WO2015034928A1 - Chimeric polynucleotides - Google Patents
Chimeric polynucleotides Download PDFInfo
- Publication number
- WO2015034928A1 WO2015034928A1 PCT/US2014/053907 US2014053907W WO2015034928A1 WO 2015034928 A1 WO2015034928 A1 WO 2015034928A1 US 2014053907 W US2014053907 W US 2014053907W WO 2015034928 A1 WO2015034928 A1 WO 2015034928A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- region
- chimeric polynucleotide
- polynucleotide
- chimeric
- utp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- QRUDEWIWKLJBPS-UHFFFAOYSA-N c(cc1)cc2c1nn[nH]2 Chemical compound c(cc1)cc2c1nn[nH]2 QRUDEWIWKLJBPS-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/67—General methods for enhancing the expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
- C12P19/28—N-glycosides
- C12P19/30—Nucleotides
- C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
Definitions
- the invention relates to compositions, methods, processes, kits and devices for the design, preparation, manufacture and/or formulation of chimeric polynucleotides.
- nucleic acid based compounds or chimeric polynucleotides both coding and non-coding and combinations thereof
- nucleic acid based compounds or chimeric polynucleotides both coding and non-coding and combinations thereof
- structural and/or chemical features that avoid one or more of the problems in the art, for example, features which are useful for optimizing nucleic acid-based therapeutics while retaining structural and functional integrity, overcoming the threshold of expression, improving expression rates, half life and/or protein concentrations, optimizing protein localization, and avoiding deleterious bio-responses such as the immune response and/or degradation pathways.
- Each of these barriers may be reduced or eliminated using the present invention.
- the present inventors have developed chimeric polynucleotides and methods of synthesizing these polynucleotides which allow for customized placement, position and percent load of chemical modifications, which improve, alter or optimize certain physicochemical and pharmaceutical properties of the polynucleotides.
- compositions, methods, processes, kits and devices for the design, preparation, manufacture and/or formulation of chimeric polynucleotides are Described herein.
- such chimeric polynucleotides take the form or or function as modified mRNA molecules which encode a polypeptide of interest.
- such chimeric polynucleotides are substantially non-coding.
- chimeric polynucleotides encoding a polypeptide, where the chimeric polynucleotide having a sequence or structure comprising Formula I, 5 ' [An]x-Ll-[Bo]y-L2-[Cp]z-L3 3 '
- each of A and B independently comprise a region of linked nucleosides
- C is an optional region of linked nucleosides
- At least one of regions A, B, or C is positionally modified, wherein said positionally modified region comprises at least two chemically modified nucleosides of one or more of the same nucleoside type of adenosine, thymidine, guanosine, cytidine, or uridine, and wherein at least two of the chemical modifications of nucleosides of the same type are different chemical modifications;
- n, o and p are independenty an integer between 15-1000;
- x and y are independently 1-20;
- LI and L2 are independently optional linker moieties, said linker moieties being either nucleic acid based or non-nucleic acid based; and
- L3 is an optional conjugate or an optional linker moiety, said linker moiety being either nucleic acid based or non-nucleic acid based.
- FIG. 1 comprises Figure 1A and Figure IB showing a schematic of a polynucleotide construct.
- Figure 1 A is a schematic of a polynucleotide construct taught in commonly owned co-pending US Patent Application 13/791,922 filed March 9, 2013, the contents of which are incorporated herein by reference.
- Figure IB is a schematic of a linear polynucleotide construct.
- FIG. 2 is a schematic of a series of chimeric polynucleotides of the present invention.
- FIG. 3 is a schematic of a series of chimeric polynucleotides illustrating various patterns of positional modifications and showing regions analogous to those regions of an m NA polynucleotide.
- FIG. 4 is a schematic of a series of chimeric polynucleotides illustrating various patterns of positional modifications based on Formula I.
- FIG. 5 is a is a schematic of a series of chimeric polynucleotides illustrating various patterns of positional modifications based on Formula I and further illustrating a blocked or structured 3 ' terminus.
- FIG. 6 is a schematic of a circular construct of the present invention.
- FIG. 7 is a schematic of a circular construct of the present invention.
- FIG. 8 is a schematic of a circular construct of the present invention comprising at least one spacer region.
- FIG. 9 is a schematic of a circular construct of the present invention comprising at least one sensor region.
- FIG. 10 is a schematic of a circular construct of the present invention comprising at least one sensor region and a spacer region.
- FIG. 11 is a schematic of a non-coding circular construct of the present invention.
- FIG. 12 is a schematic of a non-coding circular construct of the present invention.
- RNA ribonucleic acid
- RNA ribonucleic acid
- One beneficial outcome is to cause intracellular translation of the nucleic acid and production of an encoded polypeptide of interest.
- non-coding RNA has become a focus of much study; and utilization of non-coding polynucleotides, alone and in conjunction with coding polynucleotides, could provide beneficial outcomes in therapeutic scenarios.
- compositions including pharmaceutical compositions
- polynucleotides specifically chimeric polynucleotides.
- chimeric polynucleotides are preferably modified in a manner as to avoid the deficiencies of other molecules of the art.
- modified polynucleotides encoding polypeptides i.e., modified mRNA
- chimeric polynucleotides which, due to their chimeric nature, have been designed to improve one or more of the stability and/or clearance in tissues, receptor uptake and/or kinetics, cellular access, engagement with translational machinery, mRNA half-life, translation efficiency, immune evasion, immune induction (for vaccines), protein production capacity, secretion efficiency (when applicable), accessibility to circulation, protein half-life and/or modulation of a cell's status, function and/or activity.
- nucleic acid molecules specifically polynucleotides which are chimeric and which, in some embodiments, encode one or more polypeptides of interest.
- nucleic acid in its broadest sense, includes any compound and/or substance that comprise a polymer of nucleotides. These polymers are often referred to as polynucleotides.
- nucleic acids or polynucleotides of the invention include, but are not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a ⁇ - D-ribo configuration, a-LNA having an a-L- ribo configuration (a diastereomer of LNA), 2'-amino-LNA having a 2 '-amino functionalization, and 2'-amino- a-LNA having a 2'-amino functionalization), ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) or hybrids or combinations thereof.
- RNAs ribonucleic acids
- DNAs deoxyribonucleic acids
- TAAs threose nucle
- the nucleic acid molecule is or functions as a messenger RNA (mRNA).
- mRNA messenger RNA
- the term "messenger RNA” (mRNA) refers to any polynucleotide which encodes a polypeptide of interest and which is capable of being translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ or ex vivo.
- Figure 1 illustrates a representative polynucleotide 100 which may serve as a starting, parent or scaffold molecule for the design of chimeric polynucleotides of the invention which encode polypeptides.
- the polynucleotide 100 here contains a first region of linked nucleotides 102 that is flanked by a first flanking region 104 and a second flaking region 106.
- the polynucleotide may encode at its 5 ' terminus one or more signal sequences in the signal sequence region 103.
- the flanking region 104 may comprise a region of linked nucleotides comprising one or more complete or incomplete 5' UTRs sequences which may be completely codon optimized or partially codon optimized.
- the flanking region 104 may include at least one nucleic acid sequence including, but not limited to, miR sequences, TERZAKTM sequences and translation control sequences.
- the flanking region 104 may also comprise a 5' terminal cap 108.
- the 5' terminal capping region 108 may include a cap such as a naturally occurring cap, a synthetic cap or an optimized cap.
- optimized caps include the caps taught by Rhoads in US Patent No. US7074596 and International Patent Publication No. WO2008157668, WO2009149253 and WO2013103659, the contents of each of which are herein incorporated by reference in its entirety.
- the second flanking region 106 may comprise a region of linked nucleotides comprising one or more complete or incomplete 3' UTRs. The second flanking region 106 may be completely codon optimized or partially codon optimized.
- the flanking region 106 may include at least one nucleic acid sequence including, but not limited to, miR sequences and translation control sequences.
- the flanking region 106 may also comprise a 3' tailing sequence 110.
- the 3 ' tailing sequence 110 may include a synthetic tailing region 112 and/or a chain
- Non-liming examples of a synthetic tailing region include a polyA sequence, a polyC sequence, a polyA-G quartet.
- Non-limiting examples of chain terminating nucleosides include 2 -0 methyl, F and locked nucleic acids (LNA).
- first operational region 105 Bridging the 5' terminus of the first region 102 and the first flanking region 104 is a first operational region 105.
- this operational region comprises a Start codon.
- the operational region may alternatively comprise any translation initiation sequence or signal including a Start codon.
- this operational region comprises a Stop codon.
- the operational region may alternatively comprise any translation initiation sequence or signal including a Stop codon. Multiple serial stop codons may also be used.
- the present invention expands the scope of functionality of traditional mRNA molecules as well as those produced via IVT in the art, by providing chimeric polynucleotides or RNA constructs which maintain a modular organization, but which comprise one or more structural and/or chemical modifications or alterations which impart useful properties to the polynucleotide.
- the chimeric polynucleotides which are modified mRNA molecules of the present invention are termed "chimeric modified mRNA" or "chimeric mRNA.”
- a “chimera” according to the present invention is an entity having two or more incongruous or heterogeneous parts or regions.
- chimeric polynucleotides or “chimeric polynucleotides” are those nucleic acid polymers having portions or regions which differ in size and/or chemical modification pattern, chemical modification position, chemical modification percent or chemical modification population and combinations of the foregoing.
- a "part" or “region” of a polynucleotide is defined as any portion of the polynucleotide which is less than the entire length of the polynucleotide.
- Examples of parts or regions, where the chimeric polynucleotide functions as an mRNA and encodes a polypeptide of interest include, but are not limited to, untranslated regions (UTRs, such as the 5 ' UTR or 3 ' UTR), coding regions, cap regions, polyA tail regions, start regions, stop regions, signal sequence regions, and combinations thereof.
- UTRs untranslated regions
- Figure 2 illustrates certain embodiments of the chimeric polynucleotides of the invention which may be used as mRNA.
- Figure 3 illustrates a schematic of a series of chimeric polynucleotides identifying various patterns of positional modifications and showing regions analogous to those regions of an mRNA polynucleotide. Regions or parts that join or lie between other regions may also be designed to have subregions. These are shown in the figure.
- the chimeric polynucleotides of the invention have a structure comprising Formula I.
- each of A and B independently comprise a region of linked nucleosides
- C is an optional region of linked nucleosides
- At least one of regions A, B, or C is positionally modified, wherein the
- positionally modified region comprises at least two chemically modified nucleosides of one or more of the same nucleoside type of adenosine, thymidine, guanosine, cytidine, or uridine, and wherein at least two of the chemical modifications of nucleosides of the same type are different chemical modifications;
- n, o and p are independenty an integer between 15-1000;
- x and y are independently 1-20;
- LI and L2 are independently optional linker moieties, the linker moieties being either nucleic acid based or non-nucleic acid based;
- L3 is an optional conjugate or an optional linker moiety, the linker moiety being either nucleic acid based or non-nucleic acid based.
- the chimeric polynucleotide of Formula I encodes one or more peptides or polypeptides of interest. Such encoded molecules may be encoded across two or more regions.
- Figures 4 and 5 provide schematics of a series of chimeric polynucleotides illustrating various patterns of positional modifications based on Formula I as well as those having a blocked or structured 3 ' terminus.
- Chimeric polynucleotides, including the parts or regions thereof, of the present invention may be classified as hemimers, gapmers, wingmers, or blockmers.
- a "hemimer” is chimeric polynucleotide comprising a region or part which comprises half of one pattern, percent, position or population of a chemical modification(s) and half of a second pattern, percent, position or population of a chemical modification(s).
- Chimeric polynucleotides of the present invention may also comprise hemimer subregions. In one embodiment, a part or region is 50% of one and 50% of another. [00066] In one embodiment the entire chimeric polynucleotide can be 50% of one and 50% of the other. Any region or part of any chimeric polynucleotide of the invention may be a hemimer. Types of hemimers include pattern hemimers, population hemimers or position hemimers. By definition, hemimers are 50:50 percent hemimers.
- a “gapmer” is a chimeric polynucleotide having at least three parts or regions with a gap between the parts or regions.
- the "gap” can comprise a region of linked nucleosides or a single nucleoside which differs from the chimeric nature of the two parts or regions flanking it.
- the two parts or regions of a gapmer may be the same or different from each other.
- a "wingmer” is a chimeric polynucleotide having at least three parts or regions with a gap between the parts or regions. Unlike a gapmer, the two flanking parts or regions surrounding the gap in a wingmer are the same in degree or kind. Such similiarity may be in the length of number of units of different modifications or in the number of modifications.
- the wings of a wingmer may be longer or shorter than the gap.
- the wing parts or regions may be 20, 30, 40, 50, 60 70, 80, 90 or 95% greater or shorter in length than the region which comprises the gap.
- a "blockmer” is a patterned polynucleotide where parts or regions are of equivalent size or number and type of modifications. Regions or subregions in a blockmer may be 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124
- Pattern chimeras Chimeric polynucleotides, including the parts or regions thereof, of the present invention having a chemical modification pattern are referred to as "pattern chimeras.” Pattern chimeras may also be referred to as blockmers. Pattern chimeras are those polynucleotides having a pattern of modifications within, across or among regions or parts.
- Patterns of modifications within a part or region are those which start and stop within a defined region.
- Patterns of modifcations across a part or region are those patterns which start in on part or region and end in another adjacent part or region.
- Patterns of modifications among parts or regions are those which begin and end in one part or region and are repeated in a different part or region, which is not necessarily adjacent to the first region or part.
- the regions or subregions of pattern chimeras or blockmers may have simple alternating patterns such as ABAB[AB]n where each "A" and each "B" represent different chemical modifications (at at least one of the base, sugar or backbone linker), different types of chemical modifications (e.g., naturally occurring and non-naturally occurring), different percentages of modifications or different populations of
- Different patterns may also be mixed together to form a second order pattern.
- a single alternating pattern may be combined with a triple alternating pattern to form a second order alternating pattern A'B'.
- A'B' One example would be
- Patterns may include three or more different modifications to form an
- ABCABC[ABC]n pattern may also be multiples, such as AABBCCAABBCC[AABBCC]n and may be designed as combinations with other patterns such as ABCABCAABBCCABCABCAABBCC, and may be higher order patterns.
- Regions or subregions of position, percent, and population modifications need not reflect an equal contribution from each modification type. They may form series such as "1-2-3-4", "1-2-4-8", where each integer represents the number of units of a particular modification type. Alternatively, they may be odd only, such as ' 1-3-3-1-3-1-5" or even only "2-4-2-4-6-4-8" or a mixuture of both odd and even number of units such as "1-3-4- 2-5-7-3-3-4".
- Pattern chimeras may vary in their chemical modification by degree (such as those described above) or by kind (e.g., different modifications).
- Chimeric polynucleotides, including the parts or regions thereof, of the present invention having at least one region with two or more different chemical modifications of two or more nucleoside members of the same nucleoside type (A, C, G, T, or U) are referred to as "positionally modified” chimeras.
- Positionally modified chimeras are also referred to herein as “selective placement” chimeras or “selective placement polynucleotides”.
- selective placement refers to the design of polynucleotides which, unlike polynucleotides in the art where the modification to any A, C, G, T or U is the same by virtue of the method of synthesis, can have different modifications to the individual As, Cs, Gs, Ts or Us in a polynucleotide or region thereof.
- a positionally modified chimeric polynucleotide there may be two or more different chemical modifications to any of the nucleoside types of As, Cs, Gs, Ts, or Us. There may also be combinations of two or more to any two or more of the same nucleoside type.
- a positionally modified or selective placement chimeric polynucleotide may comprise 3 different modifications to the population of adenines in the moleucle and also have 3 different modifications to the population of cytosines in the construct— all of which may have a unique, non-random, placement.
- Percent chimeras Chimeric polynucleotides, including the parts or regions thereof, of the present invention having a chemical modification percent are referred to as "percent chimeras.”
- Percent chimeras may have regions or parts which comprise at least 1%, at least 2%, at least 5%, at least 8%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% positional, pattern or population of modifications.
- the percent chimera may be completely modified as to modification position, pattern, or population.
- the percent of modification of a percent chimera may be split between naturally occurring and non-naturally occurring modifications.
- Chimeric polynucleotides, including the parts or regions thereof, of the present invention having a chemical modification population are referred to as
- a population chimera may comprise a region or part where nucleosides (their base, sugar or backbone linkage, or combination thereof) have a select population of modifications. Such modifications may be selected from functional populations such as modifications which induce, alter or modulate a phenotypic outcome.
- a functional population may be a population or selection of chemical modifications which increase the level of a cytokine.
- Other functional populations may individually or collectively function to decrease the level of one or more cytokines.
- a “functional population chimera” may be one whose unique functional feature is defined by the population of modifications as described above or the term may apply to the overall function of the chimeric polynucleotide itself. For example, as a whole the chimeric polynucleotide may function in a different or superior way as compared to an unmodified or non-chimeric polynucleotide.
- polynucleotides which have a uniform chemical modification of all of any of the same nucleoside type or a population of modifications produced by mere downward titration of the same starting modification in all of any of the same nucleoside type, or a measured percent of a chemical modification of all any of the same nucleoside type but with random incorporation, such as where all uridines are replaced by a uridine analog, e.g., pseudouridine, are not considred chimeric.
- polynucleotides having a uniform chemical modification of two, three, or four of the same nucleoside type throughout the entire polynucleotide such as all uridines and all cytosines, etc.
- polynucleotide which is not chimeric is the canonical pseudouridine/5 -methyl cytosine modified polynucleotide of the prior art.
- IVT in vitro transcription
- adenosine (A), thymidine (T), guanosine (G), cytidine (C) or uradine (U) found in the polynucleotide.
- the chimeric polynucleotides of the present invention may be structurally modified or chemically modified.
- a "structural" modification is one in which two or more linked nucleosides are inserted, deleted, duplicated, inverted or randomized in a chimeric polynucleotide without significant chemical modification to the nucleotides themselves. Because chemical bonds will necessarily be broken and reformed to effect a structural modification, structural modifications are of a chemical nature and hence are chemical modifications. However, structural modifications will result in a different sequence of nucleotides.
- the polynucleotide "ATCG” may be chemically modified to "AT-5meC-G".
- the same polynucleotide may be structurally modified from "ATCG” to "ATCCCG".
- the dinucleotide "CC” has been inserted, resulting in a structural modification to the polynucleotide.
- the chimeric polynucleotides may encode two or more proteins or peptides.
- proteins or peptides include the heavy and light chains of antibodies, an enzyme and its substrate, a label and its binding molecule, a second messenger and its enzyme or the components of multimeric proteins or complexes.
- the regions or parts of the chimeric polynucleotides of the present invention may be separated by a linker or spacer moiety.
- linkers or spaces may be nucleic acid based or non-nucleosidic.
- the chimeric polynucleotides of the present invention may include a sequence encoding a self-cleaving peptide.
- the self-cleaving peptide may be, but is not limited to, a 2A peptide.
- the 2A peptide may have the protein sequence: GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 1), fragments or variants thereof.
- the 2A peptide cleaves between the last glycine and last proline.
- the chimeric polynucleotides of the present invention may include a sequence encoding a self-cleaving peptide.
- the self-cleaving peptide may be, but is not limited to, a 2A peptide.
- the 2A peptide may have the protein sequence: GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 1), fragments or variants thereof.
- the 2A peptide cleaves between the last glycine and last proline.
- polynucleotides of the present invention may include a polynucleotide sequence encoding the 2A peptide having the protein sequence GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 1) fragments or variants thereof.
- GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAG GAGAACCCTGGACCT SEQ ID NO: 2.
- the polynucleotide sequence may be modified or codon optimized by the methods described herein and/or are known in the art.
- this sequence may be used to separate the coding region of two or more polypeptides of interest.
- the sequence encoding the 2A peptide may be between a first coding region A and a second coding region B (A-2Apep-B). The presence of the 2 A peptide would result in the cleavage of one long protein into protein A, protein B and the 2A peptide. Protein A and protein B may be the same or different polypeptides of interest.
- the 2A peptide may be used in the chimeric polynucleotides of the present invention to produce two, three, four, five, six, seven, eight, nine, ten or more proteins.
- chimeric polynucleotides of the present invention may comprise a region or part which is not positionally modified or not chimeric as defined herein.
- a region or part of a chimeric polynucleotide may be uniformly modified at one ore more A, T, C, G, or U but according to the invention, the
- polynucleotides will not be uniformly modified throughout the entire region or part.
- Regions or parts of chimeric polynucleotides may be from 15-1000 nucleosides in length and a polynucleotide may have from 2-100 different regions or patterns of regions as described herein.
- chimeric polynucleotides encode one or more
- Figure 2 illustrates the design of certain chimeric polynucleotides of the present invention when based on the scaffold of the polynucleotide of Figure 1. Shown in the figure are the regions or parts of the chimeric polynucleotides where patterned regions represent those regions which are positionally modified and open regions illustrate regions which may or may not be modified but which are, when modified, uniformly modified. Chimeric polynucleotides of the present invention may be completely positionally modified or partially positionally modified. They may also have subregions which may be of any pattern or design. Shown in the figure are a chimeric subregion and a hemimer subregion.
- polynucleotide of the present invention encoding a peptide can be the length that is sufficient to encode for a dipeptide, a tripeptide, a tetrapeptide, a pentapeptide, a hexapeptide, a heptapeptide, an octapeptide, a nonapeptide, or a decapeptide.
- the length may be sufficient to encode a peptide of 2-30 amino acids, e.g. 5- 30, 10-30, 2-25, 5-25, 10-25, or 10-20 amino acids.
- the length may be sufficient to encode for a peptide of at least 11, 12, 13, 14, 15, 17, 20, 25 or 30 amino acids, or a peptide that is no longer than 40 amino acids, e.g. no longer than 35, 30, 25, 20, 17, 15, 14, 13, 12, 11 or 10 amino acids.
- the length of a region encoding the polypeptide of interest of the present invention is greater than about 30 nucleotides in length (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000 or up to and including 100,000 nucleotides).
- a region may be referred to as a "coding region” or "region encoding.”
- the chimeric polynucleotide includes from about 30 to about 100,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 1,000, from 30 to 1,500, from 30 to 3,000, from 30 to 5,000, from 30 to 7,000, from 30 to 10,000, from 30 to 25,000, from 30 to 50,000, from 30 to 70,000, from 100 to 250, from 100 to 500, from 100 to 1,000, from 100 to 1,500, from 100 to 3,000, from 100 to 5,000, from 100 to 7,000, from 100 to 10,000, from 100 to 25,000, from 100 to 50,000, from 100 to 70,000, from 100 to 100,000, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 3,000, from 500 to 5,000, from 500 to 7,000, from 500 to 10,000, from 500 to 25,000, from 500 to 50,000, from 500 to 70,000, from 500 to 100,000, from 1,000 to 1,500, from 1,000 to 2,000, from 500 to 3,000, from 500 to 5,000
- regions or subregions of chimeric polynucleotides may also range independently from 15-1,000 nucleotides in length (e.g., greater than 30, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, and 900 nucleotides or at least 30, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, and 1,000 nucleotides).
- regions or subregions of chimeric polynucleotides may range from absent to 500 nucleotides in length (e.g., at least 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, or 500 nucleotides).
- the region is a polyA tail
- the length may be determined in units of or as a function of polyA Binding Protein binding.
- the polyA tail is long enough to bind at least 4 monomers of PolyA Binding Protein.
- PolyA Binding Protein monomers bind to stretches of approximately 38 nucleotides.
- polyA tails of about 80 nucleotides (SEQ ID NO: 4) and 160 nucleotides (SEQ ID NO: 5) are functional.
- the chimeric polynucleotides of the present invention which function as an m NA need not comprise a polyA tail.
- chimeric polynucleotides which function as an mRNA may have a capping region.
- the capping region may comprise a single cap or a series of nucleotides forming the cap.
- the capping region may be from 1 to 10, e.g. 2-9, 3-8, 4-7, 1-5, 5-10, or at least 2, or 10 or fewer nucleotides in length.
- the cap is absent.
- the present invention contemplates chimeric polynucleotides which are circular or cyclic.
- circular polynucleotides are circular in nature meaning that the termini are joined in some fashion, whether by ligation, covalent bond, common association with the same protein or other molecule or complex or by hybridization.
- Chimeric polynucleotides of the present invention may be designed according to the circular RNA construct scaffolds shown in Figures 6-12. Such polynucleotides are cicular chimeric polynucleotides or circular constructs.
- circular polynucleotides or “circP” means a single stranded circular polynucleotide which acts substantially like, and has the properties of, an RNA.
- the term “circular” is also meant to encompass and secondary or tertiary configuration of the circP.
- the circPs of the present invention which encode at least one polypeptide of interest are known as circular RNAs or circRNA.
- circular RNA or “circRNA” means a circular polynucleotide that can encode at least one polypeptide of interest.
- the circPs of the present invention which comprise at least one sensor sequence and do not encode a polypeptide of interest are known as circular sponges or circSP.
- circular sponges means a circular polynucleotide which comprises at least one sensor sequence and does not encode a polypeptide of interest.
- sensor sequence means a receptor or pseudo-receptor for endogenous nucleic acid binding molecules.
- sensor sequences include, microRNA binding sites, microRNA seed sequences, microRNA binding sites without the seed sequence, transcription factor binding sites and artificial binding sites engineered to act as pseudo-receptors and portions and fragments thereof.
- the circPs of the present invention which comprise at least one sensor sequence and encode at least one polypeptide of interest are known as circular R A sponges or circR A-SP.
- circular RNA sponges or “circRNA-SP” means a circular polynucleotide which comprises at least one sensor sequence and at least one region encoding at least one polypeptide of interest.
- FIG. 6 shows a representative circular construct 200 of the present invention.
- the term "circular construct” refers to a circular polynucleotide transcript which may act substantiatlly similar to and have properties of a RNA molecule.
- the circular construct acts as an mRNA. If the circular construct encodes one or more polypeptides of interest (e.g., a circRNA or circRNA-SP) then the polynucleotide transcript retains sufficient structural and/or chemical features to allow the polypeptide of interest encoded therein to be translated.
- Circular constructs may be polynucleotides of the invention. When structurally or chemically modified, the construct may be referred to as a modified circP, circSP, circRNA or circRNA-SP.
- the circular construct 200 here contains a first region of linked nucleotides 202 that is flanked by a first flanking region 204 and a second flanking region 206.
- first region may be referred to as a "coding region,” a “non-coding region” or “region encoding” or simply the "first region.”
- this first region may comprise nucleotides such as, but not limited to, encoding the polypeptide of interest and/or nucleotides encodes or comprises a sensor region.
- the polypeptide of interest may comprise at its 5 ' terminus one or more signal peptide sequences encoded by a signal sequence region 203.
- the first flanking region 204 may comprise a region of linked nucleosides or portion thereof which may act similiarly to an untranslated region (UTR) in a mRNA and/or DNA sequence.
- the first flanking region may also comprise a region of polarity 208.
- the region of polarity 208 may include an IRES sequence or portion thereof.
- this region when linearlized this region may be split to have a first portion be on the 5 ' terminus of the first region 202 and second portion be on the 3 ' terminus of the first region 202.
- the second flanking region 206 may comprise a tailing sequence region 210 and may comprise a region of linked nucleotides or portion thereof 212 which may act similiarly to a UTR in a mRNA and/or DNA.
- Bridging the 5' terminus of the first region 202 and the first flanking region 204 is a first operational region 205.
- this operational region may comprise a start codon.
- the operational region may alternatively comprise any translation initiation sequence or signal including a start codon.
- this operational region comprises a stop codon.
- the operational region may alternatively comprise any translation initiation sequence or signal including a stop codon. According to the present invention, multiple serial stop codons may also be used.
- the operation region of the present invention may comprise two stop codons.
- the first stop codon may be "TGA” or "UGA” and the second stop codon may be selected from the group consisting of "TAA,” “TGA,” “TAG,” “UAA,” “UGA” or "UAG.”
- At least one non-nucleic acid moiety 201 may be used to prepare a circular polynucleotide 200 where the non-nucleic acid moiety 201 is used to bring the first flanking region 204 near the second flanking region 206.
- Non-limiting examples of non-nucleic acid moieties which may be used in the present invention are described herein.
- the circular polynucleotides 200 may comprise more than one non- nucleic acid moiety wherein the additional non-nucleic acid moeities may be
- the first region of linked nucleosides 202 may comprise a spacer region 214.
- This spacer region 214 may be used to separate the first region of linked nucleosides 202 so that the circular construct can include more than one open reading frame, non-coding region or an open reading frame and a non-coding region.
- the second flanking region 206 may comprise one or more sensor regions 216 in the the 3 ' UTR 212. These sensor sequences as discussed herein operate as pseudo-receptors (or binding sites) for ligands of the local
- microRNA bindng sites or miRNA seeds may be used as sensors such that they function as pseudoreceptors for any microRNAs present in the environment of the circular polynucleotide.
- the one or more sensor regions 216 may be separated by a spacer region 214.
- a circular construct 200 which includes one or more sensor regions 216, may also include a spacer region 214 in the first region of linked nucleosides 202. As discussed above for Figure 7, this spacer region 214 may be used to separate the first region of linked nucleosides 202 so that the circular construct can include more than one open reading frame and/or more than one non-coding region.
- a circular construct 200 may be a non-coding construct known as a circSP comprising at least one non-coding region such as, but not limited to, a sensor region 216.
- Each of the sensor regions 216 may include, but are not limited to, a miR sequence, a miR seed, a miR binding site and/or a miR sequence without the seed.
- At least one non-nucleic acid moiety 201 may be used to prepare a circular polynucleotide 200 which is a non-coding construct.
- the circular polynucleotides 200 which is a non-coding construct may comprise more than one non- nucleic acid moiety wherein the additional non-nucleic acid moeities may be
- multiple distinct chimeric polynucleotides may be linked together through the 3 '-end using nucleotides which are modified at the 3'- terminus.
- Chemical conjugation may be used to control the stoichiometry of delivery into cells.
- the glyoxylate cycle enzymes isocitrate lyase and malate synthase, may be supplied into cells at a 1 : 1 ratio to alter cellular fatty acid metabolism.
- This ratio may be controlled by chemically linking chimeric polynucleotides using a 3'- azido terminated nucleotide on one chimeric polynucleotides species and a C5-ethynyl or alkynyl-containing nucleotide on the opposite chimeric polynucleotide species.
- the modified nucleotide is added post-transcriptionally using terminal transferase (New England Biolabs, Ipswich, MA) according to the manufacturer's protocol.
- the two chimeric polynucleotides species may be combined in an aqueous solution, in the presence or absence of copper, to form a new covalent linkage via a click chemistry mechanism as described in the literature.
- more than two polynucleotides may be linked together using a functionalized linker molecule.
- a functionalized saccharide molecule may be chemically modified to contain multiple chemical reactive groups (SH-, ⁇ 2 -, N 3 , etc%) to react with the cognate moiety on a 3'-functionalized mR A molecule (i.e., a 3'-maleimide ester, 3'-NHS-ester, alkynyl).
- the number of reactive groups on the modified saccharide can be controlled in a stoichiometric fashion to directly control the stoichiometric ratio of conjugated chimeric polynucleotides.
- chimeric polynucleotides of the present invention can be designed to be conjugated to other polynucleotides, dyes, intercalating agents ⁇ e.g. acridines), cross-linkers ⁇ e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons ⁇ e.g., phenazine, dihydrophenazine), artificial endonucleases ⁇ e.g.
- alkylating agents phosphate, amino, mercapto, PEG ⁇ e.g., PEG-40K
- MPEG MPEG
- [MPEG] 2 polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens ⁇ e.g. biotin)
- transport/absorption facilitators ⁇ e.g., aspirin, vitamin E, folic acid), synthetic
- ribonucleases proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell, hormones and hormone receptors, non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, or a drug.
- proteins e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand
- antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell
- hormones and hormone receptors non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, or a drug.
- Conjugation may result in increased stability and/or half life and may be particularly useful in targeting the chimeric polynucleotides to specific sites in the cell, tissue or organism.
- the chimeric polynucleotides may be administered with, conjugated to or further encode one or more of RNAi agents, siRNAs, shRNAs, miRNAs, miRNA binding sites, antisense RNAs, ribozymes, catalytic DNA, tRNA, RNAs that induce triple helix formation, aptamers or vectors, and the like.
- RNAi agents siRNAs, shRNAs, miRNAs, miRNA binding sites, antisense RNAs, ribozymes, catalytic DNA, tRNA, RNAs that induce triple helix formation, aptamers or vectors, and the like.
- bifunctional polynucleotides e.g., bifunctional chimeric polynucleotides.
- bifunctional polynucleotides e.g., bifunctional chimeric polynucleotides
- polynucleotides are those having or capable of at least two functions. These molecules may also by convention be referred to as multi-functional.
- the multiple functionalities of bifunctional polynucleotides may be encoded by the RNA (the function may not manifest until the encoded product is translated) or may be a property of the polynucleotide itself. It may be structural or chemical.
- Bifunctional modified polynucleotides may comprise a function that is covalently or electrostatically associated with the polynucleotides. Further, the two functions may be provided in the context of a complex of a chimeric polynucleotide and another molecule.
- Bifunctional polynucleotides may encode peptides which are antiproliferative. These peptides may be linear, cyclic, constrained or random coil. They may function as aptamers, signaling molecules, ligands or mimics or mimetics thereof. Anti-proliferative peptides may, as translated, be from 3 to 50 amino acids in length. They may be 5-40, 10-30, or approximately 15 amino acids long. They may be single chain, multichain or branched and may form complexes, aggregates or any multi-unit structure once translated.
- chimeric polynucleotides having sequences that are partially or substantially not translatable, e.g., having a noncoding region.
- Such noncoding region may be the "first region" of the chimeric polynucleotide.
- the noncoding region may be a region other than the first region.
- Such molecules are generally not translated, but can exert an effect on protein production by one or more of binding to and sequestering one or more translational machinery components such as a ribosomal protein or a transfer RNA (tRNA), thereby effectively reducing protein expression in the cell or modulating one or more pathways or cascades in a cell which in turn alters protein levels.
- tRNA transfer RNA
- the chimeric polynucleotide may contain or encode one or more long noncoding RNA (IncRNA, or lincRNA) or portion thereof, a small nucleolar RNA (sno-RNA), micro RNA (miRNA), small interfering RNA (siRNA) or Piwi- interacting RNA (piRNA).
- RNAi-RNA small nucleolar RNA
- miRNA micro RNA
- siRNA small interfering RNA
- piRNA Piwi- interacting RNA
- Chimeric polynucleotides of the present invention may encode one or more peptides or polypeptides of interest. They may also affect the levels, signaling or function of one or more polypeptides.
- Polypeptides of interest, according to the present invention include any of those taught in, for example, those listed in Table 6 of co-pending U.S. Provisional Patent Application Nos. 61/618,862,61/681,645, 61/737,130, 61/618,866, 61/681,647, No 61/737,134, 61/618,868, 61/681,648, 61/737,135, 61/618,873,
- the chimeric polynucleotide may be designed to encode one or more polypeptides of interest or fragments thereof.
- polypeptide of interest may include, but is not limited to, whole polypeptides, a plurality of polypeptides or fragments of polypeptides, which independently may be encoded by one or more regions or parts or the whole of a chimeric polynucleotide.
- polypeptides of interest refer to any polypeptide which is selected to be encoded within, or whose function is affected by, the chimeric polnucleotides of the present invention.
- polypeptide means a polymer of amino acid residues (natural or unnatural) linked together most often by peptide bonds.
- polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing.
- a polypeptide may be a single molecule or may be a multi-molecular complex such as a dimer, trimer or tetramer. They may also comprise single chain or multichain
- polypeptides such as antibodies or insulin and may be associated or linked. Most commonly disulfide linkages are found in multichain polypeptides.
- polypeptide may also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid.
- polypeptide variant refers to molecules which differ in their amino acid sequence from a native or reference sequence.
- the amino acid sequence variants may possess substitutions, deletions, and/or insertions at certain positions within the amino acid sequence, as compared to a native or reference sequence.
- variants will possess at least about 50% identity (homology) to a native or reference sequence, and preferably, they will be at least about 80%, more preferably at least about 90% identical (homologous) to a native or reference sequence.
- variant mimics are provided.
- the term “variant mimic” is one which contains one or more amino acids which would mimic an activated sequence.
- glutamate may serve as a mimic for phosphoro- threonine and/or phosphoro-serine.
- variant mimics may result in deactivation or in an inactivated product containing the mimic, e.g., phenylalanine may act as an inactivating substitution for tyrosine; or alanine may act as an inactivating substitution for serine.
- homology as it applies to amino acid sequences is defined as the percentage of residues in the candidate amino acid sequence that are identical with the residues in the amino acid sequence of a second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology. Methods and computer programs for the alignment are well known in the art. It is understood that homology depends on a calculation of percent identity but may differ in value due to gaps and penalties introduced in the calculation.
- Analogs is meant to include polypeptide variants which differ by one or more amino acid alterations, e.g., substitutions, additions or deletions of amino acid residues that still maintain one or more of the properties of the parent or starting polypeptide.
- compositions which are polypeptide based including variants and derivatives. These include substitutional, insertional, deletion and covalent variants and derivatives.
- derivative is used synonymously with the term “variant” but generally refers to a molecule that has been modified and/or changed in any way relative to a reference molecule or starting molecule.
- sequence tags or amino acids such as one or more lysines
- Sequence tags can be used for peptide purification or localization.
- Lysines can be used to increase peptide solubility or to allow for biotinylation.
- amino acid residues located at the carboxy and amino terminal regions of the amino acid sequence of a peptide or protein may optionally be deleted providing for truncated sequences.
- Certain amino acids e.g., C-terminal or N- terminal residues
- substitutional variants when referring to polypeptides are those that have at least one amino acid residue in a native or starting sequence removed and a different amino acid inserted in its place at the same position.
- the substitutions may be single, where only one amino acid in the molecule has been substituted, or they may be multiple, where two or more amino acids have been substituted in the same molecule.
- conservative amino acid substitution refers to the substitution of an amino acid that is normally present in the sequence with a different amino acid of similar size, charge, or polarity.
- conservative substitutions include the substitution of a non-polar (hydrophobic) residue such as isoleucine, valine and leucine for another non-polar residue.
- conservative substitutions include the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between glutamine and asparagine, and between glycine and serine.
- substitution of a basic residue such as lysine, arginine or histidine for another, or the substitution of one acidic residue such as aspartic acid or glutamic acid for another acidic residue are additional examples of conservative substitutions.
- non-conservative substitutions include the substitution of a non-polar (hydrophobic) amino acid residue such as isoleucine, valine, leucine, alanine, methionine for a polar (hydrophilic) residue such as cysteine, glutamine, glutamic acid or lysine and/or a polar residue for a non-polar residue.
- “Insertional variants” when referring to polypeptides are those with one or more amino acids inserted immediately adjacent to an amino acid at a particular position in a native or starting sequence. "Immediately adjacent" to an amino acid means connected to either the alpha-carboxy or alpha-amino functional group of the amino acid.
- deletional variants when referring to polypeptides are those with one or more amino acids in the native or starting amino acid sequence removed. Ordinarily, deletional variants will have one or more amino acids deleted in a particular region of the molecule.
- Covalent derivatives when referring to polypeptides include modifications of a native or starting protein with an organic proteinaceous or non-proteinaceous derivatizing agent, and/or post-translational modifications. Covalent modifications are traditionally introduced by reacting targeted amino acid residues of the protein with an organic derivatizing agent that is capable of reacting with selected side-chains or terminal residues, or by harnessing mechanisms of post-translational modifications that function in selected recombinant host cells. The resultant covalent derivatives are useful in programs directed at identifying residues important for biological activity, for immunoassays, or for the preparation of anti-protein antibodies for immunoaffinity purification of the recombinant glycoprotein. Such modifications are within the ordinary skill in the art and are performed without undue experimentation.
- polypeptides when referring to polypeptides are defined as distinct amino acid sequence-based components of a molecule.
- Features of the polypeptides encoded by the chimeric polynucleotides of the present invention include surface manifestations, local conformational shape, folds, loops, half-loops, domains, half-domains, sites, termini or any combination thereof.
- manifestation refers to a polypeptide based component of a protein appearing on an outermost surface.
- local conformational shape means a polypeptide based structural manifestation of a protein which is located within a definable space of the protein.
- fold refers to the resultant conformation of an amino acid sequence upon energy minimization.
- a fold may occur at the secondary or tertiary level of the folding process.
- secondary level folds include beta sheets and alpha helices.
- tertiary folds include domains and regions formed due to aggregation or separation of energetic forces.
- Regions formed in this way include hydrophobic and hydrophilic pockets, and the like.
- the term "turn” as it relates to protein conformation means a bend which alters the direction of the backbone of a peptide or polypeptide and may involve one, two, three or more amino acid residues.
- loop refers to a structural feature of a polypeptide which may serve to reverse the direction of the backbone of a peptide or polypeptide. Where the loop is found in a polypeptide and only alters the direction of the backbone, it may comprise four or more amino acid residues. Oliva et al. have identified at least 5 classes of protein loops (J. Mol Biol 266 (4): 814- 830; 1997). Loops may be open or closed. Closed loops or "cyclic" loops may comprise 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids between the bridging moieties.
- Such bridging moieties may comprise a cysteine-cysteine bridge (Cys-Cys) typical in polypeptides having disulfide bridges or alternatively bridging moieties may be non-protein based such as the dibromozylyl agents used herein.
- Cys-Cys cysteine-cysteine bridge
- bridging moieties may be non-protein based such as the dibromozylyl agents used herein.
- domain refers to a motif of a polypeptide having one or more identifiable structural or functional characteristics or properties (e.g., binding capacity, serving as a site for protein-protein interactions).
- sub- domains may be identified within domains or half-domains, these subdomains possessing less than all of the structural or functional properties identified in the domains or half domains from which they were derived. It is also understood that the amino acids that comprise any of the domain types herein need not be contiguous along the backbone of the polypeptide (i.e., nonadjacent amino acids may fold structurally to produce a domain, half-domain or subdomain).
- site As used herein when referring to polypeptides the terms "site” as it pertains to amino acid based embodiments is used synonymously with "amino acid residue” and "amino acid side chain.”
- a site represents a position within a peptide or polypeptide that may be modified, manipulated, altered, derivatized or varied within the polypeptide based molecules of the present invention.
- terminal refers to an extremity of a peptide or polypeptide. Such extremity is not limited only to the first or final site of the peptide or polypeptide but may include additional amino acids in the terminal regions.
- the polypeptide based molecules of the present invention may be characterized as having both an N-terminus (terminated by an amino acid with a free amino group (NH2)) and a C -terminus (terminated by an amino acid with a free carboxyl group (COOH)).
- Proteins of the invention are in some cases made up of multiple polypeptide chains brought together by disulfide bonds or by non- covalent forces (multimers, oligomers). These sorts of proteins will have multiple N- and C-termini.
- the termini of the polypeptides may be modified such that they begin or end, as the case may be, with a non-polypeptide based moiety such as an organic conjugate.
- any of the features have been identified or defined as a desired component of a polypeptide to be encoded by the chimeric polynucleotide of the invention, any of several manipulations and/or modifications of these features may be performed by moving, swapping, inverting, deleting, randomizing or duplicating.
- manipulation of features may result in the same outcome as a modification to the molecules of the invention.
- a manipulation which involved deleting a domain would result in the alteration of the length of a molecule just as modification of a nucleic acid to encode less than a full length molecule would.
- Modifications and manipulations can be accomplished by methods known in the art such as, but not limited to, site directed mutagenesis or a priori incorporation during chemical synthesis.
- the resulting modified molecules may then be tested for activity using in vitro or in vivo assays such as those described herein or any other suitable screening assay known in the art.
- the polypeptides may comprise a consensus sequence which is discovered through rounds of experimentation.
- a "consensus" sequence is a single sequence which represents a collective population of sequences allowing for variability at one or more sites.
- protein fragments, functional protein domains, and homologous proteins are also considered to be within the scope of polypeptides of interest of this invention.
- any protein fragment meaning a polypeptide sequence at least one amino acid residue shorter than a reference polypeptide sequence but otherwise identical
- a reference protein 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or greater than 100 amino acids in length.
- any protein that includes a stretch of about 20, about 30, about 40, about 50, or about 100 amino acids which are about 40%, about 50%>, about 60%>, about 70%>, about 80%>, about 90%), about 95%o, or about 100% identical to any of the sequences described herein can be utilized in accordance with the invention.
- a polypeptide to be utilized in accordance with the invention includes 2, 3, 4, 5, 6, 7, 8, 9, 10, or more mutations as shown in any of the sequences provided or referenced herein.
- the chimeric polynucleotides of the present invention may be designed to encode polypeptides of interest selected from any of several target categories including, but not limited to, biologies, antibodies, vaccines, therapeutic proteins or peptides, cell penetrating peptides, secreted proteins, plasma membrane proteins, cytoplasmic or cytoskeletal proteins, intracellular membrane bound proteins, nuclear proteins, proteins associated with human disease, targeting moieties or those proteins encoded by the human genome for which no therapeutic indication has been identified but which nonetheless have utility in areas of research and discovery.
- chimeric polynucleotides may encode variant
- polypeptides which have a certain identity with a reference polypeptide sequence.
- a "reference polypeptide sequence” refers to a starting polypeptide sequence. Reference sequences may be wild type sequences or any sequence to which reference is made in the design of another sequence. A “reference polypeptide sequence” may, e.g., be any one of those polypeptides disclosed in Table 6 of co-pending U.S. Provisional Patent Application Nos.
- Reference molecules may share a certain identity with the designed molecules (polypeptides or polynucleotides).
- identity refers to a relationship between the sequences of two or more peptides, polypeptides or polynucleotides, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between them as determined by the number of matches between strings of two or more amino acid residues or nucleosides. Identity measures the percent of identical matches between the smaller of two or more sequences with gap alignments (if any) addressed by a particular mathematical model or computer program (i.e., "algorithms"). Identity of related peptides can be readily calculated by known methods. Such methods include, but are not limited to, those described in Computational Molecular Biology, Lesk, A.
- the encoded polypeptide variant may have the same or a similar activity as the reference polypeptide.
- the variant may have an altered activity (e.g., increased or decreased) relative to a reference polypeptide.
- variants of a particular polynucleotide or polypeptide of the invention will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% but less than 100% sequence identity to that particular reference polynucleotide or polypeptide as determined by sequence alignment programs and parameters described herein and known to those skilled in the art.
- Such tools for alignment include those of the BLAST suite (Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.)
- Other tools are described herein, specifically in the definition of "Identity.”
- BLAST algorithm Default parameters in the BLAST algorithm include, for example, an expect threshold of 10, Word size of 28, Match/Mismatch Scores 1, -2, Gap costs Linear. Any filter can be applied as well as a selection for species specific repeats, e.g., Homo sapiens. Biologies
- the chimeric polynucleotides disclosed herein may encode one or more biologies.
- a "biologic” is a polypeptide-based molecule produced by the methods provided herein and which may be used to treat, cure, mitigate, prevent, or diagnose a serious or life-threatening disease or medical condition.
- Biologies, according to the present invention include, but are not limited to, allergenic extracts (e.g. for allergy shots and tests), blood components, gene therapy products, human tissue or cellular products used in transplantation, vaccines, monoclonal antibodies, cytokines, growth factors, enzymes, thrombolytics, and immunomodulators, among others.
- one or more biologies currently being marketed or in development may be encoded by the chimeric polynucleotides of the present invention. While not wishing to be bound by theory, it is believed that incorporation of the encoding polynucleotides of a known biologic into the chimeric polynucleotides of the invention will result in improved therapeutic efficacy due at least in part to the specificity, purity and/or selectivity of the construct designs.
- the chimeric polynucleotides disclosed herein may encode one or more antibodies or fragments thereof.
- antibody includes monoclonal antibodies (including full length antibodies which have an immunoglobulin Fc region), antibody compositions with polyepitopic specificity, multispecific antibodies (e.g., bispecific antibodies, diabodies, and single-chain molecules), as well as antibody fragments.
- immunoglobulin Ig is used interchangeably with "antibody” herein.
- the term "monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations and/or post- translation modifications (e.g., isomerizations, amidations) that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site.
- the monoclonal antibodies herein specifically include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is(are) identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity.
- chimeric antibodies immunoglobulins in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is(are) identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity.
- Chimeric antibodies of interest herein include, but are not limited to, "primatized” antibodies comprising variable domain antigen-binding sequences derived from a non-human primate (e.g., Old World Monkey, Ape etc.) and human constant region sequences.
- a non- human primate e.g., Old World Monkey, Ape etc.
- human constant region sequences e.g., Old World Monkey, Ape etc.
- an "antibody fragment” comprises a portion of an intact antibody, preferably the antigen binding and/or the variable region of the intact antibody.
- antibody fragments include Fab, Fab', F(ab') 2 and Fv fragments; diabodies; linear antibodies; nanobodies; single-chain antibody molecules and multispecific antibodies formed from antibody fragments.
- any of the five classes of immunoglobulins may be encoded by the chimeric polynucleotides of the invention, including the heavy chains designated alpha, delta, epsilon, gamma and mu, respectively. Also included are polynucleotide sequences encoding the subclasses, gamma and mu.
- any of the subclasses of antibodies may be encoded in part or in whole and include the following subclasses: IgGl, IgG2, IgG3, IgG4, IgAl and IgA2.
- one or more antibodies or fragments currently being marketed or in development may be encoded by the chimeric
- polynucleotides of the present invention While not wishing to be bound by theory, it is believed that incorporation into the chimeric polynucleotides of the invention will result in improved therapeutic efficacy due at least in part to the specificity, purity and selectivity of the polynucleotide designs.
- Antibodies encoded in the chimeric polynucleotides of the invention may be utilized to treat conditions or diseases in many therapeutic areas such as, but not limited to, blood, cardiovascular, CNS, poisoning (including antivenoms), dermatology, endocrinology, gastrointestinal, medical imaging, musculoskeletal, oncology, immunology, respiratory, sensory and anti-infective.
- chimeric polynucleotides disclosed herein may encode monoclonal antibodies and/or variants thereof. Variants of antibodies may also include, but are not limited to, substitutional variants, conservative amino acid substitution, insertional variants, deletional variants and/or covalent derivatives.
- the chimeric polynucleotide or regions thereof disclosed herein may encode an immunoglobulin Fc region.
- the chimeric polynucleotide may encode a variant immunoglobulin Fc region.
- the chimeric polynucleotide may encode an antibody having a variant immunoglobulin Fc region as described in U.S. Pat. No. 8,217,147 herein incorporated by reference in its entirety.
- the chimeric polynucleotides disclosed herein may encode one or more vaccines.
- a "vaccine” is a biological preparation that improves immunity to a particular disease or infectious agent.
- one or more vaccines currently being marketed or in development may be encoded by the chimeric polynucleotides of the present invention. While not wishing to be bound by theory, it is believed that incorporation into the chimeric polynucleotides of the invention will result in improved therapeutic efficacy due at least in part to the specificity, purity and selectivity of the construct designs.
- Vaccines encoded in the chimeric polynucleotides of the invention may be utilized to treat conditions or diseases in many therapeutic areas such as, but not limited to, cardiovascular, CNS, dermatology, endocrinology, oncology, immunology, respiratory, and anti-infective.
- the chimeric polynucleotides disclosed herein may encode one or more validated or "in testing" therapeutic proteins or peptides.
- one or more therapeutic proteins or peptides currently being marketed or in development may be encoded by the chimeric polynucleotides of the present invention. While not wishing to be bound by theory, it is believed that incorporation into the chimeric polynucleotides of the invention will result in improved therapeutic efficacy due at least in part to the specificity, purity and selectivity of the construct designs.
- Therapeutic proteins and peptides encoded in the chimeric polynucleotides of the invention may be utilized to treat conditions or diseases in many therapeutic areas such as, but not limited to, blood, cardiovascular, CNS, poisoning (including
- Cell-Penetrating Polypeptides may encode one or more cell- penetrating polypeptides.
- “cell-penetrating polypeptide” or CPP refers to a polypeptide which may facilitate the cellular uptake of molecules.
- a cell-penetrating polypeptide of the present invention may contain one or more detectable labels.
- the polypeptides may be partially labeled or completely labeled throughout.
- the chimeric polynucleotides may encode the detectable label completely, partially or not at all.
- the cell-penetrating peptide may also include a signal sequence.
- a signal sequence refers to a sequence of amino acid residues bound at the amino terminus of a nascent protein during protein translation. The signal sequence may be used to signal the secretion of the cell-penetrating polypeptide.
- the chimeric polynucleotides may also encode a fusion protein.
- the fusion protein may be created by operably linking a charged protein to a therapeutic protein.
- “operably linked” refers to the therapeutic protein and the charged protein being connected in such a way to permit the expression of the complex when introduced into the cell.
- “charged protein” refers to a protein that carries a positive, negative or overall neutral electrical charge.
- the therapeutic protein may be covalently linked to the charged protein in the formation of the fusion protein.
- the ratio of surface charge to total or surface amino acids may be approximately 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8 or 0.9.
- the cell-penetrating polypeptide encoded by the chimeric polynucleotides may form a complex after being translated.
- the complex may comprise a charged protein linked, e.g. covalently linked, to the cell-penetrating polypeptide.
- “Therapeutic protein” refers to a protein that, when administered to a cell has a therapeutic, diagnostic, and/or prophylactic effect and/or elicits a desired biological and/or pharmacological effect.
- the cell-penetrating polypeptide may comprise a first domain and a second domain.
- the first domain may comprise a supercharged polypeptide.
- the second domain may comprise a protein-binding partner.
- protein-binding partner includes, but is not limited to, antibodies and functional fragments thereof, scaffold proteins, or peptides.
- the cell-penetrating polypeptide may further comprise an intracellular binding partner for the protein-binding partner.
- the cell-penetrating polypeptide may be capable of being secreted from a cell where the chimeric polynucleotides may be introduced.
- the cell-penetrating polypeptide may also be capable of penetrating the first cell.
- the cell-penetrating polypeptide is capable of penetrating a second cell.
- the second cell may be from the same area as the first cell, or it may be from a different area.
- the area may include, but is not limited to, tissues and organs.
- the second cell may also be proximal or distal to the first cell.
- the chimeric polynucleotides may encode a cell- penetrating polypeptide which may comprise a protein-binding partner.
- the protein binding partner may include, but is not limited to, an antibody, a supercharged antibody or a functional fragment.
- the chimeric polynucleotides may be introduced into the cell where a cell-penetrating polypeptide comprising the protein-binding partner is introduced.
- One type of sorting signal called a signal sequence, a signal peptide, or a leader sequence, directs a class of proteins to an organelle called the endoplasmic reticulum (ER).
- ER endoplasmic reticulum
- Proteins targeted to the ER by a signal sequence can be released into the extracellular space as a secreted protein.
- proteins residing on the cell membrane can also be secreted into the extracellular space by proteolytic cleavage of a "linker" holding the protein to the membrane.
- the molecules of the present invention may be used to exploit the cellular trafficking described above. As such, in some embodiments of the invention, chimeric
- polynucleotides are provided to express a secreted protein.
- the secreted proteins may be selected from those described herein or those in US Patent Publication, 20100255574, the contents of which are incorporated herein by reference in their entirety. [000182] In one embodiment, these may be used in the manufacture of large quantities of human gene products.
- chimeric polynucleotides are provided to express a protein of the plasma membrane.
- chimeric polynucleotides are provided to express a cytoplasmic or cytoskeletal protein.
- chimeric polynucleotides are provided to express an intracellular membrane bound protein.
- chimeric polynucleotides are provided to express a nuclear protein.
- chimeric polynucleotides are provided to express a protein associated with human disease.
- chimeric polynucleotides are provided to express a protein with a presently unknown therapeutic function.
- chimeric polynucleotides are provided to express a targeting moiety. These include a protein-binding partner or a receptor on the surface of the cell, which functions to target the cell to a specific tissue space or to interact with a specific moiety, either in vivo or in vitro. Suitable protein-binding partners include, but are not limited to, antibodies and functional fragments thereof, scaffold proteins, or peptides. Additionally, chimeric polynucleotides can be employed to direct the synthesis and extracellular localization of lipids, carbohydrates, or other biological moieties or biomolecules.
- the chimeric polynucleotides may be used to produce polypeptide libraries. These libraries may arise from the production of a population of chimeric polynucleotides, each containing various structural or chemical modification designs.
- a population of chimeric polynucleotides may comprise a plurality of encoded polypeptides, including but not limited to, an antibody or antibody fragment, protein binding partner, scaffold protein, and other polypeptides taught herein or known in the art.
- the chimeric polynucleotides may be suitable for direct introduction into a target cell or culture which in turn may synthesize the encoded polypeptides.
- multiple variants of a protein may be produced and tested to determine the best variant in terms of pharmacokinetics, stability, biocompatibility, and/or biological activity, or a biophysical property such as expression level.
- a library may contain 10, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , or over 10 9 possible variants (including, but not limited to, substitutions, deletions of one or more residues, and insertion of one or more residues).
- the chimeric polynucleotides of the present invention may be designed to encode on or more antimicrobial peptides (AMP) or antiviral peptides (A VP).
- AMPs and AVPs have been isolated and described from a wide range of animals such as, but not limited to, microorganisms, invertebrates, plants, amphibians, birds, fish, and mammals (Wang et ah, Nucleic Acids Res. 2009; 37 (Database issue):D933-7).
- Anti-microbial and anti-viral polypeptides are described in International Publication No. WO2013151666, the contents of which are herein incorporated by reference. As a non-limting example, anti-microbial polypeptides are described in paragraphs [000189] -[000199] of
- chimeric polynucleotides may be designed to comprise regions, subregions or parts which function in a similar manner as known regions or parts of other nucleic acid based molecules. Such regions include those mRNA regions discussed herein as well as noncoding regions. Noncoding regions may be at the level of a single nucleoside such as the case when the region is or incorporates one or more cytotoxic nucleosides.
- the chimeric polynucleotides of the present invention may incorporate one or more cytotoxic nucleosides.
- cytotoxic nucleosides may be incorporated into chimeric polynucleotides such as bifunctional modified RNAs or mRNAs.
- Cytotoxic nucleoside anti-cancer agents include, but are not limited to, adenosine arabinoside, cytarabine, cytosine arabinoside, 5-fluorouracil, fludarabine, floxuridine, FTORAFUR® (a combination of tegafur and uracil), tegafur ((RS)-5-fluoro- l-(tetrahydrofuran-2-yl)pyrimidine-2,4(lH,3H)-dione), and 6-mercaptopurine.
- cytotoxic nucleoside analogues are in clinical use, or have been the subject of clinical trials, as anticancer agents.
- examples of such analogues include, but are not limited to, cytarabine, gemcitabine, troxacitabine, decitabine, tezacitabine, 2'- deoxy-2'-methylidenecytidine (DMDC), cladribine, clofarabine, 5-azacytidine, 4 ' -thio- aracytidine, cyclopentenylcytosine and l-(2-C-cyano-2-deoxy-beta-D-arabino- pentofuranosyl)-cytosine.
- Another example of such a compound is fludarabine phosphate.
- cytotoxic nucleoside analogues examples include, but are not limited to, N4-behenoyl-l-beta-D- arabinofuranosylcytosine, N4-octadecyl- 1 -beta-D-arabinofuranosylcytosine, N4- palmitoyl-l-(2-C-cyano-2-deoxy-beta-D-arabino-pentofuranosyl) cytosine, and P-4055 (cytarabine 5 ' -elaidic acid ester).
- these prodrugs may be converted into the active drugs mainly in the liver and systemic circulation and display little or no selective release of active drug in the tumor tissue.
- active drug for example, capecitabine, a prodrug of 5 ' - deoxy-5-fluorocytidine (and eventually of 5-fluorouracil), is metabolized both in the liver and in the tumor tissue.
- capecitabine analogues containing "an easily hydrolysable radical under physiological conditions" has been claimed by Fujiu et al. (U.S. Pat. No. 4,966,891) and is herein incorporated by reference.
- Cytotoxic nucleotides which may be chemotherapeutic also include, but are not limited to, pyrazolo [3,4-D]-pyrimidines, allopurinol, azathioprine, capecitabine, cytosine arabinoside, fluorouracil, mercaptopurine, 6-thioguanine, acyclovir, ara- adenosine, ribavirin, 7-deaza-adenosine, 7-deaza-guanosine, 6-aza-uracil, 6-aza-cytidine, thymidine ribonucleotide, 5-bromodeoxyuridine, 2-chloro-purine, and inosine, or combinations thereof.
- pyrazolo [3,4-D]-pyrimidines allopurinol, azathioprine, capecitabine, cytosine arabinoside, fluorouracil, mercaptopurine, 6-thioguanine,
- the chimeric polynucleotides of the present invention may comprise one or more regions or parts which act or function as an untranslated region. Where chimeric polynucleotides are designed to encode a polypeptide of interest, they may comprise one or more of these untranslated regions.
- UTRs wild type untranslated regions of a gene are transcribed but not translated.
- the 5'UTR starts at the transcription start site and continues to the start codon but does not include the start codon; whereas, the 3'UTR starts immediately following the stop codon and continues until the transcriptional termination signal.
- the regulatory features of a UTR can be incorporated into the chimeric polynucleotides of the present invention to, among other things, enhance the stability of the molecule.
- the specific features can also be incorporated to ensure controlled down-regulation of the transcript in case they are misdirected to undesired organs sites.
- Natural 5'UTRs bear features which play roles in translation initiation. They harbor signatures like Kozak sequences which are commonly known to be involved in the process by which the ribosome initiates translation of many genes. Kozak sequences have the consensus CCR(A/G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another 'G'. 5'UTR also have been known to form secondary structures which are involved in elongation factor binding.
- liver- expressed mRNA such as albumin, serum amyloid A, Apolipoprotein A/B/E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII
- introduction of 5' UTR of liver- expressed mRNA such as albumin, serum amyloid A, Apolipoprotein A/B/E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII, could be used to enhance expression of a nucleic acid molecule, such as a chimeric polynucleotides, in hepatic cell lines or liver.
- tissue-specific mRNA to improve expression in that tissue is possible for muscle (MyoD, Myosin, Myoglobin, Myogenin, Herculin), for endothelial cells (Tie-1, CD36), for myeloid cells (C/EBP, AML1, G-CSF, GM-CSF, CD1 lb, MSR, Fr-1, i-NOS), for leukocytes (CD45, CD18), for adipose tissue (CD36, GLUT4, ACRP30, adiponectin) and for lung epithelial cells (SP-A/B/C/D).
- Untranslated regions useful in the design and manufacture of chimeric polynucleotides include, but are not limited, to those disclosed in co-pending, co-owned US Serial Number (USSN) 61/829372 (Attorney Docket Number M42), the contents of which are incorporated herein by reference in its entirety.
- non-UTR sequences may also be used as regions or subregions within the chimeric polynucleotides.
- introns or portions of introns sequences may be incorporated into regions of the chimeric polynucleotides of the invention. Incorporation of intronic sequences may increase protein production as well as polynucletoide levels.
- the ORF may be flanked by a 5 ' UTR which may contain a strong Kozak translational initiation signal and/or a 3 ' UTR which may include an oligo(dT) sequence for templated addition of a poly-A tail.
- 5 'UTR may comprise a first polynucleotide fragment and a second polynucleotide fragment from the same and/or different genes such as the 5 'UTRs described in US Patent Application Publication No. 20100293625, herein incorporated by reference in its entirety.
- Variants of 5 ' or 3 ' UTRs may be utilized wherein one or more nucleotides are added or removed to the termini, including A, T, C or G.
- any UTR from any gene may be incorporated into the regions of the chimeric polynucleotide.
- multiple wild-type UTRs of any known gene may be utilized. It is also within the scope of the present invention to provide artificial UTRs which are not variants of wild type regions. These UTRs or portions thereof may be placed in the same orientation as in the transcript from which they were selected or may be altered in orientation or location. Hence a 5 ' or 3' UTR may be inverted, shortened, lengthened, made chimeric with one or more other 5' UTRs or 3' UTRs.
- the term "altered" as it relates to a UTR sequence means that the UTR has been changed in some way in relation to a reference sequence.
- a 3' or 5' UTR may be altered relative to a wild type or native UTR by the change in orientation or location as taught above or may be altered by the inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. Any of these changes producing an "altered" UTR (whether 3' or 5') comprise a variant UTR.
- a double, triple or quadruple UTR such as a 5' or 3' UTR may be used.
- a "double" UTR is one in which two copies of the same UTR are encoded either in series or substantially in series.
- a double beta- globin 3' UTR may be used as described in US Patent publication 20100129877, the contents of which are incorporated herein by reference in its entirety.
- patterned UTRs are those UTRs which reflect a repeating or alternating pattern, such as ABABAB or AABBAABBAABB or ABCABCABC or variants thereof repeated once, twice, or more than 3 times. In these patterns, each letter, A, B, or C represent a different UTR at the nucleotide level.
- flanking regions are selected from a family of transcripts whose proteins share a common function, structure, feature of property.
- polypeptides of interest may belong to a family of proteins which are expressed in a particular cell, tissue or at some time during development.
- the UTRs from any of these genes may be swapped for any other UTR of the same or different family of proteins to create a new chimeric polynucleotide.
- a "family of proteins" is used in the broadest sense to refer to a group of two or more polypeptides of interest which share at least one function, structure, feature, localization, origin, or expression pattern.
- the untranslated region may also include translation enhancer elements (TEE).
- TEE translation enhancer elements
- the TEE may include those described in US
- AU rich elements can be separated into three classes (Chen et al, 1995): Class I AREs contain several dispersed copies of an AUUUA motif within U-rich regions. C- Myc and MyoD contain class I AREs. Class II AREs possess two or more overlapping UUAUUUA(U/A)(U/A) nonamers. Molecules containing this type of AREs include GM-CSF and TNF-a. Class III ARES are less well defined.
- AREs 3' UTR AU rich elements
- one or more copies of an ARE can be introduced to make chimeric polynucleotides of the invention less stable and thereby curtail translation and decrease production of the resultant protein.
- AREs can be identified and removed or mutated to increase the intracellular stability and thus increase translation and production of the resultant protein.
- Transfection experiments can be conducted in relevant cell lines, using chimeric polynucleotides of the invention and protein production can be assayed at various time points post-transfection. For example, cells can be transfected with different ARE-engineering molecules and by using an ELISA kit to the relevant protein and assaying protein produced at 6 hour, 12 hour, 24 hour, 48 hour, and 7 days post-transfection.
- microRNAs are 19-25 nucleotide long noncoding RNAs that bind to the 3 'UTR of nucleic acid molecules and down-regulate gene expression either by reducing nucleic acid molecule stability or by inhibiting translation.
- the chimeric polynucleotides of the invention may comprise one or more microRNA target sequences, microRNA seqences, or microRNA seeds. Such sequences may correspond to any known microRNA such as those taught in US Publication US2005/0261218 and US Publication US2005/0059005, the contents of which are incorporated herein by reference in their entirety.
- a microRNA sequence comprises a "seed" region, i.e., a sequence in the region of positions 2-8 of the mature microRNA, which sequence has perfect Watson- Crick complementarity to the miRNA target sequence.
- a microRNA seed may comprise positions 2-8 or 2-7 of the mature microRNA.
- a microRNA seed may comprise 7 nucleotides (e.g., nucleotides 2-8 of the mature microRNA), wherein the seed-complementary site in the corresponding miRNA target is flanked by an adenine (A) opposed to microRNA position 1.
- a microRNA seed may comprise 6 nucleotides (e.g., nucleotides 2-7 of the mature microRNA), wherein the seed-complementary site in the corresponding miRNA target is flanked byan adenine (A) opposed to microRNA position 1.
- A an adenine
- the bases of the microRNA seed have complete complementarity with the target sequence.
- microRNA target sequences By engineering microRNA target sequences into the chimeric polynucleotides (e.g., in a 3 ' UTR like region or other region) of the invention one can target the molecule for degradation or reduced translation, provided the microRNA in question is available. This process will reduce the hazard of off target effects upon nucleic acid molecule delivery. Identification of microRNA, microRNA target regions, and their expression patterns and role in biology have been reported (Bonauer et al., Curr Drug Targets 2010 11 :943-949; Anand and Cheresh Curr Opin Hematol 2011 18: 171-176; Contreras and Rao Leukemia 2012 26:404-413 (2011 Dec 20. doi: 10.1038/leu.2011.356); Barrel Cell 2009 136:215-233; Landgraf et al, Cell, 2007 129: 1401-1414; each of which is herein incorporated by reference in its entirety).
- the nucleic acid molecule is an mRNA and is not intended to be delivered to the liver but ends up there, then miR-122, a microRNA abundant in liver, can inhibit the expression of the gene of interest if one or multiple target sites of miR-122 are engineered into the 3' UTR region of the chimeric polynucleotides.
- Introduction of one or multiple binding sites for different microRNA can be engineered to further decrease the longevity, stability, and protein translation of a chimeric polynucleotides.
- microRNA site refers to a microRNA target site or a microRNA recognition site, or any nucleotide sequence to which a microRNA binds or associates. It should be understood that “binding” may follow traditional Watson-Crick hybridization rules or may reflect any stable association of the microRNA with the target sequence at or adjacent to the microRNA site.
- microRNA binding sites can be engineered out of (i.e. removed from) sequences in which they occur, e.g., in order to increase protein expression in specific tissues.
- miR-122 binding sites may be removed to improve protein expression in the liver. Regulation of expression in multiple tissues can be accomplished through introduction or removal or one or several microRNA binding sites.
- tissues where microRNA are known to regulate mRNA, and thereby protein expression include, but are not limited to, liver (miR-122), muscle (miR- 133, miR-206, miR-208), endothelial cells (miR-17-92, miR-126), myeloid cells (miR- 142-3p, miR-142-5p, miR-16, miR-21, miR-223, miR-24, miR-27), adipose tissue (let-7, miR-30c), heart (miR-ld, miR-149), kidney (miR-192, miR-194, miR-204), and lung epithelial cells (let-7, miR-133, miR-126).
- MicroRNA can also regulate complex biological processes such as angiogenesis (miR- 132) (Anand and Cheresh Curr Opin Hematol 2011 18: 171-176; herein incorporated by reference in its entirety).
- Expression profiles, microRNA and cell lines useful in the present invention include those taught in for example,U.S. Provisional Application Nos 61/857,436 (Attorney Docket Number M39) and 61/857,304 (Attorney Docket Number M37) each filed July 23, 2013, the contents of which are incorporated by reference in their entirety.
- binding sites for microRNAs that are involved in such processes may be removed or introduced, in order to tailor the expression of the chimeric polynucleotides expression to biologically relevant cell types or to the context of relevant biological processes.
- a listing of microRNA, miR sequences and miR binding sites is listed in Table 9 of U.S. Provisional Application No. 61/753,661 filed January 17, 2013, in Table 9 of U.S. Provisional Application No. 61/754,159 filed January 18, 2013, and in Table 7 of U.S. Provisional Application No. 61/758,921 filed January 31, 2013, each of which are herein
- microRNA seed sites can be incorporated into mRNA to decrease expression in certain cells which results in a biological improvement.
- An example of this is incorporation of miR- 142 sites into a UGT1A1 -expressing lentiviral vector.
- miR-142 seed sites reduced expression in hematopoietic cells, and as a consequence reduced expression in antigen- presentating cells, leading to the absence of an immune response against the virally expressed UGT1A1 (Schmitt et al, Gastroenterology 2010; 139:999-1007; Gonzalez- Asequinolaza et al. Gastroenterology 2010, 139:726-729; both herein incorporated by reference in its entirety) .
- Incorporation of miR-142 sites into modified mRNA could not only reduce expression of the encoded protein in hematopoietic cells, but could also reduce or abolish immune responses to the mRNA-encoded protein.
- chimeric polynucleotides can be engineered for more targeted expression in specific cell types or only under specific biological conditions. Through introduction of tissue-specific microRNA binding sites, chimeric polynucleotides could be designed that would be optimal for protein expression in a tissue or in the context of a biological condition.
- Transfection experiments can be conducted in relevant cell lines, using engineered chimeric polynucleotides and protein production can be assayed at various time points post-transfection.
- cells can be transfected with different microRNA binding site-engineering chimeric polynucleotides and by using an ELISA kit to the relevant protein and assaying protein produced at 6 hour, 12 hour, 24 hour, 48 hour, 72 hour and 7 days post-transfection.
- In vivo experiments can also be conducted using microRNA-binding site-engineered molecules to examine changes in tissue- specific expression of formulated chimeric polynucleotides.
- the 5' cap structure of a natural mRNA is involved in nuclear export, increasing mRNA stability and binds the mRNA Cap Binding Protein (CBP), which is responsibile for mRNA stability in the cell and translation competency through the association of CBP with poly(A) binding protein to form the mature cyclic mRNA species.
- CBP mRNA Cap Binding Protein
- the cap further assists the removal of 5' proximal introns removal during mRNA splicing.
- Endogenous mRNA molecules may be 5 '-end capped generating a 5'-ppp-5'- triphosphate linkage between a terminal guanosine cap residue and the 5 '-terminal transcribed sense nucleotide of the mR A molecule.
- This 5'-guanylate cap may then be methylated to generate an N7-methyl-guanylate residue.
- the ribose sugars of the terminal and/or anteterminal transcribed nucleotides of the 5' end of the mRNA may optionally also be 2'-0-methylated.
- 5'-decapping through hydrolysis and cleavage of the guanylate cap structure may target a nucleic acid molecule, such as an mRNA molecule, for degradation.
- chimeric polynucleotides may be designed to incorporate a cap moiety. Modifications to the chimeric polynucleotides of the present invention may generate a non-hydrolyzable cap structure preventing decapping and thus increasing mRNA half-life. Because cap structure hydrolysis requires cleavage of 5'- ppp-5' phosphorodiester linkages, modified nucleotides may be used during the capping reaction. For example, a Vaccinia Capping Enzyme from New England Biolabs
- guanosine nucleotides may be used with a-thio-guanosine nucleotides according to the manufacturer's instructions to create a phosphorothioate linkage in the 5'-ppp-5' cap. Additional modified guanosine nucleotides may be used such as a-methyl-phosphonate and seleno-phosphate nucleotides.
- Additional modifications include, but are not limited to, 2'-0-methylation of the ribose sugars of 5 '-terminal and/or 5 '-anteterminal nucleotides of the chimeric polynucleotide (as mentioned above) on the 2'-hydroxyl group of the sugar ring.
- Multiple distinct 5 '-cap structures can be used to generate the 5 '-cap of a nucleic acid molecule, such as a chimeric polynucleotide which functions as an mRNA molecule.
- Cap analogs which herein are also referred to as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ from natural (i.e. endogenous, wild-type or physiological) 5'-caps in their chemical structure, while retaining cap function. Cap analogs may be chemically (i.e. non-enzymatically) or enzymatically synthesized and/or linked to the chimeric polynucleotides of the invention.
- the Anti-Reverse Cap Analog (ARCA) cap contains two guanines linked by a 5 '-5 '-triphosphate group, wherein one guanine contains an N7 methyl group as well as a 3'-0-methyl group (i.e., N7,3'-0-dimethyl-guanosine-5'- triphosphate-5 '-guanosine (m 7 G-3'mppp-G; which may equivaliently be designated 3' O- Me-m7G(5 ' )ppp(5 ' )G).
- N7,3'-0-dimethyl-guanosine-5'- triphosphate-5 '-guanosine m 7 G-3'mppp-G; which may equivaliently be designated 3' O- Me-m7G(5 ' )ppp(5 ' )G.
- the 3'-0 atom of the other, unmodified, guanine becomes linked to the 5 '-terminal nucleotide of the capped chimeric polynucleotide.
- the N7- and 3'-0- methlyated guanine provides the terminal moiety of the capped chimeric polynucleotide.
- mCAP which is similar to ARCA but has a 2'-0- methyl group on guanosine (i.e., N7,2'-0-dimethyl-guanosine-5'-triphosphate-5'- guanosine, m 7 Gm-ppp-G).
- cap analogs allow for the concomitant capping of a chimeric
- polynucleotide or a region thereof, in an in vitro transcription reaction up to 20% of transcripts can remain uncapped. This, as well as the structural differences of a cap analog from an endogenous 5 '-cap structures of nucleic acids produced by the
- endogenous, cellular transcription machinery may lead to reduced translational competency and reduced cellular stability.
- Chimeric polynucleotides of the invention may also be capped post- manufacture (whether IVT or chemical synthesis), using enzymes, in order to generate more authentic 5 '-cap structures.
- the phrase "more authentic” refers to a feature that closely mirrors or mimics, either structurally or functionally, an endogenous or wild type feature. That is, a "more authentic" feature is better representative of an endogenous, wild-type, natural or physiological cellular function and/or structure as compared to synthetic features or analogs, etc., of the prior art, or which outperforms the corresponding endogenous, wild-type, natural or physiological feature in one or more respects.
- Non- limiting examples of more authentic 5 'cap structures of the present invention are those which, among other things, have enhanced binding of cap binding proteins, increased half life, reduced susceptibility to 5' endonucleases and/or reduced 5'decapping, as compared to synthetic 5 'cap structures known in the art (or to a wild-type, natural or physiological 5 'cap structure).
- recombinant Vaccinia Virus Capping Enzyme and recombinant 2'-0-methyltransferase enzyme can create a canonical 5 '-5 '-triphosphate linkage between the 5 '-terminal nucleotide of a chimeric
- Capl structure a structure wherein the cap guanine contains an N7 methylation and the 5 '-terminal nucleotide of the mRNA contains a 2'-0-methyl.
- Capl structure Such a structure is termed the Capl structure. This cap results in a higher translational- competency and cellular stability and a reduced activation of cellular pro-inflammatory cytokines, as compared, e.g., to other 5 'cap analog structures known in the art.
- Cap structures include, but are not limited to, 7mG(5 ' ) ⁇ (5 ' )N,pN2p (cap 0), 7mG(5 ')ppp(5 ')NlmpNp (cap 1), and 7mG(5 ')-ppp(5 ')NlmpN2mp (cap 2).
- the chimeric polynucleotides may be capped post-manufacture, and because this process is more efficient, nearly 100% of the chimeric polynucleotides may be capped. This is in contrast to -80% when a cap analog is linked to a chimeric polynucleotide in the course of an in vitro transcription reaction.
- 5' terminal caps may include endogenous caps or cap analogs.
- a 5' terminal cap may comprise a guanine analog.
- Useful guanine analogs include, but are not limited to, inosine, Nl- methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino- guanosine, LNA-guanosine, and 2-azido-guanosine.
- Additional viral sequences such as, but not limited to, the translation enhancer sequence of the barley yellow dwarf virus (BYDV-PAV), the Jaagsiekte sheep retrovirus (JSRV) and/or the Enzootic nasal tumor virus (See e.g., International Pub. No.
- WO2012129648 can be engineered and inserted in the chimeric polynucleotides of the invention and can stimulate the translation of the construct in vitro and in vivo.
- Trans fection experiments can be conducted in relevant cell lines at and protein production can be assayed by ELISA at 12hr, 24hr, 48hr, 72 hr and day 7 post-transfection.
- chimeric polynucleotides which may contain an internal ribosome entry site (IRES).
- IRES internal ribosome entry site
- An IRES may act as the sole ribosome binding site, or may serve as one of multiple ribosome binding sites of an mRNA.
- Chimeric polynucleotides containing more than one functional ribosome binding site may encode several peptides or polypeptides that are translated independently by the ribosomes ("multicistronic nucleic acid molecules").
- IRES sequences that can be used according to the invention include without limitation, those from picornaviruses (e.g. FMDV), pest viruses (CFFV), polio viruses (PV), encephalomyocarditis viruses (ECMV), foot-and- mouth disease viruses (FMDV), hepatitis C viruses (HCV), classical swine fever viruses (CSFV), murine leukemia virus (MLV), simian immune deficiency viruses (SIV) or cricket paralysis viruses (CrPV).
- picornaviruses e.g. FMDV
- CFFV pest viruses
- PV polio viruses
- ECMV encephalomyocarditis viruses
- FMDV foot-and- mouth disease viruses
- HCV hepatitis C viruses
- CSFV classical swine fever viruses
- MLV murine leukemia virus
- SIV simian immune deficiency viruses
- CrPV cricket paralysis viruses
- a long chain of adenine nucleotides may be added to a polynucleotide such as an mR A molecule in order to increase stability.
- a polynucleotide such as an mR A molecule
- poly-A polymerase adds a chain of adenine nucleotides to the RNA.
- the process called polyadenylation, adds a poly-A tail that can be between, for example, approximately 100 and 250 residues long (SEQ ID NO: 6).
- PolyA tails may also be added after the construct is exported from the nucleus.
- terminal groups on the poly A tail may be incorporated for stabilization.
- Chimeric polynucleotides of the present invention may incude des-3 ' hydroxyl tails. They may also include structural moieties or 2 ' -Omethyl modifications as taught by Junjie Li, et al.(Current Biology, Vol. 15, 1501-1507, August 23, 2005), the contents of which are incorporated herein by reference in its entirety.
- the chimeric polynucleotides of the present invention may be desiged to encode transcripts with alternative polyA tail structures including histone mRNA.
- SLBP stem-loop binding protein
- Unique poly-A tail lengths provide certain advantages to the chimeric polynucleotides of the present invention.
- the length of a poly-A tail, when present, is greater than 30 nucleotides in length (SEQ ID NO: 7).
- the poly-A tail is greater than 35 nucleotides in length (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides).
- the chimeric polynucleotide or region thereof includes from about 30 to about 3,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 750, from 30 to 1,000, from 30 to 1,500, from 30 to 2,000, from 30 to 2,500, from 50 to 100, from 50 to 250, from 50 to 500, from 50 to 750, from 50 to 1 ,000, from 50 to 1,500, from 50 to 2,000, from 50 to 2,500, from 50 to 3,000, from 100 to 500, from 100 to 750, from 100 to 1,000, from 100 to 1,500, from 100 to 2,000, from 100 to 2,500, from 100 to 3,000, from 500 to 750, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 2,500, from 500 to 3,000, from 1,000 to 1,500, from 1,000 to 2,000, from 1,000 to 2,500, from 1,000 to 3,000, from 1,500 to 2,000, from 1,500 to 2,500, from 1,500 to 2,500
- the poly-A tail is designed relative to the length of the overall chimeric polynucleotides or the length of a particular region of the chimeric polynucleotide. This design may be based on the length of a coding region, the length of a particular feature or region or based on the length of the ultimate product expressed from the chimeric polynucleotides.
- the poly-A tail may be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% greater in length than the chimeric polynucleotides or feature thereof.
- the poly-A tail may also be designed as a fraction of chimeric polynucleotides to which it belongs.
- the poly-A tail may be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct, a construct region or the total length of the construct minus the poly-A tail.
- polynucleotides for Poly-A binding protein may enhance expression.
- multiple distinct chimeric polynucleotides may be linked together via the PABP (Poly-A binding protein) through the 3 '-end using modified nucleotides at the 3 '-terminus of the poly-A tail.
- Transfection experiments can be conducted in relevant cell lines at and protein production can be assayed by ELISA at 12hr, 24hr, 48hr, 72 hr and day 7 post-transfection.
- the chimeric polynucleotides of the present invention are designed to include a polyA-G quartet region.
- the G-quartet is a cyclic hydrogen bonded array of four guanine nucleotides that can be formed by G-rich sequences in both DNA and RNA.
- the G-quartet is incorporated at the end of the poly-A tail.
- the resultant polynucleotide is assayed for stability, protein production and other parameters including half-life at various time points. It has been discovered that the polyA-G quartet results in protein production from an mRNA equivalent to at least 75% of that seen using a poly-A tail of 120 nucleotides alone (SEQ ID NO: 8).
- chimeric polynucleotides of the present invention may have regions that are analogous to or function like a start codon region.
- translation of a chimeric polynucleotide may initiate on a codon which is not the start codon AUG.
- Translation of the chimeric polynucleotide may initiate on an alternative start codon such as, but not limited to, ACG, AGG, AAG, CTG/CUG, GTG/GUG, ATA/AUA, ATT/AUU, TTG/UUG (see Touriol et al. Biology of the Cell 95 (2003) 169-178 and Matsuda and Mauro PLoS ONE, 2010 5: 11; the contents of each of which are herein incorporated by reference in its entirety).
- the translation of a chimeric polynucleotide begins on the alternative start codon ACG.
- chimeric polynucleotide translation begins on the alternative start codon CTG/CUG.
- the translation of a chimeric polynucleotide begins on the alternative start codon
- Nucleotides flanking a codon that initiates translation such as, but not limited to, a start codon or an alternative start codon, are known to effect the translation efficiency, the length and/or the structure of the polynucleotide. (See e.g., Matsuda and Mauro PLoS ONE, 2010 5: 11; the contents of which are herein incorporated by reference in its entirety). Masking any of the nucleotides flanking a codon that initiates translation may be used to alter the position of translation initiation, translation efficiency, length and/or structure of a polynucleotide.
- a masking agent may be used near the start codon or alternative start codon in order to mask or hide the codon to reduce the probability of translation initiation at the masked start codon or alternative start codon.
- masking agents include antisense locked nucleic acids (LNA)
- EJCs exon-junction complexes
- a masking agent may be used to mask a start codon of a chimeric polynucleotide in order to increase the likelihood that translation will initiate on an alternative start codon.
- a masking agent may be used to mask a first start codon or alternative start codon in order to increase the chance that translation will initiate on a start codon or alternative start codon downstream to the masked start codon or alternative start codon.
- a start codon or alternative start codon may be located within a perfect complement for a miR binding site.
- the perfect complement of a miR binding site may help control the translation, length and/or structure of the chimeric polynucleotide similar to a masking agent.
- the start codon or alternative start codon may be located in the middle of a perfect complement for a miR- 122 binding site.
- the start codon or alternative start codon may be located after the first nucleotide, second nucleotide, third nucleotide, fourth nucleotide, fifth nucleotide, sixth nucleotide, seventh nucleotide, eighth nucleotide, ninth nucleotide, tenth nucleotide, eleventh nucleotide, twelfth nucleotide, thirteenth nucleotide, fourteenth nucleotide, fifteenth nucleotide, sixteenth nucleotide, seventeenth nucleotide, eighteenth nucleotide, nineteenth nucleotide, twentieth nucleotide or twenty-first nucleotide.
- the start codon of a chimeric polynucleotide may be removed from the chimeric polynucleotide sequence in order to have the translation of the chimeric polynucleotide begin on a codon which is not the start codon. Translation of the chimeric polynucleotide may begin on the codon following the removed start codon or on a downstream start codon or an alternative start codon.
- the start codon ATG/AUG is removed as the first 3 nucleotides of the chimeric polynucleotide sequence in order to have translation initiate on a downstream start codon or alternative start codon.
- the chimeric polynucleotide sequence where the start codon was removed may further comprise at least one masking agent for the downstream start codon and/or alternative start codons in order to control or attempt to control the initiation of translation, the length of the chimeric polynucleotide and/or the structure of the chimeric polynucleotide.
- the chimeric polynucleotides of the present invention may include at least two stop codons before the 3 ' untranslated region (UTR).
- the stop codon may be selected from TGA, TAA and TAG.
- the chimeric polynucleotides of the present invention include the stop codon TGA and one additional stop codon.
- the addition stop codon may be TAA.
- the chimeric polynucleotides of the present invention include three stop codons.
- the chimeric polynucleotides may also encode additional features which facilitate trafficking of the polypeptides to therapeutically relevant sites.
- One such feature which aids in protein trafficking is the signal sequence.
- a "signal sequence” or “signal peptide” is a polynucleotide or polypeptide, respectively, which is from about 9 to 200 nucleotides (3-60 amino acids) in length which is incorporated at the 5' (or N-terminus) of the coding region or polypeptide encoded, respectively. Addition of these sequences result in trafficking of the encoded polypeptide to the endoplasmic reticulum through one or more secretory pathways. Some signal peptides are cleaved from the protein by signal peptidase after the proteins are transported.
- the polypeptides of the present invention may include at least one protein cleavage signal containing at least one protein cleavage site.
- the protein cleavage site may be located at the N-terminus, the C-terminus, at any space between the N- and the C- termini such as, but not limited to, half-way between the N- and C-termini, between the N-terminus and the half way point, between the half way point and the C-terminus, and combinations thereof.
- the polypeptides of the present invention may include, but is not limited to, a proprotein convertase (or prohormone convertase), thrombin or Factor Xa protein cleavage signal.
- Proprotein convertases are a family of nine proteinases, comprising seven basic amino acid-specific subtilisin-like serine proteinases related to yeast kexin, known as prohormone convertase 1/3 (PC 1/3), PC2, furin, PC4, PC5/6, paired basic amino-acid cleaving enzyme 4 (PACE4) and PC7, and two other subtilases that cleave at non-basic residues, called subtilisin kexin isozyme 1 (SKI-1) and proprotein convertase subtilisin kexin 9 (PCSK9).
- PC 1/3 prohormone convertase 1/3
- PC2 furin
- PC4 paired basic amino-acid cleaving enzyme 4
- PC7 subtilisin kexin isozyme 1
- the chimeric polynucleotides of the present invention may be engineered such that the chimeric polynucleotide contains at least one encoded protein cleavage signal.
- the encoded protein cleavage signal may be located in any region including but not limited to before the start codon, after the start codon, before the coding region, within the coding region such as, but not limited to, half way in the coding region, between the start codon and the half way point, between the half way point and the stop codon, after the coding region, before the stop codon, between two stop codons, after the stop codon and combinations thereof.
- the chimeric polynucleotides of the present invention may include at least one encoded protein cleavage signal containing at least one protein cleavage site.
- the encoded protein cleavage signal may include, but is not limited to, a proprotein convertase (or prohormone convertase), thrombin and/or Factor Xa protein cleavage signal.
- the polypeptides of the present invention include at least one protein cleavage signal and/or site with the proviso that the polypeptide is not GLP-1.
- the 5 ' UTR of the chimeric polynucleotide may be replaced by the insertion of at least one region and/or string of nucleosides of the same base.
- the region and/or string of nucleotides may include, but is not limited to, at least 3, at least 4, at least 5, at least 6, at least 7 or at least 8 nucleotides and the nucleotides may be natural and/or unnatural.
- the group of nucleotides may include 5-8 adenine, cytosine, thymine, a string of any of the other nucleotides disclosed herein and/or combinations thereof.
- the 5 ' UTR of the chimeric polynucleotide may be replaced by the insertion of at least two regions and/or strings of nucleotides of two different bases such as, but not limited to, adenine, cytosine, thymine, any of the other nucleotides disclosed herein and/or combinations thereof.
- the 5 ' UTR may be replaced by inserting 5-8 adenine bases followed by the insertion of 5-8 cytosine bases.
- the 5 ' UTR may be replaced by inserting 5-8 cytosine bases followed by the insertion of 5-8 adenine bases.
- the chimeric polynucleotide may include at least one substitution and/or insertion downstream of the transcription start site which may be recognized by an RNA polymerase.
- at least one substitution and/or insertion may occur downstream the transcription start site by substituting at least one nucleic acid in the region just downstream of the transcription start site (such as, but not limited to, +1 to +6). Changes to region of nucleotides just downstream of the transcription start site may affect initiation rates, increase apparent nucleotide
- NTP triphosphate
- the chimeric polynucleotide may include the substitution of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12 or at least 13 guanine bases downstream of the transcription start site.
- the chimeric polynucleotide may include the substitution of at least 1, at least 2, at least 3, at least 4, at least 5 or at least 6 guanine bases in the region just downstream of the transcription start site.
- the guanine bases may be substituted by at least 1, at least 2, at least 3 or at least 4 adenine nucleotides.
- the nucleotides in the region are GGGAGA the guanine bases may be substituted by at least 1, at least 2, at least 3 or at least 4 cytosine bases.
- the guanine bases in the region are GGGAGA the guanine bases may be substituted by at least 1, at least 2, at least 3 or at least 4 thymine, and/or any of the nucleotides described herein.
- the chimeric polynucleotide may include at least one substitution and/or insertion upstream of the start codon.
- the start codon is the first codon of the protein coding region whereas the transcription start site is the site where transcription begins.
- the chimeric polynucleotide may include, but is not limited to, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 or at least 8 substitutions and/or insertions of nucleotide bases.
- the nucleotide bases may be inserted or substituted at 1, at least 1, at least 2, at least 3, at least 4 or at least 5 locations upstream of the start codon.
- the nucleotides inserted and/or substituted may be the same base (e.g., all A or all C or all T or all G), two different bases (e.g., A and C, A and T, or C and T), three different bases (e.g., A, C and T or A, C and T) or at least four different bases.
- the guanine base upstream of the coding region in the chimeric polynucleotide may be substituted with adenine, cytosine, thymine, or any of the nucleotides described herein.
- the substitution of guanine bases in the chimeric polynucleotide may be designed so as to leave one guanine base in the region
- At least 5 nucleotides may be inserted at 1 location downstream of the transcription start site but upstream of the start codon and the at least 5 nucleotides may be the same base type.
- the chimeric polynucleotides of the present invention may include at least one post transcriptional control modulator. These post
- transcriptional control modulators may be, but are not limited to, small molecules, compounds and regulatory sequences.
- post transcriptional control may be achieved using small molecules identified by PTC Therapeutics Inc. (South Plainfield, NJ) using their GEMSTM (Gene Expression Modulation by Small- Moleclues) screening technology.
- the chimeric polynucleotides of the present invention may include at least one post transcriptional control modulator as described in
- the chimeric polynucleotides, their regions or parts or subregions may be codon optimized. Codon optimization methods are known in the art and may be useful in efforts to achieve one or more of several goals. These goals include to match codon frequencies in target and host organisms to ensure proper folding, bias GC content to increase mRNA stability or reduce secondary structures, minimize tandem repeat codons or base runs that may impair gene construction or expression, customize transcriptional and translational control regions, insert or remove protein trafficking sequences, remove/add post translation modification sites in encoded protein (e.g.
- Codon optimization tools, algorithms and services are known in the art, non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and/or proprietary methods.
- the ORF sequence is optimized using optimization algorithms. Codon options for each amino acid are given in Table 1.
- regions of the chimeric polynucleotide may be upstream (5 ') or downstream (3 ') to a region which encodes a polypeptide. These regions may be incorporated into the chimeric polynucleotide before and/or after codon optimization of the protein encoding region or open reading frame (ORF). It is not required that a chimeric polynucleotide contain both a 5' and 3' flanking region.
- a 5' UTR and/or a 3' UTR region may be provided as flanking regions. Multiple 5 ' or 3' UTRs may be included in the flanking regions and may be the same or of different sequences. Any portion of the flanking regions, including none, may be codon optimized and any may independently contain one or more different structural or chemical modifications, before and/or after codon optimization.
- the chimeric polynucleotides components are reconstituted and transformed into a vector such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes.
- a vector such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes.
- the optimized polynculeotide may be reconstituted and transformed into chemically competent E. coli, yeast, neurospora, maize, drosophila, etc. where high copy plasmid-like or chromosome structures occur by methods described herein.
- Synthetic polynucleotides and their nucleic acid analogs play an important role in the research and studies of biochemical processes.
- Various enzyme-assisted and chemical-based methods have been developed to synthesize polynucleotides and nucleic acids.
- cDNA encoding chimeric polynucleotides may be transcribed using an in vitro transcription (IVT) system.
- the system typically comprises a transcription buffer, nucleotide triphosphates (NTPs), an RNase inhibitor and a polymerase.
- NTPs may be manufactured in house, may be selected from a supplier, or may be synthesized as described herein.
- the NTPs may be selected from, but are not limited to, those described herein including natural and unnatural (modified) NTPs.
- the polymerase may be selected from, but is not limited to, T7 RNA polymerase, T3 RNA polymerase and mutant polymerases such as, but not limited to, polymerases able to incorporate chimeric polynucleotides (e.g., modified nucleic acids).
- RNA polymerases or variants may be used in the synthesis of the chimeric polynucleotides of the present invention.
- RNA polymerases may be modified by inserting or deleting amino acids of the RNA polymerase sequence.
- the RNA polymerase may be modified to exhibit an increased ability to incorporate a 2 ' -modified nucleotide triphosphate compared to an unmodified RNA polymerase (see International Publication WO2008078180 and U.S. Patent 8,101,385; herein incorporated by reference in their entireties).
- Variants may be obtained by evolving an RNA polymerase, optimizing the RNA polymerase amino acid and/or nucleic acid sequence and/or by using other methods known in the art.
- T7 RNA polymerase variants may be evolved using the continuous directed evolution system set out by Esvelt et al.
- T7 RNA polymerase may encode at least one mutation such as, but not limited to, lysine at position 93 substituted for threonine (K93T), I4M, A7T, E63V, V64D, A65E, D66Y, T76N, C125R, S128R, A136T, N165S, G175R, H176L, Y178H, F182L, L196F, G198V, D208Y, E222K, S228A, Q239R, T243N, G259D, M267I, G280C, H300R, D351A, A354S, E356D, L360P, A383V, Y385C, D388Y, S397R, M401T, N410S, K450R, P451T, G452V, E484A, H5
- T7 RNA polymerase variants may encode at least mutation as described in U.S. Pub. Nos. 20100120024 and 20070117112; herein incorporated by reference in their entireties.
- Variants of RNA polymerase may also include, but are not limited to, substitutional variants, conservative amino acid substitution, insertional variants, deletional variants and/or covalent derivatives.
- the chimeric polynucleotide may be designed to be recognized by the wild type or variant RNA polymerases. In doing so, the chimeric polynucleotide may be modified to contain sites or regions of sequence changes from the wild type or parent chimeric polynucleotide.
- Polynucleotide or nucleic acid synthesis reactions may be carried out by enzymatic methods utilizing polymerases.
- Polymerases catalyze the creation of phosphodiester bonds between nucleotides in a polynucleotide or nucleic acid chain.
- DNA polymerase I polymerase I
- a polymerase family including the Klenow fragments of E. Coli, Bacillus DNA polymerase I, Thermus aquaticus (Taq) DNA polymerases, and the T7 RNA and DNA polymerases, is among the best studied of these families.
- DNA polymerase a or B polymerase family, including all eukaryotic replicating DNA polymerases and polymerases from phages T4 and RB69. Although they employ similar catalytic mechanism, these families of polymerases differ in substrate specificity, substrate analog-incorporating efficiency, degree and rate for primer extension, mode of DNA synthesis, exonuclease activity, and sensitivity against inhibitors.
- DNA polymerases are also selected based on the optimum reaction conditions they require, such as reaction temperature, pH, and template and primer concentrations. Sometimes a combination of more than one DNA polymerases is employed to achieve the desired DNA fragment size and synthesis efficiency. For example, Cheng et al. increase pH, add glycerol and dimethyl sulfoxide, decrease denaturation times, increase extension times, and utilize a secondary thermostable DNA polymerase that possesses a 3 ' to 5 ' exonuclease activity to effectively amplify long targets from cloned inserts and human genomic DNA. (Cheng et al, PNAS, Vol.
- RNA polymerases from bacteriophage T3, T7, and SP6 have been widely used to prepare RNAs for biochemical and biophysical studies.
- RNA polymerases, capping enzymes, and poly-A polymerases are disclosed in the co-pending International Publication No. WO2014028429, the contents of which are incorporated herein by reference in their entirety.
- the RNA polymerase which may be used in the synthesis of the chimeric polynucleotides described herein is a Syn5 RNA polymerase (see Zhu et al. Nucleic Acids Research 2013, the contents of which is herein incorporated by reference in its entirety).
- the Syn5 RNA polymerase was recently characterized from marine cyanophage Syn5 by Zhu et al. where they also identified the promoter sequence (see Zhu et al. Nucleic Acids Research 2013, the contents of which is herein incorporated by reference in its entirety). Zhu et al.
- a Syn5 RNA polymerase catalyzed RNA synthesis over a wider range of temperatures and salinity as compared to T7 RNA polymerase. Additionally, the requirement for the initiating nucleotide at the promoter was found to be less stringent for Syn5 RNA polymerase as compared to the T7 RNA polymerase making Syn5 RNA polymerase promising for RNA synthesis.
- a Syn5 RNA polymerase may be used in the synthesis of the chimeric polynucleotides described herein. As a non-limiting example, a Syn5 RNA polymerase may be used in the synthesis of the chimeric polynucleotide requiring a precise 3 '-termini.
- a Syn5 promoter may be used in the synthesis of the chimeric polynucleotides.
- the Syn5 promoter may be 5 ' - ATTGGGCACCCGTAAGGG-3 ' (SEQ ID NO: 3) as described by Zhu et al. (Nucleic Acids Research 2013, the contents of which is herein incorporated by reference in its entirety).
- a Syn5 RNA polymerase may be used in the synthesis of chimeric polynucleotides comprising at least one chemical modification described herein and/or known in the art. (see e.g., the incorporation of pseudo-UTP and 5Me-CTP described in Zhu et al. Nucleic Acids Research 2013, the contents of which is herein incorporated by reference in its entirety).
- the chimeric polynucleotides described herein may be synthesized using a Syn5 RNA polymerase which has been purified using modified and improved purification procedure described by Zhu et al. (Nucleic Acids Research 2013, the contents of which is herein incorporated by reference in its entirety).
- PCR Polymerase chain reaction
- PCR PCR
- dNTPs deoxynucleoside triphosphates
- DNA polymerase a DNA polymerase that binds to the ends of target DNA strands.
- dNTPs deoxynucleoside triphosphates
- PCR requires a cycle of heating and cooling for denaturation and annealing.
- Variations of the basic PCR include asymmetric PCR [Innis et al., PNAS, vol. 85, 9436-9440 (1988)], inverse PCR [Ochman et al, Genetics, vol.
- RT-PCR reverse transcription PCR
- SDA displacement amplification
- Nucleic acid sequence-based amplification also called transcription mediated amplification (TMA) is also an isothermal amplification method that utilizes a combination of DNA polymerase, reverse transcriptase, RNAse H, and T7 RNA polymerase.
- a target RNA is used as a template and a reverse transcriptase synthesizes its complementary DNA strand.
- RNAse H hydrolyzes the RNA template, making space for a DNA polymerase to synthesize a DNA strand complementary to the first DNA strand which is complementary to the RNA target, forming a DNA duplex.
- T7 RNA polymerase continuously generates complementary RNA strands of this DNA duplex. These RNA strands act as templates for new cycles of DNA synthesis, resulting in amplification of the target gene.
- Rolling-circle amplification amplifies a single stranded circular polynucleotide and involves numerous rounds of isothermal enzymatic synthesis where ⁇ 29 DNA polymerase extends a primer by continuously progressing around the polynucleotide circle to replicate its sequence over and over again. Therefore, a linear copy of the circular template is achieved. A primer can then be annealed to this linear copy and its complementary chain can be synthesized. [Lizardi et al., Nature Genetics, vol. 19, 225-232 (1998)] the contents of which are incorporated herein by reference in their entirety. A single stranded circular DNA can also serve as a template for RNA synthesis in the presence of an RNA polymerase.
- RACE inverse rapid amplification of cDNA ends
- CircLigase into a circular DNA The amplification of the resulting circular DNA is achived with RCA. (Polidoros et al, BioTechniques, vol. 41, 35-42 (2006), the contents of which are incorporated herein by reference in their entirety).
- Ligase chain reaction is a promising diagnosing technique based on the principle that two adjacent polynucleotide probes hybridize to one strand of a target gene and couple to each other by a ligase. If a target gene is not present, or if there is a mismatch at the target gene, such as a single-nucleotide polymorphism (SNP), the probes cannot ligase.
- SNP single-nucleotide polymorphism
- LCR may be combined with various amplification techniques to increase sensitivity of detection or to increase the amount of products if it is used in synthesizing polynucleotides and nucleic acids.
- DNA fragments may be placed in a NEBNEXT® ULTRATM DNA Library Prep Kit by NewEngland BioLabs® for end preparation, ligation, size selection, clean-up, PCR amplification and final clean-up.
- RNA-dependent RNA polymerases RNA-dependent RNA polymerases
- Oligonucleotides with non-standard nucleotides may be synthesized with enzymatic polymerization by contacting a template compring non-standard nucleotides with a mixture of nucleotides that are complementary to the nucleotides of the template as disclosed in US Pat. No. 6,617,106 to Benner, the contents of which are incorporated herein by reference in their entirety.
- Chimeric polynucleotides of the invention may be manufactured in whole or in part using solid phase techniques.
- Solid-phase chemical synthesis of polynucleotides or nucleic acids is an automated method wherein molecules are immobilized on a solid support and synthesized step by step in a reactant solution. Impurities and excess reagents are washed away and no purification is required after each step. The automation of the process is amenable on a computer-controlled solid-phase synthesizer. Solid-phase synthesis allows rapid production of polynucleotides or nucleic acids in a relatively large scale that leads to the commercial availability of some polynucleotides or nucleic acids. Furthermore, it is useful in site-specific introduction of chemical modifications in the polynucleotide or nucleic acid sequences. It is an indispensable tool in designing modified derivatives of natural nucleic acids.
- nucleoside building blocks are synthesized in 3 ' to 5 ' direction.
- the hydroxyl group in the 3 ' end of a nucleoside is tethered to a solid support via a chemically cleavable or light-cleavable linker.
- Activated nucleoside monomers such as 2 ' -deoxynucleosides (dA, dC, dG and T), ribonucleosides (A, C, G, and U), or chemically modified nucleosides, are added to the support-bound nucleoside sequentially.
- monomers are the 3 ' -phophoramidite derivatives of nucleoside building blocks.
- the 3 ' phosphorus atom of the activated monomer couples with the 5 ' oxygen atom of the support-bound nucleoside to form a phosphite triester.
- all functional groups not involved in the coupling reaction such as the 5 ' hydroxyl group, the hydroxyl group on the 3 ' phosphorus atom, the 2 ' hydroxyl group in ribonucleosides monomers, and the amino groups on the purine or pyrimidine bases, are all blocked with protection groups.
- the next step involves oxidation of the phosphite triester to form a phosphate triester or phosphotriester, where the phosphorus atom is pentavalent.
- the protection group on the 5 ' hydroxyl group at the end of the growing chain is then removed, ready to couple with an incoming activated monomer building block.
- a cleaving agent such as ammonia or ammonium hydroxide is added to remove all the protecting groups and release the polynucleotide chains from the solid support.
- Light may also be applied to cleave the polynucleotide chain.
- the product can then be further purified with high pressure liquid chromatography (HPLC) or electrophoresis.
- the polynucleotide chain is covalently bound to the solid support via its 3 ' hydroxyl group.
- the solid supports are insoluble particles also called resins, typically 50-200 ⁇ in diameter.
- resins typically 50-200 ⁇ in diameter.
- Many different kinds of resins are now available, as reviewed in "Solid-phase supports for polynucleotide synthesis” by Guzaev [Guzaev, Current Protocols in Nucleic Acid Chemistry, 3.1.1-3.1.60 (2013)], the contents of which are incorporated herein by reference in their entirety.
- the most common materials for the resins include highly cross-linked polystyrene beads and controlled pore glass (CPG) beads.
- the surface of the beads may be treated to have functional groups, such as amino or aminomethyl groups that can be used as anchoring points for linkers to tether nucleosides.
- They can be implemented in columns, multi-well plates, microarrays or microchips.
- the column-based format allows relatively large scale synthesis of the polynucleotides or nucleic acids.
- the resins are held between filters in columns that enable all reagents and solvents to pass through freely.
- Multi-well plates, microarrays, or microchips are designed specifically for cost-effective small scale synthesis. Up to a million polynucleotides can be produced on a single microarray chip. However, the error rates of microchip-based synthesis are higher than traditional column-based methods.
- Linkers are attached to the solid support for further extension of the chain. They are stable to all the reagents used in the synthesis process, except in the end of the synthesis when the chain is detached from the solid support.
- Solid supports with a specific nucleoside linker i.e., A, C, dT, G, or U
- A, C, dT, G, or U can be used to prepare polynucleotides with A, C, T, G, or U as the first nucleotide in the sequence, respectively.
- Universal solid supports with non-nucleoside linkers can be used for all polynucleotide sequences. (US Pat. 6,653,468 to Guzaev et al., the contents of which are incorporated herein by reference in their entirety).
- Various non-nucleoside linkers have been developed for universal supports, a lot of them with two vicinal hydroxyl groups. For example, a succinyl group is a frequently used linker.
- a linker refers to a group of atoms, e.g., 10-1,000 atoms, and can be comprised of the atoms or groups such as, but not limited to, carbon, amino, alkylamino, oxygen, sulfur, sulfoxide, sulfonyl, carbonyl, and imine.
- the linker can be attached to a modified nucleoside or nucleotide on the nucleobase or sugar moiety.
- a linker may be nucleic acid based or non-nucleosidic. The linker may be of sufficient length as to not interfere with incorporation into a nucleic acid sequence.
- the linker can be used for any useful purpose, such as to form multimers (e.g., through linkage of two or more chimeric polynucleotides molecules) or conjugates, as well as to administer a therapeutic molecule or incorporate a label, as described herein.
- Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amido, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted, as described herein.
- linkers include, but are not limited to, unsaturated alkanes, polyethylene glycols (e.g., ethylene or propylene glycol monomeric units, e.g., diethylene glycol, dipropylene glycol, triethylene glycol, tripropylene glycol, tetraethylene glycol, or tetraethylene glycol), and dextran polymers and derivatives thereof,
- Non-limiting examples of a selectively cleavable bond include an amido bond can be cleaved for example by the use of tris(2-carboxyethyl)phosphine (TCEP), or other reducing agents, and/or photolysis, as well as an ester bond can be cleaved for example by acidic or basic hydrolysis.
- TCEP tris(2-carboxyethyl)phosphine
- the 5 ' hydroxyl group on the activated nucleoside phosphoramidite monomers may be protected with 4,4'-dimethoxytrityl (DMT) and the hydroxyl group on the phosphorus atom may be protected with 2-cyanoethyl.
- DMT 4,4'-dimethoxytrityl
- the exocyclic amino groups on the A, C, G bases may be protected with acyl groups.
- Novel protecting groups for solid- phase synthesis monomers include, but are not limited to, carbonate protecting group disclosed in US Pat. No. 8,309,706 to Dellinger et al, orthoester-type 2 ' hydroxyl protecting group and an acyl carbonate-type hydroxyl protecting group disclosed in US Pat. No.
- Short polynucleotide chains with 2-4 nucleotides may be prepared in liquid phase followed by binding to a solid support for extension reactions by solid phase synthesis.
- a high efficiency liquid phase (HELP) synthesis is developed that uses monomethyl ether of polyethylene glycol (MPEG) beads as a support for the monomer building blocks.
- MPEG polyethylene glycol
- MPEG is soluble in methylene chloride and pyridine solvents but precipitates in a diethyl ether solvent.
- the coupling reaction between monomers or between a growing chain and an incoming monomer bound on MPEG can be carried out in a homogenous liquid phase system. The mixture can then be washed with a diethyl ether solvent to easily precipitate and purify the product.
- a solid-phase synthesizer may produce enough polynucleotides or nucleic acids with good purity to preform PCR and other amplification techniques.
- Agilent Technologies have developed microarrays that are commercially available.
- Polynucleotides may be synthesized on a microarray substrate, cleaved by a strong base or light, followed by PCR amplification to generate a library of polynucleotides.
- Regions or subregions of the chimeric polynucleotides of the present invention may comprise small RNA molecules such as siRNA, and therefore may be synthesized in the same manner.
- siRNA molecules such as siRNA
- UFPD Deprotection
- siRNA construction kit produces siRNA by in vitro transcription of DNA templates and contains the enzymes, buffers, primers needed. Such methods may be used to synthesize regions or subregions of chimeric polynucleotides.
- Ligation is an indispensable tool for assembling polynucleotide or nucleic acid fragments into larger constructs.
- DNA fragments can be joined by a ligase catalyzed reaction to create recombinant DNA with different functions.
- Oligodexoynucleotides with fluorescent or chemiluminescent labels may also serve as DNA ligase substrates.
- RNA ligases such as T4 RNA ligase catalyze the formation of a phosphodiester bond between two single stranded
- Ligases may be used with other enzymes to prepare desired chimeric polynucleotide or nucleic acid molecules and to perform genome analysis.
- ligation-mediated selective PCR amplification is disclosed in EP Pat. Pub. No. 0735144 to Kato.
- Complementary DNAs (cDNAs) reverse-transcribed from tissue- or cell-derived RNA or DNA are digested into fragments with type IIS restriction enzymes the contents of which are incorporated herein by reference in their entirety.
- Biotinylated adapter sequences are attached to the fragments by E. coli DNA ligases. The biotin-labeled DNA fragments are then immobilized onto streptavidin-coated beads for downstream analysis.
- a ligation splint or a ligation splint oligo is an oligonucleotide that is used to provide an annealing site or a ligation template for joining two ends of one nucleic acid, i.e., intramolecular joining, or two ends of two nucleic acids, i.e., intermolecular joining, using a ligase or another enzyme with ligase activity.
- the ligation splint holds the ends adjacent to each other and creates a ligation junction between the 5'-phosphorylated and a 3'-hydroxylated ends that are to be ligated.
- enzymes such as, but not limited to, T4 DNA ligase, Ampligase® DNA Ligase (Epicentre® Technologies), Tth DNA ligase, Tfl DNA ligase, or Tsc DNA Ligase (Prokaria) can be used.
- T4 DNA ligase Ampligase® DNA Ligase (Epicentre® Technologies)
- Tth DNA ligase Tfl DNA ligase
- Tsc DNA Ligase Prokaria
- T4 RNA ligase can efficiently ligate ends of RNA molecules that are adjacent to each other when hybridized to an RNA splint, the contents of which are incorporated herein by reference in their entirety.
- T4 RNA ligase is a suitable ligase for joining DNA ends with
- RNA splints include modified RNA containing 2'-fluorine-CTP (2'-F-dCTP) and 2'-fluorine-UTP (2'- F-dUTP) made using the DuraScribe® T7 Transcription Kit (Epicentre® Technologies) disclosed in US Pat. No. 8,137,911 and US Pat. Publication 2012/0156679 to Dahl et al, the contents of which are incorporated herein by reference in their entirety.
- the modified RNA produced from DuraScribe® T7 Transcription kit is completely resistant to RNase A digestion.
- DNA splint and DNA ligase may be used to generate RNA-protein fusions disclosed in US Pat. No. 6,258,558 to Szostak et al, the contents of which are
- ThermoPhageTM ssDNA ligase (Prokazyme), which is derived from phage TS2126 that infects Thermus scotoductus, catalyzes ATP-dependent intra- and inter-molecular ligation of DNA and RNA.
- the solid-phase chemical synthesis method that uses phosphoramidite monomers is limited to produce DNA molecules with short strands.
- the purity of the DNA products and the yield of reactions become poor when the length exceeds 150 bases.
- Moore and Sharp describe preparing RNA fragments 10- to 20-nt long by chemical synthesis, to which site-specific modifications may be introduced, annealing the fragments to a cDNAsplint, and then assemble the fragments with T4 DNA ligase. (Moore et al., Science, vol.
- RNA ligase Ligation reactions of oligoribonucleotides with T4 RNA ligase and a DNA splint or a polyribonucleotide to generate large, synthetic RNAs are described in Bain et al, Nucleic Acids Research, vol. 20(16), 4372 (1992), Stark et al, RNA, vol. 12, 2014-2019 (2006), and US Pat. Application No. 2005/0130201 to Deras et al., the contents of which are incorporated herein by reference in their entirety.
- 5 ' -cap and 3 ' -polyA tail are often added by enzymatic addition to an oligonucleotide synthesized with solid-phase methods.
- a synthetic capped 42-mer mRNA has been synthesized in three fragments enzymatically ligated as described by Iwase et al. ⁇ Nucleic Acids Research, vol. 20, 1643-1648 (1992), the contents of which are incorporated herein by reference in their entirety).
- a 16.3-kilobase mouse mitochondrial genome has been produced from 600 overlapping 60-mer polynucleotides. The method cycles between in vitro recombination and amplification until the desired length is reached.
- Sequential ligation can be performed on a solid substrate.
- initial linker DNA molecules modified with biotin at the end are attached to streptavidin-coated beads.
- the 3 ' -ends of the linker DNA molecules are complimentary with the 5 ' -ends of the incoming DNA fragments.
- the beads are washed and collected after each ligation step and the final linear constructs are released by a meganuclease.
- This method allows rapid and efficient assembly of genes in an optimized order and orientation. (Takita, DNA Research, vol. 20(4), 1-10 (2013), the contents of which are incorporated herein by reference in their entirety).
- Labeled polynucleotides synthesized on solid-supports are disclosed in US Pat. Pub. No. 2001/0014753 to Soloveichik et al. and US Pat. Pub. No. 2003/0191303 to Vinayak et al, the contents of which are incorporated herein by reference for their entirety.
- Non-natural modified nucleotides may be introduced to chimeric
- HNAs hexitol nucleic acids
- mRNAs Short messenger RNAs
- Either enzymatic or chemical ligation methods can be used to conjugate chimeric polynucleotides or their regions with different functional blocks, such as fluorescent labels, liquids, nanoparticles, delivery agents, etc.
- the conjugates of polynucleotides and modified polynucleotides are reviewed by Goodchild in
- the chimeric polynucleotides of the present invention may be quantified in exosomes or when derived from one or more bodily fluid.
- bodily fluids include peripheral blood, serum, plasma, ascites, urine,
- cerebrospinal fluid CSF
- sputum saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or pre-ejaculatory fluid, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates, blastocyl cavity fluid, and umbilical cord blood.
- CSF cerebrospinal fluid
- saliva saliva
- bone marrow synovial fluid
- aqueous humor amniotic fluid
- cerumen cerumen
- breast milk broncheoalveolar lavage fluid
- semen
- exosomes may be retrieved from an organ selected from the group consisting of lung, heart, pancreas, stomach, intestine, bladder, kidney, ovary, testis, skin, colon, breast, prostate, brain, esophagus, liver, and placenta.
- the exosome quantification method a sample of not more than 2mL is obtained from the subject and the exosomes isolated by size exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunoabsorbent capture, affinity purification, microfluidic separation, or combinations thereof.
- the level or concentration of a chimeric polynucleotide may be an expression level, presence, absence, truncation or alteration of the administered construct. It is advantageous to correlate the level with one or more clinical phenotypes or with an assay for a human disease biomarker.
- the assay may be performed using construct specific probes, cytometry, qRT-PCR, real-time PCR, PCR, flow cytometry,
- exosomes may be isolated using immunohistochemical methods such as enzyme linked immunosorbent assay (ELISA) methods. Exosomes may also be isolated by size exclusion
- nanomembrane ultrafiltration immunoabsorbent capture, affinity purification, microfluidic separation, or combinations thereof.
- the chimeric polynucleotide may be quantified using methods such as, but not limited to, ultraviolet visible spectroscopy (UV/Vis).
- UV/Vis ultraviolet visible spectroscopy
- a non- limiting example of a UV/Vis spectrometer is a NANODROP® spectrometer
- the quantified chimeric polynucleotide may be analyzed in order to determine if the chimeric polynucleotide may be of proper size, check that no degradation of the chimeric polynucleotide has occurred.
- Degradation of the chimeric polynucleotide may be checked by methods such as, but not limited to, agarose gel electrophoresis, HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP- HPLC), and hydrophobic interaction HPLC (HIC-HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE) and capillary gel electrophoresis (CGE).
- HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP- HPLC), and hydrophobic interaction HPLC (HIC-HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE) and capillary gel electrophoresis (CGE).
- Chimeric polynucleotide purification may include, but is not limited to, polynucleotide clean-up, quality assurance and quality control. Clean-up may be performed by methods known in the arts such as, but not limited to, AGENCOURT® beads (Beckman Coulter Genomics, Danvers, MA), poly-T beads, LNATM oligo-T capture probes (EXIQON® Inc, Vedbaek, Denmark) or HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC- HPLC).
- HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC- HPLC).
- purification when used in relation to a polynucleotide such as a
- purified chimeric polynucleotide refers to one that is separated from at least one contaminant.
- a "contaminant” is any substance which makes another unfit, impure or inferior.
- a purified polynucleotide e.g., DNA and RNA
- a quality assurance and/or quality control check may be conducted using methods such as, but not limited to, gel electrophoresis, UV absorbance, or analytical HPLC.
- the chimeric polynucleotide may be sequenced by methods including, but not limited to reverse-transcriptase-PCR.
- a polynucleotide such as a chimeric polynucleotide, whether coding or noncoding
- the terms "chemical modification” or, as appropriate, “chemically modified” refer to modification with respect to adenosine (A), guanosine (G), uridine (U), thymidine (T) or cytidine (C) ribo- or deoxyribnucleosides in one or more of their position, pattern, percent or population.
- A adenosine
- G guanosine
- U uridine
- T thymidine
- C cytidine
- modification refers to a modification as compared to the canonical set of 20 amino acids.
- the regions may contain one, two, or more (optionally different) nucleoside or nucleotide modifications.
- a modified chimeric polynucleotide, introduced to a cell may exhibit reduced degradation in the cell, as compared to an unmodified polynucleotide.
- Modifications which are useful in the present invention include, but are not limted to those in Table 2. Noted in the table are the symbol of the modification, the nucleobase type and whether the modification is naturally occurring or not.
- 6-(azo)cytosine -- c NO 6-aza-cytidine - C NO aza cytosine - C NO deaza cytosine - c NO
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Crystallography & Structural Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Saccharide Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP14766339.7A EP3041934A1 (en) | 2013-09-03 | 2014-09-03 | Chimeric polynucleotides |
| US14/915,959 US20160194625A1 (en) | 2013-09-03 | 2014-09-03 | Chimeric polynucleotides |
| JP2016540348A JP2016530294A (ja) | 2013-09-03 | 2014-09-03 | キメラポリヌクレオチド |
| CA2923029A CA2923029A1 (en) | 2013-09-03 | 2014-09-03 | Chimeric polynucleotides |
| AU2014315287A AU2014315287A1 (en) | 2013-09-03 | 2014-09-03 | Chimeric polynucleotides |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361873034P | 2013-09-03 | 2013-09-03 | |
| US61/873,034 | 2013-09-03 | ||
| US201361877582P | 2013-09-13 | 2013-09-13 | |
| US61/877,582 | 2013-09-13 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015034928A1 true WO2015034928A1 (en) | 2015-03-12 |
Family
ID=51541368
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/053907 Ceased WO2015034928A1 (en) | 2013-09-03 | 2014-09-03 | Chimeric polynucleotides |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US20160194625A1 (enExample) |
| EP (1) | EP3041934A1 (enExample) |
| JP (1) | JP2016530294A (enExample) |
| AU (1) | AU2014315287A1 (enExample) |
| CA (1) | CA2923029A1 (enExample) |
| WO (1) | WO2015034928A1 (enExample) |
Cited By (59)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9095552B2 (en) | 2012-04-02 | 2015-08-04 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding copper metabolism (MURR1) domain containing 1 |
| US9107886B2 (en) | 2012-04-02 | 2015-08-18 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding basic helix-loop-helix family member E41 |
| US9181319B2 (en) | 2010-08-06 | 2015-11-10 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9186372B2 (en) | 2011-12-16 | 2015-11-17 | Moderna Therapeutics, Inc. | Split dose administration |
| WO2016014846A1 (en) | 2014-07-23 | 2016-01-28 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of intrabodies |
| US9283287B2 (en) | 2012-04-02 | 2016-03-15 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of nuclear proteins |
| US9533047B2 (en) | 2011-03-31 | 2017-01-03 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US9572897B2 (en) | 2012-04-02 | 2017-02-21 | Modernatx, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9597380B2 (en) | 2012-11-26 | 2017-03-21 | Modernatx, Inc. | Terminally modified RNA |
| US9701965B2 (en) | 2010-10-01 | 2017-07-11 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| WO2017120612A1 (en) | 2016-01-10 | 2017-07-13 | Modernatx, Inc. | Therapeutic mrnas encoding anti ctla-4 antibodies |
| WO2018009838A1 (en) | 2016-07-07 | 2018-01-11 | Rubius Therapeutics, Inc. | Compositions and methods related to therapeutic cell systems expressing exogenous rna |
| EP3157572A4 (en) * | 2014-06-19 | 2018-02-14 | Moderna Therapeutics, Inc. | Alternative nucleic acid molecules and uses thereof |
| EP3157573A4 (en) * | 2014-06-19 | 2018-02-21 | Moderna Therapeutics, Inc. | Alternative nucleic acid molecules and uses thereof |
| US10023626B2 (en) | 2013-09-30 | 2018-07-17 | Modernatx, Inc. | Polynucleotides encoding immune modulating polypeptides |
| WO2018165547A1 (en) * | 2017-03-10 | 2018-09-13 | University Of Louisville Research Foundation, Inc. | Fasl-engineered biomaterials with immunomodulatory function |
| US10077439B2 (en) | 2013-03-15 | 2018-09-18 | Modernatx, Inc. | Removal of DNA fragments in mRNA production process |
| US10106800B2 (en) | 2005-09-28 | 2018-10-23 | Biontech Ag | Modification of RNA, producing an increased transcript stability and translation efficiency |
| US10138507B2 (en) | 2013-03-15 | 2018-11-27 | Modernatx, Inc. | Manufacturing methods for production of RNA transcripts |
| US10155031B2 (en) | 2012-11-28 | 2018-12-18 | Biontech Rna Pharmaceuticals Gmbh | Individualized vaccines for cancer |
| WO2019008335A1 (en) | 2017-07-07 | 2019-01-10 | Avacta Life Sciences Limited | SCAFFOLD PROTEINS |
| US10258698B2 (en) | 2013-03-14 | 2019-04-16 | Modernatx, Inc. | Formulation and delivery of modified nucleoside, nucleotide, and nucleic acid compositions |
| CN109796769A (zh) * | 2018-12-27 | 2019-05-24 | 李新虹 | 一种医学护理手套 |
| US10385088B2 (en) | 2013-10-02 | 2019-08-20 | Modernatx, Inc. | Polynucleotide molecules and uses thereof |
| US10407683B2 (en) | 2014-07-16 | 2019-09-10 | Modernatx, Inc. | Circular polynucleotides |
| CN110366557A (zh) * | 2016-12-23 | 2019-10-22 | 威特拉公司 | 结合多肽及其制备方法 |
| US10485884B2 (en) | 2012-03-26 | 2019-11-26 | Biontech Rna Pharmaceuticals Gmbh | RNA formulation for immunotherapy |
| WO2020047394A1 (en) * | 2018-08-31 | 2020-03-05 | The Trustees Of The University Of Pennsylvania | Injectable hydrogels for local delivery to the heart |
| US10590161B2 (en) | 2013-03-15 | 2020-03-17 | Modernatx, Inc. | Ion exchange purification of mRNA |
| US10738355B2 (en) | 2011-05-24 | 2020-08-11 | Tron-Translationale Onkologie An Der Universitätsmedizin Der Johannes Gutenberg-Universität Mainz Ggmbh | Individualized vaccines for cancer |
| WO2020233706A1 (zh) * | 2019-05-22 | 2020-11-26 | 华东理工大学 | 一种治疗躁狂型精神障碍及精神分裂症的药物 |
| US10849920B2 (en) | 2015-10-05 | 2020-12-01 | Modernatx, Inc. | Methods for therapeutic administration of messenger ribonucleic acid drugs |
| CN112162052A (zh) * | 2020-11-06 | 2021-01-01 | 深圳市格物正源质量标准系统有限公司 | 一种水产品中兽药多残留的测定方法 |
| WO2021074695A1 (en) | 2019-10-16 | 2021-04-22 | Avacta Life Sciences Limited | PD-L1 INHIBITOR - TGFβ INHIBITOR BISPECIFIC DRUG MOIETIES. |
| US11027025B2 (en) | 2013-07-11 | 2021-06-08 | Modernatx, Inc. | Compositions comprising synthetic polynucleotides encoding CRISPR related proteins and synthetic sgRNAs and methods of use |
| US11156617B2 (en) | 2015-02-12 | 2021-10-26 | BioNTech RNA Pharmaceuticals GbmH | Predicting T cell epitopes useful for vaccination |
| US11173120B2 (en) | 2014-09-25 | 2021-11-16 | Biontech Rna Pharmaceuticals Gmbh | Stable formulations of lipids and liposomes |
| WO2021249786A1 (en) | 2020-06-09 | 2021-12-16 | Avacta Life Sciences Limited | Sars-cov2 diagnostic polypeptides and methods |
| US11222711B2 (en) | 2013-05-10 | 2022-01-11 | BioNTech SE | Predicting immunogenicity of T cell epitopes |
| US11298426B2 (en) | 2003-10-14 | 2022-04-12 | BioNTech SE | Recombinant vaccines and use thereof |
| US11377470B2 (en) | 2013-03-15 | 2022-07-05 | Modernatx, Inc. | Ribonucleic acid purification |
| US11434486B2 (en) | 2015-09-17 | 2022-09-06 | Modernatx, Inc. | Polynucleotides containing a morpholino linker |
| US11492628B2 (en) | 2015-10-07 | 2022-11-08 | BioNTech SE | 3′-UTR sequences for stabilization of RNA |
| WO2022234003A1 (en) | 2021-05-07 | 2022-11-10 | Avacta Life Sciences Limited | Cd33 binding polypeptides with stefin a protein |
| JP2023024669A (ja) * | 2015-10-22 | 2023-02-16 | モデルナティエックス インコーポレイテッド | 癌ワクチン |
| US11603399B2 (en) | 2013-03-13 | 2023-03-14 | Modernatx, Inc. | Long-lived polynucleotide molecules |
| EP4159741A1 (en) | 2014-07-16 | 2023-04-05 | ModernaTX, Inc. | Method for producing a chimeric polynucleotide encoding a polypeptide having a triazole-containing internucleotide linkage |
| WO2023057946A1 (en) | 2021-10-07 | 2023-04-13 | Avacta Life Sciences Limited | Serum half-life extended pd-l1 binding polypeptides |
| WO2023057567A1 (en) | 2021-10-07 | 2023-04-13 | Avacta Life Sciences Limited | Pd-l1 binding affimers |
| WO2023153876A1 (ko) | 2022-02-10 | 2023-08-17 | 주식회사 아피셀테라퓨틱스 | Cd40l에 특이적으로 결합하는 스테핀 a 단백질 변이체 및 이의 용도 |
| WO2023218243A1 (en) | 2022-05-12 | 2023-11-16 | Avacta Life Sciences Limited | Lag-3/pd-l1 binding fusion proteins |
| US12109274B2 (en) | 2015-09-17 | 2024-10-08 | Modernatx, Inc. | Polynucleotides containing a stabilizing tail region |
| US12115230B2 (en) | 2020-04-09 | 2024-10-15 | Verve Therapeutics, Inc. | Base editing of ANGPTL3 and methods of using same for treatment of disease |
| CN118878604A (zh) * | 2024-09-27 | 2024-11-01 | 北京炫景瑞医药科技有限公司 | 磷酯骨架修饰的核苷酸及寡核苷酸 |
| US12139617B2 (en) | 2017-12-22 | 2024-11-12 | North Carolina State University | Polymeric fluorophores, compositions comprising the same, and methods of preparing and using the same |
| US12270813B2 (en) | 2017-06-09 | 2025-04-08 | BioNTech SE | Methods for predicting the usefulness of disease specific amino acid modifications for immunotherapy |
| US12385034B2 (en) | 2016-06-24 | 2025-08-12 | Modernatx, Inc. | Methods and apparatus for filtration |
| WO2025194138A1 (en) | 2024-03-14 | 2025-09-18 | Tessera Therapeutics, Inc. | St1cas9 compositions and methods for modulating a genome |
| US12582609B2 (en) | 2016-10-21 | 2026-03-24 | Modernatx, Inc. | Cancer vaccines |
Families Citing this family (55)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2842964A1 (de) | 2001-06-05 | 2015-03-04 | Curevac GmbH | Virtuelles Verfahren zur Ermittlung einer modifzierten mRNA-Sequenz |
| ME03091B (me) | 2009-12-01 | 2019-01-20 | Translate Bio Inc | Isporuka irnk za povećanje ekspresije proteina i enzima u humanim genetskim oboljenjima |
| US8853377B2 (en) | 2010-11-30 | 2014-10-07 | Shire Human Genetic Therapies, Inc. | mRNA for use in treatment of human genetic diseases |
| PT2717893T (pt) | 2011-06-08 | 2019-08-20 | Translate Bio Inc | Composições de nanopartículas lipídicas e métodos para transferência de arnm |
| BR112014030677A2 (pt) | 2012-06-08 | 2022-07-19 | Shire Human Genetic Therapies | distribuição pulmonar de mrna para células-alvo não-pulmonares |
| CA2904151C (en) | 2013-03-14 | 2023-09-12 | Shire Human Genetic Therapies, Inc. | Cftr mrna compositions and related methods and uses |
| HUE055044T2 (hu) | 2013-03-14 | 2021-10-28 | Translate Bio Inc | MRNS-kódolt ellenanyagok bejuttatására szolgáló eljárások és készítmények |
| KR20150128687A (ko) | 2013-03-14 | 2015-11-18 | 샤이어 휴먼 지네틱 테라피즈 인크. | 메신저 rna의 정제 방법 |
| ES3032013T3 (en) | 2013-03-15 | 2025-07-14 | Translate Bio Inc | Synergistic enhancement of the delivery of nucleic acids via blended formulations |
| CN105658800A (zh) | 2013-10-22 | 2016-06-08 | 夏尔人类遗传性治疗公司 | Mrna的cns递送及其用途 |
| WO2015061467A1 (en) | 2013-10-22 | 2015-04-30 | Shire Human Genetic Therapies, Inc. | Lipid formulations for delivery of messenger rna |
| BR112016009014B1 (pt) | 2013-10-22 | 2024-02-06 | Translate Bio, Inc | USO DE COMPOSIÇÃO COMPREENDENDO mRNA PARA DEFICIÊNCIA DE ARGININOSSUCINATO SINTETASE |
| EA201992208A1 (ru) | 2013-10-22 | 2020-07-31 | Транслейт Био, Инк. | ЛЕЧЕНИЕ ФЕНИЛКЕТОНУРИИ С ПРИМЕНЕНИЕМ мРНК |
| KR102739894B1 (ko) | 2014-04-25 | 2024-12-05 | 샤이어 휴먼 지네틱 테라피즈 인크. | 메신저 rna 의 정제 방법 |
| US10022455B2 (en) | 2014-05-30 | 2018-07-17 | Translate Bio, Inc. | Biodegradable lipids for delivery of nucleic acids |
| AU2015279968B2 (en) | 2014-06-24 | 2019-11-14 | Translate Bio, Inc. | Stereochemically enriched compositions for delivery of nucleic acids |
| CN106456547B (zh) | 2014-07-02 | 2021-11-12 | 川斯勒佰尔公司 | 信使rna的包封 |
| US10172924B2 (en) | 2015-03-19 | 2019-01-08 | Translate Bio, Inc. | MRNA therapy for pompe disease |
| EP3328394A4 (en) | 2015-07-30 | 2019-03-13 | ModernaTX, Inc. | CONCATEMEE peptide epitope RNAs |
| CA3001312A1 (en) | 2015-10-08 | 2017-04-13 | Dna2.0, Inc. | Dna vectors, transposons and transposases for eukaryotic genome modification |
| ES2862412T3 (es) | 2015-10-14 | 2021-10-07 | Translate Bio Inc | Modificación de enzimas relacionados con el ARN para producción mejorada |
| MA47016A (fr) | 2015-10-22 | 2018-08-29 | Modernatx Inc | Vaccins contre les virus respiratoires |
| CN109072223B (zh) | 2016-04-08 | 2022-10-21 | 川斯勒佰尔公司 | 多聚体编码核酸及其用途 |
| EP3469074B1 (en) | 2016-06-13 | 2020-12-09 | Translate Bio, Inc. | Messenger rna therapy for the treatment of ornithine transcarbamylase deficiency |
| CA3036831A1 (en) | 2016-09-14 | 2018-03-22 | Modernatx, Inc. | High purity rna compositions and methods for preparation thereof |
| US11702661B2 (en) | 2016-09-21 | 2023-07-18 | The Broad Institute, Inc. | Constructs for continuous monitoring of live cells |
| US10925958B2 (en) | 2016-11-11 | 2021-02-23 | Modernatx, Inc. | Influenza vaccine |
| MX2019010155A (es) | 2017-02-27 | 2020-12-10 | Translate Bio Inc | Arnm de cftr optimizado por codón novedoso. |
| SMT202500440T1 (it) * | 2017-03-31 | 2026-01-12 | Fujifilm Corp | Composizione liposomiale e composizione farmaceutica |
| WO2018213476A1 (en) | 2017-05-16 | 2018-11-22 | Translate Bio, Inc. | Treatment of cystic fibrosis by delivery of codon-optimized mrna encoding cftr |
| WO2019018561A1 (en) * | 2017-07-19 | 2019-01-24 | The Scripps Research Institute | GENOMIC LIBRARY GENERATION IN SOLID PHASE FOR HIGH FLOW SEQUENCING |
| WO2019126593A1 (en) | 2017-12-20 | 2019-06-27 | Translate Bio, Inc. | Improved composition and methods for treatment of ornithine transcarbamylase deficiency |
| EA202091693A1 (ru) | 2018-01-12 | 2021-04-14 | Бристол-Маерс Сквибб Компани | Антисмысловые олигонуклеотиды, целенаправленно воздействующие на альфа-синуклеин, и их применения |
| MX2020007433A (es) | 2018-01-12 | 2020-09-14 | Bristol Myers Squibb Co | Oligonucleotidos antisentido que actuan sobre alfa-sinucleina, y usos de estos. |
| WO2019148101A1 (en) | 2018-01-29 | 2019-08-01 | Modernatx, Inc. | Rsv rna vaccines |
| WO2019244979A1 (ja) | 2018-06-20 | 2019-12-26 | 富士フイルム株式会社 | 薬物を内包するリポソーム組成物および免疫チェックポイント阻害剤を含む組合せ医薬 |
| WO2020041793A1 (en) | 2018-08-24 | 2020-02-27 | Translate Bio, Inc. | Methods for purification of messenger rna |
| US20220031630A1 (en) * | 2018-09-13 | 2022-02-03 | The Brigham And Women's Hospital, Inc. | Nanoparticle formulations and methods of their use |
| WO2020061284A1 (en) | 2018-09-19 | 2020-03-26 | Modernatx, Inc. | Peg lipids and uses thereof |
| EP4509118A3 (en) | 2018-09-19 | 2025-05-14 | ModernaTX, Inc. | High-purity peg lipids and uses thereof |
| TWI837189B (zh) | 2018-10-01 | 2024-04-01 | 日商富士軟片股份有限公司 | 包含內含藥物之脂質體組成物及鉑製劑之組合醫藥 |
| US12331320B2 (en) | 2018-10-10 | 2025-06-17 | The Research Foundation For The State University Of New York | Genome edited cancer cell vaccines |
| MX2021005969A (es) | 2018-11-21 | 2021-09-14 | Translate Bio Inc | Tratamiento de la fibrosis quística mediante el suministro de arnm que codifica cftr nebulizado. |
| JP2022523362A (ja) * | 2019-02-21 | 2022-04-22 | ストラトス ゲノミクス インコーポレイテッド | 単一分子配列決定における使用のための拡張可能ポリマーの固体合成のための方法、組成物、およびデバイス |
| CN113874502A (zh) | 2019-03-11 | 2021-12-31 | 摩登纳特斯有限公司 | 补料分批体外转录方法 |
| EP3947687A1 (en) * | 2019-03-29 | 2022-02-09 | Massachusetts Institute of Technology | Constructs for continuous monitoring of live cells |
| US20220098616A1 (en) * | 2020-09-29 | 2022-03-31 | NeuExcell Therapeutics Inc. | ISL1 and LHX3 VECTOR |
| JP2023553010A (ja) | 2020-12-03 | 2023-12-20 | バテル・メモリアル・インスティテュート | 非ウイルス性送達のためのポリマーナノ粒子およびdnaナノ構造組成物ならびに方法 |
| US12329811B2 (en) | 2021-01-11 | 2025-06-17 | Modernatx, Inc. | Seasonal RNA influenza virus vaccines |
| EP4320233A4 (en) | 2021-04-07 | 2025-08-13 | Battelle Memorial Institute | RAPID DESIGN, BUILD, TEST, AND LEARNING TECHNOLOGIES TO IDENTIFY AND USE NON-VIRAL VECTORS |
| US20220363937A1 (en) | 2021-05-14 | 2022-11-17 | Armstrong World Industries, Inc. | Stabilization of antimicrobial coatings |
| CN114569628A (zh) * | 2022-03-11 | 2022-06-03 | 四川大学 | Dna四面体框架纳米核酸在美容中的用途 |
| US20250213717A1 (en) * | 2022-03-24 | 2025-07-03 | The Regents Of The University Of California | Hydrogel formulations for vlp therapeutics |
| WO2025072751A1 (en) | 2023-09-29 | 2025-04-03 | Battelle Memorial Institute | Polymer nanoparticle compositions for in vivo expression of polypeptides |
| WO2025122954A1 (en) | 2023-12-08 | 2025-06-12 | Battelle Memorial Institute | Use of dna origami nanostructures for molecular information based data storage systems |
Citations (459)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US845948A (en) | 1906-11-22 | 1907-03-05 | Raymond A Hall | Soldering compound. |
| US2103001A (en) | 1933-08-28 | 1937-12-21 | E S Evans And Sons | Windshield wiper mechanism |
| US4587044A (en) | 1983-09-01 | 1986-05-06 | The Johns Hopkins University | Linkage of proteins to nucleic acids |
| US4605735A (en) | 1983-02-14 | 1986-08-12 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
| US4667025A (en) | 1982-08-09 | 1987-05-19 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
| US4762779A (en) | 1985-06-13 | 1988-08-09 | Amgen Inc. | Compositions and methods for functionalizing nucleic acids |
| US4824941A (en) | 1983-03-10 | 1989-04-25 | Julian Gordon | Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems |
| US4828979A (en) | 1984-11-08 | 1989-05-09 | Life Technologies, Inc. | Nucleotide analogs for nucleic acid labeling and detection |
| US4835263A (en) | 1983-01-27 | 1989-05-30 | Centre National De La Recherche Scientifique | Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use |
| US4876335A (en) | 1986-06-30 | 1989-10-24 | Wakunaga Seiyaku Kabushiki Kaisha | Poly-labelled oligonucleotide derivative |
| US4904582A (en) | 1987-06-11 | 1990-02-27 | Synthetic Genetics | Novel amphiphilic nucleic acid conjugates |
| US4948882A (en) | 1983-02-22 | 1990-08-14 | Syngene, Inc. | Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis |
| US4958013A (en) | 1989-06-06 | 1990-09-18 | Northwestern University | Cholesteryl modified oligonucleotides |
| US4966891A (en) | 1987-11-17 | 1990-10-30 | Hoffmann-La Roche Inc. | Fluorocytidine derivatives |
| US4981957A (en) | 1984-07-19 | 1991-01-01 | Centre National De La Recherche Scientifique | Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini |
| US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
| US5082830A (en) | 1988-02-26 | 1992-01-21 | Enzo Biochem, Inc. | End labeled nucleotide probe |
| US5109124A (en) | 1988-06-01 | 1992-04-28 | Biogen, Inc. | Nucleic acid probe linked to a label having a terminal cysteine |
| US5112963A (en) | 1987-11-12 | 1992-05-12 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | Modified oligonucleotides |
| US5118802A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside |
| US5118800A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | Oligonucleotides possessing a primary amino group in the terminal nucleotide |
| US5138045A (en) | 1990-07-27 | 1992-08-11 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
| US5208020A (en) | 1989-10-25 | 1993-05-04 | Immunogen Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| US5214136A (en) | 1990-02-20 | 1993-05-25 | Gilead Sciences, Inc. | Anthraquinone-derivatives oligonucleotides |
| US5218105A (en) | 1990-07-27 | 1993-06-08 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
| US5245022A (en) | 1990-08-03 | 1993-09-14 | Sterling Drug, Inc. | Exonuclease resistant terminally substituted oligonucleotides |
| US5254469A (en) | 1989-09-12 | 1993-10-19 | Eastman Kodak Company | Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures |
| US5258506A (en) | 1984-10-16 | 1993-11-02 | Chiron Corporation | Photolabile reagents for incorporation into oligonucleotide chains |
| US5262536A (en) | 1988-09-15 | 1993-11-16 | E. I. Du Pont De Nemours And Company | Reagents for the preparation of 5'-tagged oligonucleotides |
| US5272250A (en) | 1992-07-10 | 1993-12-21 | Spielvogel Bernard F | Boronated phosphoramidate compounds |
| US5292873A (en) | 1989-11-29 | 1994-03-08 | The Research Foundation Of State University Of New York | Nucleic acids labeled with naphthoquinone probe |
| US5317098A (en) | 1986-03-17 | 1994-05-31 | Hiroaki Shizuya | Non-radioisotope tagging of fragments |
| US5319080A (en) | 1991-10-17 | 1994-06-07 | Ciba-Geigy Corporation | Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates |
| US5359044A (en) | 1991-12-13 | 1994-10-25 | Isis Pharmaceuticals | Cyclobutyl oligonucleotide surrogates |
| US5371241A (en) | 1991-07-19 | 1994-12-06 | Pharmacia P-L Biochemicals Inc. | Fluorescein labelled phosphoramidites |
| US5391723A (en) | 1989-05-31 | 1995-02-21 | Neorx Corporation | Oligonucleotide conjugates |
| US5414077A (en) | 1990-02-20 | 1995-05-09 | Gilead Sciences | Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods |
| US5446137A (en) | 1993-12-09 | 1995-08-29 | Syntex (U.S.A.) Inc. | Oligonucleotides containing 4'-substituted nucleotides |
| US5451463A (en) | 1989-08-28 | 1995-09-19 | Clontech Laboratories, Inc. | Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides |
| US5466786A (en) | 1989-10-24 | 1995-11-14 | Gilead Sciences | 2'modified nucleoside and nucleotide compounds |
| US5475092A (en) | 1992-03-25 | 1995-12-12 | Immunogen Inc. | Cell binding agent conjugates of analogues and derivatives of CC-1065 |
| US5486603A (en) | 1990-01-08 | 1996-01-23 | Gilead Sciences, Inc. | Oligonucleotide having enhanced binding affinity |
| US5489677A (en) | 1990-07-27 | 1996-02-06 | Isis Pharmaceuticals, Inc. | Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms |
| US5505931A (en) | 1993-03-04 | 1996-04-09 | The Dow Chemical Company | Acid cleavable compounds, their preparation and use as bifunctional acid-labile crosslinking agents |
| US5510475A (en) | 1990-11-08 | 1996-04-23 | Hybridon, Inc. | Oligonucleotide multiple reporter precursors |
| US5512667A (en) | 1990-08-28 | 1996-04-30 | Reed; Michael W. | Trifunctional intermediates for preparing 3'-tailed oligonucleotides |
| US5512439A (en) | 1988-11-21 | 1996-04-30 | Dynal As | Oligonucleotide-linked magnetic particles and uses thereof |
| US5514785A (en) | 1990-05-11 | 1996-05-07 | Becton Dickinson And Company | Solid supports for nucleic acid hybridization assays |
| US5519134A (en) | 1994-01-11 | 1996-05-21 | Isis Pharmaceuticals, Inc. | Pyrrolidine-containing monomers and oligomers |
| US5525465A (en) | 1987-10-28 | 1996-06-11 | Howard Florey Institute Of Experimental Physiology And Medicine | Oligonucleotide-polyamide conjugates and methods of production and applications of the same |
| US5539082A (en) | 1993-04-26 | 1996-07-23 | Nielsen; Peter E. | Peptide nucleic acids |
| US5545730A (en) | 1984-10-16 | 1996-08-13 | Chiron Corporation | Multifunctional nucleic acid monomer |
| EP0735144A1 (en) | 1995-03-28 | 1996-10-02 | Research Development Corporation Of Japan | Method for molecular indexing categorising of expressed genes using restriction enzymes |
| US5563250A (en) | 1987-12-02 | 1996-10-08 | Neorx Corporation | Cleavable conjugates for the delivery and release of agents in native form |
| US5565552A (en) | 1992-01-21 | 1996-10-15 | Pharmacyclics, Inc. | Method of expanded porphyrin-oligonucleotide conjugate synthesis |
| US5567811A (en) | 1990-05-03 | 1996-10-22 | Amersham International Plc | Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides |
| US5574142A (en) | 1992-12-15 | 1996-11-12 | Microprobe Corporation | Peptide linkers for improved oligonucleotide delivery |
| US5576427A (en) | 1993-03-30 | 1996-11-19 | Sterling Winthrop, Inc. | Acyclic nucleoside analogs and oligonucleotide sequences containing them |
| US5578718A (en) | 1990-01-11 | 1996-11-26 | Isis Pharmaceuticals, Inc. | Thiol-derivatized nucleosides |
| US5580731A (en) | 1994-08-25 | 1996-12-03 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
| US5585108A (en) | 1994-12-30 | 1996-12-17 | Nanosystems L.L.C. | Formulations of oral gastrointestinal therapeutic agents in combination with pharmaceutically acceptable clays |
| US5585481A (en) | 1987-09-21 | 1996-12-17 | Gen-Probe Incorporated | Linking reagents for nucleotide probes |
| US5587371A (en) | 1992-01-21 | 1996-12-24 | Pharmacyclics, Inc. | Texaphyrin-oligonucleotide conjugates |
| US5591722A (en) | 1989-09-15 | 1997-01-07 | Southern Research Institute | 2'-deoxy-4'-thioribonucleosides and their antiviral activity |
| US5595726A (en) | 1992-01-21 | 1997-01-21 | Pharmacyclics, Inc. | Chromophore probe for detection of nucleic acid |
| US5597696A (en) | 1994-07-18 | 1997-01-28 | Becton Dickinson And Company | Covalent cyanine dye oligonucleotide conjugates |
| US5597909A (en) | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
| US5599923A (en) | 1989-03-06 | 1997-02-04 | Board Of Regents, University Of Tx | Texaphyrin metal complexes having improved functionalization |
| US5602240A (en) | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
| US5608046A (en) | 1990-07-27 | 1997-03-04 | Isis Pharmaceuticals, Inc. | Conjugated 4'-desmethyl nucleoside analog compounds |
| US5610300A (en) | 1992-07-01 | 1997-03-11 | Ciba-Geigy Corporation | Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
| US5627053A (en) | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
| US5637459A (en) * | 1990-06-11 | 1997-06-10 | Nexstar Pharmaceuticals, Inc. | Systematic evolution of ligands by exponential enrichment: chimeric selex |
| US5639873A (en) | 1992-02-05 | 1997-06-17 | Centre National De La Recherche Scientifique (Cnrs) | Oligothionucleotides |
| US5646265A (en) | 1990-01-11 | 1997-07-08 | Isis Pharmceuticals, Inc. | Process for the preparation of 2'-O-alkyl purine phosphoramidites |
| US5658873A (en) | 1993-04-10 | 1997-08-19 | Degussa Aktiengesellschaft | Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them |
| WO1997030064A1 (en) | 1996-02-16 | 1997-08-21 | Stichting Rega Vzw | Hexitol containing oligonucleotides and their use in antisense strategies |
| US5670633A (en) | 1990-01-11 | 1997-09-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
| US5688941A (en) | 1990-07-27 | 1997-11-18 | Isis Pharmaceuticals, Inc. | Methods of making conjugated 4' desmethyl nucleoside analog compounds |
| US5714331A (en) | 1991-05-24 | 1998-02-03 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility |
| US5719262A (en) | 1993-11-22 | 1998-02-17 | Buchardt, Deceased; Ole | Peptide nucleic acids having amino acid side chains |
| US5889136A (en) | 1995-06-09 | 1999-03-30 | The Regents Of The University Of Colorado | Orthoester protecting groups in RNA synthesis |
| US6004573A (en) | 1997-10-03 | 1999-12-21 | Macromed, Inc. | Biodegradable low molecular weight triblock poly(lactide-co-glycolide) polyethylene glycol copolymers having reverse thermal gelation properties |
| WO2000050032A1 (en) | 1999-02-25 | 2000-08-31 | Pharmacia & Upjohn S.P.A. | Antitumour synergistic composition |
| US6177274B1 (en) | 1998-05-20 | 2001-01-23 | Expression Genetics, Inc. | Hepatocyte targeting polyethylene glyco-grafted poly-L-lysine polymeric gene carrier |
| US6190315B1 (en) | 1998-01-08 | 2001-02-20 | Sontra Medical, Inc. | Sonophoretic enhanced transdermal transport |
| US6217912B1 (en) | 1998-07-13 | 2001-04-17 | Expression Genetics, Inc. | Polyester analogue of poly-L-lysine as a soluble, biodegradable gene delivery carrier |
| US6234990B1 (en) | 1996-06-28 | 2001-05-22 | Sontra Medical, Inc. | Ultrasound enhancement of transdermal transport |
| US6258558B1 (en) | 1997-01-21 | 2001-07-10 | The General Hospital Corporation | Method for selection of proteins using RNA-protein fusions |
| US6265389B1 (en) | 1995-08-31 | 2001-07-24 | Alkermes Controlled Therapeutics, Inc. | Microencapsulation and sustained release of oligonucleotides |
| US6268490B1 (en) | 1997-03-07 | 2001-07-31 | Takeshi Imanishi | Bicyclonucleoside and oligonucleotide analogues |
| US6267987B1 (en) | 1997-12-12 | 2001-07-31 | Samyang Corporation | Positively charged poly[alpha-(omega-aminoalkyl) glycolic acid] for the delivery of a bioactive agent via tissue and cellular uptake |
| US20010014753A1 (en) | 1999-12-20 | 2001-08-16 | Soloveichik Grigorii Lev | Catalyst composition and method for producing diaryl carbonates, using bisphosphines |
| US6294664B1 (en) | 1993-07-29 | 2001-09-25 | Isis Pharmaceuticals, Inc. | Synthesis of oligonucleotides |
| US6320017B1 (en) | 1997-12-23 | 2001-11-20 | Inex Pharmaceuticals Corp. | Polyamide oligomers |
| US6368801B1 (en) | 2000-04-12 | 2002-04-09 | Molecular Staging, Inc. | Detection and amplification of RNA using target-mediated ligation of DNA by RNA ligase |
| US6426086B1 (en) | 1998-02-03 | 2002-07-30 | The Regents Of The University Of California | pH-sensitive, serum-stable liposomes |
| WO2002098443A2 (de) | 2001-06-05 | 2002-12-12 | Curevac Gmbh | Stabilisierte mrna mit erhöhtem g/ c- gehalt und otimierter codon usage für die gentherapie |
| US6517869B1 (en) | 1997-12-12 | 2003-02-11 | Expression Genetics, Inc. | Positively charged poly(alpha-(omega-aminoalkyl)lycolic acid) for the delivery of a bioactive agent via tissue and cellular uptake |
| US6525183B2 (en) | 1999-02-22 | 2003-02-25 | Pe Corporation (Ny) | Multiple-labelled oligonucleotides synthesized on solid-supports |
| US20030073619A1 (en) | 2000-09-14 | 2003-04-17 | Mahato Ram I. | Novel cationic lipopolymer as biocompatible gene delivery agent |
| US6576752B1 (en) | 1997-02-14 | 2003-06-10 | Isis Pharmaceuticals, Inc. | Aminooxy functionalized oligomers |
| WO2003051401A2 (de) | 2001-12-19 | 2003-06-26 | Curevac Gmbh | Stabilisierte mrna tumor-vakzine |
| US6586524B2 (en) | 2001-07-19 | 2003-07-01 | Expression Genetics, Inc. | Cellular targeting poly(ethylene glycol)-grafted polymeric gene carrier |
| US6617106B1 (en) | 1990-10-09 | 2003-09-09 | Steven Albert Benner | Methods for preparing oligonucleotides containing non-standard nucleotides |
| US6652886B2 (en) | 2001-02-16 | 2003-11-25 | Expression Genetics | Biodegradable cationic copolymers of poly (alkylenimine) and poly (ethylene glycol) for the delivery of bioactive agents |
| US6653468B1 (en) | 2002-07-31 | 2003-11-25 | Isis Pharmaceuticals, Inc. | Universal support media for synthesis of oligomeric compounds |
| US6670461B1 (en) | 1997-09-12 | 2003-12-30 | Exiqon A/S | Oligonucleotide analogues |
| WO2004041203A2 (en) | 2002-11-04 | 2004-05-21 | Xenoport, Inc. | Gemcitabine prodrugs, pharmaceutical compositions and uses thereof |
| US20040142474A1 (en) | 2000-09-14 | 2004-07-22 | Expression Genetics, Inc. | Novel cationic lipopolymer as a biocompatible gene delivery agent |
| US6783931B1 (en) | 1990-01-11 | 2004-08-31 | Isis Pharmaceuticals, Inc. | Amine-derivatized nucleosides and oligonucleosides |
| US20040171980A1 (en) | 1998-12-18 | 2004-09-02 | Sontra Medical, Inc. | Method and apparatus for enhancement of transdermal transport |
| US20040236268A1 (en) | 1998-01-08 | 2004-11-25 | Sontra Medical, Inc. | Method and apparatus for enhancement of transdermal transport |
| US6835393B2 (en) | 1998-01-05 | 2004-12-28 | University Of Washington | Enhanced transport using membrane disruptive agents |
| US20040262223A1 (en) | 2001-07-27 | 2004-12-30 | President And Fellows Of Harvard College | Laminar mixing apparatus and methods |
| WO2005005622A2 (en) | 2003-07-09 | 2005-01-20 | Ribostem Limited | Method of altering cell properties by administering rna |
| US20050059005A1 (en) | 2001-09-28 | 2005-03-17 | Thomas Tuschl | Microrna molecules |
| US6897196B1 (en) | 2001-02-07 | 2005-05-24 | The Regents Of The University Of California | pH sensitive lipids based on ortho ester linkers, composition and method |
| US20050130201A1 (en) | 2003-10-14 | 2005-06-16 | Dharmacon, Inc. | Splint-assisted enzymatic synthesis of polyribounucleotides |
| US20050222064A1 (en) | 2002-02-20 | 2005-10-06 | Sirna Therapeutics, Inc. | Polycationic compositions for cellular delivery of polynucleotides |
| US20050261218A1 (en) | 2003-07-31 | 2005-11-24 | Christine Esau | Oligomeric compounds and compositions for use in modulation small non-coding RNAs |
| US6998484B2 (en) | 2000-10-04 | 2006-02-14 | Santaris Pharma A/S | Synthesis of purine locked nucleic acid analogues |
| US7037646B1 (en) | 1990-01-11 | 2006-05-02 | Isis Pharmaceuticals, Inc. | Amine-derivatized nucleosides and oligonucleosides |
| US7053207B2 (en) | 1999-05-04 | 2006-05-30 | Exiqon A/S | L-ribo-LNA analogues |
| WO2006063249A2 (en) | 2004-12-10 | 2006-06-15 | Justin Hanes | Functionalized poly (ether-anhydride) block copolymers |
| US7074596B2 (en) | 2002-03-25 | 2006-07-11 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Synthesis and use of anti-reverse mRNA cap analogues |
| US7084125B2 (en) | 1999-03-18 | 2006-08-01 | Exiqon A/S | Xylo-LNA analogues |
| US7098032B2 (en) | 2001-01-02 | 2006-08-29 | Mirus Bio Corporation | Compositions and methods for drug delivery using pH sensitive molecules |
| US7138382B2 (en) | 1999-06-07 | 2006-11-21 | Mirus Bio Corporation | Compositions and methods for drug delivery using pH sensitive molecules |
| WO2006122828A2 (de) | 2005-05-19 | 2006-11-23 | Curevac Gmbh | Optimierte injektionsformulierung für mrna |
| WO2007024708A2 (en) | 2005-08-23 | 2007-03-01 | The Trustees Of The University Of Pennsylvania | Rna containing modified nucleosides and methods of use thereof |
| WO2007024323A2 (en) | 2005-06-17 | 2007-03-01 | The University Of North Carolina At Chapel Hill | Nanoparticle fabrication methods, systems, and materials |
| DE102005046490A1 (de) | 2005-09-28 | 2007-03-29 | Johannes-Gutenberg-Universität Mainz | Modifikationen von RNA, die zu einer erhöhten Transkriptstabilität und Translationseffizienz führen |
| US20070117112A1 (en) | 2005-06-30 | 2007-05-24 | Diener John L | Materials and methods for the generation of fully 2'-modified nucleic acid transcripts |
| WO2007064952A2 (en) | 2005-12-02 | 2007-06-07 | University Of Rochester | TARGETED PRE-mRNA/mRNA MODIFICATION AND GENE REGULATION |
| WO2008052770A2 (en) | 2006-10-31 | 2008-05-08 | Curevac Gmbh | (base-)modified rna for increasing the expression of a protein |
| US7374930B2 (en) | 2002-05-21 | 2008-05-20 | Expression Genetics, Inc. | GLP-1 gene delivery for the treatment of type 2 diabetes |
| US20080119645A1 (en) | 2004-05-05 | 2008-05-22 | Isis Pharmaceuticals, Inc. | Amidites and Methods of Rna Synthesis |
| US7378262B2 (en) | 2001-12-03 | 2008-05-27 | Roche Molecular Systems, Inc. | Reversibly modified thermostable enzymes for DNA synthesis and amplification in vitro |
| US7385034B2 (en) | 1998-12-22 | 2008-06-10 | Serono Genetics Institute S.A. | Complementary DNAs encoding proteins with signal peptides |
| US7384739B2 (en) | 2001-11-14 | 2008-06-10 | Toyo Boseki Kabushiki Kaisha | Compositions for enhancing DNA synthesis, DNA polymerase-related factors and utilization thereof |
| WO2008078180A2 (en) | 2006-12-22 | 2008-07-03 | Archemix Corp. | Materials and methods for the generation of transcripts comprising modified nucleotides |
| US20080166414A1 (en) | 2004-01-28 | 2008-07-10 | Johns Hopkins University | Drugs And Gene Carrier Particles That Rapidly Move Through Mucous Barriers |
| US7399845B2 (en) | 2006-01-27 | 2008-07-15 | Isis Pharmaceuticals, Inc. | 6-modified bicyclic nucleic acid analogs |
| WO2008083949A2 (en) | 2007-01-09 | 2008-07-17 | Curevac Gmbh | Rna-coded antibody |
| US7404969B2 (en) | 2005-02-14 | 2008-07-29 | Sirna Therapeutics, Inc. | Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules |
| US7413875B2 (en) | 1999-08-05 | 2008-08-19 | Serono Genetics Institute S.A. | ESTs and encoded human proteins |
| WO2008103276A2 (en) | 2007-02-16 | 2008-08-28 | Merck & Co., Inc. | Compositions and methods for potentiated activity of biologicaly active molecules |
| WO2008121949A1 (en) | 2007-03-30 | 2008-10-09 | Bind Biosciences, Inc. | Cancer cell targeting using nanoparticles |
| US20080261905A1 (en) | 2004-11-08 | 2008-10-23 | K.U. Leuven Research And Development | Modified Nucleosides for Rna Interference |
| US20080275468A1 (en) | 2007-04-27 | 2008-11-06 | Echo Therapeutics, Inc. | Skin permeation device for analyte sensing or transdermal drug delivery |
| WO2008140615A2 (en) | 2006-12-21 | 2008-11-20 | Novozymes, Inc. | Modified messenger rna stabilizing sequences for expressing genes in bacterial cells |
| WO2008157668A2 (en) | 2007-06-21 | 2008-12-24 | American Power Conversion Corporation | Method and system for determining physical location of network equipment |
| US7476709B2 (en) | 2002-04-26 | 2009-01-13 | Avecia Biotechnology Inc. | Process for preparing oligonucleotides |
| US20090042829A1 (en) | 2007-08-06 | 2009-02-12 | Majed Matar | Nucleic Acid-Lipopolymer Compositions |
| US7550264B2 (en) | 2005-06-10 | 2009-06-23 | Datascope Investment Corporation | Methods and kits for sense RNA synthesis |
| WO2009077134A2 (en) | 2007-12-14 | 2009-06-25 | Johannes Gutenberg-Universität Mainz | Use of rna for reprogramming somatic cells |
| US20090170090A1 (en) | 2005-11-18 | 2009-07-02 | Bioline Limited | Method for Enhancing Enzymatic DNA Polymerase Reactions |
| US20090226470A1 (en) | 2007-12-11 | 2009-09-10 | Mauro Vincent P | Compositions and methods related to mRNA translational enhancer elements |
| WO2009127230A1 (en) | 2008-04-16 | 2009-10-22 | Curevac Gmbh | MODIFIED (m)RNA FOR SUPPRESSING OR AVOIDING AN IMMUNOSTIMULATORY RESPONSE AND IMMUNOSUPPRESSIVE COMPOSITION |
| WO2009149253A2 (en) | 2008-06-06 | 2009-12-10 | Uniwersytet Warszawski | Mrna cap analogs |
| US20100004315A1 (en) | 2008-03-14 | 2010-01-07 | Gregory Slobodkin | Biodegradable Cross-Linked Branched Poly(Alkylene Imines) |
| US20100004313A1 (en) | 2008-02-29 | 2010-01-07 | Tbd | Modified Poloxamers for Gene Expression and Associated Methods |
| US20100009865A1 (en) | 2006-09-29 | 2010-01-14 | Katholieke Universiteit Leuven | Oligonucleotide arrays |
| WO2010005726A2 (en) | 2008-06-16 | 2010-01-14 | Bind Biosciences Inc. | Therapeutic polymeric nanoparticles with mtor inhibitors and methods of making and using same |
| WO2010005723A2 (en) | 2008-06-16 | 2010-01-14 | Bind Biosciences, Inc. | Drug loaded polymeric nanoparticles and methods of making and using same |
| US20100009424A1 (en) | 2008-07-14 | 2010-01-14 | Natasha Forde | Sonoporation systems and methods |
| WO2010005740A2 (en) | 2008-06-16 | 2010-01-14 | Bind Biosciences, Inc. | Methods for the preparation of targeting agent functionalized diblock copolymers for use in fabrication of therapeutic targeted nanoparticles |
| WO2010005725A2 (en) | 2008-06-16 | 2010-01-14 | Bind Biosciences, Inc. | Therapeutic polymeric nanoparticles comprising vinca alkaloids and methods of making and using same |
| US20100036115A1 (en) | 1997-07-23 | 2010-02-11 | Sirna Therapeutics, Inc. | Novel Compositions for the Delivery of Negatively Charged Molecules |
| US7667033B2 (en) | 2002-09-27 | 2010-02-23 | Syngen, Inc. | Compositions and methods for the use of FMOC derivatives in DNA/RNA synthesis |
| WO2010021865A1 (en) | 2008-08-18 | 2010-02-25 | Merck Sharp & Dohme Corp. | Novel lipid nanoparticles and novel components for delivery of nucleic acids |
| WO2010030763A2 (en) | 2008-09-10 | 2010-03-18 | Bind Biosciences, Inc. | High throughput fabrication of nanoparticles |
| US20100075072A1 (en) | 2008-09-25 | 2010-03-25 | Tsung-Wei Chen | Decorative structure of tree-shaped bells |
| WO2010047839A1 (en) | 2008-10-25 | 2010-04-29 | Aura Biosciences | Modified plant virus particles and uses therefor |
| US20100120024A1 (en) | 2005-06-30 | 2010-05-13 | Sharon Cload | Materials and methods for the generation of transcripts comprising modified nucleotides |
| US7737108B1 (en) | 2000-01-07 | 2010-06-15 | University Of Washington | Enhanced transport using membrane disruptive agents |
| WO2010080724A1 (en) | 2009-01-12 | 2010-07-15 | Merck Sharp & Dohme Corp. | Novel lipid nanoparticles and novel components for delivery of nucleic acids |
| US20100196983A1 (en) | 2009-02-05 | 2010-08-05 | Ut-Battelle, Llc | Transformation of gram positive bacteria by sonoporation |
| WO2010087791A1 (en) | 2009-01-27 | 2010-08-05 | Utc Power Corporation | Distributively cooled, integrated water-gas shift reactor and vaporizer |
| US20100215580A1 (en) | 2006-09-08 | 2010-08-26 | The Johns Hopkins University | Compositions and methods for enhancing transport through mucus |
| US20100216804A1 (en) | 2008-12-15 | 2010-08-26 | Zale Stephen E | Long Circulating Nanoparticles for Sustained Release of Therapeutic Agents |
| US20100255574A1 (en) | 1999-03-12 | 2010-10-07 | Human Genome Sciences, Inc. | Human Secreted Proteins |
| US20100260817A1 (en) | 2009-03-20 | 2010-10-14 | Egen, Inc. | Polyamine Derivatives |
| WO2010120266A1 (en) | 2009-04-13 | 2010-10-21 | Inserm, Institut National De La Sante Et De La Recherche Medicale | Hpv particles and uses thereof |
| WO2010123569A2 (en) | 2009-04-21 | 2010-10-28 | Selecta Biosciences, Inc. | Immunonanotherapeutics providing a th1-biased response |
| WO2010129709A1 (en) | 2009-05-05 | 2010-11-11 | Alnylam Pharmaceuticals, Inc. | Lipid compositions |
| US7833992B2 (en) | 2001-05-18 | 2010-11-16 | Merck Sharpe & Dohme | Conjugates and compositions for cellular delivery |
| US20100293625A1 (en) | 2007-09-26 | 2010-11-18 | Interexon Corporation | Synthetic 5'UTRs, Expression Vectors, and Methods for Increasing Transgene Expression |
| WO2010138194A2 (en) | 2009-05-27 | 2010-12-02 | Selecta Biosciences, Inc. | Immunomodulatory agent-polymeric compounds |
| US20100324120A1 (en) | 2009-06-10 | 2010-12-23 | Jianxin Chen | Lipid formulation |
| WO2011012316A2 (de) | 2009-07-31 | 2011-02-03 | Ludwig-Maximilians-Universität | Rna mit einer kombination aus unmodifizierten und modifizierten nucleotiden zur proteinexpression |
| WO2011013062A1 (en) | 2009-07-30 | 2011-02-03 | Koninklijke Philips Electronics N.V. | Distributed image retargeting |
| WO2011014973A2 (en) | 2009-08-05 | 2011-02-10 | Polyphor Ag | Conformationally constrained, fully synthetic macrocyclic compounds |
| WO2011015312A1 (en) | 2009-08-01 | 2011-02-10 | Roche Diagnostics Gmbh | Improved detection of bacterial (mollicutes) contamination |
| US7893302B2 (en) | 2005-02-14 | 2011-02-22 | Sirna Therapeutics, Inc. | Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules |
| WO2011022460A1 (en) | 2009-08-20 | 2011-02-24 | Merck Sharp & Dohme Corp. | Novel cationic lipids with various head groups for oligonucleotide delivery |
| US7906490B2 (en) | 1993-04-15 | 2011-03-15 | University Of Rochester | Circular DNA vectors for synthesis of RNA and DNA |
| WO2011043913A2 (en) | 2009-10-08 | 2011-04-14 | Merck Sharp & Dohme Corp. | Novel cationic lipids with short lipid chains for oligonucleotide delivery |
| WO2011062965A2 (en) | 2009-11-18 | 2011-05-26 | University Of Washington Through Its Center For Commercialization | Targeting monomers and polymers having targeting blocks |
| US20110143436A1 (en) | 2009-12-07 | 2011-06-16 | Gary Dahl | Compositions and methods for reprogramming eukaryotic cells |
| US20110143397A1 (en) | 2005-08-23 | 2011-06-16 | Katalin Kariko | Rna preparations comprising purified modified rna for reprogramming cells |
| WO2011072218A2 (en) | 2009-12-11 | 2011-06-16 | Bind Biosciences | Stable formulations for lyophilizing therapeutic particles |
| US7964571B2 (en) | 2004-12-09 | 2011-06-21 | Egen, Inc. | Combination of immuno gene therapy and chemotherapy for treatment of cancer and hyperproliferative diseases |
| US7964578B2 (en) | 2001-05-18 | 2011-06-21 | Sirna Therapeutics, Inc. | Conjugates and compositions for cellular delivery |
| WO2011076807A2 (en) | 2009-12-23 | 2011-06-30 | Novartis Ag | Lipids, lipid compositions, and methods of using them |
| WO2011084518A2 (en) | 2009-12-15 | 2011-07-14 | Bind Biosciences, Inc. | Therapeutic polymeric nanoparticles comprising corticosteroids and methods of making and using same |
| WO2011084513A2 (en) | 2009-12-15 | 2011-07-14 | Bind Biosciences, Inc. | Therapeutic polymeric nanoparticle compositions with high glass transition temperature or high molecular weight copolymers |
| US20110171248A1 (en) | 2010-01-08 | 2011-07-14 | Selecta Biosciences, Inc. | Synthetic virus-like particles conjugated to human papillomavirus capsid peptides for use as vaccines |
| WO2011084521A2 (en) | 2009-12-15 | 2011-07-14 | Bind Biosciences, Inc. | Therapeutic polymeric nanoparticles comprising epothilone and methods of making and using same |
| WO2011090965A1 (en) | 2010-01-22 | 2011-07-28 | Merck Sharp & Dohme Corp. | Novel cationic lipids for oligonucleotide delivery |
| US7994304B2 (en) | 2005-11-22 | 2011-08-09 | Helicos Biosciences Corporation | Methods and compositions for sequencing a nucleic acid |
| US7999087B2 (en) | 2006-11-15 | 2011-08-16 | Agilent Technologies, Inc. | 2′-silyl containing thiocarbonate protecting groups for RNA synthesis |
| WO2011115862A1 (en) | 2010-03-18 | 2011-09-22 | Merck Sharp & Dohme Corp. | Endosomolytic poly(amidoamine) disulfide polymers for the delivery of oligonucleotides |
| WO2011120053A1 (en) | 2010-03-26 | 2011-09-29 | Mersana Therapeutics, Inc. | Modified polymers for delivery of polynucleotides, method of manufacture, and methods of use thereof |
| US20110244026A1 (en) | 2009-12-01 | 2011-10-06 | Braydon Charles Guild | Delivery of mrna for the augmentation of proteins and enzymes in human genetic diseases |
| WO2011127255A1 (en) | 2010-04-08 | 2011-10-13 | Merck Sharp & Dohme Corp. | Preparation of lipid nanoparticles |
| US8039214B2 (en) | 2007-06-29 | 2011-10-18 | Cellscript, Inc. | Synthesis of tagged nucleic acids |
| US20110262491A1 (en) | 2010-04-12 | 2011-10-27 | Selecta Biosciences, Inc. | Emulsions and methods of making nanocarriers |
| US20110275793A1 (en) | 2008-05-29 | 2011-11-10 | Debart Francoise | Chemical RNA Synthesis Method |
| US8057821B2 (en) | 2004-11-03 | 2011-11-15 | Egen, Inc. | Biodegradable cross-linked cationic multi-block copolymers for gene delivery and methods of making thereof |
| WO2011150258A1 (en) | 2010-05-26 | 2011-12-01 | Selecta Biosciences, Inc. | Dose selection of adjuvanted synthetic nanocarriers |
| WO2012001875A1 (en) | 2010-07-01 | 2012-01-05 | Canon Kabushiki Kaisha | Image forming apparatus |
| WO2012002629A1 (ko) | 2010-07-02 | 2012-01-05 | 연세대학교 산학협력단 | 발광다이오드 모듈 |
| WO2012006376A2 (en) | 2010-07-06 | 2012-01-12 | Novartis Ag | Virion-like delivery particles for self-replicating rna molecules |
| WO2012006378A1 (en) | 2010-07-06 | 2012-01-12 | Novartis Ag | Liposomes with lipids having an advantageous pka- value for rna delivery |
| WO2012006380A2 (en) | 2010-07-06 | 2012-01-12 | Novartis Ag | Cationic oil-in-water emulsions |
| US20120028342A1 (en) | 2009-03-24 | 2012-02-02 | Ismagilov Rustem F | Slip chip device and methods |
| WO2012013326A1 (en) | 2010-07-30 | 2012-02-02 | Curevac Gmbh | Complexation of nucleic acids with disulfide-crosslinked cationic components for transfection and immunostimulation |
| WO2012013501A1 (de) | 2010-07-29 | 2012-02-02 | Fujitsu Technology Solutions Intellectual Property Gmbh | Computersystem, verfahren zum programmieren einer echtzeituhr und computerprogrammprodukt |
| US20120024422A1 (en) | 2009-03-12 | 2012-02-02 | Illinois Tool Works Inc. | Mis-fuel inhibitor |
| WO2012018881A2 (en) | 2010-08-03 | 2012-02-09 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for the regulation of rna |
| WO2012016269A1 (en) | 2010-08-02 | 2012-02-09 | Curtin University Of Technology | Determining location of, and imaging, a subsurface boundary |
| WO2012018718A1 (en) | 2010-08-02 | 2012-02-09 | Advanced Technologies And Regenerative Medicine, Llc | Absorbable peg-based hydrogels |
| US20120046346A1 (en) | 2010-04-16 | 2012-02-23 | Immune Disease Institute, Inc. | Sustained polypeptide expression from synthetic, modified rnas and uses thereof |
| WO2012024526A2 (en) | 2010-08-20 | 2012-02-23 | Cerulean Pharma Inc. | Conjugates, particles, compositions, and related methods |
| WO2012022512A1 (en) | 2010-08-18 | 2012-02-23 | International Business Machines Corporation | Solar cell and battery 3d integration |
| WO2012024621A2 (en) | 2010-08-20 | 2012-02-23 | Selecta Biosciences, Inc. | Synthetic nanocarrier vaccines comprising peptides obtained or derived from human influenza a virus hemagglutinin |
| US8124379B2 (en) | 2004-06-14 | 2012-02-28 | Novozymes A/S | Signal peptide for producing a polypeptide |
| WO2012031043A1 (en) | 2010-08-31 | 2012-03-08 | Novartis Ag | Pegylated liposomes for delivery of immunogen-encoding rna |
| WO2012031046A2 (en) | 2010-08-31 | 2012-03-08 | Novartis Ag | Lipids suitable for liposomal delivery of protein-coding rna |
| WO2012030901A1 (en) | 2010-08-31 | 2012-03-08 | Novartis Ag | Small liposomes for delivery of immunogen-encoding rna |
| WO2012030683A2 (en) | 2010-08-31 | 2012-03-08 | Merck Sharp & Dohme Corp. | Novel single chemical entities and methods for delivery of oligonucleotides |
| US20120060293A1 (en) | 2009-05-18 | 2012-03-15 | Amoena Medizin-Orthopädie-Technik GmbH | Anti-decubitus cushion |
| US8137911B2 (en) | 2001-05-22 | 2012-03-20 | Cellscript, Inc. | Preparation and use of single-stranded transcription substrates for synthesis of transcription products corresponding to target sequences |
| US20120076836A1 (en) | 2009-03-31 | 2012-03-29 | The University Of Tokyo | Polyion complex of double-stranded ribonucleic acid |
| WO2012040184A2 (en) | 2010-09-20 | 2012-03-29 | Merck Sharp & Dohme Corp. | Novel low molecular weight cationic lipids for oligonucleotide delivery |
| WO2012040524A1 (en) | 2010-09-24 | 2012-03-29 | Mallinckrodt Llc | Aptamer conjugates for targeting of therapeutic and/or diagnostic nanocarriers |
| WO2012040623A2 (en) | 2010-09-24 | 2012-03-29 | The Brigham And Women's Hospital, Inc. | Nanostructured gels capable of controlled release of encapsulated agents |
| WO2012044638A1 (en) | 2010-09-30 | 2012-04-05 | Merck Sharp & Dohme Corp. | Low molecular weight cationic lipids for oligonucleotide delivery |
| WO2012049366A1 (en) | 2010-10-14 | 2012-04-19 | Timo Vesikari | Norovirus capsid and rotavirus vp6 protein for use as combined vaccine |
| WO2012054365A2 (en) | 2010-10-21 | 2012-04-26 | Merck Sharp & Dohme Corp. | Novel low molecular weight cationic lipids for oligonucleotide delivery |
| WO2012054923A2 (en) | 2010-10-22 | 2012-04-26 | Bind Biosciences, Inc. | Therapeutic nanoparticles with high molecular weight copolymers |
| WO2012061259A2 (en) | 2010-11-05 | 2012-05-10 | Merck Sharp & Dohme Corp. | Novel low molecular weight cyclic amine containing cationic lipids for oligonucleotide delivery |
| US20120121718A1 (en) | 2010-11-05 | 2012-05-17 | The Johns Hopkins University | Compositions and methods relating to reduced mucoadhesion |
| WO2012068187A1 (en) | 2010-11-19 | 2012-05-24 | Merck Sharp & Dohme Corp. | Poly(amide) polymers for the delivery of oligonucleotides |
| US8202983B2 (en) | 2007-05-10 | 2012-06-19 | Agilent Technologies, Inc. | Thiocarbon-protecting groups for RNA synthesis |
| US20120156679A1 (en) | 2002-11-21 | 2012-06-21 | Epicentre Technologies | Methods for making transcription products |
| WO2012082165A1 (en) | 2010-01-24 | 2012-06-21 | Novartis Ag | Irradiated biodegradable polymer microparticles |
| WO2012082574A1 (en) | 2010-12-17 | 2012-06-21 | Merck Sharp & Dohme Corp. | Membrane lytic poly(amido amine) polymers for the delivery of oligonucleotides |
| US8206749B1 (en) | 1999-02-26 | 2012-06-26 | Novartis Vaccines And Diagnostics, Inc. | Microemulsions with adsorbed macromolecules and microparticles |
| US20120171229A1 (en) | 2010-12-30 | 2012-07-05 | Selecta Biosciences, Inc. | Synthetic nanocarriers with reactive groups that release biologically active agents |
| US8217147B2 (en) | 2005-08-10 | 2012-07-10 | Macrogenics, Inc. | Identification and engineering of antibodies with variant Fc regions and methods of using same |
| US20120177724A1 (en) | 2010-03-19 | 2012-07-12 | Massachusetts Institute Of Technology | Lipid vesicle compositions and methods of use |
| WO2012094304A1 (en) | 2011-01-04 | 2012-07-12 | Brown University | Nanotubes as carriers of nucleic acids into cells |
| US20120178702A1 (en) | 1995-01-23 | 2012-07-12 | University Of Pittsburgh | Stable lipid-comprising drug delivery complexes and methods for their production |
| WO2012095255A1 (de) | 2011-01-13 | 2012-07-19 | Evonik Oxeno Gmbh | Verfahren zur aufreinigung von biphephos |
| US20120189700A1 (en) | 2011-01-19 | 2012-07-26 | Zoraida Aguilar | Nanoparticle Based Immunological Stimulation |
| WO2012099755A1 (en) | 2011-01-11 | 2012-07-26 | Alnylam Pharmaceuticals, Inc. | Pegylated lipids and their use for drug delivery |
| US8236280B2 (en) | 2003-12-19 | 2012-08-07 | University Of Cincinnati | Polyamides for nucleic acid delivery |
| US20120202871A1 (en) | 2009-07-01 | 2012-08-09 | Protiva Biotherapeutics, Inc. | Cationic lipids and methods for the delivery of therapeutic agents |
| US20120201859A1 (en) | 2002-05-02 | 2012-08-09 | Carrasquillo Karen G | Drug Delivery Systems and Use Thereof |
| US8241670B2 (en) | 2004-04-15 | 2012-08-14 | Chiasma Inc. | Compositions capable of facilitating penetration across a biological barrier |
| US8242258B2 (en) | 2006-12-03 | 2012-08-14 | Agilent Technologies, Inc. | Protecting groups for RNA synthesis |
| US8241610B2 (en) | 2003-07-09 | 2012-08-14 | Statens Serum Institut | Adjuvant combinations of liposomes and mycobacterial lipids for immunization compositions and vaccines |
| US20120207840A1 (en) | 2011-02-10 | 2012-08-16 | Aura Biosciences, Inc. | Virion Derived Protein Nanoparticles For Delivering Diagnostic Or Therapeutic Agents For The Treatment Of Non-Melanoma Skin Cancer |
| US20120207845A1 (en) | 2005-01-04 | 2012-08-16 | Hsing-Wen Sung | Pharmaceutical composition of nanoparticles |
| WO2012109121A1 (en) | 2011-02-07 | 2012-08-16 | Purdue Research Foundation | Carbohydrate nanoparticles for prolonged efficacy of antimicrobial peptide |
| US8246995B2 (en) | 2005-05-10 | 2012-08-21 | The Board Of Trustees Of The Leland Stanford Junior University | Hydrophobic nanotubes and nanoparticles as transporters for the delivery of drugs into cells |
| WO2012110636A2 (en) | 2011-02-18 | 2012-08-23 | Instituto Nacional De Investigación Y Tecnología Agraria Y Alimentaria (Inia) | Carrier peptides for cell delivery |
| US8257745B2 (en) | 2001-12-21 | 2012-09-04 | Novartis Ag | Use of synthetic inorganic nanoparticles as carriers for ophthalmic and otic drugs |
| US8257685B2 (en) | 2006-04-04 | 2012-09-04 | Stc.Unm | Swellable particles for drug delivery |
| US8263665B2 (en) | 2005-04-01 | 2012-09-11 | Intezyne Technologies, Inc. | Polymeric micelles for drug delivery |
| US20120228565A1 (en) | 2000-10-13 | 2012-09-13 | Life Technologies Corporation | Method for preparing surface-modified semiconductive and metallic nanoparticles having enhanced dispersibility in aqueous media |
| US20120237565A1 (en) | 2011-03-14 | 2012-09-20 | Intezyne Technologies, Incorporated | Pegylated polyplexes containing two or more different polymers for polynucleotide delivery |
| WO2012125987A2 (en) | 2011-03-17 | 2012-09-20 | Massachusetts Institute Of Technology | Delivery system |
| US20120244222A1 (en) | 2011-03-25 | 2012-09-27 | Selecta Biosciences, Inc. | Osmotic mediated release synthetic nanocarriers |
| WO2012131106A1 (en) | 2011-03-31 | 2012-10-04 | Ingell Technologies Holding B.V. | Biodegradable compositions suitable for controlled release |
| WO2012131104A2 (en) | 2011-03-31 | 2012-10-04 | Ingell Technologies Holding B.V. | Biodegradable compositions suitable for controlled release |
| WO2012129648A1 (en) | 2011-03-25 | 2012-10-04 | University Of Guelph | Enhancing protein expression of adeno-associated virus vectors |
| US8283333B2 (en) | 2009-07-01 | 2012-10-09 | Protiva Biotherapeutics, Inc. | Lipid formulations for nucleic acid delivery |
| US20120258176A1 (en) | 2005-01-04 | 2012-10-11 | Hsing-Wen Sung | Nanoparticles for protein drug delivery |
| US8287910B2 (en) | 2009-04-30 | 2012-10-16 | Intezyne Technologies, Inc. | Polymeric micelles for polynucleotide encapsulation |
| US8287849B2 (en) | 2000-10-10 | 2012-10-16 | Massachusetts Institute Of Technology | Biodegradable poly(beta-amino esters) and uses thereof |
| US20120265001A1 (en) | 2010-10-11 | 2012-10-18 | Wichita State University | Composite magnetic nanoparticle drug delivery system |
| US20120269761A1 (en) | 2006-01-12 | 2012-10-25 | Massachusetts Institute Of Technology | Biodegradable elastomers |
| WO2012149454A2 (en) | 2011-04-29 | 2012-11-01 | Selecta Biosciences, Inc. | Tolerogenic synthetic nanocarriers coupled to cd1d-restricted antigens and methods of use |
| US20120276209A1 (en) | 2009-11-04 | 2012-11-01 | The University Of British Columbia | Nucleic acid-containing lipid particles and related methods |
| WO2012148684A1 (en) | 2011-04-27 | 2012-11-01 | President And Fellows Of Harvard College | Cell-friendly inverse opal hydrogels for cell encapsulation, drug and protein delivery, and functional nanoparticle encapsulation |
| US8304532B2 (en) | 2002-07-31 | 2012-11-06 | Girindus Ag | Method for preparing oligonucleotides |
| US20120282343A1 (en) | 2001-10-03 | 2012-11-08 | Johns Hopkins University | Compositions for oral gene therapy and methods of using same |
| WO2012150467A2 (en) | 2011-05-04 | 2012-11-08 | The University Of Nottingham | Novel polymers which resist bacterial attachment |
| US20120283503A1 (en) | 2011-04-29 | 2012-11-08 | The Johns Hopkins University | Nanoparticle loaded stem cells and their use in mri guided hyperthermia |
| US20120283427A1 (en) | 2009-11-13 | 2012-11-08 | Bend Research, Inc. | Cationic dextran polymer derivatives |
| WO2012151438A1 (en) | 2011-05-05 | 2012-11-08 | Celacare Technologies, Llc | Antimicrobial silver hydrogel composition for the treatment of burns and wounds |
| US8309706B2 (en) | 1998-08-03 | 2012-11-13 | Agilent Technologies, Inc. | Methods of synthesizing oligonucleotides using carbonate protecting groups and alpha-effect nucleophile deprotection |
| US8309707B2 (en) | 2008-09-06 | 2012-11-13 | Chemgenes Corporation | RNA synthesis-phosphoramidites for synthetic RNA in the reverse direction, and application in convenient introduction of ligands, chromophores and modifications of synthetic RNA at the 3′-end |
| US8313777B2 (en) | 2006-10-05 | 2012-11-20 | The Johns Hopkins University | Water-dispersible oral, parenteral, and topical formulations for poorly water soluble drugs using smart polymeric nanoparticles |
| US20120295832A1 (en) | 2011-05-17 | 2012-11-22 | Arrowhead Research Corporation | Novel Lipids and Compositions for Intracellular Delivery of Biologically Active Compounds |
| US20120302940A1 (en) | 2011-05-26 | 2012-11-29 | Jackson State University | Popcorn Shape Gold Nanoparticle For Targeted Diagnosis, Photothermal Treatment and In-Situ Monitoring Therapy Response for Cancer and Multiple Drug Resistance Bacteria |
| WO2012166923A2 (en) | 2011-05-31 | 2012-12-06 | Bind Biosciences | Drug loaded polymeric nanoparticles and methods of making and using same |
| WO2012170930A1 (en) | 2011-06-08 | 2012-12-13 | Shire Human Genetic Therapies, Inc | Lipid nanoparticle compositions and methods for mrna delivery |
| WO2012170889A1 (en) | 2011-06-08 | 2012-12-13 | Shire Human Genetic Therapies, Inc. | Cleavable lipids |
| US20120321719A1 (en) | 2010-02-25 | 2012-12-20 | The Johns Hopkins University | Sustained Delivery of Therapeutic Agents to an Eye Compartment |
| WO2013001198A1 (fr) | 2011-06-27 | 2013-01-03 | E.Itec | Cable pour systeme d'alimentation electrique |
| WO2013003343A2 (en) | 2011-06-27 | 2013-01-03 | Adelphi Technology, Inc. | Neutron source for neutron capture therapy |
| WO2013001168A1 (en) | 2011-06-30 | 2013-01-03 | Ionphase Oy | Halogen-free polymer blend |
| WO2013001166A1 (en) | 2011-06-30 | 2013-01-03 | Wärtsilä Finland Oy | Method and arrangement for minimizing need for safety gases |
| US20130012450A1 (en) | 2011-07-10 | 2013-01-10 | Aura Biosciences, Inc. | Virion Derived Protein Nanoparticles For Delivering Diagnostic Or Therapeutic Agents For The Treatment Of Dermatology Related Genetic Diseases |
| WO2013006825A1 (en) | 2011-07-06 | 2013-01-10 | Novartis Ag | Liposomes having useful n:p ratio for delivery of rna molecules |
| WO2013008825A1 (ja) | 2011-07-11 | 2013-01-17 | 株式会社トクヤマ | フォトクロミック硬化性組成物 |
| WO2013007604A1 (de) | 2011-07-08 | 2013-01-17 | Bayer Intellectual Property Gmbh | Verfahren zur herstellung von tetrazol-substituierten anthranilsäurediamid-derivaten durch umsetzung von pyrazolsäuren mit anthranilsäureestern |
| WO2013009717A1 (en) | 2011-07-10 | 2013-01-17 | Elisabet De Los Pinos | Virion derived protein nanoparticles for delivering diagnostic or therapeutic agents for the treatment of skin-related diseases |
| WO2013009736A2 (en) | 2011-07-10 | 2013-01-17 | President And Fellows Of Harvard College | Compositions and methods for self-assembly of polymers with complementary macroscopic and microscopic scale units |
| WO2013012680A1 (en) | 2011-07-15 | 2013-01-24 | 3M Innovative Properties Company | An electrical connector |
| WO2013012226A2 (ko) | 2011-07-18 | 2013-01-24 | 이화다이아몬드공업 주식회사 | Cmp 패드 컨디셔너 |
| WO2013012476A2 (en) | 2011-07-21 | 2013-01-24 | Arizona Chemical Company, Llc | Branched polyether-polyamide block copolymers and methods of making and using the same |
| US8367328B2 (en) | 1998-04-23 | 2013-02-05 | Takara Bio Inc. | Method for synthesizing DNA |
| WO2013019669A2 (en) | 2011-07-29 | 2013-02-07 | Selecta Biosciences, Inc. | Synthetic nanocarriers that generate humoral and cytotoxic t lymphocyte (ctl) immune responses |
| US20130059360A1 (en) | 2005-04-12 | 2013-03-07 | Nektar Therapeutics | Polymer-based compositions and conjugates of antimicrobial agents |
| WO2013032829A1 (en) | 2011-08-26 | 2013-03-07 | Arrowhead Research Corporation | Poly(vinyl ester) polymers for in vivo nucleic acid delivery |
| US20130064894A1 (en) | 2011-08-31 | 2013-03-14 | Protiva Biotherapeutics, Inc. | Novel cationic lipids and methods of use thereof |
| US20130065942A1 (en) | 2007-08-06 | 2013-03-14 | Egen, Inc. | Nucleic Acid-Lipopolymer Compositions |
| US8399007B2 (en) | 2006-12-05 | 2013-03-19 | Landec Corporation | Method for formulating a controlled-release pharmaceutical formulation |
| US20130071450A1 (en) | 2010-03-18 | 2013-03-21 | Covidien Lp | Gels for transdermal delivery |
| US20130072709A1 (en) | 2006-02-21 | 2013-03-21 | Nektar Therapeutics | Segmented Degradable Polymers and Conjugates Made Therefrom |
| US8404222B2 (en) | 1996-09-26 | 2013-03-26 | Nektar Therapeutics | Soluble, degradable poly(ethylene glycol) derivatives for controllable release of bound molecules into solution |
| US8404799B2 (en) | 2010-03-26 | 2013-03-26 | Cerulean Pharma Inc. | Methods and systems for generating nanoparticles |
| WO2013044219A1 (en) | 2011-09-22 | 2013-03-28 | Bind Biosciences | Methods of treating cancers with therapeutic nanoparticles |
| WO2013049328A1 (en) | 2011-09-27 | 2013-04-04 | Alnylam Pharmaceuticals, Inc. | Di-aliphatic substituted pegylated lipids |
| US8415325B2 (en) | 2005-03-31 | 2013-04-09 | University Of Delaware | Cell-mediated delivery and targeted erosion of noncovalently crosslinked hydrogels |
| US8414927B2 (en) | 2006-11-03 | 2013-04-09 | Boston Scientific Scimed, Inc. | Cross-linked polymer particles |
| US20130090372A1 (en) | 2010-06-04 | 2013-04-11 | Brian W. Budzik | Novel Low Molecular Weight Cationic Lipids for Oligonucleotide Delivery |
| WO2013052167A2 (en) | 2011-06-02 | 2013-04-11 | The Regents Of The University Of California | Membrane encapsulated nanoparticles and method of use |
| WO2013052523A1 (en) | 2011-10-03 | 2013-04-11 | modeRNA Therapeutics | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US8420605B2 (en) | 2005-09-07 | 2013-04-16 | The University Of Strathclyde | Hydrogel compositions |
| WO2013055971A1 (en) | 2011-10-11 | 2013-04-18 | Arizona Board Of Regents For And On Behalf Of Arizona State University | Polymers for delivering a substance into a cell |
| WO2013056132A2 (en) | 2011-10-14 | 2013-04-18 | Stc.Unm | Porous nanoparticle-supported lipid bilayers (protocells) for targeted delivery including transdermal delivery of cargo and methods thereof |
| WO2013055331A1 (en) | 2011-10-12 | 2013-04-18 | The Curators Of The University Of Missouri | Pentablock polymers |
| US20130102545A1 (en) | 2009-12-16 | 2013-04-25 | Magforce Ag | Temperature dependent activation of catalytic nucleic acids for controlled active substance release |
| WO2013059496A1 (en) | 2011-10-18 | 2013-04-25 | Dicerna Pharmaceuticals, Inc. | Amine cationic lipids and uses thereof |
| WO2013059922A1 (en) | 2011-10-25 | 2013-05-02 | The University Of British Columbia | Limit size lipid nanoparticles and related methods |
| WO2013063530A2 (en) | 2011-10-28 | 2013-05-02 | Presage Biosciences, Inc. | Methods for drug delivery |
| WO2013063468A1 (en) | 2011-10-27 | 2013-05-02 | Massachusetts Institute Of Technology | Amino acid derivates functionalized on the n- terminal capable of forming drug incapsulating microspheres |
| US20130116408A1 (en) | 2011-11-05 | 2013-05-09 | Aura Biosciences, Inc. | Virion Derived Protein Nanoparticles For Delivering Radioisotopes For The Diagnosis And Treatment Of Malignant And Systemic Disease And The Monitoring Of Therapy |
| US20130115247A1 (en) | 2011-11-05 | 2013-05-09 | Aura Biosciences, Inc. | Virion Derived Protein Nanoparticles For Delivering Radioisotopes For The Diagnosis And Treatment Of Malignant And Systemic Disease And The Monitoring Of Therapy |
| US8440614B2 (en) | 2000-12-29 | 2013-05-14 | Aphios Corporation | Polymer microspheres/nanospheres and encapsulating therapeutic proteins therein |
| US20130123338A1 (en) | 2010-05-12 | 2013-05-16 | Protiva Biotherapeutics, Inc. | Novel cationic lipids and methods of use thereof |
| US8444992B2 (en) | 2005-09-01 | 2013-05-21 | Novartis Vaccines And Diagnostics Gmbh | Multiple vaccination including serogroup C meningococcus |
| WO2013075068A1 (en) | 2011-11-18 | 2013-05-23 | Regeneron Pharmaceuticals, Inc. | Polymer protein microparticles |
| US20130129726A1 (en) | 2006-02-20 | 2013-05-23 | Kyunglim Lee | Peptide having cell membrane penetrating activity |
| US20130130348A1 (en) | 2006-05-15 | 2013-05-23 | The Brigham And Women's Hospital, Inc. | Polymers for Functional Particles |
| US20130129636A1 (en) | 2009-11-20 | 2013-05-23 | Imperial Innovations Limited | Novel Liposome Nanoparticles for Tumor Magnetic Resonance Imaging |
| WO2013072929A2 (en) | 2011-09-23 | 2013-05-23 | Indian Institute Of Technology | Nanop article based cosmetic composition |
| US20130129785A1 (en) | 2010-05-10 | 2013-05-23 | Alnylam Pharmaceuticals, Inc | Methods and compositions for delivery of active agents |
| US20130129627A1 (en) | 2009-10-22 | 2013-05-23 | James B. Delehanty | Delivery of Nanoparticles to Neurons |
| US8450298B2 (en) | 2008-11-07 | 2013-05-28 | Massachusetts Institute Of Technology | Aminoalcohol lipidoids and uses thereof |
| US8449916B1 (en) | 2009-11-06 | 2013-05-28 | Iowa State University Research Foundation, Inc. | Antimicrobial compositions and methods |
| US20130138032A1 (en) | 2010-04-15 | 2013-05-30 | Sungjee Kim | ANTICANCER AGENT DELIVERY SYSTEM USING pH-SENSITIVE METAL NANOPARTICLES |
| US20130133483A1 (en) | 2010-03-08 | 2013-05-30 | University Of Rochester | Synthesis of Nanoparticles Using Reducing Gases |
| US20130137644A1 (en) | 2005-12-16 | 2013-05-30 | Cellectis | Cell penetrating peptide conjugates for delivering of nucleic acids into a cell |
| US8454946B2 (en) | 2000-02-22 | 2013-06-04 | Nektar Therapeutics | N-maleimidyl polymer derivatives |
| WO2013082529A1 (en) | 2011-12-02 | 2013-06-06 | Yale University | Enzymatic synthesis of poly(amine-co-esters) and methods of use thereof for gene delivery |
| WO2013082111A2 (en) | 2011-11-29 | 2013-06-06 | The University Of North Carolina At Chapel Hill | Geometrically engineered particles and methods for modulating macrophage or immune responses |
| US20130142876A1 (en) | 2011-12-02 | 2013-06-06 | Pegasus Laboratories, Inc. | Amphipathic lipid-based sustained release compositions |
| WO2013082590A1 (en) | 2011-12-02 | 2013-06-06 | Invivo Therapeutics Corporation | Peg based hydrogel for peripheral nerve injury applications and compositions and method of use of synthetic hydrogel sealants |
| US8461132B2 (en) | 2003-05-05 | 2013-06-11 | Ben Gurion University Of The Negev Research And Development Authority | Injectable cross-linked polymeric preparations and uses thereof |
| US8460709B2 (en) | 2002-03-13 | 2013-06-11 | Novartis Ag | Pharmaceutical microparticles |
| US20130150295A1 (en) | 2006-12-21 | 2013-06-13 | Stryker Corporation | Sustained-Release Formulations Comprising Crystals, Macromolecular Gels, and Particulate Suspensions of Biologic Agents |
| US20130149318A1 (en) | 2011-12-13 | 2013-06-13 | Invivo Therapeutics Corporation | Painting the pia, arachnoid, and spinal cord parenchyma |
| WO2013086526A1 (en) | 2011-12-09 | 2013-06-13 | The Regents Of The University Of California | Liposomal drug encapsulation |
| WO2013086354A1 (en) | 2011-12-07 | 2013-06-13 | Alnylam Pharmaceuticals, Inc. | Biodegradable lipids for the delivery of active agents |
| US20130149783A1 (en) | 2010-03-16 | 2013-06-13 | James William Yockman | Cleavable modifications to reducible poly (amido ethylenimines)s to enhance nucleotide delivery |
| WO2013084000A2 (en) | 2011-12-07 | 2013-06-13 | Isis Innovation Limited | Exosomes for delivery of biotherapeutics |
| WO2013086373A1 (en) | 2011-12-07 | 2013-06-13 | Alnylam Pharmaceuticals, Inc. | Lipids for the delivery of active agents |
| US20130150625A1 (en) | 2010-05-24 | 2013-06-13 | Brian W. Budzik | Novel Amino Alcohol Cationic Lipids for Oligonucleotide Delivery |
| WO2013086322A1 (en) | 2011-12-07 | 2013-06-13 | Alnylam Pharmaceuticals, Inc. | Branched alkyl and cycloalkyl terminated biodegradable lipids for the delivery of active agents |
| US8466122B2 (en) | 2010-09-17 | 2013-06-18 | Protiva Biotherapeutics, Inc. | Trialkyl cationic lipids and methods of use thereof |
| WO2013090648A1 (en) | 2011-12-16 | 2013-06-20 | modeRNA Therapeutics | Modified nucleoside, nucleotide, and nucleic acid compositions |
| WO2013090601A2 (en) | 2011-12-16 | 2013-06-20 | Massachusetts Institute Of Technology | Compact nanoparticles for biological applications |
| US20130156721A1 (en) | 2002-09-06 | 2013-06-20 | Cerulean Pharma Inc. | Cyclodextrin-based polymers for therapeutics delivery |
| WO2013090861A1 (en) | 2011-12-16 | 2013-06-20 | Massachusetts Institute Of Technology | Alpha-aminoamidine polymers and uses thereof |
| US20130156845A1 (en) | 2010-04-29 | 2013-06-20 | Alnylam Pharmaceuticals, Inc. | Lipid formulated single stranded rna |
| WO2013093648A2 (en) | 2011-11-04 | 2013-06-27 | Nitto Denko Corporation | Method of producing lipid nanoparticles for drug delivery |
| WO2013091001A1 (en) | 2011-12-19 | 2013-06-27 | The University Of Sydney | A peptide-hydrogel composite |
| US20130164219A1 (en) | 2010-06-14 | 2013-06-27 | Hoffmann-La Roche Inc. | Cell-penetrating peptides and uses thereof |
| US20130172600A1 (en) | 2006-07-12 | 2013-07-04 | Novartis Ag | Novel Polymers |
| US20130171646A1 (en) | 2010-08-09 | 2013-07-04 | So Jung PARK | Nanop article-oligonucleotide hybrid structures and methods of use thereof |
| US20130177633A1 (en) | 2010-04-09 | 2013-07-11 | Pacira Pharmaceuticals, Inc. | Method for formulating large diameter synthetic membrane vesicles |
| US20130177587A1 (en) | 2003-07-11 | 2013-07-11 | Novavax, Inc. | Functional influenza virus-like particles (vlps) |
| WO2013103659A1 (en) | 2012-01-04 | 2013-07-11 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Stabilizing rna by incorporating chain-terminating nucleosides at the 3'-terminus |
| US20130177499A1 (en) | 2011-12-13 | 2013-07-11 | Engenelc Molecular Delivery Pty Ltd | Bacterially derived, intact minicells for delivery of therapeutic agents to brain tumors |
| US20130177523A1 (en) | 2010-07-13 | 2013-07-11 | University Of Utah Research Foundation | Gold particles and methods of making and using the same in cancer treatment |
| US20130177611A1 (en) | 2004-06-11 | 2013-07-11 | Eidgenossisches Technische Hochschule (The Swiss Federal Institute of Technology) | Silk-based drug delivery system |
| WO2013106086A1 (en) | 2012-01-10 | 2013-07-18 | Sorbent Therapeutics, Inc. | Compositions comprising crosslinked cation-binding polymers and uses thereof |
| US20130183718A1 (en) | 2010-09-21 | 2013-07-18 | RibpxX GmbH | Method for Synthesizing RNA using DNA Template |
| US20130184453A1 (en) | 1998-07-01 | 2013-07-18 | California Institute Of Technology | Linear cyclodextrin copolymers |
| WO2013105101A1 (en) | 2012-01-13 | 2013-07-18 | Department Of Biotechnology | Solid lipid nanoparticles entrapping hydrophilic/ amphiphilic drug and a process for preparing the same |
| US20130183244A1 (en) | 2010-09-10 | 2013-07-18 | The Johns Hopkins University | Rapid Diffusion of Large Polymeric Nanoparticles in the Mammalian Brain |
| US20130184443A1 (en) | 2005-06-16 | 2013-07-18 | Nektar Therapeutics | Methods for Preparing Conjugates |
| WO2013106073A1 (en) | 2012-01-10 | 2013-07-18 | Sorbent Therapeutics, Inc. | Compositions comprising crosslinked cation-binding polymers and uses thereof |
| WO2013106072A1 (en) | 2012-01-10 | 2013-07-18 | Sorbent Therapeutics, Inc. | Compositions comprising crosslinked cation-binding polymers and uses thereof |
| WO2013106525A1 (en) | 2012-01-12 | 2013-07-18 | Stc.Unm | Immunogenic hpv l2-containing vlps and related compositions and methods |
| WO2013106715A1 (en) | 2012-01-13 | 2013-07-18 | Allergan, Inc. | Crosslinked hyaluronic acid-collagen gels for improving tissue graft viability and soft tissue augmentation |
| US8492359B2 (en) | 2008-04-15 | 2013-07-23 | Protiva Biotherapeutics, Inc. | Lipid formulations for nucleic acid delivery |
| WO2013110028A1 (en) | 2012-01-19 | 2013-07-25 | The Johns Hopkins University | Nanoparticle formulations with enhanced mucosal penetration |
| US20130189241A1 (en) | 2007-12-10 | 2013-07-25 | The Trustees Of The University Of Pennsylvania | Regulated delivery systems for inner ear drug application and uses thereof |
| US8497357B2 (en) | 1998-01-07 | 2013-07-30 | Nektar Therapeutics | Degradable heterobifunctional poly(ethylene glycol) acrylates and gels and conjugates derived therefrom |
| US8496945B2 (en) | 2007-03-05 | 2013-07-30 | Washington University | Nanoparticle delivery systems for membrane-integrating peptides |
| US20130196915A1 (en) | 2010-01-23 | 2013-08-01 | Yong Wang | Affinity hydrogels for controlled protein release |
| US20130195799A1 (en) | 2010-08-19 | 2013-08-01 | Peg Biosciences, Inc. | Synergistic biomolecule-polymer conjugates |
| US20130197100A1 (en) | 2010-06-15 | 2013-08-01 | Instituto De Pesquisas Technologicas Do Estado De Sao Paulo | Colloidal nanoscale carriers for active hydrophilic substances and method for producing same |
| US20130196948A1 (en) | 2010-06-25 | 2013-08-01 | Massachusetts Insitute Of Technology | Polymers for biomaterials and therapeutics |
| US8501824B2 (en) | 2007-05-04 | 2013-08-06 | Marina Biotech, Inc. | Amino acid lipids and uses thereof |
| US8501478B2 (en) | 2006-06-15 | 2013-08-06 | University Of Cincinnati | Trehalose click polymers for delivery of biologically active molecules |
| EP2623121A1 (en) | 2012-01-31 | 2013-08-07 | Bayer Innovation GmbH | Pharmaceutical composition comprising a polymeric carrier cargo complex and an antigen |
| WO2013113326A1 (en) | 2012-01-31 | 2013-08-08 | Curevac Gmbh | Pharmaceutical composition comprising a polymeric carrier cargo complex and at least one protein or peptide antigen |
| WO2013113071A1 (en) | 2012-02-03 | 2013-08-08 | Commonwealth Scientific And Industrial Research Organisation | Branched polymers |
| WO2013116126A1 (en) | 2012-02-01 | 2013-08-08 | Merck Sharp & Dohme Corp. | Novel low molecular weight, biodegradable cationic lipids for oligonucleotide delivery |
| WO2013113325A1 (en) | 2012-01-31 | 2013-08-08 | Curevac Gmbh | Negatively charged nucleic acid comprising complexes for immunostimulation |
| WO2013116656A1 (en) | 2012-02-03 | 2013-08-08 | Emory University | Immunostimulatory compositions, particles, and uses related thereto |
| US8506967B2 (en) | 2003-07-11 | 2013-08-13 | Novavax, Inc. | Functional influenza virus like particles (VLPs) |
| US8507653B2 (en) | 2006-12-27 | 2013-08-13 | Nektar Therapeutics | Factor IX moiety-polymer conjugates having a releasable linkage |
| US20130211249A1 (en) | 2010-07-22 | 2013-08-15 | The Johns Hopkins University | Drug eluting hydrogels for catheter delivery |
| US20130209544A1 (en) | 2010-05-26 | 2013-08-15 | Micromedmark Biotech Co., Ltd. | Microvesicles carrying small interfering rnas, preparation methods and uses thereof |
| WO2013119602A1 (en) | 2012-02-06 | 2013-08-15 | President And Fellows Of Harvard College | Arrdc1-mediated microvesicles (armms) and uses thereof |
| WO2013120052A1 (en) | 2012-02-10 | 2013-08-15 | E. I. Du Pont De Nemours And Company | Preparation, purification and use of high-x diblock copolymers |
| WO2013119936A2 (en) | 2012-02-09 | 2013-08-15 | Life Technologies Corporation | Hydrophilic polymeric particles and methods for making same |
| US20130216607A1 (en) | 2010-08-14 | 2013-08-22 | The Regents Of The University Of California | Zwitterionic lipids |
| US20130217753A1 (en) | 2011-02-22 | 2013-08-22 | Rutgers, The State University Of New Jersey | Amphiphilic macromolecules for nucleic acid delivery |
| WO2013123125A1 (en) | 2012-02-17 | 2013-08-22 | President And Fellows Of Harvard College | Assembly of nucleic acid sequences in emulsions |
| WO2013123298A1 (en) | 2012-02-17 | 2013-08-22 | University Of Georgia Research Foundation, Inc. | Nanoparticles for mitochondrial trafficking of agents |
| WO2013123492A2 (en) | 2012-02-17 | 2013-08-22 | Massachusetts Institute Of Technology | Glucose-responsive microgels for closed loop insulin delivery |
| US20130216612A1 (en) | 2007-03-23 | 2013-08-22 | Bbb Holding B.V. | Targeted intracellular delivery of antiviral agents |
| WO2013122262A1 (en) | 2012-02-16 | 2013-08-22 | Vlp Therapeutics, Llc | Virus like particle composition |
| WO2013123491A1 (en) | 2012-02-17 | 2013-08-22 | Massachusetts Institute Of Technology | Self-regulated peptide hydrogel for insulin delivery |
| WO2013123523A1 (en) | 2012-02-19 | 2013-08-22 | Nvigen, Inc. | Uses of porous nanostructure in delivery |
| WO2013123407A1 (en) | 2012-02-17 | 2013-08-22 | Celsion Corporation | Thermosensitive nanoparticle formulations and method of making the same |
| US8518907B2 (en) | 2010-08-02 | 2013-08-27 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of catenin (cadherin-associated protein), beta 1 (CTNNB1) gene expression using short interfering nucleic acid (siNA) |
| WO2013124654A1 (en) | 2012-02-20 | 2013-08-29 | Cambridge Enterprise Limited | Cucurbituril-based hydrogels |
| WO2013124620A1 (en) | 2012-02-22 | 2013-08-29 | The University Of Manchester | Method of making a hydrogel |
| WO2013124855A1 (en) | 2012-02-21 | 2013-08-29 | Ben-Gurion University Of The Negev Research And Development Authority | Hydrogel system comprising spatially separated bioactive polypeptides |
| WO2013124867A1 (en) | 2012-02-21 | 2013-08-29 | Amrita Vishwa Vidyapeetham University | Polymer - polymer or polymer - protein core - shell nano medicine loaded with multiple drug molecules |
| US8524368B2 (en) | 2003-07-09 | 2013-09-03 | Wisconsin Alumni Research Foundation | Charge-dynamic polymers and delivery of anionic compounds |
| US8524259B2 (en) | 2006-12-05 | 2013-09-03 | Landec Corporation | Systems and methods for delivery of materials |
| US20130231287A1 (en) | 2010-02-25 | 2013-09-05 | Parimala Nacharaju | Pegylated albumin polymers and uses thereof |
| WO2013151668A2 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of secreted proteins |
| WO2013151666A2 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of biologics and proteins associated with human disease |
| WO2014028429A2 (en) | 2012-08-14 | 2014-02-20 | Moderna Therapeutics, Inc. | Enzymes and polymerases for the synthesis of rna |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1044987B1 (en) * | 1991-12-24 | 2006-02-15 | Isis Pharmaceuticals, Inc. | Gapped 2'-modified oligonucleotides |
| KR101123489B1 (ko) * | 2003-01-16 | 2012-03-28 | 이데라 파마슈티칼즈, 인코포레이티드 | 개질된 면역자극성 디뉴클레오티드를 이용한 올리고뉴클레오티드-기재 화합물의 면역자극 특성의 조절 |
| AU2007210034A1 (en) * | 2006-01-26 | 2007-08-09 | University Of Massachusetts | RNA silencing agents for use in therapy and nanotransporters for efficient delivery of same |
| JP2011130725A (ja) * | 2009-12-25 | 2011-07-07 | Contig I:Kk | Lnaオリゴヌクレオチドとそれを含有する化粧品 |
| CA2859691A1 (en) * | 2011-12-21 | 2013-06-27 | Moderna Therapeutics, Inc. | Methods of increasing the viability or longevity of an organ or organ explant |
-
2014
- 2014-09-03 AU AU2014315287A patent/AU2014315287A1/en not_active Abandoned
- 2014-09-03 EP EP14766339.7A patent/EP3041934A1/en not_active Withdrawn
- 2014-09-03 WO PCT/US2014/053907 patent/WO2015034928A1/en not_active Ceased
- 2014-09-03 JP JP2016540348A patent/JP2016530294A/ja active Pending
- 2014-09-03 US US14/915,959 patent/US20160194625A1/en not_active Abandoned
- 2014-09-03 CA CA2923029A patent/CA2923029A1/en not_active Abandoned
Patent Citations (620)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US845948A (en) | 1906-11-22 | 1907-03-05 | Raymond A Hall | Soldering compound. |
| US2103001A (en) | 1933-08-28 | 1937-12-21 | E S Evans And Sons | Windshield wiper mechanism |
| US4667025A (en) | 1982-08-09 | 1987-05-19 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
| US4789737A (en) | 1982-08-09 | 1988-12-06 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives and production thereof |
| US4835263A (en) | 1983-01-27 | 1989-05-30 | Centre National De La Recherche Scientifique | Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use |
| US4605735A (en) | 1983-02-14 | 1986-08-12 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
| US4948882A (en) | 1983-02-22 | 1990-08-14 | Syngene, Inc. | Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis |
| US5541313A (en) | 1983-02-22 | 1996-07-30 | Molecular Biosystems, Inc. | Single-stranded labelled oligonucleotides of preselected sequence |
| US4824941A (en) | 1983-03-10 | 1989-04-25 | Julian Gordon | Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems |
| US4587044A (en) | 1983-09-01 | 1986-05-06 | The Johns Hopkins University | Linkage of proteins to nucleic acids |
| US5118800A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | Oligonucleotides possessing a primary amino group in the terminal nucleotide |
| US5118802A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside |
| US4981957A (en) | 1984-07-19 | 1991-01-01 | Centre National De La Recherche Scientifique | Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini |
| US5258506A (en) | 1984-10-16 | 1993-11-02 | Chiron Corporation | Photolabile reagents for incorporation into oligonucleotide chains |
| US5578717A (en) | 1984-10-16 | 1996-11-26 | Chiron Corporation | Nucleotides for introducing selectably cleavable and/or abasic sites into oligonucleotides |
| US5545730A (en) | 1984-10-16 | 1996-08-13 | Chiron Corporation | Multifunctional nucleic acid monomer |
| US5552538A (en) | 1984-10-16 | 1996-09-03 | Chiron Corporation | Oligonucleotides with cleavable sites |
| US4828979A (en) | 1984-11-08 | 1989-05-09 | Life Technologies, Inc. | Nucleotide analogs for nucleic acid labeling and detection |
| US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
| US4762779A (en) | 1985-06-13 | 1988-08-09 | Amgen Inc. | Compositions and methods for functionalizing nucleic acids |
| US5317098A (en) | 1986-03-17 | 1994-05-31 | Hiroaki Shizuya | Non-radioisotope tagging of fragments |
| US4876335A (en) | 1986-06-30 | 1989-10-24 | Wakunaga Seiyaku Kabushiki Kaisha | Poly-labelled oligonucleotide derivative |
| US4904582A (en) | 1987-06-11 | 1990-02-27 | Synthetic Genetics | Novel amphiphilic nucleic acid conjugates |
| US5585481A (en) | 1987-09-21 | 1996-12-17 | Gen-Probe Incorporated | Linking reagents for nucleotide probes |
| US5525465A (en) | 1987-10-28 | 1996-06-11 | Howard Florey Institute Of Experimental Physiology And Medicine | Oligonucleotide-polyamide conjugates and methods of production and applications of the same |
| US5112963A (en) | 1987-11-12 | 1992-05-12 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | Modified oligonucleotides |
| US4966891A (en) | 1987-11-17 | 1990-10-30 | Hoffmann-La Roche Inc. | Fluorocytidine derivatives |
| US5563250A (en) | 1987-12-02 | 1996-10-08 | Neorx Corporation | Cleavable conjugates for the delivery and release of agents in native form |
| US5082830A (en) | 1988-02-26 | 1992-01-21 | Enzo Biochem, Inc. | End labeled nucleotide probe |
| US5109124A (en) | 1988-06-01 | 1992-04-28 | Biogen, Inc. | Nucleic acid probe linked to a label having a terminal cysteine |
| US5262536A (en) | 1988-09-15 | 1993-11-16 | E. I. Du Pont De Nemours And Company | Reagents for the preparation of 5'-tagged oligonucleotides |
| US5512439A (en) | 1988-11-21 | 1996-04-30 | Dynal As | Oligonucleotide-linked magnetic particles and uses thereof |
| US5599923A (en) | 1989-03-06 | 1997-02-04 | Board Of Regents, University Of Tx | Texaphyrin metal complexes having improved functionalization |
| US5391723A (en) | 1989-05-31 | 1995-02-21 | Neorx Corporation | Oligonucleotide conjugates |
| US5416203A (en) | 1989-06-06 | 1995-05-16 | Northwestern University | Steroid modified oligonucleotides |
| US4958013A (en) | 1989-06-06 | 1990-09-18 | Northwestern University | Cholesteryl modified oligonucleotides |
| US5451463A (en) | 1989-08-28 | 1995-09-19 | Clontech Laboratories, Inc. | Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides |
| US5254469A (en) | 1989-09-12 | 1993-10-19 | Eastman Kodak Company | Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures |
| US5591722A (en) | 1989-09-15 | 1997-01-07 | Southern Research Institute | 2'-deoxy-4'-thioribonucleosides and their antiviral activity |
| US5466786B1 (en) | 1989-10-24 | 1998-04-07 | Gilead Sciences | 2' Modified nucleoside and nucleotide compounds |
| US5466786A (en) | 1989-10-24 | 1995-11-14 | Gilead Sciences | 2'modified nucleoside and nucleotide compounds |
| US5208020A (en) | 1989-10-25 | 1993-05-04 | Immunogen Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| US5292873A (en) | 1989-11-29 | 1994-03-08 | The Research Foundation Of State University Of New York | Nucleic acids labeled with naphthoquinone probe |
| US5486603A (en) | 1990-01-08 | 1996-01-23 | Gilead Sciences, Inc. | Oligonucleotide having enhanced binding affinity |
| US5578718A (en) | 1990-01-11 | 1996-11-26 | Isis Pharmaceuticals, Inc. | Thiol-derivatized nucleosides |
| US7037646B1 (en) | 1990-01-11 | 2006-05-02 | Isis Pharmaceuticals, Inc. | Amine-derivatized nucleosides and oligonucleosides |
| US6900297B1 (en) | 1990-01-11 | 2005-05-31 | Isis Pharmaceuticals, Inc. | Amine-derivatized nucleosides and oligonucleosides |
| US5646265A (en) | 1990-01-11 | 1997-07-08 | Isis Pharmceuticals, Inc. | Process for the preparation of 2'-O-alkyl purine phosphoramidites |
| US5670633A (en) | 1990-01-11 | 1997-09-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
| US6783931B1 (en) | 1990-01-11 | 2004-08-31 | Isis Pharmaceuticals, Inc. | Amine-derivatized nucleosides and oligonucleosides |
| US5214136A (en) | 1990-02-20 | 1993-05-25 | Gilead Sciences, Inc. | Anthraquinone-derivatives oligonucleotides |
| US5414077A (en) | 1990-02-20 | 1995-05-09 | Gilead Sciences | Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods |
| US5567811A (en) | 1990-05-03 | 1996-10-22 | Amersham International Plc | Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides |
| US5514785A (en) | 1990-05-11 | 1996-05-07 | Becton Dickinson And Company | Solid supports for nucleic acid hybridization assays |
| US5637459A (en) * | 1990-06-11 | 1997-06-10 | Nexstar Pharmaceuticals, Inc. | Systematic evolution of ligands by exponential enrichment: chimeric selex |
| US5608046A (en) | 1990-07-27 | 1997-03-04 | Isis Pharmaceuticals, Inc. | Conjugated 4'-desmethyl nucleoside analog compounds |
| US5218105A (en) | 1990-07-27 | 1993-06-08 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
| US5138045A (en) | 1990-07-27 | 1992-08-11 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
| US5489677A (en) | 1990-07-27 | 1996-02-06 | Isis Pharmaceuticals, Inc. | Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms |
| US5602240A (en) | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
| US5688941A (en) | 1990-07-27 | 1997-11-18 | Isis Pharmaceuticals, Inc. | Methods of making conjugated 4' desmethyl nucleoside analog compounds |
| US5245022A (en) | 1990-08-03 | 1993-09-14 | Sterling Drug, Inc. | Exonuclease resistant terminally substituted oligonucleotides |
| US5567810A (en) | 1990-08-03 | 1996-10-22 | Sterling Drug, Inc. | Nuclease resistant compounds |
| US5512667A (en) | 1990-08-28 | 1996-04-30 | Reed; Michael W. | Trifunctional intermediates for preparing 3'-tailed oligonucleotides |
| US6617106B1 (en) | 1990-10-09 | 2003-09-09 | Steven Albert Benner | Methods for preparing oligonucleotides containing non-standard nucleotides |
| US5510475A (en) | 1990-11-08 | 1996-04-23 | Hybridon, Inc. | Oligonucleotide multiple reporter precursors |
| US5714331A (en) | 1991-05-24 | 1998-02-03 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility |
| US5371241A (en) | 1991-07-19 | 1994-12-06 | Pharmacia P-L Biochemicals Inc. | Fluorescein labelled phosphoramidites |
| US5393878A (en) | 1991-10-17 | 1995-02-28 | Ciba-Geigy Corporation | Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates |
| US5319080A (en) | 1991-10-17 | 1994-06-07 | Ciba-Geigy Corporation | Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates |
| US5359044A (en) | 1991-12-13 | 1994-10-25 | Isis Pharmaceuticals | Cyclobutyl oligonucleotide surrogates |
| US5595726A (en) | 1992-01-21 | 1997-01-21 | Pharmacyclics, Inc. | Chromophore probe for detection of nucleic acid |
| US5587371A (en) | 1992-01-21 | 1996-12-24 | Pharmacyclics, Inc. | Texaphyrin-oligonucleotide conjugates |
| US5565552A (en) | 1992-01-21 | 1996-10-15 | Pharmacyclics, Inc. | Method of expanded porphyrin-oligonucleotide conjugate synthesis |
| US5639873A (en) | 1992-02-05 | 1997-06-17 | Centre National De La Recherche Scientifique (Cnrs) | Oligothionucleotides |
| US5475092A (en) | 1992-03-25 | 1995-12-12 | Immunogen Inc. | Cell binding agent conjugates of analogues and derivatives of CC-1065 |
| US5846545A (en) | 1992-03-25 | 1998-12-08 | Immunogen, Inc. | Targeted delivery of cyclopropylbenzindole-containing cytotoxic drugs |
| US5585499A (en) | 1992-03-25 | 1996-12-17 | Immunogen Inc. | Cyclopropylbenzindole-containing cytotoxic drugs |
| US5700920A (en) | 1992-07-01 | 1997-12-23 | Novartis Corporation | Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
| US5610300A (en) | 1992-07-01 | 1997-03-11 | Ciba-Geigy Corporation | Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
| US5272250A (en) | 1992-07-10 | 1993-12-21 | Spielvogel Bernard F | Boronated phosphoramidate compounds |
| US5574142A (en) | 1992-12-15 | 1996-11-12 | Microprobe Corporation | Peptide linkers for improved oligonucleotide delivery |
| US5505931A (en) | 1993-03-04 | 1996-04-09 | The Dow Chemical Company | Acid cleavable compounds, their preparation and use as bifunctional acid-labile crosslinking agents |
| US5576427A (en) | 1993-03-30 | 1996-11-19 | Sterling Winthrop, Inc. | Acyclic nucleoside analogs and oligonucleotide sequences containing them |
| US5658873A (en) | 1993-04-10 | 1997-08-19 | Degussa Aktiengesellschaft | Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them |
| US7906490B2 (en) | 1993-04-15 | 2011-03-15 | University Of Rochester | Circular DNA vectors for synthesis of RNA and DNA |
| US5539082A (en) | 1993-04-26 | 1996-07-23 | Nielsen; Peter E. | Peptide nucleic acids |
| US6294664B1 (en) | 1993-07-29 | 2001-09-25 | Isis Pharmaceuticals, Inc. | Synthesis of oligonucleotides |
| US5719262A (en) | 1993-11-22 | 1998-02-17 | Buchardt, Deceased; Ole | Peptide nucleic acids having amino acid side chains |
| US5446137A (en) | 1993-12-09 | 1995-08-29 | Syntex (U.S.A.) Inc. | Oligonucleotides containing 4'-substituted nucleotides |
| US5446137B1 (en) | 1993-12-09 | 1998-10-06 | Behringwerke Ag | Oligonucleotides containing 4'-substituted nucleotides |
| US5519134A (en) | 1994-01-11 | 1996-05-21 | Isis Pharmaceuticals, Inc. | Pyrrolidine-containing monomers and oligomers |
| US5599928A (en) | 1994-02-15 | 1997-02-04 | Pharmacyclics, Inc. | Texaphyrin compounds having improved functionalization |
| US5627053A (en) | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
| US5597696A (en) | 1994-07-18 | 1997-01-28 | Becton Dickinson And Company | Covalent cyanine dye oligonucleotide conjugates |
| US5580731A (en) | 1994-08-25 | 1996-12-03 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
| US5591584A (en) | 1994-08-25 | 1997-01-07 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
| US5597909A (en) | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
| US5585108A (en) | 1994-12-30 | 1996-12-17 | Nanosystems L.L.C. | Formulations of oral gastrointestinal therapeutic agents in combination with pharmaceutically acceptable clays |
| US20120178702A1 (en) | 1995-01-23 | 2012-07-12 | University Of Pittsburgh | Stable lipid-comprising drug delivery complexes and methods for their production |
| EP0735144A1 (en) | 1995-03-28 | 1996-10-02 | Research Development Corporation Of Japan | Method for molecular indexing categorising of expressed genes using restriction enzymes |
| US5889136A (en) | 1995-06-09 | 1999-03-30 | The Regents Of The University Of Colorado | Orthoester protecting groups in RNA synthesis |
| US6265389B1 (en) | 1995-08-31 | 2001-07-24 | Alkermes Controlled Therapeutics, Inc. | Microencapsulation and sustained release of oligonucleotides |
| US6555525B2 (en) | 1995-08-31 | 2003-04-29 | Alkermes Controlled Therapeutics, Inc. | Microencapsulation and sustained release of oligonucleotides |
| WO1997030064A1 (en) | 1996-02-16 | 1997-08-21 | Stichting Rega Vzw | Hexitol containing oligonucleotides and their use in antisense strategies |
| US6234990B1 (en) | 1996-06-28 | 2001-05-22 | Sontra Medical, Inc. | Ultrasound enhancement of transdermal transport |
| US6491657B2 (en) | 1996-06-28 | 2002-12-10 | Sontra Medical, Inc. | Ultrasound enhancement of transdermal transport |
| US8404222B2 (en) | 1996-09-26 | 2013-03-26 | Nektar Therapeutics | Soluble, degradable poly(ethylene glycol) derivatives for controllable release of bound molecules into solution |
| US6258558B1 (en) | 1997-01-21 | 2001-07-10 | The General Hospital Corporation | Method for selection of proteins using RNA-protein fusions |
| US6576752B1 (en) | 1997-02-14 | 2003-06-10 | Isis Pharmaceuticals, Inc. | Aminooxy functionalized oligomers |
| US6268490B1 (en) | 1997-03-07 | 2001-07-31 | Takeshi Imanishi | Bicyclonucleoside and oligonucleotide analogues |
| US20100036115A1 (en) | 1997-07-23 | 2010-02-11 | Sirna Therapeutics, Inc. | Novel Compositions for the Delivery of Negatively Charged Molecules |
| US6670461B1 (en) | 1997-09-12 | 2003-12-30 | Exiqon A/S | Oligonucleotide analogues |
| US6794499B2 (en) | 1997-09-12 | 2004-09-21 | Exiqon A/S | Oligonucleotide analogues |
| US6004573A (en) | 1997-10-03 | 1999-12-21 | Macromed, Inc. | Biodegradable low molecular weight triblock poly(lactide-co-glycolide) polyethylene glycol copolymers having reverse thermal gelation properties |
| US6517869B1 (en) | 1997-12-12 | 2003-02-11 | Expression Genetics, Inc. | Positively charged poly(alpha-(omega-aminoalkyl)lycolic acid) for the delivery of a bioactive agent via tissue and cellular uptake |
| US6267987B1 (en) | 1997-12-12 | 2001-07-31 | Samyang Corporation | Positively charged poly[alpha-(omega-aminoalkyl) glycolic acid] for the delivery of a bioactive agent via tissue and cellular uptake |
| US6320017B1 (en) | 1997-12-23 | 2001-11-20 | Inex Pharmaceuticals Corp. | Polyamide oligomers |
| US7374778B2 (en) | 1998-01-05 | 2008-05-20 | University Of Washington | Enhanced transport using membrane disruptive agents |
| US8003129B2 (en) | 1998-01-05 | 2011-08-23 | University Of Washington | Enhanced transport using membrane disruptive agents |
| US6835393B2 (en) | 1998-01-05 | 2004-12-28 | University Of Washington | Enhanced transport using membrane disruptive agents |
| US8497357B2 (en) | 1998-01-07 | 2013-07-30 | Nektar Therapeutics | Degradable heterobifunctional poly(ethylene glycol) acrylates and gels and conjugates derived therefrom |
| US20040236268A1 (en) | 1998-01-08 | 2004-11-25 | Sontra Medical, Inc. | Method and apparatus for enhancement of transdermal transport |
| US6190315B1 (en) | 1998-01-08 | 2001-02-20 | Sontra Medical, Inc. | Sonophoretic enhanced transdermal transport |
| US6426086B1 (en) | 1998-02-03 | 2002-07-30 | The Regents Of The University Of California | pH-sensitive, serum-stable liposomes |
| US8367328B2 (en) | 1998-04-23 | 2013-02-05 | Takara Bio Inc. | Method for synthesizing DNA |
| US6177274B1 (en) | 1998-05-20 | 2001-01-23 | Expression Genetics, Inc. | Hepatocyte targeting polyethylene glyco-grafted poly-L-lysine polymeric gene carrier |
| US20130184453A1 (en) | 1998-07-01 | 2013-07-18 | California Institute Of Technology | Linear cyclodextrin copolymers |
| US6217912B1 (en) | 1998-07-13 | 2001-04-17 | Expression Genetics, Inc. | Polyester analogue of poly-L-lysine as a soluble, biodegradable gene delivery carrier |
| US8309706B2 (en) | 1998-08-03 | 2012-11-13 | Agilent Technologies, Inc. | Methods of synthesizing oligonucleotides using carbonate protecting groups and alpha-effect nucleophile deprotection |
| US20040171980A1 (en) | 1998-12-18 | 2004-09-02 | Sontra Medical, Inc. | Method and apparatus for enhancement of transdermal transport |
| US7385034B2 (en) | 1998-12-22 | 2008-06-10 | Serono Genetics Institute S.A. | Complementary DNAs encoding proteins with signal peptides |
| US6525183B2 (en) | 1999-02-22 | 2003-02-25 | Pe Corporation (Ny) | Multiple-labelled oligonucleotides synthesized on solid-supports |
| US6835827B2 (en) | 1999-02-22 | 2004-12-28 | Applera Corporation | Labelled oligonucleotides synthesized on solid-supports |
| US20030191303A1 (en) | 1999-02-22 | 2003-10-09 | Applera Corporation | Labelled oligonucleotides synthesized on solid-supports |
| WO2000050032A1 (en) | 1999-02-25 | 2000-08-31 | Pharmacia & Upjohn S.P.A. | Antitumour synergistic composition |
| US20130195898A1 (en) | 1999-02-26 | 2013-08-01 | Novartis Vaccines And Diagnostics, Inc. | Microemulsions with adsorbed macromolecules and microparticles |
| US8309139B2 (en) | 1999-02-26 | 2012-11-13 | Novartis Vaccines And Diagnostics, Inc. | Microemulsions with adsorbed macromolecules and microparticles |
| US20130195923A1 (en) | 1999-02-26 | 2013-08-01 | Novartis Vaccines And Diagnostics, Inc. | Microemulsions with adsorbed macromolecules and microparticles |
| US8206749B1 (en) | 1999-02-26 | 2012-06-26 | Novartis Vaccines And Diagnostics, Inc. | Microemulsions with adsorbed macromolecules and microparticles |
| US20100255574A1 (en) | 1999-03-12 | 2010-10-07 | Human Genome Sciences, Inc. | Human Secreted Proteins |
| US7084125B2 (en) | 1999-03-18 | 2006-08-01 | Exiqon A/S | Xylo-LNA analogues |
| US7053207B2 (en) | 1999-05-04 | 2006-05-30 | Exiqon A/S | L-ribo-LNA analogues |
| US7138382B2 (en) | 1999-06-07 | 2006-11-21 | Mirus Bio Corporation | Compositions and methods for drug delivery using pH sensitive molecules |
| US7413875B2 (en) | 1999-08-05 | 2008-08-19 | Serono Genetics Institute S.A. | ESTs and encoded human proteins |
| US20010014753A1 (en) | 1999-12-20 | 2001-08-16 | Soloveichik Grigorii Lev | Catalyst composition and method for producing diaryl carbonates, using bisphosphines |
| US7737108B1 (en) | 2000-01-07 | 2010-06-15 | University Of Washington | Enhanced transport using membrane disruptive agents |
| US8454946B2 (en) | 2000-02-22 | 2013-06-04 | Nektar Therapeutics | N-maleimidyl polymer derivatives |
| US6368801B1 (en) | 2000-04-12 | 2002-04-09 | Molecular Staging, Inc. | Detection and amplification of RNA using target-mediated ligation of DNA by RNA ligase |
| US20030073619A1 (en) | 2000-09-14 | 2003-04-17 | Mahato Ram I. | Novel cationic lipopolymer as biocompatible gene delivery agent |
| US6696038B1 (en) | 2000-09-14 | 2004-02-24 | Expression Genetics, Inc. | Cationic lipopolymer as biocompatible gene delivery agent |
| US20040142474A1 (en) | 2000-09-14 | 2004-07-22 | Expression Genetics, Inc. | Novel cationic lipopolymer as a biocompatible gene delivery agent |
| US6998484B2 (en) | 2000-10-04 | 2006-02-14 | Santaris Pharma A/S | Synthesis of purine locked nucleic acid analogues |
| US8287849B2 (en) | 2000-10-10 | 2012-10-16 | Massachusetts Institute Of Technology | Biodegradable poly(beta-amino esters) and uses thereof |
| US20120228565A1 (en) | 2000-10-13 | 2012-09-13 | Life Technologies Corporation | Method for preparing surface-modified semiconductive and metallic nanoparticles having enhanced dispersibility in aqueous media |
| US8440614B2 (en) | 2000-12-29 | 2013-05-14 | Aphios Corporation | Polymer microspheres/nanospheres and encapsulating therapeutic proteins therein |
| US7098032B2 (en) | 2001-01-02 | 2006-08-29 | Mirus Bio Corporation | Compositions and methods for drug delivery using pH sensitive molecules |
| US6897196B1 (en) | 2001-02-07 | 2005-05-24 | The Regents Of The University Of California | pH sensitive lipids based on ortho ester linkers, composition and method |
| US6652886B2 (en) | 2001-02-16 | 2003-11-25 | Expression Genetics | Biodegradable cationic copolymers of poly (alkylenimine) and poly (ethylene glycol) for the delivery of bioactive agents |
| US7833992B2 (en) | 2001-05-18 | 2010-11-16 | Merck Sharpe & Dohme | Conjugates and compositions for cellular delivery |
| US7964578B2 (en) | 2001-05-18 | 2011-06-21 | Sirna Therapeutics, Inc. | Conjugates and compositions for cellular delivery |
| US8137911B2 (en) | 2001-05-22 | 2012-03-20 | Cellscript, Inc. | Preparation and use of single-stranded transcription substrates for synthesis of transcription products corresponding to target sequences |
| EP1392341A2 (de) | 2001-06-05 | 2004-03-03 | Curevac GmbH | Stabilisierte mrna mit erhöhtem g/c-gehalt und optimierter codon usage für die gentherapie |
| US20100239608A1 (en) | 2001-06-05 | 2010-09-23 | Curevac Gmbh | PHARMACEUTICAL COMPOSITION CONTAINING A STABILISED mRNA OPTIMISED FOR TRANSLATION IN ITS CODING REGIONS |
| WO2002098443A2 (de) | 2001-06-05 | 2002-12-12 | Curevac Gmbh | Stabilisierte mrna mit erhöhtem g/ c- gehalt und otimierter codon usage für die gentherapie |
| US20050032730A1 (en) | 2001-06-05 | 2005-02-10 | Florian Von Der Mulbe | Pharmaceutical composition containing a stabilised mRNA optimised for translation in its coding regions |
| US20110077287A1 (en) | 2001-06-05 | 2011-03-31 | Curevac Gmbh | Pharmaceutical composition containing a stabilised mrna optimised for translation in its coding regions |
| US20110269950A1 (en) | 2001-06-05 | 2011-11-03 | Curevac Gmbh | PHARMACEUTICAL COMPOSITION CONTAINING A STABILISED mRNA OPTIMISED FOR TRANSLATION IN ITS CODING REGIONS |
| US6586524B2 (en) | 2001-07-19 | 2003-07-01 | Expression Genetics, Inc. | Cellular targeting poly(ethylene glycol)-grafted polymeric gene carrier |
| US20040262223A1 (en) | 2001-07-27 | 2004-12-30 | President And Fellows Of Harvard College | Laminar mixing apparatus and methods |
| US20050059005A1 (en) | 2001-09-28 | 2005-03-17 | Thomas Tuschl | Microrna molecules |
| US20120282343A1 (en) | 2001-10-03 | 2012-11-08 | Johns Hopkins University | Compositions for oral gene therapy and methods of using same |
| US7384739B2 (en) | 2001-11-14 | 2008-06-10 | Toyo Boseki Kabushiki Kaisha | Compositions for enhancing DNA synthesis, DNA polymerase-related factors and utilization thereof |
| US7378262B2 (en) | 2001-12-03 | 2008-05-27 | Roche Molecular Systems, Inc. | Reversibly modified thermostable enzymes for DNA synthesis and amplification in vitro |
| US20050059624A1 (en) | 2001-12-19 | 2005-03-17 | Ingmar Hoerr | Application of mRNA for use as a therapeutic against tumour diseases |
| WO2003051401A2 (de) | 2001-12-19 | 2003-06-26 | Curevac Gmbh | Stabilisierte mrna tumor-vakzine |
| EP1458410A2 (de) | 2001-12-19 | 2004-09-22 | Curevac GmbH | Stabilisierte mrna tumor-vakzine |
| US20110311472A1 (en) | 2001-12-19 | 2011-12-22 | Curevac Gmbh | Application of mrna for use as a therapeutic against tumour diseases |
| US8257745B2 (en) | 2001-12-21 | 2012-09-04 | Novartis Ag | Use of synthetic inorganic nanoparticles as carriers for ophthalmic and otic drugs |
| US20050222064A1 (en) | 2002-02-20 | 2005-10-06 | Sirna Therapeutics, Inc. | Polycationic compositions for cellular delivery of polynucleotides |
| US8460709B2 (en) | 2002-03-13 | 2013-06-11 | Novartis Ag | Pharmaceutical microparticles |
| US7074596B2 (en) | 2002-03-25 | 2006-07-11 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Synthesis and use of anti-reverse mRNA cap analogues |
| US7476709B2 (en) | 2002-04-26 | 2009-01-13 | Avecia Biotechnology Inc. | Process for preparing oligonucleotides |
| US20120201859A1 (en) | 2002-05-02 | 2012-08-09 | Carrasquillo Karen G | Drug Delivery Systems and Use Thereof |
| US20090227660A1 (en) | 2002-05-21 | 2009-09-10 | Seungjoon Oh | GLP-1 gene delivery for the treatment of type 2 diabetes |
| US7374930B2 (en) | 2002-05-21 | 2008-05-20 | Expression Genetics, Inc. | GLP-1 gene delivery for the treatment of type 2 diabetes |
| US6653468B1 (en) | 2002-07-31 | 2003-11-25 | Isis Pharmaceuticals, Inc. | Universal support media for synthesis of oligomeric compounds |
| US8304532B2 (en) | 2002-07-31 | 2012-11-06 | Girindus Ag | Method for preparing oligonucleotides |
| US20130156721A1 (en) | 2002-09-06 | 2013-06-20 | Cerulean Pharma Inc. | Cyclodextrin-based polymers for therapeutics delivery |
| US7667033B2 (en) | 2002-09-27 | 2010-02-23 | Syngen, Inc. | Compositions and methods for the use of FMOC derivatives in DNA/RNA synthesis |
| WO2004041203A2 (en) | 2002-11-04 | 2004-05-21 | Xenoport, Inc. | Gemcitabine prodrugs, pharmaceutical compositions and uses thereof |
| US20120156679A1 (en) | 2002-11-21 | 2012-06-21 | Epicentre Technologies | Methods for making transcription products |
| US8461132B2 (en) | 2003-05-05 | 2013-06-11 | Ben Gurion University Of The Negev Research And Development Authority | Injectable cross-linked polymeric preparations and uses thereof |
| WO2005005622A2 (en) | 2003-07-09 | 2005-01-20 | Ribostem Limited | Method of altering cell properties by administering rna |
| US8241610B2 (en) | 2003-07-09 | 2012-08-14 | Statens Serum Institut | Adjuvant combinations of liposomes and mycobacterial lipids for immunization compositions and vaccines |
| US8524368B2 (en) | 2003-07-09 | 2013-09-03 | Wisconsin Alumni Research Foundation | Charge-dynamic polymers and delivery of anionic compounds |
| EP1646714A2 (en) | 2003-07-09 | 2006-04-19 | Ribostem Limited | Method of altering cell properties by administering rna |
| US20060247195A1 (en) | 2003-07-09 | 2006-11-02 | Ribostem Limited | Method of altering cell properties by administering rna |
| US20130177587A1 (en) | 2003-07-11 | 2013-07-11 | Novavax, Inc. | Functional influenza virus-like particles (vlps) |
| US8506967B2 (en) | 2003-07-11 | 2013-08-13 | Novavax, Inc. | Functional influenza virus like particles (VLPs) |
| US20050261218A1 (en) | 2003-07-31 | 2005-11-24 | Christine Esau | Oligomeric compounds and compositions for use in modulation small non-coding RNAs |
| US20050130201A1 (en) | 2003-10-14 | 2005-06-16 | Dharmacon, Inc. | Splint-assisted enzymatic synthesis of polyribounucleotides |
| US8236280B2 (en) | 2003-12-19 | 2012-08-07 | University Of Cincinnati | Polyamides for nucleic acid delivery |
| US20120270927A1 (en) | 2003-12-19 | 2012-10-25 | Reineke Theresa M | Polyamides For Nucleic Acid Delivery |
| US20080166414A1 (en) | 2004-01-28 | 2008-07-10 | Johns Hopkins University | Drugs And Gene Carrier Particles That Rapidly Move Through Mucous Barriers |
| US8241670B2 (en) | 2004-04-15 | 2012-08-14 | Chiasma Inc. | Compositions capable of facilitating penetration across a biological barrier |
| US20080119645A1 (en) | 2004-05-05 | 2008-05-22 | Isis Pharmaceuticals, Inc. | Amidites and Methods of Rna Synthesis |
| US20130177611A1 (en) | 2004-06-11 | 2013-07-11 | Eidgenossisches Technische Hochschule (The Swiss Federal Institute of Technology) | Silk-based drug delivery system |
| US8124379B2 (en) | 2004-06-14 | 2012-02-28 | Novozymes A/S | Signal peptide for producing a polypeptide |
| US20120009145A1 (en) | 2004-11-03 | 2012-01-12 | Gregory Slobodkin | Biodegradable Cross-Linked Cationic Multi-block Copolymers for Gene Delivery and Methods of Making Thereof |
| US8057821B2 (en) | 2004-11-03 | 2011-11-15 | Egen, Inc. | Biodegradable cross-linked cationic multi-block copolymers for gene delivery and methods of making thereof |
| US20080261905A1 (en) | 2004-11-08 | 2008-10-23 | K.U. Leuven Research And Development | Modified Nucleosides for Rna Interference |
| US7964571B2 (en) | 2004-12-09 | 2011-06-21 | Egen, Inc. | Combination of immuno gene therapy and chemotherapy for treatment of cancer and hyperproliferative diseases |
| US20110218231A1 (en) | 2004-12-09 | 2011-09-08 | Egen, Inc. | Combination of Immuno Gene Therapy and Chemotherapy for Treatment of Cancer and Hyperproliferative Diseases |
| US20100003337A1 (en) | 2004-12-10 | 2010-01-07 | Justin Hanes | Functionalized poly(ether-anhydride) block copolymers |
| WO2006063249A2 (en) | 2004-12-10 | 2006-06-15 | Justin Hanes | Functionalized poly (ether-anhydride) block copolymers |
| US20120207845A1 (en) | 2005-01-04 | 2012-08-16 | Hsing-Wen Sung | Pharmaceutical composition of nanoparticles |
| US20120258176A1 (en) | 2005-01-04 | 2012-10-11 | Hsing-Wen Sung | Nanoparticles for protein drug delivery |
| US7404969B2 (en) | 2005-02-14 | 2008-07-29 | Sirna Therapeutics, Inc. | Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules |
| US7893302B2 (en) | 2005-02-14 | 2011-02-22 | Sirna Therapeutics, Inc. | Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules |
| US8415325B2 (en) | 2005-03-31 | 2013-04-09 | University Of Delaware | Cell-mediated delivery and targeted erosion of noncovalently crosslinked hydrogels |
| US8263665B2 (en) | 2005-04-01 | 2012-09-11 | Intezyne Technologies, Inc. | Polymeric micelles for drug delivery |
| US20130195987A1 (en) | 2005-04-01 | 2013-08-01 | Intezyne Technologies, Inc. | Polymeric micelles for drug delivery |
| US20130059360A1 (en) | 2005-04-12 | 2013-03-07 | Nektar Therapeutics | Polymer-based compositions and conjugates of antimicrobial agents |
| US8246995B2 (en) | 2005-05-10 | 2012-08-21 | The Board Of Trustees Of The Leland Stanford Junior University | Hydrophobic nanotubes and nanoparticles as transporters for the delivery of drugs into cells |
| US20080267873A1 (en) | 2005-05-19 | 2008-10-30 | Curevac Gmbh | Injection Solution for Rna |
| WO2006122828A2 (de) | 2005-05-19 | 2006-11-23 | Curevac Gmbh | Optimierte injektionsformulierung für mrna |
| US7550264B2 (en) | 2005-06-10 | 2009-06-23 | Datascope Investment Corporation | Methods and kits for sense RNA synthesis |
| US20130184443A1 (en) | 2005-06-16 | 2013-07-18 | Nektar Therapeutics | Methods for Preparing Conjugates |
| WO2007024323A2 (en) | 2005-06-17 | 2007-03-01 | The University Of North Carolina At Chapel Hill | Nanoparticle fabrication methods, systems, and materials |
| US20100120024A1 (en) | 2005-06-30 | 2010-05-13 | Sharon Cload | Materials and methods for the generation of transcripts comprising modified nucleotides |
| US20070117112A1 (en) | 2005-06-30 | 2007-05-24 | Diener John L | Materials and methods for the generation of fully 2'-modified nucleic acid transcripts |
| US8101385B2 (en) | 2005-06-30 | 2012-01-24 | Archemix Corp. | Materials and methods for the generation of transcripts comprising modified nucleotides |
| US8217147B2 (en) | 2005-08-10 | 2012-07-10 | Macrogenics, Inc. | Identification and engineering of antibodies with variant Fc regions and methods of using same |
| US20090286852A1 (en) | 2005-08-23 | 2009-11-19 | Katalin Kariko | RNA containing modified nucleosides and methods of use thereof |
| WO2007024708A2 (en) | 2005-08-23 | 2007-03-01 | The Trustees Of The University Of Pennsylvania | Rna containing modified nucleosides and methods of use thereof |
| US20110143397A1 (en) | 2005-08-23 | 2011-06-16 | Katalin Kariko | Rna preparations comprising purified modified rna for reprogramming cells |
| US8444992B2 (en) | 2005-09-01 | 2013-05-21 | Novartis Vaccines And Diagnostics Gmbh | Multiple vaccination including serogroup C meningococcus |
| US8420605B2 (en) | 2005-09-07 | 2013-04-16 | The University Of Strathclyde | Hydrogel compositions |
| DE102005046490A1 (de) | 2005-09-28 | 2007-03-29 | Johannes-Gutenberg-Universität Mainz | Modifikationen von RNA, die zu einer erhöhten Transkriptstabilität und Translationseffizienz führen |
| WO2007036366A2 (de) | 2005-09-28 | 2007-04-05 | Johannes Gutenberg-Universität Mainz, Vertreten Durch Den Präsidenten | Modifikationen von rna, die zu einer erhöhten transkriptstabilität und translationseffizienz führen |
| US20100129877A1 (en) | 2005-09-28 | 2010-05-27 | Ugur Sahin | Modification of RNA, Producing an Increased Transcript Stability and Translation Efficiency |
| EP1934345A2 (de) | 2005-09-28 | 2008-06-25 | Johannes Gutenberg-Universität Mainz, vertreten durch den Präsidenten | Modifikationen von rna, die zu einer erhöhten transkriptstabilität und translationseffizienz führen |
| US20090170090A1 (en) | 2005-11-18 | 2009-07-02 | Bioline Limited | Method for Enhancing Enzymatic DNA Polymerase Reactions |
| US7994304B2 (en) | 2005-11-22 | 2011-08-09 | Helicos Biosciences Corporation | Methods and compositions for sequencing a nucleic acid |
| US20070141030A1 (en) | 2005-12-02 | 2007-06-21 | Yi-Tao Yu | Targeted pre-mRNA/mRNA modification and gene regulation |
| WO2007064952A2 (en) | 2005-12-02 | 2007-06-07 | University Of Rochester | TARGETED PRE-mRNA/mRNA MODIFICATION AND GENE REGULATION |
| US20130137644A1 (en) | 2005-12-16 | 2013-05-30 | Cellectis | Cell penetrating peptide conjugates for delivering of nucleic acids into a cell |
| US20120269761A1 (en) | 2006-01-12 | 2012-10-25 | Massachusetts Institute Of Technology | Biodegradable elastomers |
| US7399845B2 (en) | 2006-01-27 | 2008-07-15 | Isis Pharmaceuticals, Inc. | 6-modified bicyclic nucleic acid analogs |
| US20130129726A1 (en) | 2006-02-20 | 2013-05-23 | Kyunglim Lee | Peptide having cell membrane penetrating activity |
| US20130072709A1 (en) | 2006-02-21 | 2013-03-21 | Nektar Therapeutics | Segmented Degradable Polymers and Conjugates Made Therefrom |
| US8257685B2 (en) | 2006-04-04 | 2012-09-04 | Stc.Unm | Swellable particles for drug delivery |
| US8440231B2 (en) | 2006-04-04 | 2013-05-14 | Stc.Unm | Swellable particles for drug delivery |
| US20130130348A1 (en) | 2006-05-15 | 2013-05-23 | The Brigham And Women's Hospital, Inc. | Polymers for Functional Particles |
| US8501478B2 (en) | 2006-06-15 | 2013-08-06 | University Of Cincinnati | Trehalose click polymers for delivery of biologically active molecules |
| US20130172600A1 (en) | 2006-07-12 | 2013-07-04 | Novartis Ag | Novel Polymers |
| US20130164343A1 (en) | 2006-09-08 | 2013-06-27 | The Johns Hopkins University | Compositions and methods for enhancing transport through mucus |
| US20100215580A1 (en) | 2006-09-08 | 2010-08-26 | The Johns Hopkins University | Compositions and methods for enhancing transport through mucus |
| US20100009865A1 (en) | 2006-09-29 | 2010-01-14 | Katholieke Universiteit Leuven | Oligonucleotide arrays |
| EP2073848B1 (en) | 2006-10-05 | 2013-08-28 | The Johns Hopkins University | Water-dispersible oral, parenteral, and topical formulations for poorly water soluble drugs using smart polymeric nanoparticles |
| US8313777B2 (en) | 2006-10-05 | 2012-11-20 | The Johns Hopkins University | Water-dispersible oral, parenteral, and topical formulations for poorly water soluble drugs using smart polymeric nanoparticles |
| US20100047261A1 (en) | 2006-10-31 | 2010-02-25 | Curevac Gmbh | Base-modified rna for increasing the expression of a protein |
| WO2008052770A2 (en) | 2006-10-31 | 2008-05-08 | Curevac Gmbh | (base-)modified rna for increasing the expression of a protein |
| US8414927B2 (en) | 2006-11-03 | 2013-04-09 | Boston Scientific Scimed, Inc. | Cross-linked polymer particles |
| US7999087B2 (en) | 2006-11-15 | 2011-08-16 | Agilent Technologies, Inc. | 2′-silyl containing thiocarbonate protecting groups for RNA synthesis |
| US8242258B2 (en) | 2006-12-03 | 2012-08-14 | Agilent Technologies, Inc. | Protecting groups for RNA synthesis |
| US8399007B2 (en) | 2006-12-05 | 2013-03-19 | Landec Corporation | Method for formulating a controlled-release pharmaceutical formulation |
| US8524259B2 (en) | 2006-12-05 | 2013-09-03 | Landec Corporation | Systems and methods for delivery of materials |
| US20100028943A1 (en) | 2006-12-21 | 2010-02-04 | Novozymes, Inc. | Modified Messenger RNA Stabilizing Sequences for Expressing Genes in Bacterial Cells |
| US20130150295A1 (en) | 2006-12-21 | 2013-06-13 | Stryker Corporation | Sustained-Release Formulations Comprising Crystals, Macromolecular Gels, and Particulate Suspensions of Biologic Agents |
| WO2008140615A2 (en) | 2006-12-21 | 2008-11-20 | Novozymes, Inc. | Modified messenger rna stabilizing sequences for expressing genes in bacterial cells |
| EP2104739A2 (en) | 2006-12-21 | 2009-09-30 | Novozymes Inc. | Modified messenger rna stabilizing sequences for expressing genes in bacterial cells |
| WO2008078180A2 (en) | 2006-12-22 | 2008-07-03 | Archemix Corp. | Materials and methods for the generation of transcripts comprising modified nucleotides |
| US8507653B2 (en) | 2006-12-27 | 2013-08-13 | Nektar Therapeutics | Factor IX moiety-polymer conjugates having a releasable linkage |
| US20100189729A1 (en) | 2007-01-09 | 2010-07-29 | Curvac Gmbh | Rna-coded antibody |
| WO2008083949A2 (en) | 2007-01-09 | 2008-07-17 | Curevac Gmbh | Rna-coded antibody |
| WO2008103276A2 (en) | 2007-02-16 | 2008-08-28 | Merck & Co., Inc. | Compositions and methods for potentiated activity of biologicaly active molecules |
| US8496945B2 (en) | 2007-03-05 | 2013-07-30 | Washington University | Nanoparticle delivery systems for membrane-integrating peptides |
| US20130216612A1 (en) | 2007-03-23 | 2013-08-22 | Bbb Holding B.V. | Targeted intracellular delivery of antiviral agents |
| US8246968B2 (en) | 2007-03-30 | 2012-08-21 | Bind Biosciences, Inc. | Cancer cell targeting using nanoparticles |
| WO2008121949A1 (en) | 2007-03-30 | 2008-10-09 | Bind Biosciences, Inc. | Cancer cell targeting using nanoparticles |
| US20080275468A1 (en) | 2007-04-27 | 2008-11-06 | Echo Therapeutics, Inc. | Skin permeation device for analyte sensing or transdermal drug delivery |
| US8501824B2 (en) | 2007-05-04 | 2013-08-06 | Marina Biotech, Inc. | Amino acid lipids and uses thereof |
| US8202983B2 (en) | 2007-05-10 | 2012-06-19 | Agilent Technologies, Inc. | Thiocarbon-protecting groups for RNA synthesis |
| WO2008157668A2 (en) | 2007-06-21 | 2008-12-24 | American Power Conversion Corporation | Method and system for determining physical location of network equipment |
| US20120009649A1 (en) | 2007-06-29 | 2012-01-12 | Cellscript, Inc. | Synthesis of tagged nucleic acids |
| US8039214B2 (en) | 2007-06-29 | 2011-10-18 | Cellscript, Inc. | Synthesis of tagged nucleic acids |
| US20090042825A1 (en) | 2007-08-06 | 2009-02-12 | Majed Matar | Composition, method of preparation & application of concentrated formulations of condensed nucleic acids with a cationic lipopolymer |
| US20130065942A1 (en) | 2007-08-06 | 2013-03-14 | Egen, Inc. | Nucleic Acid-Lipopolymer Compositions |
| US20090042829A1 (en) | 2007-08-06 | 2009-02-12 | Majed Matar | Nucleic Acid-Lipopolymer Compositions |
| US20100293625A1 (en) | 2007-09-26 | 2010-11-18 | Interexon Corporation | Synthetic 5'UTRs, Expression Vectors, and Methods for Increasing Transgene Expression |
| US8236330B2 (en) | 2007-09-28 | 2012-08-07 | Bind Biosciences, Inc. | Cancer cell targeting using nanoparticles |
| US20130172406A1 (en) | 2007-09-28 | 2013-07-04 | Bind Biosciences, Inc. | Cancer Cell Targeting Using Nanoparticles |
| US8273363B2 (en) | 2007-09-28 | 2012-09-25 | Bind Biosciences, Inc. | Cancer cell targeting using nanoparticles |
| US20120004293A1 (en) | 2007-09-28 | 2012-01-05 | Zale Stephen E | Cancer Cell Targeting Using Nanoparticles |
| US20130189241A1 (en) | 2007-12-10 | 2013-07-25 | The Trustees Of The University Of Pennsylvania | Regulated delivery systems for inner ear drug application and uses thereof |
| US20090226470A1 (en) | 2007-12-11 | 2009-09-10 | Mauro Vincent P | Compositions and methods related to mRNA translational enhancer elements |
| WO2009077134A2 (en) | 2007-12-14 | 2009-06-25 | Johannes Gutenberg-Universität Mainz | Use of rna for reprogramming somatic cells |
| US20110065103A1 (en) | 2007-12-14 | 2011-03-17 | Ugur Sahin | Use of rna for reprogramming somatic cells |
| EP2240572A2 (en) | 2007-12-14 | 2010-10-20 | BioNTech AG | Use of rna for reprogramming somatic cells |
| US20100004313A1 (en) | 2008-02-29 | 2010-01-07 | Tbd | Modified Poloxamers for Gene Expression and Associated Methods |
| US20100004315A1 (en) | 2008-03-14 | 2010-01-07 | Gregory Slobodkin | Biodegradable Cross-Linked Branched Poly(Alkylene Imines) |
| US8492359B2 (en) | 2008-04-15 | 2013-07-23 | Protiva Biotherapeutics, Inc. | Lipid formulations for nucleic acid delivery |
| WO2009127230A1 (en) | 2008-04-16 | 2009-10-22 | Curevac Gmbh | MODIFIED (m)RNA FOR SUPPRESSING OR AVOIDING AN IMMUNOSTIMULATORY RESPONSE AND IMMUNOSUPPRESSIVE COMPOSITION |
| US20110275793A1 (en) | 2008-05-29 | 2011-11-10 | Debart Francoise | Chemical RNA Synthesis Method |
| WO2009149253A2 (en) | 2008-06-06 | 2009-12-10 | Uniwersytet Warszawski | Mrna cap analogs |
| US20110274759A1 (en) | 2008-06-16 | 2011-11-10 | Greg Troiano | Drug Loaded Polymeric Nanoparticles and Methods of Making and Using Same |
| US20100068285A1 (en) | 2008-06-16 | 2010-03-18 | Zale Stephen E | Drug Loaded Polymeric Nanoparticles and Methods of Making and Using Same |
| WO2010005725A2 (en) | 2008-06-16 | 2010-01-14 | Bind Biosciences, Inc. | Therapeutic polymeric nanoparticles comprising vinca alkaloids and methods of making and using same |
| WO2010005721A2 (en) | 2008-06-16 | 2010-01-14 | Bind Biosciences, Inc. | Drug loaded polymeric nanoparticles and methods of making and using same |
| US20120288541A1 (en) | 2008-06-16 | 2012-11-15 | Zale Stephen E | Drug Loaded Polymeric Nanoparticles and Methods of Making and Using Same |
| US20130230567A1 (en) | 2008-06-16 | 2013-09-05 | Bind Therapeutics, Inc. | Drug Loaded Polymeric Nanoparticles and Methods of Making and Using Same |
| US20100104655A1 (en) | 2008-06-16 | 2010-04-29 | Zale Stephen E | Therapeutic Polymeric Nanoparticles Comprising Vinca Alkaloids and Methods of Making and Using Same |
| WO2010005740A2 (en) | 2008-06-16 | 2010-01-14 | Bind Biosciences, Inc. | Methods for the preparation of targeting agent functionalized diblock copolymers for use in fabrication of therapeutic targeted nanoparticles |
| US8318208B1 (en) | 2008-06-16 | 2012-11-27 | Bind Biosciences, Inc. | Drug loaded polymeric nanoparticles and methods of making and using same |
| US20100068286A1 (en) | 2008-06-16 | 2010-03-18 | Greg Troiano | Drug Loaded Polymeric Nanoparticles and Methods of Making and Using Same |
| US8293276B2 (en) | 2008-06-16 | 2012-10-23 | Bind Biosciences, Inc. | Drug loaded polymeric nanoparticles and methods of making and using same |
| WO2010005726A2 (en) | 2008-06-16 | 2010-01-14 | Bind Biosciences Inc. | Therapeutic polymeric nanoparticles with mtor inhibitors and methods of making and using same |
| WO2010005723A2 (en) | 2008-06-16 | 2010-01-14 | Bind Biosciences, Inc. | Drug loaded polymeric nanoparticles and methods of making and using same |
| US8420123B2 (en) | 2008-06-16 | 2013-04-16 | Bind Biosciences, Inc. | Drug loaded polymeric nanoparticles and methods of making and using same |
| US8318211B2 (en) | 2008-06-16 | 2012-11-27 | Bind Biosciences, Inc. | Therapeutic polymeric nanoparticles comprising vinca alkaloids and methods of making and using same |
| US8206747B2 (en) | 2008-06-16 | 2012-06-26 | Bind Biosciences, Inc. | Drug loaded polymeric nanoparticles and methods of making and using same |
| US20100104645A1 (en) | 2008-06-16 | 2010-04-29 | Bind Biosciences, Inc. | Methods for the preparation of targeting agent functionalized diblock copolymers for use in fabrication of therapeutic targeted nanoparticles |
| US20100069426A1 (en) | 2008-06-16 | 2010-03-18 | Zale Stephen E | Therapeutic polymeric nanoparticles with mTor inhibitors and methods of making and using same |
| US20100009424A1 (en) | 2008-07-14 | 2010-01-14 | Natasha Forde | Sonoporation systems and methods |
| WO2010021865A1 (en) | 2008-08-18 | 2010-02-25 | Merck Sharp & Dohme Corp. | Novel lipid nanoparticles and novel components for delivery of nucleic acids |
| US8309707B2 (en) | 2008-09-06 | 2012-11-13 | Chemgenes Corporation | RNA synthesis-phosphoramidites for synthetic RNA in the reverse direction, and application in convenient introduction of ligands, chromophores and modifications of synthetic RNA at the 3′-end |
| US20130072670A1 (en) | 2008-09-06 | 2013-03-21 | Chemgenes Corporation | Rna synthesis-phosphoramidites for synthetic rna in the reverse direction, and application in convenient introduction of ligands, chromophores and modifications of synthetic rna at the 3'-end |
| US20100087337A1 (en) | 2008-09-10 | 2010-04-08 | Bind Biosciences, Inc. | High Throughput Fabrication of Nanoparticles |
| WO2010030763A2 (en) | 2008-09-10 | 2010-03-18 | Bind Biosciences, Inc. | High throughput fabrication of nanoparticles |
| US20130123351A1 (en) | 2008-09-10 | 2013-05-16 | Bind Biosciences, Inc. | High throughput fabrication of nanoparticles |
| US20100075072A1 (en) | 2008-09-25 | 2010-03-25 | Tsung-Wei Chen | Decorative structure of tree-shaped bells |
| US20120015899A1 (en) | 2008-10-25 | 2012-01-19 | Plant Bioscience, Limited | Modified plant virus particles and uses therefor |
| WO2010047839A1 (en) | 2008-10-25 | 2010-04-29 | Aura Biosciences | Modified plant virus particles and uses therefor |
| US8450298B2 (en) | 2008-11-07 | 2013-05-28 | Massachusetts Institute Of Technology | Aminoalcohol lipidoids and uses thereof |
| US20110217377A1 (en) | 2008-12-15 | 2011-09-08 | Zale Stephen E | Long Circulating Nanoparticles for Sustained Release of Therapeutic Agents |
| US20100216804A1 (en) | 2008-12-15 | 2010-08-26 | Zale Stephen E | Long Circulating Nanoparticles for Sustained Release of Therapeutic Agents |
| WO2010080724A1 (en) | 2009-01-12 | 2010-07-15 | Merck Sharp & Dohme Corp. | Novel lipid nanoparticles and novel components for delivery of nucleic acids |
| WO2010087791A1 (en) | 2009-01-27 | 2010-08-05 | Utc Power Corporation | Distributively cooled, integrated water-gas shift reactor and vaporizer |
| US20100196983A1 (en) | 2009-02-05 | 2010-08-05 | Ut-Battelle, Llc | Transformation of gram positive bacteria by sonoporation |
| US20120024422A1 (en) | 2009-03-12 | 2012-02-02 | Illinois Tool Works Inc. | Mis-fuel inhibitor |
| US20100260817A1 (en) | 2009-03-20 | 2010-10-14 | Egen, Inc. | Polyamine Derivatives |
| US8460696B2 (en) | 2009-03-20 | 2013-06-11 | Egen, Inc. | Polyamine derivatives |
| US20120028342A1 (en) | 2009-03-24 | 2012-02-02 | Ismagilov Rustem F | Slip chip device and methods |
| US20120076836A1 (en) | 2009-03-31 | 2012-03-29 | The University Of Tokyo | Polyion complex of double-stranded ribonucleic acid |
| WO2010120266A1 (en) | 2009-04-13 | 2010-10-21 | Inserm, Institut National De La Sante Et De La Recherche Medicale | Hpv particles and uses thereof |
| US20120171290A1 (en) | 2009-04-13 | 2012-07-05 | Coursaget Pierre L | Hpv particles and uses thereof |
| US20110223201A1 (en) | 2009-04-21 | 2011-09-15 | Selecta Biosciences, Inc. | Immunonanotherapeutics Providing a Th1-Biased Response |
| WO2010123569A2 (en) | 2009-04-21 | 2010-10-28 | Selecta Biosciences, Inc. | Immunonanotherapeutics providing a th1-biased response |
| US8287910B2 (en) | 2009-04-30 | 2012-10-16 | Intezyne Technologies, Inc. | Polymeric micelles for polynucleotide encapsulation |
| WO2010129709A1 (en) | 2009-05-05 | 2010-11-11 | Alnylam Pharmaceuticals, Inc. | Lipid compositions |
| US20120060293A1 (en) | 2009-05-18 | 2012-03-15 | Amoena Medizin-Orthopädie-Technik GmbH | Anti-decubitus cushion |
| WO2010138192A2 (en) | 2009-05-27 | 2010-12-02 | Selecta Biosciences, Inc. | Nanocarriers possessing components with different rates of release |
| US20100303850A1 (en) | 2009-05-27 | 2010-12-02 | Selecta Biosciences, Inc. | Nanocarriers possessing components with different rates of release |
| WO2010138194A2 (en) | 2009-05-27 | 2010-12-02 | Selecta Biosciences, Inc. | Immunomodulatory agent-polymeric compounds |
| US20110020388A1 (en) | 2009-05-27 | 2011-01-27 | Selecta Biosciences, Inc. | Targeted synthetic nanocarriers with ph sensitive release of immunomodulatory agents |
| WO2010138193A2 (en) | 2009-05-27 | 2010-12-02 | Selecta Biosciences, Inc. | Targeted synthetic nanocarriers with ph sensitive release of immunomodulatory agents |
| US20110027217A1 (en) | 2009-05-27 | 2011-02-03 | Selecta Biosciences, Inc. | Immunomodulatory agent-polymeric compounds |
| US20100324120A1 (en) | 2009-06-10 | 2010-12-23 | Jianxin Chen | Lipid formulation |
| US20120202871A1 (en) | 2009-07-01 | 2012-08-09 | Protiva Biotherapeutics, Inc. | Cationic lipids and methods for the delivery of therapeutic agents |
| US8283333B2 (en) | 2009-07-01 | 2012-10-09 | Protiva Biotherapeutics, Inc. | Lipid formulations for nucleic acid delivery |
| US20130122104A1 (en) | 2009-07-01 | 2013-05-16 | Protiva Biotherapeutics, Inc. | Novel lipid formulations for delivery of therapeutic agents to solid tumors |
| WO2011013062A1 (en) | 2009-07-30 | 2011-02-03 | Koninklijke Philips Electronics N.V. | Distributed image retargeting |
| WO2011012316A2 (de) | 2009-07-31 | 2011-02-03 | Ludwig-Maximilians-Universität | Rna mit einer kombination aus unmodifizierten und modifizierten nucleotiden zur proteinexpression |
| WO2011015312A1 (en) | 2009-08-01 | 2011-02-10 | Roche Diagnostics Gmbh | Improved detection of bacterial (mollicutes) contamination |
| WO2011014973A2 (en) | 2009-08-05 | 2011-02-10 | Polyphor Ag | Conformationally constrained, fully synthetic macrocyclic compounds |
| WO2011022460A1 (en) | 2009-08-20 | 2011-02-24 | Merck Sharp & Dohme Corp. | Novel cationic lipids with various head groups for oligonucleotide delivery |
| WO2011043913A2 (en) | 2009-10-08 | 2011-04-14 | Merck Sharp & Dohme Corp. | Novel cationic lipids with short lipid chains for oligonucleotide delivery |
| US20130129627A1 (en) | 2009-10-22 | 2013-05-23 | James B. Delehanty | Delivery of Nanoparticles to Neurons |
| US20120276209A1 (en) | 2009-11-04 | 2012-11-01 | The University Of British Columbia | Nucleic acid-containing lipid particles and related methods |
| US8449916B1 (en) | 2009-11-06 | 2013-05-28 | Iowa State University Research Foundation, Inc. | Antimicrobial compositions and methods |
| US20120283427A1 (en) | 2009-11-13 | 2012-11-08 | Bend Research, Inc. | Cationic dextran polymer derivatives |
| WO2011062965A2 (en) | 2009-11-18 | 2011-05-26 | University Of Washington Through Its Center For Commercialization | Targeting monomers and polymers having targeting blocks |
| US20130129636A1 (en) | 2009-11-20 | 2013-05-23 | Imperial Innovations Limited | Novel Liposome Nanoparticles for Tumor Magnetic Resonance Imaging |
| US20110244026A1 (en) | 2009-12-01 | 2011-10-06 | Braydon Charles Guild | Delivery of mrna for the augmentation of proteins and enzymes in human genetic diseases |
| US20130195967A1 (en) | 2009-12-01 | 2013-08-01 | Shire Human Genetic Therapies, Inc. | Liver specific delivery of messenger rna |
| US20110143436A1 (en) | 2009-12-07 | 2011-06-16 | Gary Dahl | Compositions and methods for reprogramming eukaryotic cells |
| WO2011071931A2 (en) | 2009-12-07 | 2011-06-16 | Katalin Kariko | Rna preparations comprising purified modified rna for reprogramming cells |
| WO2011071936A2 (en) | 2009-12-07 | 2011-06-16 | Gary Dahl | Compositions and methods for reprogramming eukaryotic cells |
| WO2011072218A2 (en) | 2009-12-11 | 2011-06-16 | Bind Biosciences | Stable formulations for lyophilizing therapeutic particles |
| US8211473B2 (en) | 2009-12-11 | 2012-07-03 | Bind Biosciences, Inc. | Stable formulations for lyophilizing therapeutic particles |
| US20130230568A1 (en) | 2009-12-11 | 2013-09-05 | Bind Therapeutics, Inc. | Stable Formulations for Lyophilizing Therapeutic Particles |
| US20120140790A1 (en) | 2009-12-15 | 2012-06-07 | Ali Mir M | Therapeutic Polymeric Nanoparticle Compositions with High Glass Transition Termperature or High Molecular Weight Copolymers |
| WO2011084521A2 (en) | 2009-12-15 | 2011-07-14 | Bind Biosciences, Inc. | Therapeutic polymeric nanoparticles comprising epothilone and methods of making and using same |
| US20110294717A1 (en) | 2009-12-15 | 2011-12-01 | Ali Mir M | Therapeutic Polymeric Nanoparticle Compositions with High Glass Transition Temperature or High Molecular Weight Copolymers |
| US8518963B2 (en) | 2009-12-15 | 2013-08-27 | Bind Therapeutics, Inc. | Therapeutic polymeric nanoparticle compositions with high glass transition temperature or high molecular weight copolymers |
| WO2011084513A2 (en) | 2009-12-15 | 2011-07-14 | Bind Biosciences, Inc. | Therapeutic polymeric nanoparticle compositions with high glass transition temperature or high molecular weight copolymers |
| WO2011084518A2 (en) | 2009-12-15 | 2011-07-14 | Bind Biosciences, Inc. | Therapeutic polymeric nanoparticles comprising corticosteroids and methods of making and using same |
| US20130102545A1 (en) | 2009-12-16 | 2013-04-25 | Magforce Ag | Temperature dependent activation of catalytic nucleic acids for controlled active substance release |
| WO2011076807A2 (en) | 2009-12-23 | 2011-06-30 | Novartis Ag | Lipids, lipid compositions, and methods of using them |
| US20110200582A1 (en) | 2009-12-23 | 2011-08-18 | Novartis Ag | Lipids, lipid compositions, and methods of using them |
| US20110171248A1 (en) | 2010-01-08 | 2011-07-14 | Selecta Biosciences, Inc. | Synthetic virus-like particles conjugated to human papillomavirus capsid peptides for use as vaccines |
| WO2011085231A2 (en) | 2010-01-08 | 2011-07-14 | Selecta Biosciences, Inc. | Synthetic virus-like particles conjugated to human papillomavirus capsid peptides for use as vaccines |
| WO2011090965A1 (en) | 2010-01-22 | 2011-07-28 | Merck Sharp & Dohme Corp. | Novel cationic lipids for oligonucleotide delivery |
| US20130196915A1 (en) | 2010-01-23 | 2013-08-01 | Yong Wang | Affinity hydrogels for controlled protein release |
| WO2012082165A1 (en) | 2010-01-24 | 2012-06-21 | Novartis Ag | Irradiated biodegradable polymer microparticles |
| US20130231287A1 (en) | 2010-02-25 | 2013-09-05 | Parimala Nacharaju | Pegylated albumin polymers and uses thereof |
| US20120321719A1 (en) | 2010-02-25 | 2012-12-20 | The Johns Hopkins University | Sustained Delivery of Therapeutic Agents to an Eye Compartment |
| US20130133483A1 (en) | 2010-03-08 | 2013-05-30 | University Of Rochester | Synthesis of Nanoparticles Using Reducing Gases |
| US20130149783A1 (en) | 2010-03-16 | 2013-06-13 | James William Yockman | Cleavable modifications to reducible poly (amido ethylenimines)s to enhance nucleotide delivery |
| US20130071450A1 (en) | 2010-03-18 | 2013-03-21 | Covidien Lp | Gels for transdermal delivery |
| WO2011115862A1 (en) | 2010-03-18 | 2011-09-22 | Merck Sharp & Dohme Corp. | Endosomolytic poly(amidoamine) disulfide polymers for the delivery of oligonucleotides |
| US20120177724A1 (en) | 2010-03-19 | 2012-07-12 | Massachusetts Institute Of Technology | Lipid vesicle compositions and methods of use |
| WO2011120053A1 (en) | 2010-03-26 | 2011-09-29 | Mersana Therapeutics, Inc. | Modified polymers for delivery of polynucleotides, method of manufacture, and methods of use thereof |
| US8404799B2 (en) | 2010-03-26 | 2013-03-26 | Cerulean Pharma Inc. | Methods and systems for generating nanoparticles |
| WO2011127255A1 (en) | 2010-04-08 | 2011-10-13 | Merck Sharp & Dohme Corp. | Preparation of lipid nanoparticles |
| US20130183375A1 (en) | 2010-04-09 | 2013-07-18 | Pacira Pharmaceuticals, Inc. | Method for formulating large diameter synthetic membrane vesicles |
| US20130177633A1 (en) | 2010-04-09 | 2013-07-11 | Pacira Pharmaceuticals, Inc. | Method for formulating large diameter synthetic membrane vesicles |
| US20130177634A1 (en) | 2010-04-09 | 2013-07-11 | Pacira Pharmaceuticals, Inc. | Method for formulating large diameter synthetic membrane vesicles |
| US20130177638A1 (en) | 2010-04-09 | 2013-07-11 | Pacira Pharmaceuticals, Inc. | Method for formulating large diameter synthetic membrane vesicles |
| US20130177636A1 (en) | 2010-04-09 | 2013-07-11 | Pacira Pharmaceuticals, Inc. | Method for formulating large diameter synthetic membrane vesicles |
| US20130183372A1 (en) | 2010-04-09 | 2013-07-18 | Pacira Pharmaceuticals, Inc. | Method for formulating large diameter synthetic membrane vesicles |
| US20130177635A1 (en) | 2010-04-09 | 2013-07-11 | Pacira Pharmaceuticals, Inc. | Method for formulating large diameter synthetic membrane vesicles |
| US20130177637A1 (en) | 2010-04-09 | 2013-07-11 | Pacira Pharmaceuticals, Inc. | Method for formulating large diameter synthetic membrane vesicles |
| US20130183373A1 (en) | 2010-04-09 | 2013-07-18 | Pacira Pharmaceuticals, Inc. | Method for formulating large diameter synthetic membrane vesicles |
| US20110262491A1 (en) | 2010-04-12 | 2011-10-27 | Selecta Biosciences, Inc. | Emulsions and methods of making nanocarriers |
| US20130138032A1 (en) | 2010-04-15 | 2013-05-30 | Sungjee Kim | ANTICANCER AGENT DELIVERY SYSTEM USING pH-SENSITIVE METAL NANOPARTICLES |
| US20120046346A1 (en) | 2010-04-16 | 2012-02-23 | Immune Disease Institute, Inc. | Sustained polypeptide expression from synthetic, modified rnas and uses thereof |
| US20130156845A1 (en) | 2010-04-29 | 2013-06-20 | Alnylam Pharmaceuticals, Inc. | Lipid formulated single stranded rna |
| US20130129785A1 (en) | 2010-05-10 | 2013-05-23 | Alnylam Pharmaceuticals, Inc | Methods and compositions for delivery of active agents |
| US20130123338A1 (en) | 2010-05-12 | 2013-05-16 | Protiva Biotherapeutics, Inc. | Novel cationic lipids and methods of use thereof |
| US20130150625A1 (en) | 2010-05-24 | 2013-06-13 | Brian W. Budzik | Novel Amino Alcohol Cationic Lipids for Oligonucleotide Delivery |
| WO2011150264A2 (en) | 2010-05-26 | 2011-12-01 | Selecta Biosciences, Inc. | Synthetic nanocarrier combination vaccines |
| US20110293700A1 (en) | 2010-05-26 | 2011-12-01 | Selecta Biosciences, Inc. | Nanocarrier compositions with uncoupled adjuvant |
| US20120027806A1 (en) | 2010-05-26 | 2012-02-02 | Selecta Biosciences, Inc. | Dose selection of adjuvanted synthetic nanocarriers |
| WO2011150240A1 (en) | 2010-05-26 | 2011-12-01 | Selecta Biosciences, Inc. | Nanocarrier compositions with uncoupled adjuvant |
| US20110293701A1 (en) | 2010-05-26 | 2011-12-01 | Selecta Biosciences, Inc. | Multivalent synthetic nanocarrier vaccines |
| WO2011150249A1 (en) | 2010-05-26 | 2011-12-01 | Selecta Biosciences, Inc. | Multivalent synthetic nanocarrier vaccines |
| US20110293723A1 (en) | 2010-05-26 | 2011-12-01 | Selecta Biosciences, Inc. | Synthetic nanocarrier combination vaccines |
| WO2011150258A1 (en) | 2010-05-26 | 2011-12-01 | Selecta Biosciences, Inc. | Dose selection of adjuvanted synthetic nanocarriers |
| US20130209544A1 (en) | 2010-05-26 | 2013-08-15 | Micromedmark Biotech Co., Ltd. | Microvesicles carrying small interfering rnas, preparation methods and uses thereof |
| US20130090372A1 (en) | 2010-06-04 | 2013-04-11 | Brian W. Budzik | Novel Low Molecular Weight Cationic Lipids for Oligonucleotide Delivery |
| US20130164219A1 (en) | 2010-06-14 | 2013-06-27 | Hoffmann-La Roche Inc. | Cell-penetrating peptides and uses thereof |
| US20130197100A1 (en) | 2010-06-15 | 2013-08-01 | Instituto De Pesquisas Technologicas Do Estado De Sao Paulo | Colloidal nanoscale carriers for active hydrophilic substances and method for producing same |
| US20130196948A1 (en) | 2010-06-25 | 2013-08-01 | Massachusetts Insitute Of Technology | Polymers for biomaterials and therapeutics |
| WO2012001875A1 (en) | 2010-07-01 | 2012-01-05 | Canon Kabushiki Kaisha | Image forming apparatus |
| WO2012002629A1 (ko) | 2010-07-02 | 2012-01-05 | 연세대학교 산학협력단 | 발광다이오드 모듈 |
| WO2012006376A2 (en) | 2010-07-06 | 2012-01-12 | Novartis Ag | Virion-like delivery particles for self-replicating rna molecules |
| WO2012006378A1 (en) | 2010-07-06 | 2012-01-12 | Novartis Ag | Liposomes with lipids having an advantageous pka- value for rna delivery |
| WO2012006380A2 (en) | 2010-07-06 | 2012-01-12 | Novartis Ag | Cationic oil-in-water emulsions |
| US20130195968A1 (en) | 2010-07-06 | 2013-08-01 | Novartis Ag | Virion-like delivery particles for self-replicating rna molecules |
| US20130171241A1 (en) | 2010-07-06 | 2013-07-04 | Novartis Ag | Liposomes with lipids having an advantageous pka-value for rna delivery |
| US20130177523A1 (en) | 2010-07-13 | 2013-07-11 | University Of Utah Research Foundation | Gold particles and methods of making and using the same in cancer treatment |
| US20130211249A1 (en) | 2010-07-22 | 2013-08-15 | The Johns Hopkins University | Drug eluting hydrogels for catheter delivery |
| WO2012013501A1 (de) | 2010-07-29 | 2012-02-02 | Fujitsu Technology Solutions Intellectual Property Gmbh | Computersystem, verfahren zum programmieren einer echtzeituhr und computerprogrammprodukt |
| WO2012013326A1 (en) | 2010-07-30 | 2012-02-02 | Curevac Gmbh | Complexation of nucleic acids with disulfide-crosslinked cationic components for transfection and immunostimulation |
| US20130142818A1 (en) | 2010-07-30 | 2013-06-06 | Curevac Gmbh | Complexation of nucleic acids with disulfide-crosslinked cationic components for transfection and immunostimulation |
| WO2012018718A1 (en) | 2010-08-02 | 2012-02-09 | Advanced Technologies And Regenerative Medicine, Llc | Absorbable peg-based hydrogels |
| WO2012016269A1 (en) | 2010-08-02 | 2012-02-09 | Curtin University Of Technology | Determining location of, and imaging, a subsurface boundary |
| US8524215B2 (en) | 2010-08-02 | 2013-09-03 | Janssen Biotech, Inc. | Absorbable PEG-based hydrogels |
| US8518907B2 (en) | 2010-08-02 | 2013-08-27 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of catenin (cadherin-associated protein), beta 1 (CTNNB1) gene expression using short interfering nucleic acid (siNA) |
| WO2012018881A2 (en) | 2010-08-03 | 2012-02-09 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for the regulation of rna |
| US20130171646A1 (en) | 2010-08-09 | 2013-07-04 | So Jung PARK | Nanop article-oligonucleotide hybrid structures and methods of use thereof |
| US20130216607A1 (en) | 2010-08-14 | 2013-08-22 | The Regents Of The University Of California | Zwitterionic lipids |
| WO2012022512A1 (en) | 2010-08-18 | 2012-02-23 | International Business Machines Corporation | Solar cell and battery 3d integration |
| US20130195799A1 (en) | 2010-08-19 | 2013-08-01 | Peg Biosciences, Inc. | Synergistic biomolecule-polymer conjugates |
| WO2012024632A2 (en) | 2010-08-20 | 2012-02-23 | Selecta Biosciences, Inc. | Synthetic nanocarrier vaccines comprising peptides obtained or derived from human influenza a virus m2e |
| WO2012024621A2 (en) | 2010-08-20 | 2012-02-23 | Selecta Biosciences, Inc. | Synthetic nanocarrier vaccines comprising peptides obtained or derived from human influenza a virus hemagglutinin |
| US20120058154A1 (en) | 2010-08-20 | 2012-03-08 | Selecta Biosciences, Inc. | Synthetic nanocarrier vaccines comprising peptides obtained or derived from human influenza a virus m2e |
| WO2012024526A2 (en) | 2010-08-20 | 2012-02-23 | Cerulean Pharma Inc. | Conjugates, particles, compositions, and related methods |
| US20120064110A1 (en) | 2010-08-20 | 2012-03-15 | Selecta Biosciences, Inc. | Synthetic nanocarrier vaccines comprising peptides obtained or derived from human influenza a virus hemagglutinin |
| US20120058153A1 (en) | 2010-08-20 | 2012-03-08 | Selecta Biosciences, Inc. | Synthetic nanocarrier vaccines comprising proteins obtained or derived from human influenza a virus hemagglutinin |
| WO2012030683A2 (en) | 2010-08-31 | 2012-03-08 | Merck Sharp & Dohme Corp. | Novel single chemical entities and methods for delivery of oligonucleotides |
| US20130189351A1 (en) | 2010-08-31 | 2013-07-25 | Novartis Ag | Lipids suitable for liposomal delivery of protein coding rna |
| US20130202684A1 (en) | 2010-08-31 | 2013-08-08 | Lichtstrasse | Pegylated liposomes for delivery of immunogen encoding rna |
| WO2012031043A1 (en) | 2010-08-31 | 2012-03-08 | Novartis Ag | Pegylated liposomes for delivery of immunogen-encoding rna |
| WO2012030901A1 (en) | 2010-08-31 | 2012-03-08 | Novartis Ag | Small liposomes for delivery of immunogen-encoding rna |
| US20130195969A1 (en) | 2010-08-31 | 2013-08-01 | Novartis Ag | Small liposomes for delivery of immunogen encoding rna |
| WO2012031046A2 (en) | 2010-08-31 | 2012-03-08 | Novartis Ag | Lipids suitable for liposomal delivery of protein-coding rna |
| US20130183244A1 (en) | 2010-09-10 | 2013-07-18 | The Johns Hopkins University | Rapid Diffusion of Large Polymeric Nanoparticles in the Mammalian Brain |
| US8466122B2 (en) | 2010-09-17 | 2013-06-18 | Protiva Biotherapeutics, Inc. | Trialkyl cationic lipids and methods of use thereof |
| WO2012040184A2 (en) | 2010-09-20 | 2012-03-29 | Merck Sharp & Dohme Corp. | Novel low molecular weight cationic lipids for oligonucleotide delivery |
| US20130178541A1 (en) | 2010-09-20 | 2013-07-11 | Matthew G. Stanton | Novel low molecular weight cationic lipids for oligonucleotide delivery |
| US20130183718A1 (en) | 2010-09-21 | 2013-07-18 | RibpxX GmbH | Method for Synthesizing RNA using DNA Template |
| WO2012040623A2 (en) | 2010-09-24 | 2012-03-29 | The Brigham And Women's Hospital, Inc. | Nanostructured gels capable of controlled release of encapsulated agents |
| WO2012040524A1 (en) | 2010-09-24 | 2012-03-29 | Mallinckrodt Llc | Aptamer conjugates for targeting of therapeutic and/or diagnostic nanocarriers |
| WO2012044638A1 (en) | 2010-09-30 | 2012-04-05 | Merck Sharp & Dohme Corp. | Low molecular weight cationic lipids for oligonucleotide delivery |
| US20120265001A1 (en) | 2010-10-11 | 2012-10-18 | Wichita State University | Composite magnetic nanoparticle drug delivery system |
| WO2012049366A1 (en) | 2010-10-14 | 2012-04-19 | Timo Vesikari | Norovirus capsid and rotavirus vp6 protein for use as combined vaccine |
| WO2012054365A2 (en) | 2010-10-21 | 2012-04-26 | Merck Sharp & Dohme Corp. | Novel low molecular weight cationic lipids for oligonucleotide delivery |
| WO2012054923A2 (en) | 2010-10-22 | 2012-04-26 | Bind Biosciences, Inc. | Therapeutic nanoparticles with high molecular weight copolymers |
| US20120121718A1 (en) | 2010-11-05 | 2012-05-17 | The Johns Hopkins University | Compositions and methods relating to reduced mucoadhesion |
| WO2012061259A2 (en) | 2010-11-05 | 2012-05-10 | Merck Sharp & Dohme Corp. | Novel low molecular weight cyclic amine containing cationic lipids for oligonucleotide delivery |
| US20130225836A1 (en) | 2010-11-05 | 2013-08-29 | Merck Sharp & Dohme Corp. | Novel low molecular weight cyclic amine containing cationic lipids for oligonucleotide delivery |
| WO2012068187A1 (en) | 2010-11-19 | 2012-05-24 | Merck Sharp & Dohme Corp. | Poly(amide) polymers for the delivery of oligonucleotides |
| WO2012082574A1 (en) | 2010-12-17 | 2012-06-21 | Merck Sharp & Dohme Corp. | Membrane lytic poly(amido amine) polymers for the delivery of oligonucleotides |
| US20120171229A1 (en) | 2010-12-30 | 2012-07-05 | Selecta Biosciences, Inc. | Synthetic nanocarriers with reactive groups that release biologically active agents |
| WO2012094304A1 (en) | 2011-01-04 | 2012-07-12 | Brown University | Nanotubes as carriers of nucleic acids into cells |
| WO2012099755A1 (en) | 2011-01-11 | 2012-07-26 | Alnylam Pharmaceuticals, Inc. | Pegylated lipids and their use for drug delivery |
| WO2012095255A1 (de) | 2011-01-13 | 2012-07-19 | Evonik Oxeno Gmbh | Verfahren zur aufreinigung von biphephos |
| US20120189700A1 (en) | 2011-01-19 | 2012-07-26 | Zoraida Aguilar | Nanoparticle Based Immunological Stimulation |
| WO2012099805A2 (en) | 2011-01-19 | 2012-07-26 | Ocean Nanotech, Llc | Nanoparticle based immunological stimulation |
| WO2012109121A1 (en) | 2011-02-07 | 2012-08-16 | Purdue Research Foundation | Carbohydrate nanoparticles for prolonged efficacy of antimicrobial peptide |
| US20120207840A1 (en) | 2011-02-10 | 2012-08-16 | Aura Biosciences, Inc. | Virion Derived Protein Nanoparticles For Delivering Diagnostic Or Therapeutic Agents For The Treatment Of Non-Melanoma Skin Cancer |
| WO2012110636A2 (en) | 2011-02-18 | 2012-08-23 | Instituto Nacional De Investigación Y Tecnología Agraria Y Alimentaria (Inia) | Carrier peptides for cell delivery |
| US20130217753A1 (en) | 2011-02-22 | 2013-08-22 | Rutgers, The State University Of New Jersey | Amphiphilic macromolecules for nucleic acid delivery |
| US20120237565A1 (en) | 2011-03-14 | 2012-09-20 | Intezyne Technologies, Incorporated | Pegylated polyplexes containing two or more different polymers for polynucleotide delivery |
| WO2012125987A2 (en) | 2011-03-17 | 2012-09-20 | Massachusetts Institute Of Technology | Delivery system |
| US20120244222A1 (en) | 2011-03-25 | 2012-09-27 | Selecta Biosciences, Inc. | Osmotic mediated release synthetic nanocarriers |
| WO2012129648A1 (en) | 2011-03-25 | 2012-10-04 | University Of Guelph | Enhancing protein expression of adeno-associated virus vectors |
| WO2012131106A1 (en) | 2011-03-31 | 2012-10-04 | Ingell Technologies Holding B.V. | Biodegradable compositions suitable for controlled release |
| WO2012131104A2 (en) | 2011-03-31 | 2012-10-04 | Ingell Technologies Holding B.V. | Biodegradable compositions suitable for controlled release |
| WO2012148684A1 (en) | 2011-04-27 | 2012-11-01 | President And Fellows Of Harvard College | Cell-friendly inverse opal hydrogels for cell encapsulation, drug and protein delivery, and functional nanoparticle encapsulation |
| WO2012149259A1 (en) | 2011-04-29 | 2012-11-01 | Selecta Biosciences, Inc. | Tolerogenic synthetic nanocarriers to reduce antibody responses |
| WO2012149255A2 (en) | 2011-04-29 | 2012-11-01 | Selecta Biosciences, Inc. | Tolerogenic synthetic nanocarriers to reduce immune responses to therapeutic proteins |
| US20120283503A1 (en) | 2011-04-29 | 2012-11-08 | The Johns Hopkins University | Nanoparticle loaded stem cells and their use in mri guided hyperthermia |
| WO2012149411A1 (en) | 2011-04-29 | 2012-11-01 | Selecta Biosciences, Inc. | Controlled release of immunosuppressants from synthetic nanocarriers |
| WO2012149454A2 (en) | 2011-04-29 | 2012-11-01 | Selecta Biosciences, Inc. | Tolerogenic synthetic nanocarriers coupled to cd1d-restricted antigens and methods of use |
| WO2012149282A2 (en) | 2011-04-29 | 2012-11-01 | Selecta Biosciences, Inc. | Tolerogenic synthetic nanocarriers for generating cd8+regulatory t cells |
| WO2012149405A2 (en) | 2011-04-29 | 2012-11-01 | Selecta Biosciences, Inc. | Tolerogenic synthetic nanocarriers for regulating innate immune responses |
| WO2012149393A2 (en) | 2011-04-29 | 2012-11-01 | Selecta Biosciences, Inc. | Tolerogenic synthetic nanocarriers for antigen-specific deletion of t effector cells |
| WO2012149268A1 (en) | 2011-04-29 | 2012-11-01 | Selecta Biociences, Inc. | Tolerogenic synthetic nanocarriers for allergy therapy |
| WO2012149265A2 (en) | 2011-04-29 | 2012-11-01 | Selecta Biosciences, Inc. | Tolerogenic synthetic nanocarriers to reduce cytotoxic t lymphocyte responses |
| WO2012149301A2 (en) | 2011-04-29 | 2012-11-01 | Selecta Biosciences, Inc. | Tolerogenic synthetic nanocarriers for inducing regulatory b cells |
| WO2012149252A2 (en) | 2011-04-29 | 2012-11-01 | Selecta Biosciences, Inc. | Tolerogenic synthetic nanocarriers |
| WO2012150467A2 (en) | 2011-05-04 | 2012-11-08 | The University Of Nottingham | Novel polymers which resist bacterial attachment |
| WO2012151438A1 (en) | 2011-05-05 | 2012-11-08 | Celacare Technologies, Llc | Antimicrobial silver hydrogel composition for the treatment of burns and wounds |
| US20120295832A1 (en) | 2011-05-17 | 2012-11-22 | Arrowhead Research Corporation | Novel Lipids and Compositions for Intracellular Delivery of Biologically Active Compounds |
| US20120302940A1 (en) | 2011-05-26 | 2012-11-29 | Jackson State University | Popcorn Shape Gold Nanoparticle For Targeted Diagnosis, Photothermal Treatment and In-Situ Monitoring Therapy Response for Cancer and Multiple Drug Resistance Bacteria |
| WO2012166923A2 (en) | 2011-05-31 | 2012-12-06 | Bind Biosciences | Drug loaded polymeric nanoparticles and methods of making and using same |
| WO2013052167A2 (en) | 2011-06-02 | 2013-04-11 | The Regents Of The University Of California | Membrane encapsulated nanoparticles and method of use |
| WO2012170930A1 (en) | 2011-06-08 | 2012-12-13 | Shire Human Genetic Therapies, Inc | Lipid nanoparticle compositions and methods for mrna delivery |
| WO2012170889A1 (en) | 2011-06-08 | 2012-12-13 | Shire Human Genetic Therapies, Inc. | Cleavable lipids |
| WO2013003343A2 (en) | 2011-06-27 | 2013-01-03 | Adelphi Technology, Inc. | Neutron source for neutron capture therapy |
| WO2013001198A1 (fr) | 2011-06-27 | 2013-01-03 | E.Itec | Cable pour systeme d'alimentation electrique |
| WO2013001166A1 (en) | 2011-06-30 | 2013-01-03 | Wärtsilä Finland Oy | Method and arrangement for minimizing need for safety gases |
| WO2013001168A1 (en) | 2011-06-30 | 2013-01-03 | Ionphase Oy | Halogen-free polymer blend |
| WO2013006825A1 (en) | 2011-07-06 | 2013-01-10 | Novartis Ag | Liposomes having useful n:p ratio for delivery of rna molecules |
| WO2013007604A1 (de) | 2011-07-08 | 2013-01-17 | Bayer Intellectual Property Gmbh | Verfahren zur herstellung von tetrazol-substituierten anthranilsäurediamid-derivaten durch umsetzung von pyrazolsäuren mit anthranilsäureestern |
| US20130012566A1 (en) | 2011-07-10 | 2013-01-10 | Aura Biosciences, Inc. | Virion Derived Protein Nanoparticles For Delivering Diagnostic Or Therapeutic Agents For The Treatment of Alopecia |
| WO2013009736A2 (en) | 2011-07-10 | 2013-01-17 | President And Fellows Of Harvard College | Compositions and methods for self-assembly of polymers with complementary macroscopic and microscopic scale units |
| US20130012450A1 (en) | 2011-07-10 | 2013-01-10 | Aura Biosciences, Inc. | Virion Derived Protein Nanoparticles For Delivering Diagnostic Or Therapeutic Agents For The Treatment Of Dermatology Related Genetic Diseases |
| WO2013009717A1 (en) | 2011-07-10 | 2013-01-17 | Elisabet De Los Pinos | Virion derived protein nanoparticles for delivering diagnostic or therapeutic agents for the treatment of skin-related diseases |
| WO2013008825A1 (ja) | 2011-07-11 | 2013-01-17 | 株式会社トクヤマ | フォトクロミック硬化性組成物 |
| WO2013012680A1 (en) | 2011-07-15 | 2013-01-24 | 3M Innovative Properties Company | An electrical connector |
| WO2013012226A2 (ko) | 2011-07-18 | 2013-01-24 | 이화다이아몬드공업 주식회사 | Cmp 패드 컨디셔너 |
| WO2013012476A2 (en) | 2011-07-21 | 2013-01-24 | Arizona Chemical Company, Llc | Branched polyether-polyamide block copolymers and methods of making and using the same |
| WO2013019669A2 (en) | 2011-07-29 | 2013-02-07 | Selecta Biosciences, Inc. | Synthetic nanocarriers that generate humoral and cytotoxic t lymphocyte (ctl) immune responses |
| US20130121954A1 (en) | 2011-08-26 | 2013-05-16 | Arrowhead Madison Inc. | Poly(vinyl ester) Polymers for In Vivo Nucleic Acid Delivery |
| WO2013032829A1 (en) | 2011-08-26 | 2013-03-07 | Arrowhead Research Corporation | Poly(vinyl ester) polymers for in vivo nucleic acid delivery |
| US20130064894A1 (en) | 2011-08-31 | 2013-03-14 | Protiva Biotherapeutics, Inc. | Novel cationic lipids and methods of use thereof |
| WO2013044219A1 (en) | 2011-09-22 | 2013-03-28 | Bind Biosciences | Methods of treating cancers with therapeutic nanoparticles |
| WO2013072929A2 (en) | 2011-09-23 | 2013-05-23 | Indian Institute Of Technology | Nanop article based cosmetic composition |
| WO2013049328A1 (en) | 2011-09-27 | 2013-04-04 | Alnylam Pharmaceuticals, Inc. | Di-aliphatic substituted pegylated lipids |
| WO2013052523A1 (en) | 2011-10-03 | 2013-04-11 | modeRNA Therapeutics | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| WO2013055971A1 (en) | 2011-10-11 | 2013-04-18 | Arizona Board Of Regents For And On Behalf Of Arizona State University | Polymers for delivering a substance into a cell |
| WO2013055331A1 (en) | 2011-10-12 | 2013-04-18 | The Curators Of The University Of Missouri | Pentablock polymers |
| WO2013056132A2 (en) | 2011-10-14 | 2013-04-18 | Stc.Unm | Porous nanoparticle-supported lipid bilayers (protocells) for targeted delivery including transdermal delivery of cargo and methods thereof |
| WO2013059496A1 (en) | 2011-10-18 | 2013-04-25 | Dicerna Pharmaceuticals, Inc. | Amine cationic lipids and uses thereof |
| WO2013059922A1 (en) | 2011-10-25 | 2013-05-02 | The University Of British Columbia | Limit size lipid nanoparticles and related methods |
| WO2013063468A1 (en) | 2011-10-27 | 2013-05-02 | Massachusetts Institute Of Technology | Amino acid derivates functionalized on the n- terminal capable of forming drug incapsulating microspheres |
| WO2013063530A2 (en) | 2011-10-28 | 2013-05-02 | Presage Biosciences, Inc. | Methods for drug delivery |
| WO2013093648A2 (en) | 2011-11-04 | 2013-06-27 | Nitto Denko Corporation | Method of producing lipid nanoparticles for drug delivery |
| US20130164400A1 (en) | 2011-11-04 | 2013-06-27 | Nitto Denko Corporation | Single use system for sterilely producing lipid-nucleic acid particles |
| US20130116408A1 (en) | 2011-11-05 | 2013-05-09 | Aura Biosciences, Inc. | Virion Derived Protein Nanoparticles For Delivering Radioisotopes For The Diagnosis And Treatment Of Malignant And Systemic Disease And The Monitoring Of Therapy |
| US20130115247A1 (en) | 2011-11-05 | 2013-05-09 | Aura Biosciences, Inc. | Virion Derived Protein Nanoparticles For Delivering Radioisotopes For The Diagnosis And Treatment Of Malignant And Systemic Disease And The Monitoring Of Therapy |
| US20130129830A1 (en) | 2011-11-18 | 2013-05-23 | Regeneron Pharmaceuticals, Inc. | Polymer Protein Microparticles |
| WO2013075068A1 (en) | 2011-11-18 | 2013-05-23 | Regeneron Pharmaceuticals, Inc. | Polymer protein microparticles |
| WO2013082111A2 (en) | 2011-11-29 | 2013-06-06 | The University Of North Carolina At Chapel Hill | Geometrically engineered particles and methods for modulating macrophage or immune responses |
| WO2013082529A1 (en) | 2011-12-02 | 2013-06-06 | Yale University | Enzymatic synthesis of poly(amine-co-esters) and methods of use thereof for gene delivery |
| WO2013082590A1 (en) | 2011-12-02 | 2013-06-06 | Invivo Therapeutics Corporation | Peg based hydrogel for peripheral nerve injury applications and compositions and method of use of synthetic hydrogel sealants |
| WO2013082470A1 (en) | 2011-12-02 | 2013-06-06 | Pegasus Laboratories, Inc. | Amphipathic lipid-based sustained release compositions |
| US20130142876A1 (en) | 2011-12-02 | 2013-06-06 | Pegasus Laboratories, Inc. | Amphipathic lipid-based sustained release compositions |
| WO2013086354A1 (en) | 2011-12-07 | 2013-06-13 | Alnylam Pharmaceuticals, Inc. | Biodegradable lipids for the delivery of active agents |
| US20130195920A1 (en) | 2011-12-07 | 2013-08-01 | Alnylam Pharmaceuticals, Inc. | Biodegradable lipids for the delivery of active agents |
| WO2013086373A1 (en) | 2011-12-07 | 2013-06-13 | Alnylam Pharmaceuticals, Inc. | Lipids for the delivery of active agents |
| WO2013084000A2 (en) | 2011-12-07 | 2013-06-13 | Isis Innovation Limited | Exosomes for delivery of biotherapeutics |
| WO2013086322A1 (en) | 2011-12-07 | 2013-06-13 | Alnylam Pharmaceuticals, Inc. | Branched alkyl and cycloalkyl terminated biodegradable lipids for the delivery of active agents |
| WO2013086526A1 (en) | 2011-12-09 | 2013-06-13 | The Regents Of The University Of California | Liposomal drug encapsulation |
| US20130177499A1 (en) | 2011-12-13 | 2013-07-11 | Engenelc Molecular Delivery Pty Ltd | Bacterially derived, intact minicells for delivery of therapeutic agents to brain tumors |
| US20130149318A1 (en) | 2011-12-13 | 2013-06-13 | Invivo Therapeutics Corporation | Painting the pia, arachnoid, and spinal cord parenchyma |
| WO2013090648A1 (en) | 2011-12-16 | 2013-06-20 | modeRNA Therapeutics | Modified nucleoside, nucleotide, and nucleic acid compositions |
| WO2013090861A1 (en) | 2011-12-16 | 2013-06-20 | Massachusetts Institute Of Technology | Alpha-aminoamidine polymers and uses thereof |
| WO2013090601A2 (en) | 2011-12-16 | 2013-06-20 | Massachusetts Institute Of Technology | Compact nanoparticles for biological applications |
| WO2013091001A1 (en) | 2011-12-19 | 2013-06-27 | The University Of Sydney | A peptide-hydrogel composite |
| WO2013103659A1 (en) | 2012-01-04 | 2013-07-11 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Stabilizing rna by incorporating chain-terminating nucleosides at the 3'-terminus |
| WO2013106073A1 (en) | 2012-01-10 | 2013-07-18 | Sorbent Therapeutics, Inc. | Compositions comprising crosslinked cation-binding polymers and uses thereof |
| WO2013106086A1 (en) | 2012-01-10 | 2013-07-18 | Sorbent Therapeutics, Inc. | Compositions comprising crosslinked cation-binding polymers and uses thereof |
| WO2013106072A1 (en) | 2012-01-10 | 2013-07-18 | Sorbent Therapeutics, Inc. | Compositions comprising crosslinked cation-binding polymers and uses thereof |
| WO2013106525A1 (en) | 2012-01-12 | 2013-07-18 | Stc.Unm | Immunogenic hpv l2-containing vlps and related compositions and methods |
| WO2013105101A1 (en) | 2012-01-13 | 2013-07-18 | Department Of Biotechnology | Solid lipid nanoparticles entrapping hydrophilic/ amphiphilic drug and a process for preparing the same |
| WO2013106715A1 (en) | 2012-01-13 | 2013-07-18 | Allergan, Inc. | Crosslinked hyaluronic acid-collagen gels for improving tissue graft viability and soft tissue augmentation |
| WO2013110028A1 (en) | 2012-01-19 | 2013-07-25 | The Johns Hopkins University | Nanoparticle formulations with enhanced mucosal penetration |
| WO2013113736A1 (en) | 2012-01-31 | 2013-08-08 | Bayer Innovation Gmbh | Pharmaceutical composition comprising a polymeric carrier cargo complex and an antigen |
| WO2013113325A1 (en) | 2012-01-31 | 2013-08-08 | Curevac Gmbh | Negatively charged nucleic acid comprising complexes for immunostimulation |
| WO2013113501A1 (en) | 2012-01-31 | 2013-08-08 | Curevac Gmbh | Pharmaceutical composition comprising a polymeric carrier cargo complex and at least one protein or pepide antigen |
| WO2013113326A1 (en) | 2012-01-31 | 2013-08-08 | Curevac Gmbh | Pharmaceutical composition comprising a polymeric carrier cargo complex and at least one protein or peptide antigen |
| EP2623121A1 (en) | 2012-01-31 | 2013-08-07 | Bayer Innovation GmbH | Pharmaceutical composition comprising a polymeric carrier cargo complex and an antigen |
| WO2013113502A1 (en) | 2012-01-31 | 2013-08-08 | Curevac Gmbh | Negatively charged nucleic acid comprising complexes for immunostimulation |
| WO2013116126A1 (en) | 2012-02-01 | 2013-08-08 | Merck Sharp & Dohme Corp. | Novel low molecular weight, biodegradable cationic lipids for oligonucleotide delivery |
| WO2013113071A1 (en) | 2012-02-03 | 2013-08-08 | Commonwealth Scientific And Industrial Research Organisation | Branched polymers |
| WO2013116656A1 (en) | 2012-02-03 | 2013-08-08 | Emory University | Immunostimulatory compositions, particles, and uses related thereto |
| WO2013119602A1 (en) | 2012-02-06 | 2013-08-15 | President And Fellows Of Harvard College | Arrdc1-mediated microvesicles (armms) and uses thereof |
| WO2013119936A2 (en) | 2012-02-09 | 2013-08-15 | Life Technologies Corporation | Hydrophilic polymeric particles and methods for making same |
| US20130210991A1 (en) | 2012-02-09 | 2013-08-15 | Life Technologies Corporation | Hydrophilic Polymeric Particles and Methods for Making and Using Same |
| WO2013120052A1 (en) | 2012-02-10 | 2013-08-15 | E. I. Du Pont De Nemours And Company | Preparation, purification and use of high-x diblock copolymers |
| WO2013122262A1 (en) | 2012-02-16 | 2013-08-22 | Vlp Therapeutics, Llc | Virus like particle composition |
| WO2013123407A1 (en) | 2012-02-17 | 2013-08-22 | Celsion Corporation | Thermosensitive nanoparticle formulations and method of making the same |
| WO2013123491A1 (en) | 2012-02-17 | 2013-08-22 | Massachusetts Institute Of Technology | Self-regulated peptide hydrogel for insulin delivery |
| WO2013123492A2 (en) | 2012-02-17 | 2013-08-22 | Massachusetts Institute Of Technology | Glucose-responsive microgels for closed loop insulin delivery |
| WO2013123298A1 (en) | 2012-02-17 | 2013-08-22 | University Of Georgia Research Foundation, Inc. | Nanoparticles for mitochondrial trafficking of agents |
| WO2013123125A1 (en) | 2012-02-17 | 2013-08-22 | President And Fellows Of Harvard College | Assembly of nucleic acid sequences in emulsions |
| WO2013123523A1 (en) | 2012-02-19 | 2013-08-22 | Nvigen, Inc. | Uses of porous nanostructure in delivery |
| WO2013124654A1 (en) | 2012-02-20 | 2013-08-29 | Cambridge Enterprise Limited | Cucurbituril-based hydrogels |
| WO2013124867A1 (en) | 2012-02-21 | 2013-08-29 | Amrita Vishwa Vidyapeetham University | Polymer - polymer or polymer - protein core - shell nano medicine loaded with multiple drug molecules |
| WO2013124855A1 (en) | 2012-02-21 | 2013-08-29 | Ben-Gurion University Of The Negev Research And Development Authority | Hydrogel system comprising spatially separated bioactive polypeptides |
| WO2013124620A1 (en) | 2012-02-22 | 2013-08-29 | The University Of Manchester | Method of making a hydrogel |
| WO2013151668A2 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of secreted proteins |
| WO2013151664A1 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of proteins |
| WO2013151736A2 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | In vivo production of proteins |
| WO2013151670A2 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of nuclear proteins |
| WO2013151671A1 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of cosmetic proteins and peptides |
| WO2013151663A1 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of membrane proteins |
| WO2013151667A1 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides |
| WO2013151665A2 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of proteins associated with human disease |
| WO2013151669A1 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| WO2013151666A2 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of biologics and proteins associated with human disease |
| WO2013151672A2 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of oncology-related proteins and peptides |
| WO2014028429A2 (en) | 2012-08-14 | 2014-02-20 | Moderna Therapeutics, Inc. | Enzymes and polymerases for the synthesis of rna |
Non-Patent Citations (212)
| Title |
|---|
| "Biocomputing: Informatics and Genome Projects", 1993, ACADEMIC PRESS |
| "Cancer Principles and Practice of Oncology", 15 February 2001, LIPPINCOTT WILLIAMS & WILKINS PUBLISHERS |
| "Computational Molecular Biology", 1988, OXFORD UNIVERSITY PRESS |
| "Computer Analysis of Sequence Data, Part l", 1994, HUMANA PRESS |
| "Remington: The Science and Practice of Pharmacy", 2005, LIPPINCOTT WILLIAMS & WILKINS |
| "Sequence Analysis Primer", 1991, M. STOCKTON PRESS |
| 8TH INTERNATIONAL JUDAH FOLKMAN CONFERENCE, 8 October 2010 (2010-10-08) |
| A. R. GENNARO: "Remington: The Science and Practice of Pharmacy", 2006, LIPPINCOTT, WILLIAMS & WILKINS |
| ABRAHAM ET AL.: "Chaotic Mixer for Microchannels", SCIENCE, vol. 295, 2002, pages 647 - 651 |
| ABRAMOVA, MOLECULES, vol. 18, 2013, pages 1063 - 1075 |
| AKINC ET AL., MOL THER., vol. 17, 2009, pages 872 - 879 |
| AKINC ET AL., MOL THER., vol. 18, 2010, pages 1357 - 1364 |
| AKINC ET AL., NAT BIOTECHNOL., vol. 26, 2008, pages 561 - 569 |
| ALEKU ET AL., CANCER RES., vol. 68, 2008, pages 9788 - 9798 |
| ANAND; CHERESH, CURR OPIN HEMATOL, vol. 18, 2011, pages 171 - 176 |
| ANDRE ET AL., CURR GENE THER., vol. 10, 2010, pages 267 - 280 |
| BAIN ET AL., NUCLEIC ACIDS RESEARCH, vol. 20, no. 16, 1992, pages 4372 |
| BARTEL, CELL, vol. 136, 2009, pages 215 - 233 |
| BASHA ET AL., MOL THER., vol. 19, 2011, pages 2186 - 2200 |
| BASHA ET AL., MOL. THER., vol. 19, 2011, pages 2186 - 2200 |
| BATTIG ET AL., J. AM. CHEM. SOCIETY, vol. 134, 2012, pages 12410 - 12413 |
| BELLIVEAU, N.M. ET AL.: "Microfluidic synthesis of highly potent limit-size lipid nanoparticles for in vivo delivery of siRNA", MOLECULAR THERAPY-NUCLEIC ACIDS, vol. 1, 2012, pages E37 |
| BEN-ARIE ET AL., METHODS MOL BIOL., vol. 757, 2012, pages 497 - 507 |
| BENOIT ET AL., BIOMACROMOLECULES, vol. 12, 2011, pages 2708 - 2714 |
| BONAUER ET AL., CURR DRUG TARGETS, vol. 11, 2010, pages 943 - 949 |
| BONORA ET AL., NUCLEIC ACIDS RESEARCH, vol. 18, 1990, pages 3155 - 3159 |
| BOROVKOV ET AL., NUCLEIC ACIDS RESEARCH, vol. 38, no. 19, 2010, pages E180 |
| BRIEBA ET AL., BIOCHEMISTRY, vol. 41, 2002, pages 5144 - 5149 |
| CARILLO ET AL., SIAM J. APPLIED MATH., vol. 48, 1988, pages 1073 |
| CARON ET AL., MOL. THER., vol. 3, no. 3, 2001, pages 310 - 8 |
| CATELAS ET AL., TISSUE ENGINEERING, vol. 14, 2008, pages 119 - 128 |
| CHANG ET AL.: "Non-ionic amphiphilic biodegradable PEG-PLGA-PEG copolymer enhances gene delivery efficiency in rat skeletal muscle", J CONTROLLED RELEASE, vol. 118, 2007, pages 245 - 253, XP005912153, DOI: doi:10.1016/j.jconrel.2006.11.025 |
| CHATURVEDI ET AL., EXPERT OPIN DRUG DELIV., vol. 8, 2011, pages 1455 - 1468 |
| CHEN, D. ET AL.: "Rapid discovery of potent siRNA-containing lipid nanoparticles enabled by controlled microfluidic formulation", J AM CHEM SOC., vol. 134, no. 16, 2012, pages 6948 - 51, XP002715254, DOI: doi:10.1021/ja301621z |
| CHENG ET AL., PNAS, vol. 91, 1994, pages 5695 - 5699 |
| CHIARELLA ET AL., CURR GENE THER., vol. 10, 2010, pages 281 - 286 |
| CHO ET AL., ADV. FUNCT. MATER., vol. 19, 2009, pages 3112 - 3118 |
| CHU ET AL., ACE CHEM RES., 13 January 2012 (2012-01-13) |
| CLEARY ET AL., NATURE METHODS, vol. 1, no. 3, 2004, pages 241 - 247 |
| COMPTON, NATURE, vol. 350, 1991, pages 91 - 92 |
| CONTRERAS; RAO, LEUKEMIA, vol. 26, 20 December 2011 (2011-12-20), pages 404 - 413 |
| CONVERTINE ET AL., BIOMACROMOLECULES, 1 October 2010 (2010-10-01) |
| CRONICAN ET AL., ACS CHEM. BIOL., vol. 5, 2010, pages 747 - 752 |
| CUBURU ET AL.: "Intravaginal immunization with HPV vectors induces tissue-resident CD8+ T cell responses", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 122, no. 12, 2012, pages 4606 - 4620, XP002767208 |
| CUSI, HUM VACCIN, vol. 2, 2006, pages 1 - 7 |
| DAUBENDIEK ET AL., JACS, vol. 117, 1995, pages 7818 - 7819 |
| DAVIS, MOL PHARM., vol. 6, 2009, pages 659 - 668 |
| DAVIS, NATURE, vol. 464, 2010, pages 1067 - 1070 |
| DE JONGE ET AL., GENE THER., vol. 13, 2006, pages 400 - 411 |
| DEFOUGEROLLES, HUM GENE THER., vol. 19, 2008, pages 125 - 132 |
| DEKOKER ET AL., ADV DRUG DELIV REV., vol. 63, 2011, pages 748 - 761 |
| DESHAYES ET AL., CELL. MOL. LIFE SCI., vol. 62, no. 16, 2005, pages 1839 - 49 |
| EL-ANDALOUSSI ET AL., CURR. PHARM. DES., vol. 11, no. 28, 2003, pages 3597 - 611 1 |
| EL-SAGHEER ET AL., ACCOUNTS OF CHEMICAL RESEARCH, vol. 45, no. 8, 2012, pages 1258 - 1267 |
| ENDRES ET AL., BIOMATERIALS, vol. 32, 2011, pages 7721 - 7731 |
| ENSIGN ET AL., BIOMATERIALS, vol. 34, no. 28, 2013, pages 6922 - 9 |
| ESVELT ET AL., NATURE, vol. 472, no. 7344, 2011, pages 499 - 503 |
| FADL ET AL., PHARMAZIE, vol. 50, 1995, pages 382 - 7 |
| FANG ET AL., EXPERT OPIN BIOL THER., vol. 12, 2012, pages 385 - 389 |
| FARROW M ET AL: "Combinatorial recombination of gene fragments to construct a library of chimeras", CURRENT PROTOCOLS IN PROTEIN SCIENCE 2010 JOHN WILEY AND SONS INC. USA, no. SUPPL. 61, August 2010 (2010-08-01), pages 26.2.1 - 26.2.20, XP002733355, ISSN: 1934-3655 * |
| FENSKE; CULLIS, EXPERT OPIN DRUG DELIV., vol. 5, 2008, pages 25 - 44 |
| FOTIN-MLECZEK ET AL., J. IMMUNOTHER., vol. 34, 2011, pages 1 - 15 |
| FRANK-KAMENETSKY ET AL., PROC NATL ACAD SCI U S A., vol. 105, 2008, pages 11915 - 11920 |
| FREEMAN ET AL., BIOTECHNIQUES, vol. 26, no. 1, 1999, pages 112 - 22,124-5 |
| FROST, EXPERT OPIN. DRUG DELIV., vol. 4, 2007, pages 427 - 440 |
| FULLER ET AL., BIOMATERIALS, vol. 29, 2008, pages 1526 - 1532 |
| GEALL ET AL.: "Nonviral delivery of self amplifying RNA vaccines", PNAS, 2012 |
| GETNER; NALDINI, TISSUE ANTIGENS, vol. 80, 2012, pages 393 - 403 |
| GIBSON ET AL., NATURE METHODS, vol. 7, 2010, pages 901 - 903 |
| GIBSON ET AL., SCIENCE, vol. 329, 2010, pages 52 - 56 |
| GILJOHANN ET AL., JOURN. AMER. CHEM. SOC., vol. 131, no. 6, 2009, pages 2072 - 2073 |
| GODFRIN ET AL., EXPERT OPIN BIOL THER., vol. 12, 2012, pages 127 - 133 |
| GONZALEZ-ASEQUINOLAZA ET AL., GASTROENTEROLOGY, vol. 139, 2010, pages 726 - 729 |
| GOODCHILD, BIOCONJUGATE CHEMISTRY, vol. 1, no. 3, 1990, pages 165 - 187 |
| GORDON ET AL.: "Targeting the Vaginal Mucosa with Human Papillomavirus Psedudovirion Vaccines delivering SIV DNA", J IMMUNOL., vol. 188, no. 2, 2012, pages 714 - 723 |
| GRABOW; JAEGAR, NATURE MATERIALS, vol. 11, 2012, pages 269 - 269 |
| GREENE ET AL.: "Protective Groups in Organic Synthesis", 1991, WILEY & SONS |
| GRIMSON A; FARH KK; JOHNSTON WK; GARRETT-ENGELE P; LIM LP; BARTEL DP, MOL CELL, vol. 27, no. 1, 6 July 2007 (2007-07-06), pages 91 - 105 |
| GUTBIER ET AL., PULM PHARMACOL. THER., vol. 23, 2010, pages 334 - 344 |
| GUZAEV, CURRENT PROTOCOLS IN NUCLEIC ACID CHEMISTRY, vol. 3.1., 2013, pages L-3.1.60 |
| HEIDEL ET AL., PROC NATL ACAD SCI USA, vol. 104, 2007, pages 5715 - 21 |
| HEINJE, G.: "Sequence Analysis in Molecular Biology", 1987, ACADEMIC PRESS |
| HEYES ET AL., J CONTR REL., vol. 107, 2005, pages 276 - 287 |
| HEYES ET AL., MOL THER., vol. 15, 2007, pages 713 - 720 |
| HOJMAN, CURR GENE THER., vol. 10, 2010, pages 128 - 138 |
| HU ET AL., PROC NATL ACAD SCI U S A., vol. 108, 2011, pages 10980 - 10985 |
| HUCKRIEDE ET AL., J LIPOSOME RES., vol. 17, 2007, pages 39 - 47 |
| HU-LIESKOVAN ET AL., CANCER RES., vol. 65, 2005, pages 8984 - 8982 |
| HUNG ET AL.: "Ovarian Cancer Gene Therapy Using HPV-16 Psedudovirion Carrying the HSV-tk Gene", PLOS ONE, vol. 7, no. 7, 2012, pages E40983 |
| INNIS ET AL., PNAS, vol. 85, 1988, pages 9436 - 9440 |
| IWASE ET AL., NUCLEIC ACIDS RESEARCH, vol. 20, 1992, pages 1643 - 1648 |
| J CONTROL RELEASE, vol. 170, no. 2, 2013, pages 279 - 86 |
| J. MOL BIOL, vol. 266, no. 4, 1997, pages 814 - 830 |
| JEFFS ET AL., PHARM RES., vol. 22, 2005, pages 362 - 372 |
| JOHNSON ET AL.: "Role of Heparan Sulfate in Attachment to and Infection of the Murine Femal Genital Tract by Human Papillomavirus", J VIROLOGY, vol. 83, no. 5, 2009, pages 2067 - 2074 |
| JUDGE ET AL., J CLIN INVEST., vol. 119, 2009, pages 661 - 673 |
| JUNJIE LI ET AL., CURRENT BIOLOGY, vol. 15, 23 August 2005 (2005-08-23), pages 1501 - 1507 |
| KANG ET AL., NUCLEIC ACIDS RESEARCH, vol. 32, no. 4, 2004, pages 4411 - 4419 |
| KANWAR JAGAT R ET AL: "Chimeric aptamers in cancer cell-targeted drug delivery", CRITICAL REVIEWS IN BIOCHEMISTRY AND MOLECULAR BIOLOGY, vol. 46, no. 6, December 2011 (2011-12-01), pages 459 - 477, XP002733357 * |
| KATZ ET AL., ANESTH ANALG, vol. 98, 2004, pages 371 - 76 |
| KAUFMANN ET AL., MICROVASC RES, vol. 80, 2010, pages 286 - 293 |
| KAZIKAWA ET AL., J CONTR REL., vol. 111, 2006, pages 368 - 370 |
| KAZIKAWA ET AL., J CONTR REL., vol. 97, 2004, pages 345 - 356 |
| KIDD ET AL., JOURNAL OF CONTROLLED RELEASE, vol. 157, 2012, pages 80 - 85 |
| KIM ET AL., METHODS MOL BIOL., vol. 721, 2011, pages 339 - 353 |
| KINES ET AL.: "The initial steps leading to papillomavirus infection occur on the basement membrane prior to cell surface binding", PNAS, vol. 106, no. 48, 2009, pages 20458 - 20463, XP055094958, DOI: doi:10.1073/pnas.0908502106 |
| KIRPOTIN ET AL., CANCER RES., vol. 66, 2006, pages 6732 - 6740 |
| KOLHATKAR ET AL., CURR DRUG DISCOV TECHNOL., vol. 8, 2011, pages 197 - 206 |
| KUWAHARA MASAYASU ET AL: "Molecular evolution of functional nucleic acids with chemical modifications.", MOLECULES (BASEL, SWITZERLAND) AUG 2010, vol. 15, no. 8, August 2010 (2010-08-01), pages 5423 - 5444, XP002733356, ISSN: 1420-3049 * |
| LAI ET AL., ADV DRUG DELIV REV., vol. 61, no. 2, 2009, pages 158 - 171 |
| LAI ET AL., PNAS, vol. 104, no. 5, 2007, pages 1482 - 487 |
| LANDEN ET AL., CANCER BIOLOGY & THERAPY, vol. 5, no. 12, 2006, pages 1708 - 1713 |
| LANDGRAF ET AL., CELL, vol. 129, 2007, pages 1401 - 1414 |
| LANGEL: "Cell-Penetrating Peptides: Processes and Applications", 2002, CRC PRESS |
| LANGMUIR, vol. 28, 2012, pages 3633 - 40 |
| LAVRIK ET AL., BIOCHEMISTRY, vol. 40, 2001, pages 11777 - 11784 |
| LEE ET AL., NATURE NANOTECHNOLOGY, vol. 7, 2012, pages 389 - 393 |
| LEE ET AL.: "Thermosensitive Hydrogel as a Tgf-?1 Gene Delivery Vehicle Enhances Diabetic Wound Healing", PHARMACEUTICAL RESEARCH, vol. 20, no. 12, 2003, pages 1995 - 2000 |
| LEUSCHNER ET AL., NAT BIOTECHNOL, vol. 29, 2011, pages 1005 - 1010 |
| LEUSCHNER ET AL., NAT BIOTECHNOL., vol. 29, 2011, pages 1005 - 1010 |
| LI ET AL., J CONTR REL., vol. 142, 2010, pages 416 - 421 |
| LI ET AL., J CONTR REL., vol. 158, 2012, pages 108 - 114 |
| LI ET AL.: "Controlled Gene Delivery System Based on Thermosensitive Biodegradable Hydrogel", PHARMACEUTICAL RESEARCH, vol. 20, no. 6, 2003, pages 884 - 888 |
| LIU; HUANG, MOLECULAR THERAPY, 2010, pages 669 - 670 |
| LIZARDI ET AL., NATURE GENETICS, vol. 19, 1998, pages 225 - 232 |
| LOVE ET AL., PROC NATL ACAD SCI U S A., vol. 107, 2010, pages 1864 - 1869 |
| LUND ET AL., PHARM RES., vol. 27, 2010, pages 400 - 420 |
| MA ET AL.: "HPV pseudovirions as DNA delivery vehicles", THER DELIV., vol. 2, no. 4, 2011, pages 427 - 430 |
| MAHON ET AL., BIOCONJUG CHEM., vol. 21, 2010, pages 1448 - 1454 |
| MANGANIELLO ET AL., BIOMATERIALS, vol. 33, 2012, pages 2301 - 2309 |
| MARTIN ET AL., HELV. CHIM. ACTA, vol. 78, 1995, pages 486 - 504 |
| MARTINELLI ET AL., CLINICAL CHEMISTRY, vol. 42, 1996, pages 14 - 18 |
| MATSUDA; MAURO, PLOS ONE, vol. 5, 2010, pages 11 |
| MCNAUGHTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 106, 2009, pages 6111 - 6116 |
| MOORE ET AL., SCIENCE, vol. 256, 1992, pages 992 - 997 |
| MORRISSEY ET AL., NAT BIOTECHNOL., vol. 2, 2005, pages 1002 - 1007 |
| MURUGAIAH ET AL., ANALYTICAL BIOCHEMISTRY, vol. 401, 2010, pages 61 |
| MUSACCHIO; TORCHILIN, FRONT BIOSCI., vol. 16, 2011, pages 1388 - 1412 |
| NAGATA ET AL., NUCLEIC ACIDS RESEARCH, vol. 38, no. 21, 2010, pages 7845 - 7857 |
| NEWMAN; BETTINGER, GENE, vol. 14, 2007, pages 465 - 475 |
| NGUYEN; LEE: "Injectable Biodegradable Hydrogels", MACROMOLECULAR BIOSCIENCE, vol. 10, 2010, pages 563 - 579 |
| NIELSEN ET AL., SCIENCE, vol. 254, 1991, pages 1497 - 1500 |
| NOMURA ET AL., BIOORG MED. CHEM., vol. 11, 2003, pages 2453 - 61 |
| NORBURY: "Cytoplasmic RNA: a case of the tail wagging the dog", NATURE REVIEWS MOLECULAR CELL BIOLOGY; AOP, 29 August 2013 (2013-08-29) |
| NWE ET AL., CANCER BIOTHERAPY AND RADIOPHARMACEUTICALS, vol. 24, no. 3, 2009, pages 289 - 302 |
| OCHMAN ET AL., GENETICS, vol. 120, no. 3, 1988, pages 621 - 623 |
| PASCOLO, EXPERT OPIN. BIOL. THER., vol. 4, pages 1285 - 1294 |
| PATIL ET AL., CRIT REV THER DRUG CARRIER SYST., vol. 25, 2008, pages 1 - 61 |
| PEER ET AL., PROC NATL ACAD SCI U S A., vol. 104, 2007, pages 4095 - 4100 |
| PEER ET AL., PROC NATL ACAD SCI U S A., vol. 104, 6 December 2006 (2006-12-06), pages 4095 - 4100 |
| PEER ET AL., SCIENCE, vol. 319, 2008, pages 627 - 630 |
| PEER, J CONTROL RELEASE, vol. 20, 2010, pages 63 - 68 |
| PEER; LIEBERMAN, GENE THER., vol. 18, 2011, pages 1127 - 1133 |
| PITELLA ET AL., BIOMATERIALS, vol. 32, 2011, pages 3106 - 3114 |
| PLOS ONE, vol. 5, 2010, pages 11 |
| POLIDOROS ET AL., BIOTECHNIQUES, vol. 41, 2006, pages 35 - 42 |
| PON ET AL., NUCLEIC ACID RESEARCH, vol. 27, 1999, pages 1531 - 1538 |
| POSTEMA; GILJA, CURR PHARM BIOTECHNOL., vol. 8, 2007, pages 355 - 361 |
| REMINGTON; A. R. GENNARO: "The Science and Practice of pharmacy", 2006, LIPPINCOTT, WILLIAMS & WILKINS |
| ROBERTS ET AL.: "Genital transmission of HPV in a mouse model is potentiated by nonoxynol-9 and inhibited by carrageenan", NATURE MEDICINE, vol. 13, no. 7, 2007, pages 857 - 861, XP002537493, DOI: doi:10.1038/nm1598 |
| RODRIGUEZ ET AL., SCIENCE, vol. 339, 2013, pages 971 - 975 |
| ROZEMA ET AL., PROC NATL ACAD SCI U S A., vol. 104, 2007, pages 12982 - 12887 |
| SANTEL ET AL., GENE THER, vol. 13, 2006, pages 1222 - 1234 |
| SANTEL ET AL., GENE THER, vol. 13, 2006, pages 1360 - 1370 |
| SANTEL ET AL., GENE, vol. 13, 2006, pages 1222 - 1234 |
| SANTEL ET AL., GENE, vol. 13, 2006, pages 1360 - 1370 |
| SAWYER, CHEM BIOL, vol. 73, 2009, pages 3 - 6 |
| SCHAFFERT; WAGNER, GENE THER., vol. 16, 2008, pages 1131 - 1138 |
| SCHMITT ET AL., GASTROENTEROLOGY, vol. 139, 2010, pages 999 - 1007 |
| SCHROEDER ET AL., J INTERN MED., vol. 267, 2010, pages 9 - 21 |
| SCIENCE, vol. 255, 1992, pages 996 - 998 |
| SEMPLE ET AL., NATURE BIOTECH., vol. 28, 2010, pages 172 - 176 |
| SHI ET AL., ANGEW CHEM INT ED., vol. 50, 2011, pages 7027 - 7031 |
| SHIBA ET AL., NUCLEIC ACIDS RESEARCH, vol. 35, 2007, pages 3287 - 3296 |
| SIEGWART ET AL., PROC NATL ACAD SCI U S A., vol. 108, 2011, pages 12996 - 13001 |
| SIEGWART ET AL., PROC NATL ACAD SCI U S A., vol. 108, 2011, pages 12996 - 3001 |
| SINDELAR ET AL., NUCLEIC ACIDS RESEARCH, vol. 23, 1995, pages 982 - 987 |
| SINGHA ET AL., NUCLEIC ACID THER., vol. 2, 2011, pages 133 - 147 |
| SMITH ET AL., CANCER CHEMOTHERAPTY AND PHARMACOLOGY, vol. 44, no. 4, 1999, pages 267 - 274 |
| SONG ET AL., NAT BIOTECHNOL., vol. 23, 2005, pages 709 - 717 |
| SONG ET AL., NATURE BIOTECHNOL., vol. 23, 2005, pages 709 - 717 |
| SPICER; MIKOS, JOURNAL OF CONTROLLED RELEASE, vol. 148, 2010, pages 49 - 55 |
| SRINIVASAN ET AL., METHODS MOL BIOL., vol. 820, 2012, pages 105 - 116 |
| STARK ET AL., RNA, vol. 12, 2006, pages 2014 - 2019 |
| STEPHEN F. ALTSCHUL; THOMAS L. MADDEN; ALEJANDRO A. SCHDFFER; JINGHUI ZHANG; ZHENG ZHANG; WEBB MILLER; DAVID J. LIPMAN: "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402, XP002905950, DOI: doi:10.1093/nar/25.17.3389 |
| STRUMBERG ET AL., INT J CLIN PHARMACOL THER, vol. 50, 2012, pages 76 - 78 |
| SU ET AL., MOL PHARM., vol. 8, no. 3, 6 June 2011 (2011-06-06), pages 774 - 87 |
| SUBRAMANYA ET AL., MOL THER., vol. 18, 2010, pages 2028 - 2037 |
| SULLIVAN ET AL., EXPERT OPIN DRUG DELIV., vol. 7, 2010, pages 1433 - 1446 |
| T. E. CREIGHTON: "Proteins: Structure and Molecular Properties", 1983, W.H. FREEMAN & CO., pages: 79 - 86 |
| TAKITA, DNA RESEARCH, vol. 20, no. 4, 2013, pages 1 - 10 |
| TOURIOL ET AL., BIOLOGY OF THE CELL, vol. 95, 2003, pages 169 - 178 |
| VERDINE; HILINSKI, METHODS ENZYMOL., vol. 503, 2012, pages 3 - 33 |
| VERMA; ECKSTEIN, ANNUAL REVIEW OF BIOCHEMISTRY, vol. 76, 1998, pages 99 - 134 |
| WALKER ET AL., PNAS, vol. 89, 1992, pages 392 - 396 |
| WANG ET AL., NAT MATER., vol. 5, 2006, pages 791 - 796 |
| WANG ET AL., NUCLEIC ACIDS RES., vol. 37, 2009, pages D933 - 7 |
| WEIDE ET AL., J IMMUNOTHER., vol. 31, 2008, pages 180 - 188 |
| WEIDE ET AL., J IMMUNOTHER., vol. 32, 2009, pages 498 - 507 |
| WHEELER ET AL., GENE THERAPY, vol. 6, 1999, pages 271 - 281 |
| WHITEHEAD ET AL., MOL. THER., vol. 19, 2011, pages 1688 - 1694 |
| WHITESIDES, GEORGE M.: "The Origins and the Future of Microfluidics", NATURE, vol. 442, 2006, pages 368 - 373, XP055123139, DOI: doi:10.1038/nature05058 |
| WIEDMANN ET AL., PCR METHODS AND APPLICATION, vol. 3, no. 4, 1994, pages S51 - S64 |
| YANG ET AL., ANGEW. CHEM. INT. ED., vol. 50, 2011, pages 2597 - 2600 |
| YANG ET AL., MOL THER., vol. 20, 2012, pages 609 - 615 |
| YOON; PARK, EXPERT OPIN DRUG DELIV., vol. 7, 2010, pages 321 - 330 |
| YU ET AL., MOL MEMBR BIOL., vol. 27, 2010, pages 286 - 298 |
| ZHANG ET AL., ACS NANO, vol. 2, no. 8, 2008, pages 1696 - 1702 |
| ZHANG ET AL., GENE THERAPY, vol. 6, 1999, pages 1438 - 1447 |
| ZHAO ET AL., EXPERT OPIN DRUG DELIV., vol. 5, 2008, pages 309 - 319 |
| ZHU ET AL., NUCLEIC ACIDS RESEARCH, 2013 |
| ZIMMERMANN ET AL., NATURE, vol. 441, 2006, pages 111 - 114 |
Cited By (112)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11298426B2 (en) | 2003-10-14 | 2022-04-12 | BioNTech SE | Recombinant vaccines and use thereof |
| US10106800B2 (en) | 2005-09-28 | 2018-10-23 | Biontech Ag | Modification of RNA, producing an increased transcript stability and translation efficiency |
| US12385049B2 (en) | 2005-09-28 | 2025-08-12 | BioNTech SE | Modification of RNA, producing an increased transcript stability and translation efficiency |
| US9447164B2 (en) | 2010-08-06 | 2016-09-20 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9181319B2 (en) | 2010-08-06 | 2015-11-10 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9937233B2 (en) | 2010-08-06 | 2018-04-10 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| US9701965B2 (en) | 2010-10-01 | 2017-07-11 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| US12419957B2 (en) | 2011-03-31 | 2025-09-23 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US12364763B2 (en) | 2011-03-31 | 2025-07-22 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US12502431B2 (en) | 2011-03-31 | 2025-12-23 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US9533047B2 (en) | 2011-03-31 | 2017-01-03 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US11911474B2 (en) | 2011-03-31 | 2024-02-27 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US10898574B2 (en) | 2011-03-31 | 2021-01-26 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US12409226B2 (en) | 2011-03-31 | 2025-09-09 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US9950068B2 (en) | 2011-03-31 | 2018-04-24 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US10738355B2 (en) | 2011-05-24 | 2020-08-11 | Tron-Translationale Onkologie An Der Universitätsmedizin Der Johannes Gutenberg-Universität Mainz Ggmbh | Individualized vaccines for cancer |
| US11248264B2 (en) | 2011-05-24 | 2022-02-15 | Tron-Translationale Onkologie An Der Universitätsmedizin Der Johannes Gutenberg-Universität Mainz Ggmbh | Individualized vaccines for cancer |
| US9295689B2 (en) | 2011-12-16 | 2016-03-29 | Moderna Therapeutics, Inc. | Formulation and delivery of PLGA microspheres |
| US9186372B2 (en) | 2011-12-16 | 2015-11-17 | Moderna Therapeutics, Inc. | Split dose administration |
| US10485884B2 (en) | 2012-03-26 | 2019-11-26 | Biontech Rna Pharmaceuticals Gmbh | RNA formulation for immunotherapy |
| US11559587B2 (en) | 2012-03-26 | 2023-01-24 | Tron-Translationale Onkologie An Der Universitätsmedizin Der Johannes Gutenberg-Universität Mainz Ggmbh | RNA formulation for immunotherapy |
| US10703789B2 (en) | 2012-04-02 | 2020-07-07 | Modernatx, Inc. | Modified polynucleotides for the production of secreted proteins |
| US10577403B2 (en) | 2012-04-02 | 2020-03-03 | Modernatx, Inc. | Modified polynucleotides for the production of secreted proteins |
| US9233141B2 (en) | 2012-04-02 | 2016-01-12 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders |
| US9675668B2 (en) | 2012-04-02 | 2017-06-13 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding hepatitis A virus cellular receptor 2 |
| US9572897B2 (en) | 2012-04-02 | 2017-02-21 | Modernatx, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9107886B2 (en) | 2012-04-02 | 2015-08-18 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding basic helix-loop-helix family member E41 |
| US9782462B2 (en) | 2012-04-02 | 2017-10-10 | Modernatx, Inc. | Modified polynucleotides for the production of proteins associated with human disease |
| US9814760B2 (en) | 2012-04-02 | 2017-11-14 | Modernatx, Inc. | Modified polynucleotides for the production of biologics and proteins associated with human disease |
| US9827332B2 (en) | 2012-04-02 | 2017-11-28 | Modernatx, Inc. | Modified polynucleotides for the production of proteins |
| US9828416B2 (en) | 2012-04-02 | 2017-11-28 | Modernatx, Inc. | Modified polynucleotides for the production of secreted proteins |
| US9114113B2 (en) | 2012-04-02 | 2015-08-25 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding citeD4 |
| US9878056B2 (en) | 2012-04-02 | 2018-01-30 | Modernatx, Inc. | Modified polynucleotides for the production of cosmetic proteins and peptides |
| US9149506B2 (en) | 2012-04-02 | 2015-10-06 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding septin-4 |
| US9192651B2 (en) | 2012-04-02 | 2015-11-24 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of secreted proteins |
| US9303079B2 (en) | 2012-04-02 | 2016-04-05 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9301993B2 (en) | 2012-04-02 | 2016-04-05 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding apoptosis inducing factor 1 |
| US9220792B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding aquaporin-5 |
| US9216205B2 (en) | 2012-04-02 | 2015-12-22 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding granulysin |
| US9255129B2 (en) | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1 |
| US9283287B2 (en) | 2012-04-02 | 2016-03-15 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of nuclear proteins |
| US9095552B2 (en) | 2012-04-02 | 2015-08-04 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding copper metabolism (MURR1) domain containing 1 |
| US9254311B2 (en) | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins |
| US9221891B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | In vivo production of proteins |
| US9220755B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders |
| US9587003B2 (en) | 2012-04-02 | 2017-03-07 | Modernatx, Inc. | Modified polynucleotides for the production of oncology-related proteins and peptides |
| US10385106B2 (en) | 2012-04-02 | 2019-08-20 | Modernatx, Inc. | Modified polynucleotides for the production of secreted proteins |
| US9597380B2 (en) | 2012-11-26 | 2017-03-21 | Modernatx, Inc. | Terminally modified RNA |
| US11504419B2 (en) | 2012-11-28 | 2022-11-22 | BioNTech SE | Individualized vaccines for cancer |
| US10155031B2 (en) | 2012-11-28 | 2018-12-18 | Biontech Rna Pharmaceuticals Gmbh | Individualized vaccines for cancer |
| US11603399B2 (en) | 2013-03-13 | 2023-03-14 | Modernatx, Inc. | Long-lived polynucleotide molecules |
| US10258698B2 (en) | 2013-03-14 | 2019-04-16 | Modernatx, Inc. | Formulation and delivery of modified nucleoside, nucleotide, and nucleic acid compositions |
| US10138507B2 (en) | 2013-03-15 | 2018-11-27 | Modernatx, Inc. | Manufacturing methods for production of RNA transcripts |
| US10590161B2 (en) | 2013-03-15 | 2020-03-17 | Modernatx, Inc. | Ion exchange purification of mRNA |
| US11845772B2 (en) | 2013-03-15 | 2023-12-19 | Modernatx, Inc. | Ribonucleic acid purification |
| US10077439B2 (en) | 2013-03-15 | 2018-09-18 | Modernatx, Inc. | Removal of DNA fragments in mRNA production process |
| US11377470B2 (en) | 2013-03-15 | 2022-07-05 | Modernatx, Inc. | Ribonucleic acid purification |
| US10858647B2 (en) | 2013-03-15 | 2020-12-08 | Modernatx, Inc. | Removal of DNA fragments in mRNA production process |
| US11222711B2 (en) | 2013-05-10 | 2022-01-11 | BioNTech SE | Predicting immunogenicity of T cell epitopes |
| US11027025B2 (en) | 2013-07-11 | 2021-06-08 | Modernatx, Inc. | Compositions comprising synthetic polynucleotides encoding CRISPR related proteins and synthetic sgRNAs and methods of use |
| US10815291B2 (en) | 2013-09-30 | 2020-10-27 | Modernatx, Inc. | Polynucleotides encoding immune modulating polypeptides |
| US10023626B2 (en) | 2013-09-30 | 2018-07-17 | Modernatx, Inc. | Polynucleotides encoding immune modulating polypeptides |
| US10385088B2 (en) | 2013-10-02 | 2019-08-20 | Modernatx, Inc. | Polynucleotide molecules and uses thereof |
| US10286086B2 (en) | 2014-06-19 | 2019-05-14 | Modernatx, Inc. | Alternative nucleic acid molecules and uses thereof |
| EP3157573A4 (en) * | 2014-06-19 | 2018-02-21 | Moderna Therapeutics, Inc. | Alternative nucleic acid molecules and uses thereof |
| EP3157572A4 (en) * | 2014-06-19 | 2018-02-14 | Moderna Therapeutics, Inc. | Alternative nucleic acid molecules and uses thereof |
| EP4159741A1 (en) | 2014-07-16 | 2023-04-05 | ModernaTX, Inc. | Method for producing a chimeric polynucleotide encoding a polypeptide having a triazole-containing internucleotide linkage |
| US10407683B2 (en) | 2014-07-16 | 2019-09-10 | Modernatx, Inc. | Circular polynucleotides |
| WO2016014846A1 (en) | 2014-07-23 | 2016-01-28 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of intrabodies |
| US12220484B2 (en) | 2014-09-25 | 2025-02-11 | BioNTech SE | Stable formulations of lipids and liposomes |
| US11173120B2 (en) | 2014-09-25 | 2021-11-16 | Biontech Rna Pharmaceuticals Gmbh | Stable formulations of lipids and liposomes |
| US11156617B2 (en) | 2015-02-12 | 2021-10-26 | BioNTech RNA Pharmaceuticals GbmH | Predicting T cell epitopes useful for vaccination |
| US12109274B2 (en) | 2015-09-17 | 2024-10-08 | Modernatx, Inc. | Polynucleotides containing a stabilizing tail region |
| US12071620B2 (en) | 2015-09-17 | 2024-08-27 | Modernatx, Inc. | Polynucleotides containing a morpholino linker |
| US11434486B2 (en) | 2015-09-17 | 2022-09-06 | Modernatx, Inc. | Polynucleotides containing a morpholino linker |
| US11590157B2 (en) | 2015-10-05 | 2023-02-28 | Modernatx, Inc. | Methods for therapeutic administration of messenger ribonucleic acid drugs |
| US12246030B2 (en) | 2015-10-05 | 2025-03-11 | Modernatx, Inc. | Methods for therapeutic administration of messenger ribonucleic acid drugs |
| US10849920B2 (en) | 2015-10-05 | 2020-12-01 | Modernatx, Inc. | Methods for therapeutic administration of messenger ribonucleic acid drugs |
| US12516333B2 (en) | 2015-10-07 | 2026-01-06 | BioNTech SE | 3′-UTR sequences for stabilization of RNA |
| US11492628B2 (en) | 2015-10-07 | 2022-11-08 | BioNTech SE | 3′-UTR sequences for stabilization of RNA |
| JP2023024669A (ja) * | 2015-10-22 | 2023-02-16 | モデルナティエックス インコーポレイテッド | 癌ワクチン |
| JP7625568B2 (ja) | 2015-10-22 | 2025-02-03 | モデルナティエックス インコーポレイテッド | 癌ワクチン |
| WO2017120612A1 (en) | 2016-01-10 | 2017-07-13 | Modernatx, Inc. | Therapeutic mrnas encoding anti ctla-4 antibodies |
| US12385034B2 (en) | 2016-06-24 | 2025-08-12 | Modernatx, Inc. | Methods and apparatus for filtration |
| WO2018009838A1 (en) | 2016-07-07 | 2018-01-11 | Rubius Therapeutics, Inc. | Compositions and methods related to therapeutic cell systems expressing exogenous rna |
| US12582609B2 (en) | 2016-10-21 | 2026-03-24 | Modernatx, Inc. | Cancer vaccines |
| US11820979B2 (en) * | 2016-12-23 | 2023-11-21 | Visterra, Inc. | Binding polypeptides and methods of making the same |
| CN110366557B (zh) * | 2016-12-23 | 2024-04-09 | 威特拉公司 | 结合多肽及其制备方法 |
| CN110366557A (zh) * | 2016-12-23 | 2019-10-22 | 威特拉公司 | 结合多肽及其制备方法 |
| WO2018165547A1 (en) * | 2017-03-10 | 2018-09-13 | University Of Louisville Research Foundation, Inc. | Fasl-engineered biomaterials with immunomodulatory function |
| EP4299749A3 (en) * | 2017-03-10 | 2024-03-27 | University Of Louisville Research Foundation, Inc. | Fasl-engineered biomaterials with immunomodulatory function |
| US11602547B2 (en) | 2017-03-10 | 2023-03-14 | University Of Louisville Research Foundation, Inc. | FasL-engineered biomaterials with immunomodulatory function |
| US12270813B2 (en) | 2017-06-09 | 2025-04-08 | BioNTech SE | Methods for predicting the usefulness of disease specific amino acid modifications for immunotherapy |
| WO2019008335A1 (en) | 2017-07-07 | 2019-01-10 | Avacta Life Sciences Limited | SCAFFOLD PROTEINS |
| EP4467650A2 (en) | 2017-07-07 | 2024-11-27 | Avacta Life Sciences Limited | Scaffold proteins |
| US12139617B2 (en) | 2017-12-22 | 2024-11-12 | North Carolina State University | Polymeric fluorophores, compositions comprising the same, and methods of preparing and using the same |
| WO2020047394A1 (en) * | 2018-08-31 | 2020-03-05 | The Trustees Of The University Of Pennsylvania | Injectable hydrogels for local delivery to the heart |
| CN109796769B (zh) * | 2018-12-27 | 2021-06-25 | 李新虹 | 一种医学护理手套 |
| CN109796769A (zh) * | 2018-12-27 | 2019-05-24 | 李新虹 | 一种医学护理手套 |
| WO2020233706A1 (zh) * | 2019-05-22 | 2020-11-26 | 华东理工大学 | 一种治疗躁狂型精神障碍及精神分裂症的药物 |
| WO2021074695A1 (en) | 2019-10-16 | 2021-04-22 | Avacta Life Sciences Limited | PD-L1 INHIBITOR - TGFβ INHIBITOR BISPECIFIC DRUG MOIETIES. |
| US12115230B2 (en) | 2020-04-09 | 2024-10-15 | Verve Therapeutics, Inc. | Base editing of ANGPTL3 and methods of using same for treatment of disease |
| WO2021249786A1 (en) | 2020-06-09 | 2021-12-16 | Avacta Life Sciences Limited | Sars-cov2 diagnostic polypeptides and methods |
| CN112162052A (zh) * | 2020-11-06 | 2021-01-01 | 深圳市格物正源质量标准系统有限公司 | 一种水产品中兽药多残留的测定方法 |
| WO2022234003A1 (en) | 2021-05-07 | 2022-11-10 | Avacta Life Sciences Limited | Cd33 binding polypeptides with stefin a protein |
| WO2023057946A1 (en) | 2021-10-07 | 2023-04-13 | Avacta Life Sciences Limited | Serum half-life extended pd-l1 binding polypeptides |
| WO2023057567A1 (en) | 2021-10-07 | 2023-04-13 | Avacta Life Sciences Limited | Pd-l1 binding affimers |
| WO2023153876A1 (ko) | 2022-02-10 | 2023-08-17 | 주식회사 아피셀테라퓨틱스 | Cd40l에 특이적으로 결합하는 스테핀 a 단백질 변이체 및 이의 용도 |
| WO2023218243A1 (en) | 2022-05-12 | 2023-11-16 | Avacta Life Sciences Limited | Lag-3/pd-l1 binding fusion proteins |
| WO2025194138A1 (en) | 2024-03-14 | 2025-09-18 | Tessera Therapeutics, Inc. | St1cas9 compositions and methods for modulating a genome |
| CN118878604A (zh) * | 2024-09-27 | 2024-11-01 | 北京炫景瑞医药科技有限公司 | 磷酯骨架修饰的核苷酸及寡核苷酸 |
| CN118878604B (zh) * | 2024-09-27 | 2025-01-24 | 北京炫景瑞医药科技有限公司 | 磷酯骨架修饰的核苷酸及寡核苷酸 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP3041934A1 (en) | 2016-07-13 |
| US20160194625A1 (en) | 2016-07-07 |
| AU2014315287A1 (en) | 2015-03-12 |
| JP2016530294A (ja) | 2016-09-29 |
| CA2923029A1 (en) | 2015-03-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12274743B2 (en) | Nucleic acid vaccines | |
| US10815291B2 (en) | Polynucleotides encoding immune modulating polypeptides | |
| US9925277B2 (en) | Polynucleotide compositions containing amino acids | |
| US20160194625A1 (en) | Chimeric polynucleotides | |
| US20170173128A1 (en) | Targeted adaptive vaccines | |
| US20160194368A1 (en) | Circular polynucleotides | |
| AU2014329452B2 (en) | Polynucleotides encoding low density lipoprotein receptor | |
| US20170204152A1 (en) | Chimeric polynucleotides | |
| HK40076592A (en) | Nucleic acid vaccines | |
| HK40072892A (en) | Nucleic acid vaccines |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14766339 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2923029 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14915959 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2016540348 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2014766339 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2014766339 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2014315287 Country of ref document: AU Date of ref document: 20140903 Kind code of ref document: A |