
US8287910B2 (en) 2009-04-30 2012-10-16 Intezyne Technologies, Inc. Polymeric micelles for polynucleotide encapsulation
WO2010129709A1 (en) 2009-05-05 2010-11-11 Alnylam Pharmaceuticals, Inc. Lipid compositions
US20120060293A1 (en) 2009-05-18 2012-03-15 Amoena Medizin-Orthopädie-Technik GmbH Anti-decubitus cushion
US20110027217A1 (en) 2009-05-27 2011-02-03 Selecta Biosciences, Inc. Immunomodulatory agent-polymeric compounds
US20110020388A1 (en) 2009-05-27 2011-01-27 Selecta Biosciences, Inc. Targeted synthetic nanocarriers with ph sensitive release of immunomodulatory agents
WO2010138193A2 (en) 2009-05-27 2010-12-02 Selecta Biosciences, Inc. Targeted synthetic nanocarriers with ph sensitive release of immunomodulatory agents
US20100303850A1 (en) 2009-05-27 2010-12-02 Selecta Biosciences, Inc. Nanocarriers possessing components with different rates of release
WO2010138192A2 (en) 2009-05-27 2010-12-02 Selecta Biosciences, Inc. Nanocarriers possessing components with different rates of release
WO2010138194A2 (en) 2009-05-27 2010-12-02 Selecta Biosciences, Inc. Immunomodulatory agent-polymeric compounds
US20100324120A1 (en) 2009-06-10 2010-12-23 Jianxin Chen Lipid formulation
US8283333B2 (en) 2009-07-01 2012-10-09 Protiva Biotherapeutics, Inc. Lipid formulations for nucleic acid delivery
US20120202871A1 (en) 2009-07-01 2012-08-09 Protiva Biotherapeutics, Inc. Cationic lipids and methods for the delivery of therapeutic agents
US20130122104A1 (en) 2009-07-01 2013-05-16 Protiva Biotherapeutics, Inc. Novel lipid formulations for delivery of therapeutic agents to solid tumors
WO2011013062A1 (en) 2009-07-30 2011-02-03 Koninklijke Philips Electronics N.V. Distributed image retargeting
WO2011012316A2 (de) 2009-07-31 2011-02-03 Ludwig-Maximilians-Universität Rna mit einer kombination aus unmodifizierten und modifizierten nucleotiden zur proteinexpression
WO2011015312A1 (en) 2009-08-01 2011-02-10 Roche Diagnostics Gmbh Improved detection of bacterial (mollicutes) contamination
WO2011014973A2 (en) 2009-08-05 2011-02-10 Polyphor Ag Conformationally constrained, fully synthetic macrocyclic compounds
WO2011022460A1 (en) 2009-08-20 2011-02-24 Merck Sharp & Dohme Corp. Novel cationic lipids with various head groups for oligonucleotide delivery
WO2011043913A2 (en) 2009-10-08 2011-04-14 Merck Sharp & Dohme Corp. Novel cationic lipids with short lipid chains for oligonucleotide delivery
US20130129627A1 (en) 2009-10-22 2013-05-23 James B. Delehanty Delivery of Nanoparticles to Neurons
US20120276209A1 (en) 2009-11-04 2012-11-01 The University Of British Columbia Nucleic acid-containing lipid particles and related methods
US8449916B1 (en) 2009-11-06 2013-05-28 Iowa State University Research Foundation, Inc. Antimicrobial compositions and methods
US20120283427A1 (en) 2009-11-13 2012-11-08 Bend Research, Inc. Cationic dextran polymer derivatives
WO2011062965A2 (en) 2009-11-18 2011-05-26 University Of Washington Through Its Center For Commercialization Targeting monomers and polymers having targeting blocks
US20130129636A1 (en) 2009-11-20 2013-05-23 Imperial Innovations Limited Novel Liposome Nanoparticles for Tumor Magnetic Resonance Imaging
US20130195967A1 (en) 2009-12-01 2013-08-01 Shire Human Genetic Therapies, Inc. Liver specific delivery of messenger rna
US20110244026A1 (en) 2009-12-01 2011-10-06 Braydon Charles Guild Delivery of mrna for the augmentation of proteins and enzymes in human genetic diseases
US20110143436A1 (en) 2009-12-07 2011-06-16 Gary Dahl Compositions and methods for reprogramming eukaryotic cells
WO2011071931A2 (en) 2009-12-07 2011-06-16 Katalin Kariko Rna preparations comprising purified modified rna for reprogramming cells
WO2011071936A2 (en) 2009-12-07 2011-06-16 Gary Dahl Compositions and methods for reprogramming eukaryotic cells
WO2011072218A2 (en) 2009-12-11 2011-06-16 Bind Biosciences Stable formulations for lyophilizing therapeutic particles
US20130230568A1 (en) 2009-12-11 2013-09-05 Bind Therapeutics, Inc. Stable Formulations for Lyophilizing Therapeutic Particles
US8211473B2 (en) 2009-12-11 2012-07-03 Bind Biosciences, Inc. Stable formulations for lyophilizing therapeutic particles
US20110294717A1 (en) 2009-12-15 2011-12-01 Ali Mir M Therapeutic Polymeric Nanoparticle Compositions with High Glass Transition Temperature or High Molecular Weight Copolymers
US8518963B2 (en) 2009-12-15 2013-08-27 Bind Therapeutics, Inc. Therapeutic polymeric nanoparticle compositions with high glass transition temperature or high molecular weight copolymers
WO2011084518A2 (en) 2009-12-15 2011-07-14 Bind Biosciences, Inc. Therapeutic polymeric nanoparticles comprising corticosteroids and methods of making and using same
WO2011084521A2 (en) 2009-12-15 2011-07-14 Bind Biosciences, Inc. Therapeutic polymeric nanoparticles comprising epothilone and methods of making and using same
WO2011084513A2 (en) 2009-12-15 2011-07-14 Bind Biosciences, Inc. Therapeutic polymeric nanoparticle compositions with high glass transition temperature or high molecular weight copolymers
US20120140790A1 (en) 2009-12-15 2012-06-07 Ali Mir M Therapeutic Polymeric Nanoparticle Compositions with High Glass Transition Termperature or High Molecular Weight Copolymers
US20130102545A1 (en) 2009-12-16 2013-04-25 Magforce Ag Temperature dependent activation of catalytic nucleic acids for controlled active substance release
WO2011076807A2 (en) 2009-12-23 2011-06-30 Novartis Ag Lipids, lipid compositions, and methods of using them
US20110200582A1 (en) 2009-12-23 2011-08-18 Novartis Ag Lipids, lipid compositions, and methods of using them
US20110171248A1 (en) 2010-01-08 2011-07-14 Selecta Biosciences, Inc. Synthetic virus-like particles conjugated to human papillomavirus capsid peptides for use as vaccines
WO2011085231A2 (en) 2010-01-08 2011-07-14 Selecta Biosciences, Inc. Synthetic virus-like particles conjugated to human papillomavirus capsid peptides for use as vaccines
WO2011090965A1 (en) 2010-01-22 2011-07-28 Merck Sharp & Dohme Corp. Novel cationic lipids for oligonucleotide delivery
US20130196915A1 (en) 2010-01-23 2013-08-01 Yong Wang Affinity hydrogels for controlled protein release
WO2012082165A1 (en) 2010-01-24 2012-06-21 Novartis Ag Irradiated biodegradable polymer microparticles
US20130231287A1 (en) 2010-02-25 2013-09-05 Parimala Nacharaju Pegylated albumin polymers and uses thereof
US20120321719A1 (en) 2010-02-25 2012-12-20 The Johns Hopkins University Sustained Delivery of Therapeutic Agents to an Eye Compartment
US20130133483A1 (en) 2010-03-08 2013-05-30 University Of Rochester Synthesis of Nanoparticles Using Reducing Gases
US20130149783A1 (en) 2010-03-16 2013-06-13 James William Yockman Cleavable modifications to reducible poly (amido ethylenimines)s to enhance nucleotide delivery
WO2011115862A1 (en) 2010-03-18 2011-09-22 Merck Sharp & Dohme Corp. Endosomolytic poly(amidoamine) disulfide polymers for the delivery of oligonucleotides
US20130071450A1 (en) 2010-03-18 2013-03-21 Covidien Lp Gels for transdermal delivery
US20120177724A1 (en) 2010-03-19 2012-07-12 Massachusetts Institute Of Technology Lipid vesicle compositions and methods of use
WO2011120053A1 (en) 2010-03-26 2011-09-29 Mersana Therapeutics, Inc. Modified polymers for delivery of polynucleotides, method of manufacture, and methods of use thereof
US8404799B2 (en) 2010-03-26 2013-03-26 Cerulean Pharma Inc. Methods and systems for generating nanoparticles
WO2011127255A1 (en) 2010-04-08 2011-10-13 Merck Sharp & Dohme Corp. Preparation of lipid nanoparticles
US20130177638A1 (en) 2010-04-09 2013-07-11 Pacira Pharmaceuticals, Inc. Method for formulating large diameter synthetic membrane vesicles
US20130177634A1 (en) 2010-04-09 2013-07-11 Pacira Pharmaceuticals, Inc. Method for formulating large diameter synthetic membrane vesicles
US20130183372A1 (en) 2010-04-09 2013-07-18 Pacira Pharmaceuticals, Inc. Method for formulating large diameter synthetic membrane vesicles
US20130177637A1 (en) 2010-04-09 2013-07-11 Pacira Pharmaceuticals, Inc. Method for formulating large diameter synthetic membrane vesicles
US20130177633A1 (en) 2010-04-09 2013-07-11 Pacira Pharmaceuticals, Inc. Method for formulating large diameter synthetic membrane vesicles
US20130177635A1 (en) 2010-04-09 2013-07-11 Pacira Pharmaceuticals, Inc. Method for formulating large diameter synthetic membrane vesicles
US20130183375A1 (en) 2010-04-09 2013-07-18 Pacira Pharmaceuticals, Inc. Method for formulating large diameter synthetic membrane vesicles
US20130183373A1 (en) 2010-04-09 2013-07-18 Pacira Pharmaceuticals, Inc. Method for formulating large diameter synthetic membrane vesicles
US20130177636A1 (en) 2010-04-09 2013-07-11 Pacira Pharmaceuticals, Inc. Method for formulating large diameter synthetic membrane vesicles
US20110262491A1 (en) 2010-04-12 2011-10-27 Selecta Biosciences, Inc. Emulsions and methods of making nanocarriers
US20130138032A1 (en) 2010-04-15 2013-05-30 Sungjee Kim ANTICANCER AGENT DELIVERY SYSTEM USING pH-SENSITIVE METAL NANOPARTICLES
US20120046346A1 (en) 2010-04-16 2012-02-23 Immune Disease Institute, Inc. Sustained polypeptide expression from synthetic, modified rnas and uses thereof
US20130156845A1 (en) 2010-04-29 2013-06-20 Alnylam Pharmaceuticals, Inc. Lipid formulated single stranded rna
US20130129785A1 (en) 2010-05-10 2013-05-23 Alnylam Pharmaceuticals, Inc Methods and compositions for delivery of active agents
US20130123338A1 (en) 2010-05-12 2013-05-16 Protiva Biotherapeutics, Inc. Novel cationic lipids and methods of use thereof
US20130150625A1 (en) 2010-05-24 2013-06-13 Brian W. Budzik Novel Amino Alcohol Cationic Lipids for Oligonucleotide Delivery
US20120027806A1 (en) 2010-05-26 2012-02-02 Selecta Biosciences, Inc. Dose selection of adjuvanted synthetic nanocarriers
WO2011150240A1 (en) 2010-05-26 2011-12-01 Selecta Biosciences, Inc. Nanocarrier compositions with uncoupled adjuvant
US20110293723A1 (en) 2010-05-26 2011-12-01 Selecta Biosciences, Inc. Synthetic nanocarrier combination vaccines
WO2011150249A1 (en) 2010-05-26 2011-12-01 Selecta Biosciences, Inc. Multivalent synthetic nanocarrier vaccines
US20110293700A1 (en) 2010-05-26 2011-12-01 Selecta Biosciences, Inc. Nanocarrier compositions with uncoupled adjuvant
WO2011150264A2 (en) 2010-05-26 2011-12-01 Selecta Biosciences, Inc. Synthetic nanocarrier combination vaccines
US20130209544A1 (en) 2010-05-26 2013-08-15 Micromedmark Biotech Co., Ltd. Microvesicles carrying small interfering rnas, preparation methods and uses thereof
WO2011150258A1 (en) 2010-05-26 2011-12-01 Selecta Biosciences, Inc. Dose selection of adjuvanted synthetic nanocarriers
US20110293701A1 (en) 2010-05-26 2011-12-01 Selecta Biosciences, Inc. Multivalent synthetic nanocarrier vaccines
US20130090372A1 (en) 2010-06-04 2013-04-11 Brian W. Budzik Novel Low Molecular Weight Cationic Lipids for Oligonucleotide Delivery
US20130164219A1 (en) 2010-06-14 2013-06-27 Hoffmann-La Roche Inc. Cell-penetrating peptides and uses thereof
US20130197100A1 (en) 2010-06-15 2013-08-01 Instituto De Pesquisas Technologicas Do Estado De Sao Paulo Colloidal nanoscale carriers for active hydrophilic substances and method for producing same
US20130196948A1 (en) 2010-06-25 2013-08-01 Massachusetts Insitute Of Technology Polymers for biomaterials and therapeutics
WO2012001875A1 (en) 2010-07-01 2012-01-05 Canon Kabushiki Kaisha Image forming apparatus
WO2012002629A1 (ko) 2010-07-02 2012-01-05 연세대학교 산학협력단 발광다이오드 모듈
WO2012006378A1 (en) 2010-07-06 2012-01-12 Novartis Ag Liposomes with lipids having an advantageous pka- value for rna delivery
US20130171241A1 (en) 2010-07-06 2013-07-04 Novartis Ag Liposomes with lipids having an advantageous pka-value for rna delivery
WO2012006380A2 (en) 2010-07-06 2012-01-12 Novartis Ag Cationic oil-in-water emulsions
WO2012006376A2 (en) 2010-07-06 2012-01-12 Novartis Ag Virion-like delivery particles for self-replicating rna molecules
US20130195968A1 (en) 2010-07-06 2013-08-01 Novartis Ag Virion-like delivery particles for self-replicating rna molecules
US20130177523A1 (en) 2010-07-13 2013-07-11 University Of Utah Research Foundation Gold particles and methods of making and using the same in cancer treatment
US20130211249A1 (en) 2010-07-22 2013-08-15 The Johns Hopkins University Drug eluting hydrogels for catheter delivery
WO2012013501A1 (de) 2010-07-29 2012-02-02 Fujitsu Technology Solutions Intellectual Property Gmbh Computersystem, verfahren zum programmieren einer echtzeituhr und computerprogrammprodukt
US20130142818A1 (en) 2010-07-30 2013-06-06 Curevac Gmbh Complexation of nucleic acids with disulfide-crosslinked cationic components for transfection and immunostimulation
WO2012013326A1 (en) 2010-07-30 2012-02-02 Curevac Gmbh Complexation of nucleic acids with disulfide-crosslinked cationic components for transfection and immunostimulation
WO2012018718A1 (en) 2010-08-02 2012-02-09 Advanced Technologies And Regenerative Medicine, Llc Absorbable peg-based hydrogels
US8518907B2 (en) 2010-08-02 2013-08-27 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of catenin (cadherin-associated protein), beta 1 (CTNNB1) gene expression using short interfering nucleic acid (siNA)
WO2012016269A1 (en) 2010-08-02 2012-02-09 Curtin University Of Technology Determining location of, and imaging, a subsurface boundary
US8524215B2 (en) 2010-08-02 2013-09-03 Janssen Biotech, Inc. Absorbable PEG-based hydrogels
WO2012018881A2 (en) 2010-08-03 2012-02-09 Alnylam Pharmaceuticals, Inc. Methods and compositions for the regulation of rna
US20130171646A1 (en) 2010-08-09 2013-07-04 So Jung PARK Nanop article-oligonucleotide hybrid structures and methods of use thereof
US20130216607A1 (en) 2010-08-14 2013-08-22 The Regents Of The University Of California Zwitterionic lipids
WO2012022512A1 (en) 2010-08-18 2012-02-23 International Business Machines Corporation Solar cell and battery 3d integration
US20130195799A1 (en) 2010-08-19 2013-08-01 Peg Biosciences, Inc. Synergistic biomolecule-polymer conjugates
US20120064110A1 (en) 2010-08-20 2012-03-15 Selecta Biosciences, Inc. Synthetic nanocarrier vaccines comprising peptides obtained or derived from human influenza a virus hemagglutinin
US20120058154A1 (en) 2010-08-20 2012-03-08 Selecta Biosciences, Inc. Synthetic nanocarrier vaccines comprising peptides obtained or derived from human influenza a virus m2e
WO2012024632A2 (en) 2010-08-20 2012-02-23 Selecta Biosciences, Inc. Synthetic nanocarrier vaccines comprising peptides obtained or derived from human influenza a virus m2e
WO2012024526A2 (en) 2010-08-20 2012-02-23 Cerulean Pharma Inc. Conjugates, particles, compositions, and related methods
US20120058153A1 (en) 2010-08-20 2012-03-08 Selecta Biosciences, Inc. Synthetic nanocarrier vaccines comprising proteins obtained or derived from human influenza a virus hemagglutinin
WO2012024621A2 (en) 2010-08-20 2012-02-23 Selecta Biosciences, Inc. Synthetic nanocarrier vaccines comprising peptides obtained or derived from human influenza a virus hemagglutinin
US20130195969A1 (en) 2010-08-31 2013-08-01 Novartis Ag Small liposomes for delivery of immunogen encoding rna
WO2012031043A1 (en) 2010-08-31 2012-03-08 Novartis Ag Pegylated liposomes for delivery of immunogen-encoding rna
US20130189351A1 (en) 2010-08-31 2013-07-25 Novartis Ag Lipids suitable for liposomal delivery of protein coding rna
WO2012031046A2 (en) 2010-08-31 2012-03-08 Novartis Ag Lipids suitable for liposomal delivery of protein-coding rna
US20130202684A1 (en) 2010-08-31 2013-08-08 Lichtstrasse Pegylated liposomes for delivery of immunogen encoding rna
WO2012030901A1 (en) 2010-08-31 2012-03-08 Novartis Ag Small liposomes for delivery of immunogen-encoding rna
WO2012030683A2 (en) 2010-08-31 2012-03-08 Merck Sharp & Dohme Corp. Novel single chemical entities and methods for delivery of oligonucleotides
US20130183244A1 (en) 2010-09-10 2013-07-18 The Johns Hopkins University Rapid Diffusion of Large Polymeric Nanoparticles in the Mammalian Brain
US8466122B2 (en) 2010-09-17 2013-06-18 Protiva Biotherapeutics, Inc. Trialkyl cationic lipids and methods of use thereof
WO2012040184A2 (en) 2010-09-20 2012-03-29 Merck Sharp & Dohme Corp. Novel low molecular weight cationic lipids for oligonucleotide delivery
US20130178541A1 (en) 2010-09-20 2013-07-11 Matthew G. Stanton Novel low molecular weight cationic lipids for oligonucleotide delivery
US20130183718A1 (en) 2010-09-21 2013-07-18 RibpxX GmbH Method for Synthesizing RNA using DNA Template
WO2012040623A2 (en) 2010-09-24 2012-03-29 The Brigham And Women's Hospital, Inc. Nanostructured gels capable of controlled release of encapsulated agents
WO2012040524A1 (en) 2010-09-24 2012-03-29 Mallinckrodt Llc Aptamer conjugates for targeting of therapeutic and/or diagnostic nanocarriers
WO2012044638A1 (en) 2010-09-30 2012-04-05 Merck Sharp & Dohme Corp. Low molecular weight cationic lipids for oligonucleotide delivery
US20120265001A1 (en) 2010-10-11 2012-10-18 Wichita State University Composite magnetic nanoparticle drug delivery system
WO2012049366A1 (en) 2010-10-14 2012-04-19 Timo Vesikari Norovirus capsid and rotavirus vp6 protein for use as combined vaccine
WO2012054365A2 (en) 2010-10-21 2012-04-26 Merck Sharp & Dohme Corp. Novel low molecular weight cationic lipids for oligonucleotide delivery
WO2012054923A2 (en) 2010-10-22 2012-04-26 Bind Biosciences, Inc. Therapeutic nanoparticles with high molecular weight copolymers
US20130225836A1 (en) 2010-11-05 2013-08-29 Merck Sharp & Dohme Corp. Novel low molecular weight cyclic amine containing cationic lipids for oligonucleotide delivery
WO2012061259A2 (en) 2010-11-05 2012-05-10 Merck Sharp & Dohme Corp. Novel low molecular weight cyclic amine containing cationic lipids for oligonucleotide delivery
US20120121718A1 (en) 2010-11-05 2012-05-17 The Johns Hopkins University Compositions and methods relating to reduced mucoadhesion
WO2012068187A1 (en) 2010-11-19 2012-05-24 Merck Sharp & Dohme Corp. Poly(amide) polymers for the delivery of oligonucleotides
WO2012082574A1 (en) 2010-12-17 2012-06-21 Merck Sharp & Dohme Corp. Membrane lytic poly(amido amine) polymers for the delivery of oligonucleotides
US20120171229A1 (en) 2010-12-30 2012-07-05 Selecta Biosciences, Inc. Synthetic nanocarriers with reactive groups that release biologically active agents
WO2012094304A1 (en) 2011-01-04 2012-07-12 Brown University Nanotubes as carriers of nucleic acids into cells
WO2012099755A1 (en) 2011-01-11 2012-07-26 Alnylam Pharmaceuticals, Inc. Pegylated lipids and their use for drug delivery
WO2012095255A1 (de) 2011-01-13 2012-07-19 Evonik Oxeno Gmbh Verfahren zur aufreinigung von biphephos
WO2012099805A2 (en) 2011-01-19 2012-07-26 Ocean Nanotech, Llc Nanoparticle based immunological stimulation
US20120189700A1 (en) 2011-01-19 2012-07-26 Zoraida Aguilar Nanoparticle Based Immunological Stimulation
WO2012109121A1 (en) 2011-02-07 2012-08-16 Purdue Research Foundation Carbohydrate nanoparticles for prolonged efficacy of antimicrobial peptide
US20120207840A1 (en) 2011-02-10 2012-08-16 Aura Biosciences, Inc. Virion Derived Protein Nanoparticles For Delivering Diagnostic Or Therapeutic Agents For The Treatment Of Non-Melanoma Skin Cancer
WO2012110636A2 (en) 2011-02-18 2012-08-23 Instituto Nacional De Investigación Y Tecnología Agraria Y Alimentaria (Inia) Carrier peptides for cell delivery
US20130217753A1 (en) 2011-02-22 2013-08-22 Rutgers, The State University Of New Jersey Amphiphilic macromolecules for nucleic acid delivery
US20120237565A1 (en) 2011-03-14 2012-09-20 Intezyne Technologies, Incorporated Pegylated polyplexes containing two or more different polymers for polynucleotide delivery
WO2012125987A2 (en) 2011-03-17 2012-09-20 Massachusetts Institute Of Technology Delivery system
WO2012129648A1 (en) 2011-03-25 2012-10-04 University Of Guelph Enhancing protein expression of adeno-associated virus vectors
US20120244222A1 (en) 2011-03-25 2012-09-27 Selecta Biosciences, Inc. Osmotic mediated release synthetic nanocarriers
WO2012131106A1 (en) 2011-03-31 2012-10-04 Ingell Technologies Holding B.V. Biodegradable compositions suitable for controlled release
WO2012131104A2 (en) 2011-03-31 2012-10-04 Ingell Technologies Holding B.V. Biodegradable compositions suitable for controlled release
WO2012148684A1 (en) 2011-04-27 2012-11-01 President And Fellows Of Harvard College Cell-friendly inverse opal hydrogels for cell encapsulation, drug and protein delivery, and functional nanoparticle encapsulation
WO2012149268A1 (en) 2011-04-29 2012-11-01 Selecta Biociences, Inc. Tolerogenic synthetic nanocarriers for allergy therapy
WO2012149255A2 (en) 2011-04-29 2012-11-01 Selecta Biosciences, Inc. Tolerogenic synthetic nanocarriers to reduce immune responses to therapeutic proteins
WO2012149282A2 (en) 2011-04-29 2012-11-01 Selecta Biosciences, Inc. Tolerogenic synthetic nanocarriers for generating cd8+regulatory t cells
WO2012149411A1 (en) 2011-04-29 2012-11-01 Selecta Biosciences, Inc. Controlled release of immunosuppressants from synthetic nanocarriers
WO2012149259A1 (en) 2011-04-29 2012-11-01 Selecta Biosciences, Inc. Tolerogenic synthetic nanocarriers to reduce antibody responses
US20120283503A1 (en) 2011-04-29 2012-11-08 The Johns Hopkins University Nanoparticle loaded stem cells and their use in mri guided hyperthermia
WO2012149393A2 (en) 2011-04-29 2012-11-01 Selecta Biosciences, Inc. Tolerogenic synthetic nanocarriers for antigen-specific deletion of t effector cells
WO2012149265A2 (en) 2011-04-29 2012-11-01 Selecta Biosciences, Inc. Tolerogenic synthetic nanocarriers to reduce cytotoxic t lymphocyte responses
WO2012149454A2 (en) 2011-04-29 2012-11-01 Selecta Biosciences, Inc. Tolerogenic synthetic nanocarriers coupled to cd1d-restricted antigens and methods of use
WO2012149301A2 (en) 2011-04-29 2012-11-01 Selecta Biosciences, Inc. Tolerogenic synthetic nanocarriers for inducing regulatory b cells
WO2012149252A2 (en) 2011-04-29 2012-11-01 Selecta Biosciences, Inc. Tolerogenic synthetic nanocarriers
WO2012149405A2 (en) 2011-04-29 2012-11-01 Selecta Biosciences, Inc. Tolerogenic synthetic nanocarriers for regulating innate immune responses
WO2012150467A2 (en) 2011-05-04 2012-11-08 The University Of Nottingham Novel polymers which resist bacterial attachment
WO2012151438A1 (en) 2011-05-05 2012-11-08 Celacare Technologies, Llc Antimicrobial silver hydrogel composition for the treatment of burns and wounds
US20120295832A1 (en) 2011-05-17 2012-11-22 Arrowhead Research Corporation Novel Lipids and Compositions for Intracellular Delivery of Biologically Active Compounds
US20120302940A1 (en) 2011-05-26 2012-11-29 Jackson State University Popcorn Shape Gold Nanoparticle For Targeted Diagnosis, Photothermal Treatment and In-Situ Monitoring Therapy Response for Cancer and Multiple Drug Resistance Bacteria
WO2012166923A2 (en) 2011-05-31 2012-12-06 Bind Biosciences Drug loaded polymeric nanoparticles and methods of making and using same
WO2013052167A2 (en) 2011-06-02 2013-04-11 The Regents Of The University Of California Membrane encapsulated nanoparticles and method of use
WO2012170930A1 (en) 2011-06-08 2012-12-13 Shire Human Genetic Therapies, Inc Lipid nanoparticle compositions and methods for mrna delivery
WO2012170889A1 (en) 2011-06-08 2012-12-13 Shire Human Genetic Therapies, Inc. Cleavable lipids
WO2013003343A2 (en) 2011-06-27 2013-01-03 Adelphi Technology, Inc. Neutron source for neutron capture therapy
WO2013001198A1 (fr) 2011-06-27 2013-01-03 E.Itec Cable pour systeme d'alimentation electrique
WO2013001168A1 (en) 2011-06-30 2013-01-03 Ionphase Oy Halogen-free polymer blend
WO2013001166A1 (en) 2011-06-30 2013-01-03 Wärtsilä Finland Oy Method and arrangement for minimizing need for safety gases
WO2013006825A1 (en) 2011-07-06 2013-01-10 Novartis Ag Liposomes having useful n:p ratio for delivery of rna molecules
WO2013007604A1 (de) 2011-07-08 2013-01-17 Bayer Intellectual Property Gmbh Verfahren zur herstellung von tetrazol-substituierten anthranilsäurediamid-derivaten durch umsetzung von pyrazolsäuren mit anthranilsäureestern
WO2013009736A2 (en) 2011-07-10 2013-01-17 President And Fellows Of Harvard College Compositions and methods for self-assembly of polymers with complementary macroscopic and microscopic scale units
WO2013009717A1 (en) 2011-07-10 2013-01-17 Elisabet De Los Pinos Virion derived protein nanoparticles for delivering diagnostic or therapeutic agents for the treatment of skin-related diseases
US20130012450A1 (en) 2011-07-10 2013-01-10 Aura Biosciences, Inc. Virion Derived Protein Nanoparticles For Delivering Diagnostic Or Therapeutic Agents For The Treatment Of Dermatology Related Genetic Diseases
US20130012566A1 (en) 2011-07-10 2013-01-10 Aura Biosciences, Inc. Virion Derived Protein Nanoparticles For Delivering Diagnostic Or Therapeutic Agents For The Treatment of Alopecia
WO2013008825A1 (ja) 2011-07-11 2013-01-17 株式会社トクヤマ フォトクロミック硬化性組成物
WO2013012680A1 (en) 2011-07-15 2013-01-24 3M Innovative Properties Company An electrical connector
WO2013012226A2 (ko) 2011-07-18 2013-01-24 이화다이아몬드공업 주식회사 Cmp 패드 컨디셔너
WO2013012476A2 (en) 2011-07-21 2013-01-24 Arizona Chemical Company, Llc Branched polyether-polyamide block copolymers and methods of making and using the same
WO2013019669A2 (en) 2011-07-29 2013-02-07 Selecta Biosciences, Inc. Synthetic nanocarriers that generate humoral and cytotoxic t lymphocyte (ctl) immune responses
US20130121954A1 (en) 2011-08-26 2013-05-16 Arrowhead Madison Inc. Poly(vinyl ester) Polymers for In Vivo Nucleic Acid Delivery
WO2013032829A1 (en) 2011-08-26 2013-03-07 Arrowhead Research Corporation Poly(vinyl ester) polymers for in vivo nucleic acid delivery
US20130064894A1 (en) 2011-08-31 2013-03-14 Protiva Biotherapeutics, Inc. Novel cationic lipids and methods of use thereof
WO2013044219A1 (en) 2011-09-22 2013-03-28 Bind Biosciences Methods of treating cancers with therapeutic nanoparticles
WO2013072929A2 (en) 2011-09-23 2013-05-23 Indian Institute Of Technology Nanop article based cosmetic composition
WO2013049328A1 (en) 2011-09-27 2013-04-04 Alnylam Pharmaceuticals, Inc. Di-aliphatic substituted pegylated lipids
WO2013052523A1 (en) 2011-10-03 2013-04-11 modeRNA Therapeutics Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
WO2013055971A1 (en) 2011-10-11 2013-04-18 Arizona Board Of Regents For And On Behalf Of Arizona State University Polymers for delivering a substance into a cell
WO2013055331A1 (en) 2011-10-12 2013-04-18 The Curators Of The University Of Missouri Pentablock polymers
WO2013056132A2 (en) 2011-10-14 2013-04-18 Stc.Unm Porous nanoparticle-supported lipid bilayers (protocells) for targeted delivery including transdermal delivery of cargo and methods thereof
WO2013059496A1 (en) 2011-10-18 2013-04-25 Dicerna Pharmaceuticals, Inc. Amine cationic lipids and uses thereof
WO2013059922A1 (en) 2011-10-25 2013-05-02 The University Of British Columbia Limit size lipid nanoparticles and related methods
WO2013063468A1 (en) 2011-10-27 2013-05-02 Massachusetts Institute Of Technology Amino acid derivates functionalized on the n- terminal capable of forming drug incapsulating microspheres
WO2013063530A2 (en) 2011-10-28 2013-05-02 Presage Biosciences, Inc. Methods for drug delivery
WO2013093648A2 (en) 2011-11-04 2013-06-27 Nitto Denko Corporation Method of producing lipid nanoparticles for drug delivery
US20130164400A1 (en) 2011-11-04 2013-06-27 Nitto Denko Corporation Single use system for sterilely producing lipid-nucleic acid particles
US20130115247A1 (en) 2011-11-05 2013-05-09 Aura Biosciences, Inc. Virion Derived Protein Nanoparticles For Delivering Radioisotopes For The Diagnosis And Treatment Of Malignant And Systemic Disease And The Monitoring Of Therapy
US20130116408A1 (en) 2011-11-05 2013-05-09 Aura Biosciences, Inc. Virion Derived Protein Nanoparticles For Delivering Radioisotopes For The Diagnosis And Treatment Of Malignant And Systemic Disease And The Monitoring Of Therapy
US20130129830A1 (en) 2011-11-18 2013-05-23 Regeneron Pharmaceuticals, Inc. Polymer Protein Microparticles
WO2013075068A1 (en) 2011-11-18 2013-05-23 Regeneron Pharmaceuticals, Inc. Polymer protein microparticles
WO2013082111A2 (en) 2011-11-29 2013-06-06 The University Of North Carolina At Chapel Hill Geometrically engineered particles and methods for modulating macrophage or immune responses
WO2013082590A1 (en) 2011-12-02 2013-06-06 Invivo Therapeutics Corporation Peg based hydrogel for peripheral nerve injury applications and compositions and method of use of synthetic hydrogel sealants
WO2013082470A1 (en) 2011-12-02 2013-06-06 Pegasus Laboratories, Inc. Amphipathic lipid-based sustained release compositions
US20130142876A1 (en) 2011-12-02 2013-06-06 Pegasus Laboratories, Inc. Amphipathic lipid-based sustained release compositions
WO2013082529A1 (en) 2011-12-02 2013-06-06 Yale University Enzymatic synthesis of poly(amine-co-esters) and methods of use thereof for gene delivery
WO2013086322A1 (en) 2011-12-07 2013-06-13 Alnylam Pharmaceuticals, Inc. Branched alkyl and cycloalkyl terminated biodegradable lipids for the delivery of active agents
WO2013086373A1 (en) 2011-12-07 2013-06-13 Alnylam Pharmaceuticals, Inc. Lipids for the delivery of active agents
US20130195920A1 (en) 2011-12-07 2013-08-01 Alnylam Pharmaceuticals, Inc. Biodegradable lipids for the delivery of active agents
WO2013086354A1 (en) 2011-12-07 2013-06-13 Alnylam Pharmaceuticals, Inc. Biodegradable lipids for the delivery of active agents
WO2013084000A2 (en) 2011-12-07 2013-06-13 Isis Innovation Limited Exosomes for delivery of biotherapeutics
WO2013086526A1 (en) 2011-12-09 2013-06-13 The Regents Of The University Of California Liposomal drug encapsulation
US20130177499A1 (en) 2011-12-13 2013-07-11 Engenelc Molecular Delivery Pty Ltd Bacterially derived, intact minicells for delivery of therapeutic agents to brain tumors
US20130149318A1 (en) 2011-12-13 2013-06-13 Invivo Therapeutics Corporation Painting the pia, arachnoid, and spinal cord parenchyma
WO2013090648A1 (en) 2011-12-16 2013-06-20 modeRNA Therapeutics Modified nucleoside, nucleotide, and nucleic acid compositions
WO2013090601A2 (en) 2011-12-16 2013-06-20 Massachusetts Institute Of Technology Compact nanoparticles for biological applications
WO2013090861A1 (en) 2011-12-16 2013-06-20 Massachusetts Institute Of Technology Alpha-aminoamidine polymers and uses thereof
WO2013091001A1 (en) 2011-12-19 2013-06-27 The University Of Sydney A peptide-hydrogel composite
WO2013103659A1 (en) 2012-01-04 2013-07-11 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Stabilizing rna by incorporating chain-terminating nucleosides at the 3'-terminus
WO2013106073A1 (en) 2012-01-10 2013-07-18 Sorbent Therapeutics, Inc. Compositions comprising crosslinked cation-binding polymers and uses thereof
WO2013106086A1 (en) 2012-01-10 2013-07-18 Sorbent Therapeutics, Inc. Compositions comprising crosslinked cation-binding polymers and uses thereof
WO2013106072A1 (en) 2012-01-10 2013-07-18 Sorbent Therapeutics, Inc. Compositions comprising crosslinked cation-binding polymers and uses thereof
WO2013106525A1 (en) 2012-01-12 2013-07-18 Stc.Unm Immunogenic hpv l2-containing vlps and related compositions and methods
WO2013105101A1 (en) 2012-01-13 2013-07-18 Department Of Biotechnology Solid lipid nanoparticles entrapping hydrophilic/ amphiphilic drug and a process for preparing the same
WO2013106715A1 (en) 2012-01-13 2013-07-18 Allergan, Inc. Crosslinked hyaluronic acid-collagen gels for improving tissue graft viability and soft tissue augmentation
WO2013110028A1 (en) 2012-01-19 2013-07-25 The Johns Hopkins University Nanoparticle formulations with enhanced mucosal penetration
WO2013113502A1 (en) 2012-01-31 2013-08-08 Curevac Gmbh Negatively charged nucleic acid comprising complexes for immunostimulation
WO2013113326A1 (en) 2012-01-31 2013-08-08 Curevac Gmbh Pharmaceutical composition comprising a polymeric carrier cargo complex and at least one protein or peptide antigen
WO2013113501A1 (en) 2012-01-31 2013-08-08 Curevac Gmbh Pharmaceutical composition comprising a polymeric carrier cargo complex and at least one protein or pepide antigen
WO2013113736A1 (en) 2012-01-31 2013-08-08 Bayer Innovation Gmbh Pharmaceutical composition comprising a polymeric carrier cargo complex and an antigen
WO2013113325A1 (en) 2012-01-31 2013-08-08 Curevac Gmbh Negatively charged nucleic acid comprising complexes for immunostimulation
EP2623121A1 (en) 2012-01-31 2013-08-07 Bayer Innovation GmbH Pharmaceutical composition comprising a polymeric carrier cargo complex and an antigen
WO2013116126A1 (en) 2012-02-01 2013-08-08 Merck Sharp & Dohme Corp. Novel low molecular weight, biodegradable cationic lipids for oligonucleotide delivery
WO2013116656A1 (en) 2012-02-03 2013-08-08 Emory University Immunostimulatory compositions, particles, and uses related thereto
WO2013113071A1 (en) 2012-02-03 2013-08-08 Commonwealth Scientific And Industrial Research Organisation Branched polymers
WO2013119602A1 (en) 2012-02-06 2013-08-15 President And Fellows Of Harvard College Arrdc1-mediated microvesicles (armms) and uses thereof
US20130210991A1 (en) 2012-02-09 2013-08-15 Life Technologies Corporation Hydrophilic Polymeric Particles and Methods for Making and Using Same
WO2013119936A2 (en) 2012-02-09 2013-08-15 Life Technologies Corporation Hydrophilic polymeric particles and methods for making same
WO2013120052A1 (en) 2012-02-10 2013-08-15 E. I. Du Pont De Nemours And Company Preparation, purification and use of high-x diblock copolymers
WO2013122262A1 (en) 2012-02-16 2013-08-22 Vlp Therapeutics, Llc Virus like particle composition
WO2013123492A2 (en) 2012-02-17 2013-08-22 Massachusetts Institute Of Technology Glucose-responsive microgels for closed loop insulin delivery
WO2013123491A1 (en) 2012-02-17 2013-08-22 Massachusetts Institute Of Technology Self-regulated peptide hydrogel for insulin delivery
WO2013123125A1 (en) 2012-02-17 2013-08-22 President And Fellows Of Harvard College Assembly of nucleic acid sequences in emulsions
WO2013123298A1 (en) 2012-02-17 2013-08-22 University Of Georgia Research Foundation, Inc. Nanoparticles for mitochondrial trafficking of agents
WO2013123407A1 (en) 2012-02-17 2013-08-22 Celsion Corporation Thermosensitive nanoparticle formulations and method of making the same
WO2013123523A1 (en) 2012-02-19 2013-08-22 Nvigen, Inc. Uses of porous nanostructure in delivery
WO2013124654A1 (en) 2012-02-20 2013-08-29 Cambridge Enterprise Limited Cucurbituril-based hydrogels
WO2013124867A1 (en) 2012-02-21 2013-08-29 Amrita Vishwa Vidyapeetham University Polymer - polymer or polymer - protein core - shell nano medicine loaded with multiple drug molecules
WO2013124855A1 (en) 2012-02-21 2013-08-29 Ben-Gurion University Of The Negev Research And Development Authority Hydrogel system comprising spatially separated bioactive polypeptides
WO2013124620A1 (en) 2012-02-22 2013-08-29 The University Of Manchester Method of making a hydrogel
WO2013151666A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of biologics and proteins associated with human disease
WO2013151668A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of secreted proteins
WO2013151663A1 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of membrane proteins
WO2013151672A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of oncology-related proteins and peptides
WO2013151669A1 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
WO2013151671A1 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of cosmetic proteins and peptides
WO2013151667A1 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides
WO2013151670A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of nuclear proteins
WO2013151664A1 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of proteins
WO2013151665A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of proteins associated with human disease
WO2013151736A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics In vivo production of proteins
WO2014028429A2 (en) 2012-08-14 2014-02-20 Moderna Therapeutics, Inc. Enzymes and polymerases for the synthesis of rna

Non-Patent Citations (212)

* Cited by examiner, † Cited by third party
Title
"Biocomputing: Informatics and Genome Projects", 1993, ACADEMIC PRESS
"Cancer Principles and Practice of Oncology", 15 February 2001, LIPPINCOTT WILLIAMS & WILKINS PUBLISHERS
"Computational Molecular Biology", 1988, OXFORD UNIVERSITY PRESS
"Computer Analysis of Sequence Data, Part l", 1994, HUMANA PRESS
"Remington: The Science and Practice of Pharmacy", 2005, LIPPINCOTT WILLIAMS & WILKINS
"Sequence Analysis Primer", 1991, M. STOCKTON PRESS
8TH INTERNATIONAL JUDAH FOLKMAN CONFERENCE, 8 October 2010 (2010-10-08)
A. R. GENNARO: "Remington: The Science and Practice of Pharmacy", 2006, LIPPINCOTT, WILLIAMS & WILKINS
ABRAHAM ET AL.: "Chaotic Mixer for Microchannels", SCIENCE, vol. 295, 2002, pages 647 - 651
ABRAMOVA, MOLECULES, vol. 18, 2013, pages 1063 - 1075
AKINC ET AL., MOL THER., vol. 17, 2009, pages 872 - 879
AKINC ET AL., MOL THER., vol. 18, 2010, pages 1357 - 1364
AKINC ET AL., NAT BIOTECHNOL., vol. 26, 2008, pages 561 - 569
ALEKU ET AL., CANCER RES., vol. 68, 2008, pages 9788 - 9798
ANAND; CHERESH, CURR OPIN HEMATOL, vol. 18, 2011, pages 171 - 176
ANDRE ET AL., CURR GENE THER., vol. 10, 2010, pages 267 - 280
BAIN ET AL., NUCLEIC ACIDS RESEARCH, vol. 20, no. 16, 1992, pages 4372
BARTEL, CELL, vol. 136, 2009, pages 215 - 233
BASHA ET AL., MOL THER., vol. 19, 2011, pages 2186 - 2200
BASHA ET AL., MOL. THER., vol. 19, 2011, pages 2186 - 2200
BATTIG ET AL., J. AM. CHEM. SOCIETY, vol. 134, 2012, pages 12410 - 12413
BELLIVEAU, N.M. ET AL.: "Microfluidic synthesis of highly potent limit-size lipid nanoparticles for in vivo delivery of siRNA", MOLECULAR THERAPY-NUCLEIC ACIDS, vol. 1, 2012, pages E37
BEN-ARIE ET AL., METHODS MOL BIOL., vol. 757, 2012, pages 497 - 507
BENOIT ET AL., BIOMACROMOLECULES, vol. 12, 2011, pages 2708 - 2714
BONAUER ET AL., CURR DRUG TARGETS, vol. 11, 2010, pages 943 - 949
BONORA ET AL., NUCLEIC ACIDS RESEARCH, vol. 18, 1990, pages 3155 - 3159
BOROVKOV ET AL., NUCLEIC ACIDS RESEARCH, vol. 38, no. 19, 2010, pages E180
BRIEBA ET AL., BIOCHEMISTRY, vol. 41, 2002, pages 5144 - 5149
CARILLO ET AL., SIAM J. APPLIED MATH., vol. 48, 1988, pages 1073
CARON ET AL., MOL. THER., vol. 3, no. 3, 2001, pages 310 - 8
CATELAS ET AL., TISSUE ENGINEERING, vol. 14, 2008, pages 119 - 128
CHANG ET AL.: "Non-ionic amphiphilic biodegradable PEG-PLGA-PEG copolymer enhances gene delivery efficiency in rat skeletal muscle", J CONTROLLED RELEASE, vol. 118, 2007, pages 245 - 253, XP005912153, DOI: doi:10.1016/j.jconrel.2006.11.025
CHATURVEDI ET AL., EXPERT OPIN DRUG DELIV., vol. 8, 2011, pages 1455 - 1468
CHEN, D. ET AL.: "Rapid discovery of potent siRNA-containing lipid nanoparticles enabled by controlled microfluidic formulation", J AM CHEM SOC., vol. 134, no. 16, 2012, pages 6948 - 51, XP002715254, DOI: doi:10.1021/ja301621z
CHENG ET AL., PNAS, vol. 91, 1994, pages 5695 - 5699
CHIARELLA ET AL., CURR GENE THER., vol. 10, 2010, pages 281 - 286
CHO ET AL., ADV. FUNCT. MATER., vol. 19, 2009, pages 3112 - 3118
CHU ET AL., ACE CHEM RES., 13 January 2012 (2012-01-13)
CLEARY ET AL., NATURE METHODS, vol. 1, no. 3, 2004, pages 241 - 247
COMPTON, NATURE, vol. 350, 1991, pages 91 - 92
CONTRERAS; RAO, LEUKEMIA, vol. 26, 20 December 2011 (2011-12-20), pages 404 - 413
CONVERTINE ET AL., BIOMACROMOLECULES, 1 October 2010 (2010-10-01)
CRONICAN ET AL., ACS CHEM. BIOL., vol. 5, 2010, pages 747 - 752
CUBURU ET AL.: "Intravaginal immunization with HPV vectors induces tissue-resident CD8+ T cell responses", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 122, no. 12, 2012, pages 4606 - 4620, XP002767208
CUSI, HUM VACCIN, vol. 2, 2006, pages 1 - 7
DAUBENDIEK ET AL., JACS, vol. 117, 1995, pages 7818 - 7819
DAVIS, MOL PHARM., vol. 6, 2009, pages 659 - 668
DAVIS, NATURE, vol. 464, 2010, pages 1067 - 1070
DE JONGE ET AL., GENE THER., vol. 13, 2006, pages 400 - 411
DEFOUGEROLLES, HUM GENE THER., vol. 19, 2008, pages 125 - 132
DEKOKER ET AL., ADV DRUG DELIV REV., vol. 63, 2011, pages 748 - 761
DESHAYES ET AL., CELL. MOL. LIFE SCI., vol. 62, no. 16, 2005, pages 1839 - 49
EL-ANDALOUSSI ET AL., CURR. PHARM. DES., vol. 11, no. 28, 2003, pages 3597 - 611 1
EL-SAGHEER ET AL., ACCOUNTS OF CHEMICAL RESEARCH, vol. 45, no. 8, 2012, pages 1258 - 1267
ENDRES ET AL., BIOMATERIALS, vol. 32, 2011, pages 7721 - 7731
ENSIGN ET AL., BIOMATERIALS, vol. 34, no. 28, 2013, pages 6922 - 9
ESVELT ET AL., NATURE, vol. 472, no. 7344, 2011, pages 499 - 503
FADL ET AL., PHARMAZIE, vol. 50, 1995, pages 382 - 7
FANG ET AL., EXPERT OPIN BIOL THER., vol. 12, 2012, pages 385 - 389
FARROW M ET AL: "Combinatorial recombination of gene fragments to construct a library of chimeras", CURRENT PROTOCOLS IN PROTEIN SCIENCE 2010 JOHN WILEY AND SONS INC. USA, no. SUPPL. 61, August 2010 (2010-08-01), pages 26.2.1 - 26.2.20, XP002733355, ISSN: 1934-3655 *
FENSKE; CULLIS, EXPERT OPIN DRUG DELIV., vol. 5, 2008, pages 25 - 44
FOTIN-MLECZEK ET AL., J. IMMUNOTHER., vol. 34, 2011, pages 1 - 15
FRANK-KAMENETSKY ET AL., PROC NATL ACAD SCI U S A., vol. 105, 2008, pages 11915 - 11920
FREEMAN ET AL., BIOTECHNIQUES, vol. 26, no. 1, 1999, pages 112 - 22,124-5
FROST, EXPERT OPIN. DRUG DELIV., vol. 4, 2007, pages 427 - 440
FULLER ET AL., BIOMATERIALS, vol. 29, 2008, pages 1526 - 1532
GEALL ET AL.: "Nonviral delivery of self amplifying RNA vaccines", PNAS, 2012
GETNER; NALDINI, TISSUE ANTIGENS, vol. 80, 2012, pages 393 - 403
GIBSON ET AL., NATURE METHODS, vol. 7, 2010, pages 901 - 903
GIBSON ET AL., SCIENCE, vol. 329, 2010, pages 52 - 56
GILJOHANN ET AL., JOURN. AMER. CHEM. SOC., vol. 131, no. 6, 2009, pages 2072 - 2073
GODFRIN ET AL., EXPERT OPIN BIOL THER., vol. 12, 2012, pages 127 - 133
GONZALEZ-ASEQUINOLAZA ET AL., GASTROENTEROLOGY, vol. 139, 2010, pages 726 - 729
GOODCHILD, BIOCONJUGATE CHEMISTRY, vol. 1, no. 3, 1990, pages 165 - 187
GORDON ET AL.: "Targeting the Vaginal Mucosa with Human Papillomavirus Psedudovirion Vaccines delivering SIV DNA", J IMMUNOL., vol. 188, no. 2, 2012, pages 714 - 723
GRABOW; JAEGAR, NATURE MATERIALS, vol. 11, 2012, pages 269 - 269
GREENE ET AL.: "Protective Groups in Organic Synthesis", 1991, WILEY & SONS
GRIMSON A; FARH KK; JOHNSTON WK; GARRETT-ENGELE P; LIM LP; BARTEL DP, MOL CELL, vol. 27, no. 1, 6 July 2007 (2007-07-06), pages 91 - 105
GUTBIER ET AL., PULM PHARMACOL. THER., vol. 23, 2010, pages 334 - 344
GUZAEV, CURRENT PROTOCOLS IN NUCLEIC ACID CHEMISTRY, vol. 3.1., 2013, pages L-3.1.60
HEIDEL ET AL., PROC NATL ACAD SCI USA, vol. 104, 2007, pages 5715 - 21
HEINJE, G.: "Sequence Analysis in Molecular Biology", 1987, ACADEMIC PRESS
HEYES ET AL., J CONTR REL., vol. 107, 2005, pages 276 - 287
HEYES ET AL., MOL THER., vol. 15, 2007, pages 713 - 720
HOJMAN, CURR GENE THER., vol. 10, 2010, pages 128 - 138
HU ET AL., PROC NATL ACAD SCI U S A., vol. 108, 2011, pages 10980 - 10985
HUCKRIEDE ET AL., J LIPOSOME RES., vol. 17, 2007, pages 39 - 47
HU-LIESKOVAN ET AL., CANCER RES., vol. 65, 2005, pages 8984 - 8982
HUNG ET AL.: "Ovarian Cancer Gene Therapy Using HPV-16 Psedudovirion Carrying the HSV-tk Gene", PLOS ONE, vol. 7, no. 7, 2012, pages E40983
INNIS ET AL., PNAS, vol. 85, 1988, pages 9436 - 9440
IWASE ET AL., NUCLEIC ACIDS RESEARCH, vol. 20, 1992, pages 1643 - 1648
J CONTROL RELEASE, vol. 170, no. 2, 2013, pages 279 - 86
J. MOL BIOL, vol. 266, no. 4, 1997, pages 814 - 830
JEFFS ET AL., PHARM RES., vol. 22, 2005, pages 362 - 372
JOHNSON ET AL.: "Role of Heparan Sulfate in Attachment to and Infection of the Murine Femal Genital Tract by Human Papillomavirus", J VIROLOGY, vol. 83, no. 5, 2009, pages 2067 - 2074
JUDGE ET AL., J CLIN INVEST., vol. 119, 2009, pages 661 - 673
JUNJIE LI ET AL., CURRENT BIOLOGY, vol. 15, 23 August 2005 (2005-08-23), pages 1501 - 1507
KANG ET AL., NUCLEIC ACIDS RESEARCH, vol. 32, no. 4, 2004, pages 4411 - 4419
KANWAR JAGAT R ET AL: "Chimeric aptamers in cancer cell-targeted drug delivery", CRITICAL REVIEWS IN BIOCHEMISTRY AND MOLECULAR BIOLOGY, vol. 46, no. 6, December 2011 (2011-12-01), pages 459 - 477, XP002733357 *
KATZ ET AL., ANESTH ANALG, vol. 98, 2004, pages 371 - 76
KAUFMANN ET AL., MICROVASC RES, vol. 80, 2010, pages 286 - 293
KAZIKAWA ET AL., J CONTR REL., vol. 111, 2006, pages 368 - 370
KAZIKAWA ET AL., J CONTR REL., vol. 97, 2004, pages 345 - 356
KIDD ET AL., JOURNAL OF CONTROLLED RELEASE, vol. 157, 2012, pages 80 - 85
KIM ET AL., METHODS MOL BIOL., vol. 721, 2011, pages 339 - 353
KINES ET AL.: "The initial steps leading to papillomavirus infection occur on the basement membrane prior to cell surface binding", PNAS, vol. 106, no. 48, 2009, pages 20458 - 20463, XP055094958, DOI: doi:10.1073/pnas.0908502106
KIRPOTIN ET AL., CANCER RES., vol. 66, 2006, pages 6732 - 6740
KOLHATKAR ET AL., CURR DRUG DISCOV TECHNOL., vol. 8, 2011, pages 197 - 206
KUWAHARA MASAYASU ET AL: "Molecular evolution of functional nucleic acids with chemical modifications.", MOLECULES (BASEL, SWITZERLAND) AUG 2010, vol. 15, no. 8, August 2010 (2010-08-01), pages 5423 - 5444, XP002733356, ISSN: 1420-3049 *
LAI ET AL., ADV DRUG DELIV REV., vol. 61, no. 2, 2009, pages 158 - 171
LAI ET AL., PNAS, vol. 104, no. 5, 2007, pages 1482 - 487
LANDEN ET AL., CANCER BIOLOGY & THERAPY, vol. 5, no. 12, 2006, pages 1708 - 1713
LANDGRAF ET AL., CELL, vol. 129, 2007, pages 1401 - 1414
LANGEL: "Cell-Penetrating Peptides: Processes and Applications", 2002, CRC PRESS
LANGMUIR, vol. 28, 2012, pages 3633 - 40
LAVRIK ET AL., BIOCHEMISTRY, vol. 40, 2001, pages 11777 - 11784
LEE ET AL., NATURE NANOTECHNOLOGY, vol. 7, 2012, pages 389 - 393
LEE ET AL.: "Thermosensitive Hydrogel as a Tgf-?1 Gene Delivery Vehicle Enhances Diabetic Wound Healing", PHARMACEUTICAL RESEARCH, vol. 20, no. 12, 2003, pages 1995 - 2000
LEUSCHNER ET AL., NAT BIOTECHNOL, vol. 29, 2011, pages 1005 - 1010
LEUSCHNER ET AL., NAT BIOTECHNOL., vol. 29, 2011, pages 1005 - 1010
LI ET AL., J CONTR REL., vol. 142, 2010, pages 416 - 421
LI ET AL., J CONTR REL., vol. 158, 2012, pages 108 - 114
LI ET AL.: "Controlled Gene Delivery System Based on Thermosensitive Biodegradable Hydrogel", PHARMACEUTICAL RESEARCH, vol. 20, no. 6, 2003, pages 884 - 888
LIU; HUANG, MOLECULAR THERAPY, 2010, pages 669 - 670
LIZARDI ET AL., NATURE GENETICS, vol. 19, 1998, pages 225 - 232
LOVE ET AL., PROC NATL ACAD SCI U S A., vol. 107, 2010, pages 1864 - 1869
LUND ET AL., PHARM RES., vol. 27, 2010, pages 400 - 420
MA ET AL.: "HPV pseudovirions as DNA delivery vehicles", THER DELIV., vol. 2, no. 4, 2011, pages 427 - 430
MAHON ET AL., BIOCONJUG CHEM., vol. 21, 2010, pages 1448 - 1454
MANGANIELLO ET AL., BIOMATERIALS, vol. 33, 2012, pages 2301 - 2309
MARTIN ET AL., HELV. CHIM. ACTA, vol. 78, 1995, pages 486 - 504
MARTINELLI ET AL., CLINICAL CHEMISTRY, vol. 42, 1996, pages 14 - 18
MATSUDA; MAURO, PLOS ONE, vol. 5, 2010, pages 11
MCNAUGHTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 106, 2009, pages 6111 - 6116
MOORE ET AL., SCIENCE, vol. 256, 1992, pages 992 - 997
MORRISSEY ET AL., NAT BIOTECHNOL., vol. 2, 2005, pages 1002 - 1007
MURUGAIAH ET AL., ANALYTICAL BIOCHEMISTRY, vol. 401, 2010, pages 61
MUSACCHIO; TORCHILIN, FRONT BIOSCI., vol. 16, 2011, pages 1388 - 1412
NAGATA ET AL., NUCLEIC ACIDS RESEARCH, vol. 38, no. 21, 2010, pages 7845 - 7857
NEWMAN; BETTINGER, GENE, vol. 14, 2007, pages 465 - 475
NGUYEN; LEE: "Injectable Biodegradable Hydrogels", MACROMOLECULAR BIOSCIENCE, vol. 10, 2010, pages 563 - 579
NIELSEN ET AL., SCIENCE, vol. 254, 1991, pages 1497 - 1500
NOMURA ET AL., BIOORG MED. CHEM., vol. 11, 2003, pages 2453 - 61
NORBURY: "Cytoplasmic RNA: a case of the tail wagging the dog", NATURE REVIEWS MOLECULAR CELL BIOLOGY; AOP, 29 August 2013 (2013-08-29)
NWE ET AL., CANCER BIOTHERAPY AND RADIOPHARMACEUTICALS, vol. 24, no. 3, 2009, pages 289 - 302
OCHMAN ET AL., GENETICS, vol. 120, no. 3, 1988, pages 621 - 623
PASCOLO, EXPERT OPIN. BIOL. THER., vol. 4, pages 1285 - 1294
PATIL ET AL., CRIT REV THER DRUG CARRIER SYST., vol. 25, 2008, pages 1 - 61
PEER ET AL., PROC NATL ACAD SCI U S A., vol. 104, 2007, pages 4095 - 4100
PEER ET AL., PROC NATL ACAD SCI U S A., vol. 104, 6 December 2006 (2006-12-06), pages 4095 - 4100
PEER ET AL., SCIENCE, vol. 319, 2008, pages 627 - 630
PEER, J CONTROL RELEASE, vol. 20, 2010, pages 63 - 68
PEER; LIEBERMAN, GENE THER., vol. 18, 2011, pages 1127 - 1133
PITELLA ET AL., BIOMATERIALS, vol. 32, 2011, pages 3106 - 3114
PLOS ONE, vol. 5, 2010, pages 11
POLIDOROS ET AL., BIOTECHNIQUES, vol. 41, 2006, pages 35 - 42
PON ET AL., NUCLEIC ACID RESEARCH, vol. 27, 1999, pages 1531 - 1538
POSTEMA; GILJA, CURR PHARM BIOTECHNOL., vol. 8, 2007, pages 355 - 361
REMINGTON; A. R. GENNARO: "The Science and Practice of pharmacy", 2006, LIPPINCOTT, WILLIAMS & WILKINS
ROBERTS ET AL.: "Genital transmission of HPV in a mouse model is potentiated by nonoxynol-9 and inhibited by carrageenan", NATURE MEDICINE, vol. 13, no. 7, 2007, pages 857 - 861, XP002537493, DOI: doi:10.1038/nm1598
RODRIGUEZ ET AL., SCIENCE, vol. 339, 2013, pages 971 - 975
ROZEMA ET AL., PROC NATL ACAD SCI U S A., vol. 104, 2007, pages 12982 - 12887
SANTEL ET AL., GENE THER, vol. 13, 2006, pages 1222 - 1234
SANTEL ET AL., GENE THER, vol. 13, 2006, pages 1360 - 1370
SANTEL ET AL., GENE, vol. 13, 2006, pages 1222 - 1234
SANTEL ET AL., GENE, vol. 13, 2006, pages 1360 - 1370
SAWYER, CHEM BIOL, vol. 73, 2009, pages 3 - 6
SCHAFFERT; WAGNER, GENE THER., vol. 16, 2008, pages 1131 - 1138
SCHMITT ET AL., GASTROENTEROLOGY, vol. 139, 2010, pages 999 - 1007
SCHROEDER ET AL., J INTERN MED., vol. 267, 2010, pages 9 - 21
SCIENCE, vol. 255, 1992, pages 996 - 998
SEMPLE ET AL., NATURE BIOTECH., vol. 28, 2010, pages 172 - 176
SHI ET AL., ANGEW CHEM INT ED., vol. 50, 2011, pages 7027 - 7031
SHIBA ET AL., NUCLEIC ACIDS RESEARCH, vol. 35, 2007, pages 3287 - 3296
SIEGWART ET AL., PROC NATL ACAD SCI U S A., vol. 108, 2011, pages 12996 - 13001
SIEGWART ET AL., PROC NATL ACAD SCI U S A., vol. 108, 2011, pages 12996 - 3001
SINDELAR ET AL., NUCLEIC ACIDS RESEARCH, vol. 23, 1995, pages 982 - 987
SINGHA ET AL., NUCLEIC ACID THER., vol. 2, 2011, pages 133 - 147
SMITH ET AL., CANCER CHEMOTHERAPTY AND PHARMACOLOGY, vol. 44, no. 4, 1999, pages 267 - 274
SONG ET AL., NAT BIOTECHNOL., vol. 23, 2005, pages 709 - 717
SONG ET AL., NATURE BIOTECHNOL., vol. 23, 2005, pages 709 - 717
SPICER; MIKOS, JOURNAL OF CONTROLLED RELEASE, vol. 148, 2010, pages 49 - 55
SRINIVASAN ET AL., METHODS MOL BIOL., vol. 820, 2012, pages 105 - 116
STARK ET AL., RNA, vol. 12, 2006, pages 2014 - 2019
STEPHEN F. ALTSCHUL; THOMAS L. MADDEN; ALEJANDRO A. SCHDFFER; JINGHUI ZHANG; ZHENG ZHANG; WEBB MILLER; DAVID J. LIPMAN: "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402, XP002905950, DOI: doi:10.1093/nar/25.17.3389
STRUMBERG ET AL., INT J CLIN PHARMACOL THER, vol. 50, 2012, pages 76 - 78
SU ET AL., MOL PHARM., vol. 8, no. 3, 6 June 2011 (2011-06-06), pages 774 - 87
SUBRAMANYA ET AL., MOL THER., vol. 18, 2010, pages 2028 - 2037
SULLIVAN ET AL., EXPERT OPIN DRUG DELIV., vol. 7, 2010, pages 1433 - 1446
T. E. CREIGHTON: "Proteins: Structure and Molecular Properties", 1983, W.H. FREEMAN & CO., pages: 79 - 86
TAKITA, DNA RESEARCH, vol. 20, no. 4, 2013, pages 1 - 10
TOURIOL ET AL., BIOLOGY OF THE CELL, vol. 95, 2003, pages 169 - 178
VERDINE; HILINSKI, METHODS ENZYMOL., vol. 503, 2012, pages 3 - 33
VERMA; ECKSTEIN, ANNUAL REVIEW OF BIOCHEMISTRY, vol. 76, 1998, pages 99 - 134
WALKER ET AL., PNAS, vol. 89, 1992, pages 392 - 396
WANG ET AL., NAT MATER., vol. 5, 2006, pages 791 - 796
WANG ET AL., NUCLEIC ACIDS RES., vol. 37, 2009, pages D933 - 7
WEIDE ET AL., J IMMUNOTHER., vol. 31, 2008, pages 180 - 188
WEIDE ET AL., J IMMUNOTHER., vol. 32, 2009, pages 498 - 507
WHEELER ET AL., GENE THERAPY, vol. 6, 1999, pages 271 - 281
WHITEHEAD ET AL., MOL. THER., vol. 19, 2011, pages 1688 - 1694
WHITESIDES, GEORGE M.: "The Origins and the Future of Microfluidics", NATURE, vol. 442, 2006, pages 368 - 373, XP055123139, DOI: doi:10.1038/nature05058
WIEDMANN ET AL., PCR METHODS AND APPLICATION, vol. 3, no. 4, 1994, pages S51 - S64
YANG ET AL., ANGEW. CHEM. INT. ED., vol. 50, 2011, pages 2597 - 2600
YANG ET AL., MOL THER., vol. 20, 2012, pages 609 - 615
YOON; PARK, EXPERT OPIN DRUG DELIV., vol. 7, 2010, pages 321 - 330
YU ET AL., MOL MEMBR BIOL., vol. 27, 2010, pages 286 - 298
ZHANG ET AL., ACS NANO, vol. 2, no. 8, 2008, pages 1696 - 1702
ZHANG ET AL., GENE THERAPY, vol. 6, 1999, pages 1438 - 1447
ZHAO ET AL., EXPERT OPIN DRUG DELIV., vol. 5, 2008, pages 309 - 319
ZHU ET AL., NUCLEIC ACIDS RESEARCH, 2013
ZIMMERMANN ET AL., NATURE, vol. 441, 2006, pages 111 - 114

Cited By (112)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11298426B2 (en) 2003-10-14 2022-04-12 BioNTech SE Recombinant vaccines and use thereof
US10106800B2 (en) 2005-09-28 2018-10-23 Biontech Ag Modification of RNA, producing an increased transcript stability and translation efficiency
US12385049B2 (en) 2005-09-28 2025-08-12 BioNTech SE Modification of RNA, producing an increased transcript stability and translation efficiency
US9447164B2 (en) 2010-08-06 2016-09-20 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9181319B2 (en) 2010-08-06 2015-11-10 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9937233B2 (en) 2010-08-06 2018-04-10 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US9701965B2 (en) 2010-10-01 2017-07-11 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US12419957B2 (en) 2011-03-31 2025-09-23 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US12364763B2 (en) 2011-03-31 2025-07-22 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US12502431B2 (en) 2011-03-31 2025-12-23 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9533047B2 (en) 2011-03-31 2017-01-03 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US11911474B2 (en) 2011-03-31 2024-02-27 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US10898574B2 (en) 2011-03-31 2021-01-26 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US12409226B2 (en) 2011-03-31 2025-09-09 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9950068B2 (en) 2011-03-31 2018-04-24 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US10738355B2 (en) 2011-05-24 2020-08-11 Tron-Translationale Onkologie An Der Universitätsmedizin Der Johannes Gutenberg-Universität Mainz Ggmbh Individualized vaccines for cancer
US11248264B2 (en) 2011-05-24 2022-02-15 Tron-Translationale Onkologie An Der Universitätsmedizin Der Johannes Gutenberg-Universität Mainz Ggmbh Individualized vaccines for cancer
US9295689B2 (en) 2011-12-16 2016-03-29 Moderna Therapeutics, Inc. Formulation and delivery of PLGA microspheres
US9186372B2 (en) 2011-12-16 2015-11-17 Moderna Therapeutics, Inc. Split dose administration
US10485884B2 (en) 2012-03-26 2019-11-26 Biontech Rna Pharmaceuticals Gmbh RNA formulation for immunotherapy
US11559587B2 (en) 2012-03-26 2023-01-24 Tron-Translationale Onkologie An Der Universitätsmedizin Der Johannes Gutenberg-Universität Mainz Ggmbh RNA formulation for immunotherapy
US10703789B2 (en) 2012-04-02 2020-07-07 Modernatx, Inc. Modified polynucleotides for the production of secreted proteins
US10577403B2 (en) 2012-04-02 2020-03-03 Modernatx, Inc. Modified polynucleotides for the production of secreted proteins
US9233141B2 (en) 2012-04-02 2016-01-12 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders
US9675668B2 (en) 2012-04-02 2017-06-13 Moderna Therapeutics, Inc. Modified polynucleotides encoding hepatitis A virus cellular receptor 2
US9572897B2 (en) 2012-04-02 2017-02-21 Modernatx, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9107886B2 (en) 2012-04-02 2015-08-18 Moderna Therapeutics, Inc. Modified polynucleotides encoding basic helix-loop-helix family member E41
US9782462B2 (en) 2012-04-02 2017-10-10 Modernatx, Inc. Modified polynucleotides for the production of proteins associated with human disease
US9814760B2 (en) 2012-04-02 2017-11-14 Modernatx, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
US9828416B2 (en) 2012-04-02 2017-11-28 Modernatx, Inc. Modified polynucleotides for the production of secreted proteins
US9827332B2 (en) 2012-04-02 2017-11-28 Modernatx, Inc. Modified polynucleotides for the production of proteins
US9114113B2 (en) 2012-04-02 2015-08-25 Moderna Therapeutics, Inc. Modified polynucleotides encoding citeD4
US9878056B2 (en) 2012-04-02 2018-01-30 Modernatx, Inc. Modified polynucleotides for the production of cosmetic proteins and peptides
US9149506B2 (en) 2012-04-02 2015-10-06 Moderna Therapeutics, Inc. Modified polynucleotides encoding septin-4
US9192651B2 (en) 2012-04-02 2015-11-24 Moderna Therapeutics, Inc. Modified polynucleotides for the production of secreted proteins
US9301993B2 (en) 2012-04-02 2016-04-05 Moderna Therapeutics, Inc. Modified polynucleotides encoding apoptosis inducing factor 1
US9303079B2 (en) 2012-04-02 2016-04-05 Moderna Therapeutics, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9220755B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders
US9216205B2 (en) 2012-04-02 2015-12-22 Moderna Therapeutics, Inc. Modified polynucleotides encoding granulysin
US9254311B2 (en) 2012-04-02 2016-02-09 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins
US9283287B2 (en) 2012-04-02 2016-03-15 Moderna Therapeutics, Inc. Modified polynucleotides for the production of nuclear proteins
US9095552B2 (en) 2012-04-02 2015-08-04 Moderna Therapeutics, Inc. Modified polynucleotides encoding copper metabolism (MURR1) domain containing 1
US9255129B2 (en) 2012-04-02 2016-02-09 Moderna Therapeutics, Inc. Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1
US9220792B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. Modified polynucleotides encoding aquaporin-5
US9221891B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. In vivo production of proteins
US9587003B2 (en) 2012-04-02 2017-03-07 Modernatx, Inc. Modified polynucleotides for the production of oncology-related proteins and peptides
US10385106B2 (en) 2012-04-02 2019-08-20 Modernatx, Inc. Modified polynucleotides for the production of secreted proteins
US9597380B2 (en) 2012-11-26 2017-03-21 Modernatx, Inc. Terminally modified RNA
US11504419B2 (en) 2012-11-28 2022-11-22 BioNTech SE Individualized vaccines for cancer
US10155031B2 (en) 2012-11-28 2018-12-18 Biontech Rna Pharmaceuticals Gmbh Individualized vaccines for cancer
US11603399B2 (en) 2013-03-13 2023-03-14 Modernatx, Inc. Long-lived polynucleotide molecules
US10258698B2 (en) 2013-03-14 2019-04-16 Modernatx, Inc. Formulation and delivery of modified nucleoside, nucleotide, and nucleic acid compositions
US10138507B2 (en) 2013-03-15 2018-11-27 Modernatx, Inc. Manufacturing methods for production of RNA transcripts
US10590161B2 (en) 2013-03-15 2020-03-17 Modernatx, Inc. Ion exchange purification of mRNA
US10077439B2 (en) 2013-03-15 2018-09-18 Modernatx, Inc. Removal of DNA fragments in mRNA production process
US11377470B2 (en) 2013-03-15 2022-07-05 Modernatx, Inc. Ribonucleic acid purification
US10858647B2 (en) 2013-03-15 2020-12-08 Modernatx, Inc. Removal of DNA fragments in mRNA production process
US11845772B2 (en) 2013-03-15 2023-12-19 Modernatx, Inc. Ribonucleic acid purification
US11222711B2 (en) 2013-05-10 2022-01-11 BioNTech SE Predicting immunogenicity of T cell epitopes
US11027025B2 (en) 2013-07-11 2021-06-08 Modernatx, Inc. Compositions comprising synthetic polynucleotides encoding CRISPR related proteins and synthetic sgRNAs and methods of use
US10815291B2 (en) 2013-09-30 2020-10-27 Modernatx, Inc. Polynucleotides encoding immune modulating polypeptides
US10023626B2 (en) 2013-09-30 2018-07-17 Modernatx, Inc. Polynucleotides encoding immune modulating polypeptides
US10385088B2 (en) 2013-10-02 2019-08-20 Modernatx, Inc. Polynucleotide molecules and uses thereof
US10286086B2 (en) 2014-06-19 2019-05-14 Modernatx, Inc. Alternative nucleic acid molecules and uses thereof
EP3157572A4 (en) * 2014-06-19 2018-02-14 Moderna Therapeutics, Inc. Alternative nucleic acid molecules and uses thereof
EP3157573A4 (en) * 2014-06-19 2018-02-21 Moderna Therapeutics, Inc. Alternative nucleic acid molecules and uses thereof
EP4159741A1 (en) 2014-07-16 2023-04-05 ModernaTX, Inc. Method for producing a chimeric polynucleotide encoding a polypeptide having a triazole-containing internucleotide linkage
US10407683B2 (en) 2014-07-16 2019-09-10 Modernatx, Inc. Circular polynucleotides
WO2016014846A1 (en) 2014-07-23 2016-01-28 Moderna Therapeutics, Inc. Modified polynucleotides for the production of intrabodies
US12220484B2 (en) 2014-09-25 2025-02-11 BioNTech SE Stable formulations of lipids and liposomes
US11173120B2 (en) 2014-09-25 2021-11-16 Biontech Rna Pharmaceuticals Gmbh Stable formulations of lipids and liposomes
US11156617B2 (en) 2015-02-12 2021-10-26 BioNTech RNA Pharmaceuticals GbmH Predicting T cell epitopes useful for vaccination
US12071620B2 (en) 2015-09-17 2024-08-27 Modernatx, Inc. Polynucleotides containing a morpholino linker
US12109274B2 (en) 2015-09-17 2024-10-08 Modernatx, Inc. Polynucleotides containing a stabilizing tail region
US11434486B2 (en) 2015-09-17 2022-09-06 Modernatx, Inc. Polynucleotides containing a morpholino linker
US11590157B2 (en) 2015-10-05 2023-02-28 Modernatx, Inc. Methods for therapeutic administration of messenger ribonucleic acid drugs
US12246030B2 (en) 2015-10-05 2025-03-11 Modernatx, Inc. Methods for therapeutic administration of messenger ribonucleic acid drugs
US10849920B2 (en) 2015-10-05 2020-12-01 Modernatx, Inc. Methods for therapeutic administration of messenger ribonucleic acid drugs
US11492628B2 (en) 2015-10-07 2022-11-08 BioNTech SE 3′-UTR sequences for stabilization of RNA
US12516333B2 (en) 2015-10-07 2026-01-06 BioNTech SE 3′-UTR sequences for stabilization of RNA
JP7625568B2 (ja) 2015-10-22 2025-02-03 モデルナティエックス インコーポレイテッド 癌ワクチン
JP2023024669A (ja) * 2015-10-22 2023-02-16 モデルナティエックス インコーポレイテッド 癌ワクチン
US12582609B2 (en) 2015-10-22 2026-03-24 Modernatx, Inc. Cancer vaccines
WO2017120612A1 (en) 2016-01-10 2017-07-13 Modernatx, Inc. Therapeutic mrnas encoding anti ctla-4 antibodies
US12385034B2 (en) 2016-06-24 2025-08-12 Modernatx, Inc. Methods and apparatus for filtration
WO2018009838A1 (en) 2016-07-07 2018-01-11 Rubius Therapeutics, Inc. Compositions and methods related to therapeutic cell systems expressing exogenous rna
US11820979B2 (en) * 2016-12-23 2023-11-21 Visterra, Inc. Binding polypeptides and methods of making the same
CN110366557B (zh) * 2016-12-23 2024-04-09 威特拉公司 结合多肽及其制备方法
CN110366557A (zh) * 2016-12-23 2019-10-22 威特拉公司 结合多肽及其制备方法
WO2018165547A1 (en) * 2017-03-10 2018-09-13 University Of Louisville Research Foundation, Inc. Fasl-engineered biomaterials with immunomodulatory function
EP4299749A3 (en) * 2017-03-10 2024-03-27 University Of Louisville Research Foundation, Inc. Fasl-engineered biomaterials with immunomodulatory function
US11602547B2 (en) 2017-03-10 2023-03-14 University Of Louisville Research Foundation, Inc. FasL-engineered biomaterials with immunomodulatory function
US12270813B2 (en) 2017-06-09 2025-04-08 BioNTech SE Methods for predicting the usefulness of disease specific amino acid modifications for immunotherapy
WO2019008335A1 (en) 2017-07-07 2019-01-10 Avacta Life Sciences Limited SCAFFOLD PROTEINS
EP4467650A2 (en) 2017-07-07 2024-11-27 Avacta Life Sciences Limited Scaffold proteins
US12139617B2 (en) 2017-12-22 2024-11-12 North Carolina State University Polymeric fluorophores, compositions comprising the same, and methods of preparing and using the same
WO2020047394A1 (en) * 2018-08-31 2020-03-05 The Trustees Of The University Of Pennsylvania Injectable hydrogels for local delivery to the heart
CN109796769B (zh) * 2018-12-27 2021-06-25 李新虹 一种医学护理手套
CN109796769A (zh) * 2018-12-27 2019-05-24 李新虹 一种医学护理手套
WO2020233706A1 (zh) * 2019-05-22 2020-11-26 华东理工大学 一种治疗躁狂型精神障碍及精神分裂症的药物
WO2021074695A1 (en) 2019-10-16 2021-04-22 Avacta Life Sciences Limited PD-L1 INHIBITOR - TGFβ INHIBITOR BISPECIFIC DRUG MOIETIES.
US12115230B2 (en) 2020-04-09 2024-10-15 Verve Therapeutics, Inc. Base editing of ANGPTL3 and methods of using same for treatment of disease
WO2021249786A1 (en) 2020-06-09 2021-12-16 Avacta Life Sciences Limited Sars-cov2 diagnostic polypeptides and methods
CN112162052A (zh) * 2020-11-06 2021-01-01 深圳市格物正源质量标准系统有限公司 一种水产品中兽药多残留的测定方法
WO2022234003A1 (en) 2021-05-07 2022-11-10 Avacta Life Sciences Limited Cd33 binding polypeptides with stefin a protein
WO2023057567A1 (en) 2021-10-07 2023-04-13 Avacta Life Sciences Limited Pd-l1 binding affimers
WO2023057946A1 (en) 2021-10-07 2023-04-13 Avacta Life Sciences Limited Serum half-life extended pd-l1 binding polypeptides
WO2023153876A1 (ko) 2022-02-10 2023-08-17 주식회사 아피셀테라퓨틱스 Cd40l에 특이적으로 결합하는 스테핀 a 단백질 변이체 및 이의 용도
WO2023218243A1 (en) 2022-05-12 2023-11-16 Avacta Life Sciences Limited Lag-3/pd-l1 binding fusion proteins
WO2025194138A1 (en) 2024-03-14 2025-09-18 Tessera Therapeutics, Inc. St1cas9 compositions and methods for modulating a genome
CN118878604A (zh) * 2024-09-27 2024-11-01 北京炫景瑞医药科技有限公司 磷酯骨架修饰的核苷酸及寡核苷酸
CN118878604B (zh) * 2024-09-27 2025-01-24 北京炫景瑞医药科技有限公司 磷酯骨架修饰的核苷酸及寡核苷酸

Also Published As

Publication number Publication date
CA2923029A1 (en) 2015-03-12
AU2014315287A1 (en) 2015-03-12
US20160194625A1 (en) 2016-07-07
EP3041934A1 (en) 2016-07-13
JP2016530294A (ja) 2016-09-29

Similar Documents

Publication Publication Date Title
US12274743B2 (en) Nucleic acid vaccines
US10815291B2 (en) Polynucleotides encoding immune modulating polypeptides
US9925277B2 (en) Polynucleotide compositions containing amino acids
US20160194625A1 (en) Chimeric polynucleotides
US20170173128A1 (en) Targeted adaptive vaccines
US20160194368A1 (en) Circular polynucleotides
AU2014329452B2 (en) Polynucleotides encoding low density lipoprotein receptor
HK40076592A (en) Nucleic acid vaccines
HK40072892A (en) Nucleic acid vaccines

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14766339

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2923029

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 14915959

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2016540348

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2014766339

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2014766339

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2014315287

Country of ref document: AU

Date of ref document: 20140903

Kind code of ref document: A