WO2015031694A2 - Oligonucleotide probes and uses thereof - Google Patents
Oligonucleotide probes and uses thereof Download PDFInfo
- Publication number
- WO2015031694A2 WO2015031694A2 PCT/US2014/053306 US2014053306W WO2015031694A2 WO 2015031694 A2 WO2015031694 A2 WO 2015031694A2 US 2014053306 W US2014053306 W US 2014053306W WO 2015031694 A2 WO2015031694 A2 WO 2015031694A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cancer
- disease
- oligonucleotides
- oligonucleotide
- aptamer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1048—SELEX
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
- C12Q2525/10—Modifications characterised by
- C12Q2525/205—Aptamer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- EFS-WEB server as authorized and set forth in MPEP ⁇ 1730 II.B.2(a), is incorporated herein by reference in its entirety for all purposes.
- sequence listing is within the electronically filed text file that is identified as follows:
- the invention relates generally to the field of aptamers capable of binding to microvesicle surface antigens, which are useful as therapeutics in and diagnostics of cancer and/or other diseases or disorders in which microvesicles implicated.
- the invention further relates to materials and methods for the administration of aptamers capable of binding to microvesicles.
- the microvesicles may be derived from cells indicative of cancer, e.g., a breast cancer.
- Aptamers are multi-meric nucleic acid molecules having specific binding affinity to molecules, which may be through interactions other than classic Watson-Crick base pairing.
- the terms aptamer, oligonucleotide, polynucleotide, or the like may be used interchangeably herein.
- Aptamers like peptides generated by phage display or monoclonal antibodies (“mAbs"), are capable of specifically binding to selected targets and modulating the target's activity, e.g., through binding aptamers may block their target's ability to function.
- mAbs monoclonal antibodies
- aptamers Created by an in vitro selection process from pools of random sequence oligonucleotides, aptamers have been generated for over 100 proteins including growth factors, transcription factors, enzymes, immunoglobulins, and receptors.
- a typical aptamer is 10- 15 kDa in size (30-45 nucleotides), binds its target with sub-nanomolar affinity, and discriminates against closely related targets (e.g., aptamers will typically not bind other proteins from the same gene family).
- a series of structural studies have shown that aptamers are capable of using the same types of binding interactions (e.g., hydrogen bonding, electrostatic complementarity, hydrophobic contacts, steric exclusion) that drive affinity and specificity in antibody-antigen complexes.
- Aptamers have a number of desirable characteristics for use as therapeutics and diagnostics including high specificity and affinity, biological efficacy, and excellent pharmacokinetic properties. In addition, they offer specific competitive advantages over antibodies and other protein biologies, for example:
- Toxicity and Immunogenicity Aptamers as a class have demonstrated little or no toxicity or immunogenicity. In chronic dosing of rats or woodchucks with high levels of aptamer (10 mg/kg daily for 90 days), no toxicity is observed by any clinical, cellular, or biochemical measure. Whereas the efficacy of many monoclonal antibodies can be severely limited by immune response to antibodies themselves, it is extremely difficult to elicit antibodies to aptamers most likely because aptamers cannot be presented by T-cells via the MHC and the immune response is generally trained not to recognize nucleic acid fragments.
- aptamers can be administered by subcutaneous injection (aptamer bioavailability via subcutaneous administration is >80% in monkey studies (Tucker et al., J. Chromatography B. 732: 203-212, 1999)). This difference is primarily due to the comparatively low solubility and thus large volumes necessary for most therapeutic mAbs. With good solubility (>150 mg/mL) and comparatively low molecular weight (aptamer: 10-50 kDa; antibody: 150 kDa), a weekly dose of aptamer may be delivered by injection in a volume of less than 0.5 mL. In addition, the small size of aptamers allows them to penetrate into areas of conformational constrictions that do not allow for antibodies or antibody fragments to penetrate, presenting yet another advantage of aptamer-based therapeutics or prophylaxis.
- compositions and methods of the invention provide aptamers that bind biomarkers of interest such as microvesicle surface antigens or functional fragments of microvesicle surface antigens.
- biomarkers of interest such as microvesicle surface antigens or functional fragments of microvesicle surface antigens.
- aptamers of the invention are used in diagnostic, prognostic or theranostic processes to screen a biological sample for the presence or levels of microvesicle surface antigens determined to provide a diagnostic readout. The diagnosis may be related to a cancer, e.g., a breast cancer.
- aptamers of the invention are chemically modified or composed in a pharmaceutical composition for therapeutic applications.
- the invention provides an oligonucleotide at least 50, 55, 60, 65, 70, 75, 80, 85, 90,
- the invention provides a plurality of oligonucleotides comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 200000, 300000, 400000, 500000, 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , or at least 10 18 different oligonucleot
- the invention provides a plurality of oligonucleotides comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 200000, 300000, 400000, or 500000 different oligonucleotide sequences, wherein each of the oligonucleotide sequences or a portion thereof is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to a sequence selected from SEQ ID NOs.
- the invention provides an oligonucleotide probe library comprising at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or at least 99% of the oligonucleotides listed in SEQ ID NOs. 10559-510558.
- the invention provides an oligonucleotide comprising a nucleic acid sequence or a portion thereof that is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to a sequence selected from SEQ ID NOs. 510559-510578.
- the invention provides a plurality of oligonucleotides comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 different oligonucleotide sequences, wherein each of the oligonucleotide sequences or a portion thereof is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to SEQ ID NOs. 510559-510578.
- the invention provides an oligonucleotide comprising a nucleic acid sequence or a portion thereof that is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to a sequence selected from SEQ ID NOs. 510579-510598.
- the invention provides a plurality of oligonucleotides comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 different oligonucleotide sequences, wherein each of the oligonucleotide
- the invention provides an oligonucleotide comprising a nucleic acid sequence or a portion thereof that is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to a sequence selected from SEQ ID NOs. 510599-510763.
- the invention provides a plurality of oligonucleotides comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 120, 125, 130, 140, 150, 160 or 165 different oligonucleotide sequences, wherein each of the oligonucleotide sequences or a portion thereof is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to SEQ ID NOs. 510599-510763.
- the invention provides a plurality of oligonucleotides comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 125, 130, 140, 150, 160 or 165 different oligonucleotide sequences, wherein each of the oligonucleotide sequences or a portion thereof is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to the SEQ ID NOs. in a row in Table 16.
- nucleic acid sequences provided herein can also be modified as desired so long as the functional aspects are still maintained (e.g., binding to various targets or ability to characterize a phenotype). Such a modification may be referred to as a "functional modification" herein.
- a functional modification may enhance or have minimal or no effect on functional aspects of an oligonucleotide.
- the oligonucleotides may comprise DNA or RNA, incorporate various non-natural nucleotides, incorporate other chemical modifications, or comprise various deletions or insertions. Such modifications may facilitate synthesis, stability, delivery, labeling, etc, or may have little to no effect in practice.
- nucleotides in an oligonucleotide may be substituted while maintaining functional aspects of the oligonucleotide.
- 5' and 3' flanking regions may be substituted.
- only a portion of an oligonucleotide may be determined to direct its functionality such that other portions can be deleted or substituted.
- the invention also provides a method comprising contacting an oligonucleotide or plurality of oligonucleotides with a sample and detecting the presence or level of binding of the oligonucleotide or plurality of oligonucleotides to a target in the sample, wherein the oligonucleotide or plurality of oligonucleotides can be those provided by the invention above.
- the sample may comprise a biological sample, an organic sample, an inorganic sample, a tissue, a cell culture, a bodily fluid, blood, serum, a cell, a microvesicle, a protein complex, a lipid complex, a carbohydrate, or any combination, fraction or variation thereof.
- the target may comprise a cell, an organelle, a protein complex, a lipoprotein, a carbohydrate, a microvesicle, a membrane fragment, a small molecule, a heavy metal, a toxin, or a drug.
- the invention provides a method comprising: a) contacting a biological sample comprising microvesicles with an oligonucleotide probe library, wherein optionally the oligonucleotide
- probe library comprises an oligonucleotide or plurality of oligonucleotides those provided by the invention above; b) identifying oligonucleotides bound to at least a portion of the microvesicles; and c) characterizing the sample based on a profile of the identified oligonucleotides.
- the invention provides a method comprising: a) contacting a sample with an oligonucleotide probe library comprising at least 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , or at least 10 18 different oligonucleotide sequences oligonucleotides to form a mixture in solution, wherein the oligonucleotides are capable of binding a plurality of entities in the sample to form complexes, wherein optionally the oligonucleotide probe library comprises an oligonucleotide or plurality of oligonucleotides as provided by the invention above; b) partitioning the complexes formed in step (a) from the mixture; and c) detecting oligonucleotides present in the complexes partitioned in step (b) to identify an oligonucleotide profile for
- the detecting step comprises performing sequencing of all or some of the oligonucleotides in the complexes, amplification of all or some of the oligonucleotides in the complexes, and/or hybridization of all or some of the oligonucleotides in the complexes to an array.
- the array can be any useful array, such as a planar or particle-based array.
- the invention provides a method for generating an enriched oligonucleotide probe library comprising: a) contacting a first oligonucleotide library with a biological test sample and a biological control sample, wherein complexes are formed between biological entities present in the biological samples and a plurality of oligonucleotides present in the first oligonucleotide library; b) partitioning the complexes formed in step (a) and isolating the oligonucleotides in the complexes to produce a subset of oligonucleotides for each of the biological test sample and biological control sample; c) contacting the subsets of oligonucleotides in (b) with the biological test sample and biological control sample wherein complexes are formed between biological entities present in the biological samples and a second plurality of oligonucleotides present in the subsets of oligonucleotides to generate a second subset group of oli
- the invention provides a plurality of oligonucleotides comprising at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 200000, 300000, 400000, or 500000 different oligonucleotide sequences, wherein the plurality results from the method in this paragraph, wherein the library is capable of distinguishing a first phenotype from a second phenotype.
- the first phenotype comprises a disease or disorder and the second phenotype comprises a healthy state; or wherein the first phenotype comprises a disease or disorder and the second phenotype comprises a different disease or disorder; or wherein the first phenotype comprises a stage or progression of a disease or disorder and the second phenotype comprises a different stage or progression of the same disease or disorder; or wherein the first phenotype comprises a positive response to a therapy and the second phenotype comprises a negative response to the same therapy.
- the invention provides a method of characterizing a disease or disorder, comprising: a) contacting a biological test sample with the oligonucleotide or plurality of oligonucleotides provided by the invention; b) detecting a presence or level of complexes formed in step (a) between the oligonucleotide or plurality of oligonucleotides provided by the invention and a target in the biological test sample; and c) comparing the presence or level detected in step (b) to a reference level from a biological control sample, thereby characterizing the disease or disorder.
- the step of detecting may comprise performing sequencing of all or some of the oligonucleotides in the complexes, amplification of all or some of the oligonucleotides in the complexes, and/or hybridization of all or some of the oligonucleotides in the complexes to an array.
- the sequencing may be high-throughput or next generation sequencing.
- the biological test sample and biological control sample may each comprise a tissue sample, a cell culture, or a biological fluid.
- the biological fluid comprises a bodily fluid.
- useful bodily fluids within the method of the invention comprise peripheral blood, sera, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or pre-ejaculatory fluid, female ejaculate, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities
- the bodily fluid comprises blood, serum or plasma.
- the biological fluid may comprise microvesicles.
- the complexes may be formed between the oligonucleotide or plurality of oligonucleotides and at least one of the microvesicles.
- the biological test sample and biological control sample may further comprise isolated microvesicles, wherein optionally the microvesicles are isolated using at least one of chromatography, filtration, ultrafiltration, centrifugation, ultracentrifugation, flow cytometry, affinity capture (e.g., to a planar surface, column or bead), polymer precipitation, and using microfluidics.
- the vesicles can also be isolated after contact with the oligonucleotide or plurality of oligonucleotides.
- the oligonucleotide or plurality of oligonucleotides binds a polypeptide or fragment thereof.
- the polypeptide or fragment thereof can be soluble or membrane bound, wherein optionally the membrane comprises a microvesicle membrane.
- the membrane could also be from a cell or a fragment of a cell of vesicle.
- the polypeptide or fragment thereof comprises a biomarker in Table 3 or Table 4.
- the polypeptide or fragment thereof could be a general vesicle marker such as in Table 3 or a tissue -related or disease-related marker such as in Table 4.
- the oligonucleotide or plurality of oligonucleotides may bind a microvesicle surface antigen in the biological sample.
- the oligonucleotide or plurality of oligonucleotides can be enriched from a na ' ive library against microvesicles.
- the disease or disorder detected by the oligonucleotide, plurality of oligonucleotides, or methods provided here may comprise any appropriate disease or disorder of interest, including without limitation
- Rheumatoid Arthritis Renal cell carcinoma, Squamous cell carcinoma of skin, Adenocarcinoma of the stomach, carcinoma of the thyroid gland, Testicular cancer, ulcerative colitis, or Uterine adenocarcinoma.
- the disease or disorder comprises a cancer, a premalignant condition, an inflammatory disease, an immune disease, an autoimmune disease or disorder, a cardiovascular disease or disorder, neurological disease or disorder, infectious disease or pain.
- the cancer can include without limitation one of acute lymphoblastic leukemia; acute myeloid leukemia; adrenocortical carcinoma;
- AIDS-related cancers AIDS-related lymphoma; anal cancer; appendix cancer; astrocytomas; atypical teratoid/rhabdoid tumor; basal cell carcinoma; bladder cancer; brain stem glioma; brain tumor (including brain stem glioma, central nervous system atypical teratoid/rhabdoid tumor, central nervous system embryonal tumors, astrocytomas, craniopharyngioma, ependymoblastoma, ependymoma,
- medulloblastoma medulloepithelioma, pineal parenchymal tumors of intermediate differentiation, supratentorial primitive neuroectodermal tumors and pineoblastoma
- breast cancer bronchial tumors; Burkitt lymphoma; cancer of unknown primary site; carcinoid tumor; carcinoma of unknown primary site; central nervous system atypical teratoid/rhabdoid tumor; central nervous system embryonal tumors;
- cervical cancer childhood cancers; chordoma; chronic lymphocytic leukemia; chronic myelogenous leukemia; chronic myeloproliferative disorders; colon cancer; colorectal cancer; craniopharyngioma; cutaneous T-cell lymphoma; endocrine pancreas islet cell tumors; endometrial cancer;
- ependymoblastoma ependymoblastoma
- ependymoma ependymoma
- esophageal cancer esthesioneuroblastoma
- Ewing sarcoma ependymoblastoma
- extracranial germ cell tumor extragonadal germ cell tumor; extrahepatic bile duct cancer; gallbladder cancer; gastric (stomach) cancer; gastrointestinal carcinoid tumor; gastrointestinal stromal cell tumor; gastrointestinal stromal tumor (GIST); gestational trophoblastic tumor; glioma; hairy cell leukemia; head and neck cancer; heart cancer; Hodgkin lymphoma; hypopharyngeal cancer; intraocular melanoma; islet cell tumors; Kaposi sarcoma; kidney cancer; Langerhans cell histiocytosis; laryngeal cancer; lip cancer; liver cancer; lung cancer; malignant fibrous histiocytoma bone cancer; medulloblastoma;
- medulloepithelioma melanoma
- Merkel cell carcinoma Merkel cell skin carcinoma
- mesothelioma metastatic squamous neck cancer with occult primary
- mouth cancer multiple endocrine neoplasia syndromes
- multiple myeloma multiple myeloma/plasma cell neoplasm
- mycosis fungoides mycosis fungoides
- myelodysplastic syndromes myeloproliferative neoplasms; nasal cavity cancer; nasopharyngeal cancer; neuroblastoma; Non-Hodgkin lymphoma; nonmelanoma skin cancer; non-small cell lung cancer; oral cancer; oral cavity cancer; oropharyngeal cancer; osteosarcoma; other brain and spinal cord tumors;
- ovarian cancer ovarian epithelial cancer; ovarian germ cell tumor; ovarian low malignant potential tumor; pancreatic cancer; papillomatosis; paranasal sinus cancer; parathyroid cancer; pelvic cancer; penile
- rhabdomyosarcoma salivary gland cancer; Sezary syndrome; small cell lung cancer; small intestine cancer; soft tissue sarcoma; squamous cell carcinoma; squamous neck cancer; stomach (gastric) cancer; supratentorial primitive neuroectodermal tumors; T-cell lymphoma; testicular cancer; throat cancer;
- the premalignant condition can include without limitation Barrett's Esophagus.
- the autoimmune disease can include without limitation one of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), pelvic inflammation, vasculitis, psoriasis, diabetes, autoimmune hepatitis, multiple sclerosis, myasthenia gravis, Type I diabetes, rheumatoid arthritis, psoriasis, systemic lupus erythematosis (SLE), Hashimoto's Thyroiditis, Grave's disease, Ankylosing Spondylitis Sjogrens Disease, CREST syndrome, Scleroderma, Rheumatic Disease, organ rejection, Primary Sclerosing Cholangitis, or sepsis.
- IBD inflammatory bowel disease
- CD Crohn's disease
- UC ulcerative colitis
- pelvic inflammation vasculitis
- psoriasis diabetes
- autoimmune hepatitis multiple sclerosis
- myasthenia gravis Type I diabetes
- the cardiovascular disease can include without limitation one of atherosclerosis, congestive heart failure, vulnerable plaque, stroke, ischemia, high blood pressure, stenosis, vessel occlusion or a thrombotic event.
- the neurological disease can include without limitation one of Multiple Sclerosis (MS), Parkinson's Disease (PD), Alzheimer's Disease (AD), schizophrenia, bipolar disorder, depression, autism, Prion Disease, Pick's disease, dementia, Huntington disease (HD), Down's syndrome, cerebrovascular disease, Rasmussen's encephalitis, viral meningitis, neurospsychiatric systemic lupus erythematosus (NPSLE), amyotrophic lateral sclerosis, Creutzfeldt- Jacob disease, Gerstmann-Straussler-Scheinker disease, transmissible spongiform encephalopathy, ischemic reperfusion damage (e.g.
- the pain can include without limitation one of fibromyalgia, chronic neuropathic pain, or peripheral neuropathic pain.
- the infectious disease can include without limitation one of a bacterial infection, viral infection, yeast infection, Whipple's Disease, Prion Disease, cirrhosis, methicillin-resistant staphylococcus aureus, HIV, HCV, hepatitis, syphilis, meningitis, malaria, tuberculosis, or influenza.
- the oligonucleotide or plurality of oligonucleotides or methods of the invention can be used to assess any number of these or other related diseases and disorders.
- the oligonucleotide or plurality of oligonucleotides and methods of use thereof are useful for characterizing certain diseases or disease states.
- a pool of oligonucleotides useful for characterizing various diseases is assembled to create a master pool that can be used to probe useful for characterizing the various diseases.
- the combination of SEQ ID NOs. 510599-510763 provided herein comprise such a pool.
- pools of oligonucleotides useful for characterizing specific diseases or disorders can be created as well.
- the oligonucleotides and pools thereof can be modified as described herein.
- the disease or disorder comprises a breast cancer and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or at least 40 of SEQ ID NOs. 510559-510598.
- the oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder comprises Alzheimer's disease and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- the disease or disorder comprises Alzheimer's disease and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the
- oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder may comprise bronchial asthma and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- the disease or disorder may also comprise bronchial asthma and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder comprises a transitional cell carcinoma of the bladder and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder comprises a giant cellular osteoblastoclastoma and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 ,
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the
- oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder may comprise a brain tumor and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder comprises a colorectal adenocarcinoma and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2,
- oligonucleotides may incorporate various chemical modifications,
- the disease or disorder comprises a chronic obstructive pulmonary disease (COPD) and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- COPD chronic obstructive pulmonary disease
- the disease or disorder comprises a chronic obstructive pulmonary disease (COPD) and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs. 510601 , 510609, 51061 1 , 510613, 510620, 510634, 510637,
- COPD chronic obstructive pulmonary disease
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder can be a squamous cell carcinoma of the cervix and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs. 510615, 510619,
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder may comprise an acute myocardial infarction (AMI) or acute heart failure and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs. 510607, 510608, 510613, 510626, 510629, 510631 , 510634, 510635, 510638, 510639, 510646,
- AMI acute myocardial infarction
- the disease or disorder comprises an acute myocardial infarction (AMI) or acute heart failure and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs. 510599, 510601 , 510606, 510607, 510608, 510609, 51061 1 , 510614, 510616, 510619, 510622,
- AMI acute myocardial infarction
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder comprises Chron's Disease and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs. 510600, 510602, 510608, 51061 1 , 510624, 510644, 510653, 510656, 510659, 510669, 510671 , 510676, 510686, 510689,
- the disease or disorder comprises Chron's Disease and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder may comprise diabetes mellitus type II and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs. 510600, 510604, 510608, 510610, 51061 1 , 510614, 510616, 510620, 510624, 510629, 510632, 510634, 510640, 510649,
- the disease or disorder may comprise diabetes mellitus type II and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs. 510613, 510632, 510635, 510636, 510641 , 510645, 510647, 510648, 510654, 510660, 510664, 510667, 510668, 510670, 510675, 510684, 510691, 510695, 510696, 510706, 510710, 510734, and 510749.
- the oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder comprises an esophageal carcinoma and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder comprises a squamous cell carcinoma of the larynx and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder comprises an acute or chronic leukemia of the bone marrow and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder comprises a lung carcinoma and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder may comprise a malignant lymphoma and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs. 510601, 51061 1, 510618, 510623,
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder may also comprise multiple sclerosis and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs. 510607, 510612, 510620, 510646, 510653, 510655, 510661, 510663, 510669, 510675, 510682, 510685, 510686, 510690, 510699, 510701, 510710, 510713, 510731, 510738, 510747, 510758, and 510762.
- the disease or disorder may comprise multiple sclerosis and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs. 510607,
- characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs. 510599, 510604, 510609, 510610, 510613, 510617, 510618, 510622, 510632, 510635, 510647, 510670, 510675, 510677, 510687, 510690, 510692, 510695, 510701, 510706, 510708, 510731, and 510733.
- the oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder comprises an ovarian carcinoma and the
- oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder comprises Parkinson disease and the
- oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder comprises a prostate adenocarcinoma and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder comprises psoriasis and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- the disease or disorder can be psoriasis and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs. 510600, 510601, 510604, 510613, 510621, 510627, 510637, 510641, 510644, 510648, 510650, 510652, 510663, 510667, 510668, 510676, 510680, 510681,
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder can also be rheumatoid arthritis and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12,
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder comprises rheumatoid arthritis and the
- oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- the disease or disorder comprises a renal cell carcinoma and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides
- oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder comprises a squamous cell carcinoma of skin and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions,
- the disease or disorder comprises an adenocarcinoma of the stomach and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder may comprise a carcinoma of the thyroid gland and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder may also comprise a testicular cancer and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions,
- the disease or disorder can be ulcerative colitis and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- -17- Docket No. 37901-820.601 disorder comprises ulcerative colitis and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs.
- oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the disease or disorder can also be a uterine adenocarcinoma and the oligonucleotide or plurality of oligonucleotides useful for characterization thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50 or all of SEQ ID NOs. 510601, 510612, 510621, 510626, 510637, 510641, 510644, 510650, 510653, 510669, 510675, 510684, 510686, 510687, 510696, 510714, 510717, 510722, 510739, 510743, 510745, 510746, 510753, 510755, and 510762.
- the oligonucleotides may incorporate various chemical modifications, additions, deletions, insertions, substitutions or other modifications so long as functional aspects of the oligonucleotides are enhanced or maintained in whole or in part.
- the invention provides a kit comprising a reagent for carrying out the methods of the invention provided herein.
- the invention contemplates use of a reagent for carrying out the methods of the invention provided herein.
- the reagent comprises an oligonucleotide or plurality of oligonucleotides.
- the oligonucleotide or plurality of oligonucleotides can be those provided herein.
- the reagent may comprise various other useful components including without limitation one or more of: a) a reagent configured to isolate a microvesicle, optionally wherein the at least one reagent configured to isolate a microvesicle comprises a binding agent to a microvesicle antigen, a column, a substrate, a filtration unit, a polymer, polyethylene glycol, PEG4000, PEG8000, a particle or a bead; b) at least one oligonucleotide configured to act as a primer or probe in order to amplify, sequence, hybridize or detect the oligonucleotide or plurality of oligonucleotides; and c) a reagent configured to remove one or more abundant protein from a sample, wherein optionally the one or more abundant protein comprises at least one of albumin, immunoglobulin, fibrinogen and fibrin.
- the invention provides an aptamer comprising a nucleic acid sequence that is at least about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous of any of: a) SEQ ID NOs. 8-21 or a variable sequence thereof as described in Table 8; b) SEQ ID NOs. 24-43 or a variable sequence thereof as described in Table 11; c) SEQ ID NOs. 44-10527; d) SEQ ID NOs. 10528- 10557 or a variable sequence thereof as described in Table 12; or e) a functional fragment of any preceding sequence.
- the aptamer may recognize a microvesicle surface antigen.
- aptamers of the invention may be identified herein in the form of DNA or RNA. Unless otherwise specified, one of skill in the art will appreciate that an aptamer may generally be synthesized in various forms of nucleic acid. The aptamers may also carry various chemical modifications and remain within the scope of the invention.
- an aptamer of the invention is modified to comprise at least one chemical modification.
- the modification may include without limitation a chemical substitution at a sugar position; a chemical substitution at a phosphate position; and a chemical substitution at a base position of the nucleic acid.
- the modification is selected from the group consisting of:
- biotinylation incorporation of a fluorescent label, incorporation of a modified nucleotide, a 2'-modified pyrimidine, 3' capping, conjugation to an amine linker, conjugation to a high molecular weight, non- immunogenic compound, conjugation to a lipophilic compound, conjugation to a drug, conjugation to a cytotoxic moiety, and labeling with a radioisotope, or other modification as disclosed herein.
- the position of the modification can be varied as desired.
- the biotinylation, fluorescent label, or cytotoxic moiety can be conjugated to the 5' end of the aptamer.
- the biotinylation, fluorescent label, or cytotoxic moiety can also be conjugated to the 3' end of the aptamer.
- the cytotoxic moiety is encapsulated in a nanoparticle.
- the nanoparticle can be selected from the group consisting of: liposomes, dendrimers, and comb polymers.
- the cytotoxic moiety comprises a small molecule cytotoxic moiety.
- the small molecule cytotoxic moiety can include without limtation vinblastine hydrazide, calicheamicin, vinca alkaloid, a cryptophycin, a tubulysin, dolastatin- 10, dolastatin- 15, auristatin E, rhizoxin, epothilone B, epithilone D, taxoids, maytansinoids and any variants and derivatives thereof.
- the cytotoxic moiety comprises a protein toxin.
- the protein toxin can be selected from the group consisting of diphtheria toxin, ricin, abrin, gelonin, and Pseudomonas exotoxin A.
- Non-immunogenic, high molecular weight compounds for use with the invention include polyalkylene glycols, e.g., polyethylene glycol.
- radioisotopes include yttrium-90, indium- 1 1 1 , iodine- 131 , lutetium- 177, copper-67, rhenium- 186, rhenium- 188, bismuth-212, bismuth-213, astatine-21 1 , and actinium-225.
- the aptamer may be labeled with a gamma-emitting radioisotope.
- an active agent is conjugated to the aptamer.
- the active agent may be a therapeutic agent or a diagnostic agent.
- the therapeutic agent may be selected from the group consisting of tyrosine kinase inhibitors, kinase inhibitors, biologically active agents, biological molecules, radionuclides, adriamycin, ansamycin antibiotics, asparaginase, bleomycin, busulphan, cisplatin, carboplatin, carmustine, capecotabine, chlorambucil, cytarabine, cyclophosphamide, camptothecin, dacarbazine, dactinomycin, daunorubicin, dexrazoxane, docetaxel, doxorubicin, etoposide, epothilones, floxuridine, fludarabine, fluorouracil, gemcitabine, hydroxyurea, idarubicin
- the invention further provides a pharmaceutical composition comprising a therapeutically effective amount of the aptamer described above or a salt thereof, and a pharmaceutically acceptable carrier or diluent.
- the invention also provides a pharmaceutical composition comprising a therapeutically effective amount of the aptamer or a salt thereof, and a pharmaceutically acceptable carrier or diluent.
- the invention provides a method of treating or ameliorating a disease or disorder, comprising administering the pharmaceutical composition to a subject in need thereof. Administering a
- compositions to the subject may result in: (a) an enhancement of the delivery of the active agent to a disease site relative to delivery of the active agent alone; or (b) an enhancement of microvesicles clearance resulting in a decrease of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% in a blood level of microvesicles targeted by the aptamer; or (c) an decrease in biological activity of microvesicles targeted by the aptamer of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%.
- the biological activity of microvesicles comprises immune suppression or transfer of genetic information.
- the disease or disorder can include without limitation those disclosed herein.
- the disease or disorder may comprise a neoplastic, proliferative, or inflammatory, metabolic, cardiovascular, or neurological disease or disorder. See above and further section "Phenotypes.”
- the invention further provides a kit comprising an aptamer disclosed herein, or a pharmaceutical composition thereof.
- the invention provides a method comprising contacting the aptamer as described above with a biological sample and detecting the presence or absence of binding of the aptamer to a microvesicle in the biological sample.
- the biological sample can be a tissue, fluid or cell culture sample.
- the biological sample may comprise blood or a blood component.
- the aptamer is conjugated to a substrate prior to the contacting with the biological sample.
- the substrate may comprise a bead or a plate well.
- the aptamer may also be conjugated to a detectable label.
- FIGs. 2A-2B and 16A Various configurations of the method are provided herein. See, e.g., FIGs. 2A-2B and 16A.
- the invention provides a method of detecting a presence or level of a microvesicle population in a biological sample suspected of containing the microvesicle population, comprising contacting the biological sample with one or more binding agent specific to the microvesicle population and one or more aptamer as described above, and detecting microvesicles that are recognized by both the one or more binding agent and the one or more aptamer, thereby detecting the presence or level of the microvesicle population in the biological sample.
- the biological sample can be a tissue sample, a cell culture, or a bodily fluid.
- the bodily fluid can be any useful fluid, including without limitation one or more of peripheral blood, sera, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or pre- ejaculatory fluid, female ejaculate, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal
- the bodily fluid comprises blood, serum or plasma.
- the one or more binding agent comprises an antibody or aptamer to a microvesicle surface antigen selected from Table 3, Table 4, and a combination thereof.
- the one or more binding agent may be an antibody or aptamer to a microvesicle surface antigen selected from the group consisting of EpCam, CD9, PCSA, CD63, CD81, PSMA, B7H3, PSCA, ICAM, STEAP, KLK2, SSX2, SSX4, PBP, SPDEF, EGFR, and a combination thereof.
- the one or more binding agent can also comprise an antibody or aptamer to a microvesicle surface antigen selected from the group consisting of EGFR, PBP, EpCAM, KLK2, and a combination thereof.
- the invention contemplates various configurations. For example, a "sandwich" format can be used. See, e.g., FIGs. 2A-2B.
- the one or more binding agent is conjugated to a substrate prior to the contacting with the biological sample.
- the one or more aptamer may be conjugated to a detectable label to serve as a detector agent.
- a detectable label to serve as a detector agent.
- the one or more binding agent is conjugated to a detectable label.
- the one or more aptamer may be conjugated to a substrate prior to the contacting with the biological sample to serve as a capture agent.
- the one or more aptamer can be conjugated to a substrate prior to the contacting with the biological sample, and/or the one or more aptamer is conjugated to a detectable label.
- the one or more aptamer can act as either or both of a capture agent and a detection agent.
- the invention provides a method of characterizing a disease or disorder, comprising: (a) contacting a biological test sample with one or more aptamer as provided herein; (b) detecting a presence or level of a complex between the one or more aptamer and the target bound by the one or more aptamer in the biological test sample formed in step (a); and (c) comparing the presence or level detected in step (b) to a reference level from a biological control sample, thereby characterizing the disease or disorder.
- the reference level may be derived from a level of the target in a healthy sample individual, e.g., one that does not have or is not known to have the disease or disorder.
- the reference level may also be derived from an individual or sample having a treated, controlled, or alternate disease.
- the biological test sample and biological control sample may each comprise a tissue sample, a cell culture, or a biological fluid.
- the biological fluid comprises a bodily fluid.
- the bodily fluid can be any useful fluid, including without limitation one or more of peripheral blood, sera, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or pre-ejaculatory fluid, female ejaculate, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bron
- the bodily fluid comprises blood, serum or plasma.
- the biological fluid may comprise or be suspected to comprise microvesicles.
- the one or more aptamer may bind a polypeptide or fragment thereof.
- the binding may be promiscuous or selective as desired.
- the polypeptide or fragment thereof can be soluble or membrane bound, e.g., in the membrane of a microvesicle or cell fragment.
- the polypeptide or fragment thereof comprises a biomarker in Table 3 or Table 4.
- the one or more aptamer can bind a microvesicle surface antigen in the biological sample.
- the method provided herein of detecting aptamer binding to a microvesicle or of characterizing a disease or disorder may include providing a diagnosis, prognosis or theranosis of the disease or disorder.
- the disease or disorder can include without limitation those disclosed herein.
- the disease or disorder may comprise a cancer, a premalignant condition, an inflammatory disease, an immune disease, an autoimmune disease or disorder, a cardiovascular disease or disorder, a neurological disease or disorder, an infectious disease, and/or pain. See, e.g., section "Phenotypes" herein.
- the invention further provides a kit comprising a reagent for carrying out the methods herein and also use of the reagent for carrying out the methods related to the aptamers of the invention.
- the reagent may comprise an aptamer disclosed herein.
- the reagent may further comprise other useful components disclosed herein including without limitation at least one of: a) a reagent configured to isolate a microvesicle, optionally wherein the at least one reagent configured to isolate a microvesicle comprises a binding agent to a microvesicle antigen, a column, a substrate, a filtration unit, a polymer, polyethylene glycol, PEG4000, PEG8000, a particle or a bead; b) at least one oligonucleotide configured to act as a primer or probe in order to amplify, sequence, hybridize or detect the oligonucleotide or plurality of oligonucleotides; and c) a reagent configured to remove one or more abundant protein from a sample, wherein optionally the one or more abundant protein comprises at least one of albumin, immunoglobulin, fibrinogen and fibrin.
- the invention provides a composition comprising an input oligonucleotide library for assessing a cellular or extracellular vesicle sample comprising at least two subset oligonucleotide libraries to generate the input oligonucleotide library, wherein at least one of the at least two subset oligonucleotide libraries are manufactured with amounts of nucleotides with a total G and C content that is not equal to 50%.
- the total G and C content can be less than 50%, or the total G and C content can be more than 50%.
- at least one subset library is manufactured with a total G and C content that is more than 50% and another subset library is manufactured with a total G and C content less than 50%.
- the at least two subset libraries comprises three subset libraries
- the at least two subset libraries can be manufactured with amounts of nucleotides similar or equal to at least two rows in Table 13.
- the nucleotides can consist of naturally occurring nucleotides or modified naturally occurring nucleotides as desired.
- the nucleotides can also comprise non-naturally occurring nucleotides.
- oligonucleotide libraries may be referred to as "GC” libraries herein.
- the invention provides a method of generating an input oligonucleotide library of the invention, comprising contacting the at least two subset oligonucleotide libraries to generate the input oligonucleotide library.
- the input oligonucleotide library can be screened or enriched to provide various aptamers or oligonucleotide probe libraries using the methods described herein.
- the invention provides an oligonucleotide having a sequence that comprises a 5' transposon adapter region, an offset region comprising 0 or more nucleotides located 5' to the transposon adapter region, a variable region located 5' to the offset region, and a left primer region located 5' to the variable region.
- the invention provides a plurality of oligonucleotides comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 200000, 300000, 400000, 500000, 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , or at least 10 18 different oligonucleotide sequences, wherein each of the oligonucleotide sequences comprises a 5' transposon adapt
- the balanced oligonucleotide or plurality of oligonucleotides of the invention can be such that: a) the transposon adapter region comprises 20-40 nucleotides; b) the offset region compries 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides; c) the variable region comprises 20-50 nucleotides; and/or d) the left primer region comprises 20-40 nucleotides.
- the balanced oligonucleotides are such that: a) the transposon adapter region comprises a nucleic acid sequence that is at least about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to the sequence 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (SEQ ID NO.
- the offset region compries 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides that are at least about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to at least one of the following sequences: 5'-T (SEQ ID NO. 510765), 5'-CT (SEQ ID NO. 510766) and 5'-ACT (SEQ ID NO.
- variable region comprises 20, 21, 22, 23, 24, 25 26 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides; and/or d) the left primer region comprises a nucleic acid sequence that is at least about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to a sequence selected from SEQ ID NOs. 510768 and 510769.
- the variable region may comprise "GC" library sequences as provided herein.
- the invention provides a method of identifying an aptamer, comprising performing a selection or enrichment process using a balanced oligonucleotide or plurality of balanced oligonucleotides as a na ' ive input library.
- selection or enrichment processes are described or provided herein, including without limitation SELEX and variations thereof.
- the selection process comprises at least one round of positive selection against a target of interest and optionally at least one round of negative selection against a target other than the target of interest.
- the invention provides a method comprising contacting a balanced oligonucleotide or plurality of balanced oligonucleotides with a sample and detecting the presence or level of binding of the oligonucleotide or plurality of oligonucleotides to a target in the sample.
- the sample may comprise a biological sample, such as an organic sample, an inorganic sample, a tissue, a cell culture, a bodily fluid, blood, serum, a cell, a microvesicle, a protein complex, a lipid complex, a carbohydrate, or any combination, fraction or variation thereof.
- the target can be any useful target, including without limitation a cell, an organelle, a protein complex, a lipoprotein, a carbohydrate, a microvesicle, a membrane fragment, a small molecule, a heavy metal, a toxin, or a drug.
- the invention provides a method comprising: a) contacting a biological sample comprising microvesicles with an oligonucleotide probe library, wherein the oligonucleotide probe library comprises a balanced oligonucleotide or plurality of balanced oligonucleotides; b) identifying
- oligonucleotides bound to at least a portion of the microvesicles; and c) characterizing the sample based on a profile of the identified oligonucleotides.
- the invention provides a method comprising: a) contacting a sample with an oligonucleotide probe library comprising at least 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , or at least 10 18 different oligonucleotide sequences oligonucleotides to form a mixture in solution, wherein the oligonucleotides are capable of binding a plurality of entities in the sample to form complexes, wherein the oligonucleotide probe library comprises a balanced oligonucleotide or plurality of balanced oligonucleotides; d) partitioning the complexes formed in step (a) from the mixture; and c) detecting oligonucleotides present in the complexes partitioned in step (b) to identify an oligonucleotide profile for the sample.
- the invention provides a method of characterizing a disease or disorder, comprising: a) contacting a biological test sample with a balanced oligonucleotide or plurality of balanced oligonucleotides; b) detecting a presence or level of complexes formed in step (a) between the balanced oligonucleotide or plurality of balanced oligonucleotides and a target in the biological test sample; and c) comparing the presence or level detected in step (b) to a reference level from a biological control sample, thereby characterizing the disease or disorder.
- the step of detecting may comprise performing sequencing of all or some of the oligonucleotides in the complexes, amplification of all or some of the oligonucleotides in the complexes, and/or hybridization of all or some of the oligonucleotides in the complexes to an array.
- the sequencing comprises high-throughput sequencing.
- the biological test sample and biological control sample may each comprise a tissue sample, a cell culture, or a biological fluid.
- the biological fluid comprises a bodily fluid.
- Useful bodily fluids within the method of the invention comprise peripheral blood, sera, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or pre-ejaculatory fluid, female ejaculate, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum,
- the bodily fluid comprises blood, serum or plasma.
- the biological fluid may comprise microvesicles.
- the complexes may be formed between the oligonucleotide or plurality of oligonucleotides and at least one of the microvesicles.
- the biological test sample and biological control sample may further comprise isolated microvesicles, wherein optionally the microvesicles are isolated using at least one of chromatography, filtration, ultrafiltration, centrifugation, ultracentrifugation, flow cytometry, affinity capture (e.g., to a planar surface, column or bead), polymer precipitation, and using microfluidics.
- the vesicles can also be isolated after contact with the oligonucleotide or plurality of oligonucleotides.
- oligonucleotide or plurality of balanced oligonucleotides the oligonucleotide or plurality of
- oligonucleotides binds a polypeptide or fragment thereof.
- the polypeptide or fragment thereof can be soluble or membrane bound, wherein optionally the membrane comprises a microvesicle membrane.
- the membrane could also be from a cell or a fragment of a cell of vesicle.
- the polypeptide or fragment thereof comprises a biomarker in Table 3 or Table 4.
- the polypeptide or fragment thereof could be a general vesicle marker such as in Table 3 or a tissue -related or disease-related marker such as in Table 4.
- the oligonucleotide or plurality of oligonucleotides may bind a microvesicle surface antigen in the biological sample.
- the oligonucleotide or plurality of oligonucleotides can be enriched from a na ' ive library against microvesicles.
- the disease or disorder detected by the oligonucleotide, plurality of oligonucleotides, or methods provided herein comprising use of a balanced oligonucleotide or plurality of balanced oligonucleotides may comprise any appropriate disease or disorder of interest.
- the disease or disorder may comprise a cancer, a premalignant condition, an inflammatory disease, an immune disease, an
- the disease or disorder may include without limitation Breast Cancer, Alzheimer's disease, bronchial asthma, Transitional cell carcinoma of the bladder, Giant cellular osteoblastoclastoma, Brain Tumor, Colorectal adenocarcinoma, Chronic obstructive pulmonary disease (COPD), Squamous cell carcinoma of the cervix, acute myocardial infarction (AMI) / acute heart failure, Chron's Disease, diabetes mellitus type II, Esophageal carcinoma, Squamous cell carcinoma of the larynx, Acute and chronic leukemia of the bone marrow, Lung carcinoma, Malignant lymphoma, Multiple Sclerosis, Ovarian carcinoma, Parkinson disease, Prostate adenocarcinoma, psoriasis, Rheumatoid Arthritis, Renal
- the invention further provides a kit comprising a reagent for carrying out the methods herein and also use of the reagent for carrying out the methods related to GC libraries or balanced oligonucleotides of the invention.
- the reagent may comprise one or more oligonucleotide having a sequence
- the reagent may further comprise other useful components disclosed herein including without limitation at least one of: a) a reagent configured to isolate a microvesicle, optionally wherein the at least one reagent configured to isolate a microvesicle comprises a binding agent to a microvesicle antigen, a column, a substrate, a filtration unit, a polymer, polyethylene glycol, PEG4000, PEG8000, a particle or a bead; b) at least one oligonucleotide configured to act as a primer or probe in order to amplify, sequence, hybridize or detect the
- oligonucleotide or plurality of oligonucleotides and c) a reagent configured to remove one or more abundant protein from a sample, wherein optionally the one or more abundant protein comprises at least one of albumin, immunoglobulin, fibrinogen and fibrin.
- FIG. 1 illustrates a competitive assay selection strategy: the random pool of aptamer (the library) is incubated with the target protein, in this case, EpCAM. After washing and elution from the target, the eluted aptamers are again added to the target and allowed to bind. The antibody is then added to the reaction, competing with the aptamers at the epitope of the antibody. The aptamers displaced by the antibody are then collected.
- the target protein in this case, EpCAM.
- FIGs. 2A-2F illustrate methods of assessing biomarkers such as microvesicle surface antigens.
- FIG. 2A is a schematic of a planar substrate coated with a capture agent, such as an aptamer or antibody, which captures vesicles expressing the target antigen of the capture agent.
- the capture agent may bind a protein expressed on the surface of vesicles shed from diseased cells ("disease vesicle").
- the detection agent which may also be an aptamer or antibody, carries a detectable label, here a fluorescent signal. The detection agent binds to the captured vesicle and provides a detectable signal via its fluorescent label.
- the detection agent can detect an antigen that is generally associated with vesicles, or is associated with a cell- of-origin or a disease, e.g., a cancer.
- FIG. 2B is a schematic of a particle bead conjugated with a capture agent, which captures vesicles expressing the target antigen of the capture agent.
- the capture agent may bind a protein expressed on the surface of vesicles shed from diseased cells ("disease vesicle").
- the detection agent which may also be an aptamer or antibody, carries a detectable label, here a fluorescent signal. The detection agent binds to the captured vesicle and provides a detectable signal via its fluorescent label.
- the detection agent can detect an antigen that is generally associated with vesicles, or is associated with a cell-of-origin or a disease, e.g., a cancer.
- FIG. 2C is an example of a screening scheme that can be performed by using different combinations of capture and detection agents to the indicated biomarkers. The biomarker combinations can be detected using assays as shown in FIGs. 2A-2B.
- FIGs. 2D-2E present illustrative schemes for capturing and detecting vesicles to characterize a phenotype.
- FIG. 2F presents illustrative schemes for assessing vesicle payload to characterize a phenotype.
- FIGs. 3A-3B illustrate a non-limiting example of an aptamer nucleotide sequence and its secondary structure.
- FIG. 3A illustrates a secondary structure of a 32-mer oligonucleotide, Aptamer 4, with sequence 5 ' -CCCCCCGAATCACATGACTTGGGCGGGGGTCG (SEQ ID NO. 1).
- the sequence is shown with 6 thymine nucleotides added to the end, which can act as a spacer to attach a biotin molecule.
- This particular oligo has a high binding affinity to the target, EpCAM (see Table 5).
- FIG. 3B illustrates another 32-mer oligo with sequence 5'- ACCGGATAGCGGTTGGAGGCGTGCTCCACTCG (SEQ ID NO. 2) that has a different secondary structure than the aptamer in FIG. 3A. This aptamer is also shown with a 6-thymine tail.
- FIG. 4 illustrates a process for producing a target- specific set of aptamers using a cell subtraction method, wherein the target is a biomarker associated with a specific disease.
- Step 1 a random pool of oligonucleotides is contacted with a biological sample from a normal patient.
- the oligos that did not bind in Step 1 are added to a biological sample isolated from diseased patients.
- the bound oligos from this step are then eluted, captured via their biotin linkage and then combined again with normal biological sample.
- the unbound oligos are then added again to disease-derived biological sample and isolated. This process can be repeated iteratively.
- the final eluted aptamers are tested against patient samples to measure the sensitivity and specificity of the set.
- Biological samples can include blood, including plasma or serum, or other components of the circulatory system, such as microvesicles.
- FIG. 5 illustrates results from a binding assay showing the binding affinity of an exemplary aptamer (Aptamer ID BTX176881 (SEQ ID NO: 3)) to the target EpCAM protein at various target concentrations.
- the aptamer to be tested is fixed to a substrate using a biotin tail and is incubated with various concentrations of target (125, 250 and 500 tiM).
- the test is performed on a surface plasmon resonance machine (SPR).
- SPR surface plasmon resonance machine
- the SPR machine detects association and disassociation of the aptamer and the target.
- Target is applied until the association and disassociation events are equal, resulting in a plateau of the curve.
- the equations describing the curve at each concentration can then be used to calculate the K D of the aptamer (see Table 5).
- FIG. 6 illustrates the use of an anti-EpCAM aptamer (Aptamer 4; SEQ ID NO. 1) to detect a microvesicle population.
- Vesicles in patient plasma samples were captured using bead-conjugated antibodies to the indicated microvesicle surface antigens: A) EGFR; B) PBP; C) EpCAM; D) KLK2.
- Fluorescently labeled Aptamer 4 was used as a detector in the microbead assay.
- the figure shows average median fluorescence values (MFI values) for three cancer (C1-C3) and three normal samples (N1-N3) in each plot. In each plot, the samples from left to right are ordered as: CI, C2, C3, Nl, N2, N3.
- FIG. 7A illustrates the sequence of EPCAM aptamer CAR003 (SEQ ID NO. 4).
- FIG. 7B illustrates the optimal secondary structure of CAR003 with a minimum free energy (AG) of -30.00 kcal/mol.
- the aptamer is shown as an RNA aptamer (SEQ ID NO. 5) corresponding to the DNA sequence in FIG. 7A.
- FIG. 7C illustrates aptamer pool purification. The figure comprises an FPLC chromatogram with all product and fractions assigned in pools after checking quality on gel.
- FIG. 7D illustrates a SYBR GOLD stained gel with different FPLC fractions of CAR003 aptamer after synthesis.
- FIG. 7E-F illustrate binding of CAR003 to EPCAM protein in 25 mM HEPES with PBS-BN (FIG. 7E) or in 25 mM HEPES with 1 mM MgCl 2 (FIG. 7F).
- FIG. 7G illustrates CAR003 binding to EpCAM in the indicated salts with and without addition of bovine serum albumin (BSA).
- FIG. 7H illustrates the effect of
- FIG. 71 illustrates titration of aptamers against EPCAM recombinant protein (constant input 5 ⁇ g).
- FIG. 7J illustrates a Western blot with CAR003 aptamer versus EPCAM his-tagged protein, BSA, and HSA (5 ⁇ g each). The gel was blocked 0.5% F127 and probed with ⁇ 50 ⁇ g/ml CAR003 biotinylated aptamer, fraction 3. The blot was visualized with NeutrAvidin-HRP followed by SuperSignal West Femto Chemiluminescent Substrate.
- FIGs. 8A-8D illustrates methods to attach microvesicles to a substrate.
- FIG. 8A illustrates direct conjugation of a carboxylated microsphere to a vesicle surface antigen.
- FIG. 8B illustrates anchoring of a microvesicle to a microsphere via a biotin functionalized lipid anchor.
- FIG. 8C illustrates antibody binding to a vesicle surface antigen, wherein the antibody is conjugated to a carboxylated microsphere.
- FIG. 8D illustrates aptamer binding to a vesicle surface antigen, wherein the aptamer is conjugated to a carboxylated microsphere.
- FIG. 9 comprises a schematic for identifying a target of a selected aptamer, such as an aptamer selected by the above process.
- the figure shows a binding agent 902, here an aptamer for purposes of illustration, tethered to a substrate 901.
- the binding agent 902 can be covalently attached to substrate 901.
- the binding agent 902 may also be non-covalently attached.
- binding agent 902 can comprise a label which can be attracted to the substrate, such as a biotin group which can form a complex with an avidin/streptavidin molecule that is covalently attached to the substrate.
- the binding agent 902 binds to a surface antigen 903 of microvesicle 904. In the step signified by arrow (i), the microvesicle is disrupted while leaving the complex between the binding agent 902 and surface antigen 903 intact.
- Disrupted microvesicle 905 is removed, e.g., via washing or buffer exchange, in the step signified by arrow (ii).
- the surface antigen 903 is released from the binding agent 902.
- the surface antigen 903 can be analyzed to determine its identity.
- FIGs. lOA-C illustrate binding of selected aptamers against microbeads conjugated to various input sample.
- the aptamers were selected from an aptamer library as binding to microbeads conjugated to breast cancer-derived microvesicles. Experimental details are in the Examples herein. Each plot shows a different aptamer. The Y-axis indicates level of binding. In each group of samples, binding of 9 purified aptamer candidates is shown.
- the input sample is indicated on the X axis from left to right as follows: 1) Cancer Exosome: aptamer binding to microbeads conjugated to microvesicles isolated from plasma samples from breast cancer patients; 2) Cancer Non-exosome: aptamer binding to microbeads conjugated to plasma samples from breast cancer patients after removal of microvesicles by ultracentrifugation; 3) Non-Cancer Exosome: aptamer binding to microbeads conjugated to microvesicles isolated from plasma samples from normal (i.e., non-breast cancer) patients; 4) Non-Cancer Non- Exosome: aptamer binding to microbeads conjugated to plasma samples from breast cancer patients after removal of microvesicles by ultracentrifugation.
- FIGs. 11A-G illustrate selection schemes used to enrich a starting aptamer library to a target of interest.
- selection A indicates 13 rounds of positive selection against microvesicles isolated from the plasma of breast cancer patients and non-breast cancer individuals. Cal refers to round 1
- nCal refers to round 1 of non-cancer vesicle selection, etc.
- Selection B indicates a derivative wherein the aptamer pools after 3 rounds of positive selection in “Selection A” were used as input for 9 additions rounds (i.e., rounds 4-12) of positive and negative selection against microvesicles isolated from the plasma of breast cancer patients and non-breast cancer individuals.
- “noE” indicates the negative selection rounds.
- FIG. 11B show the recovered aptamer library after the indicated rounds of enrichment as run on agarose gels.
- FIG. 11C illustrates enrichment of aptamers that bind to cancer vesicles (three leftmost columns “Ca”) and non-cancer microvesicles (three rightmost columns “nCa”) through the rounds of selection 1 (Rl), 7 (R7) and 13 (R13). Labeled aptamers after the indicated round of selection were incubated with bead-captured microvesicles. The number of aptamers binding to the bead- captured microvesicles was determined. The Y-axis indicates the percentage of bound aptamers compared to total input.
- FIG. 11D and FIG. HE indicate additional selection done for cancer and non-cancer microvesicles, respectively, after rounds 9 of "Selection B.”
- FIG. 11F presents another view of FIG. 11D.
- FIG. 11G shows a third selection "Selection C” performed after rounds 9 of "Selection B” with alternating rounds of selection against cancer-derived (Ca#) and non-cancer derived (nCa#) microvesicles.
- FIG. 12 illustrates distribution of aptamer frequency observed in a selection steps versus sequence GC content.
- the library in this figure comprised of randomly generated sequences 30 nucleotides in length flanked by primer annealing sequences.
- FIGs. 13A-I illustrate development and use of an oligonucleotide probe library to distinguish biological sample types.
- FIGs. 14A-L illustrate application of the approach outlined in FIGs. 13A-I applied to distinguish breast cancer and normal (i.e., non-cancer) samples by probing plasma-derived microvesicles with an oligonucleotide probe library.
- FIGs. 15A-AN comprise heat maps created using cluster analysis of oligonucleotide probe library analysis for various indications versus normal samples.
- FIGs. 16A-C illustrate use of aptamers in methods of characterizing a phenotype.
- FIG. 16A is a schematic 1600 showing an assay configuration that can be used to detect and/or quantify a target of interest.
- capture aptamer 1602 is attached to substrate 1601.
- Target of interest 1603 is bound by capture aptamer 1602.
- Detection aptamer 1604 is also bound to target of interest 1603.
- Detection aptamer 1604 carries label 1605 which can be detected to identify target captured to substrate 1601 via capture aptamer 1602.
- FIG. 16B is a schematic 1610 showing use of an aptamer pool to characterize a phenotype.
- a pool of aptamers to a target of interest is provided 1611.
- FIG. 16C is a schematic 1620 showing an implementation of the method in FIG. 16B.
- a pool of aptamers identified as binding a microvesicle population is provided 1621.
- the input sample comprises microvesicles that are isolated
- the mixture is washed to remove unbound aptamers and the remaining aptamers are disassociated and collected 1625.
- the collected aptamers are identified and the identity of the retained aptamers is used to characterize the phenotype 1626.
- FIGs. 17A-H illustrate an optimized aptamer library design for high throughput
- compositions and methods that can be used to assess a biomarker profile, which can include a presence or level of one or more biomarkers.
- the compositions and methods of the invention comprise the use of aptamers that bind microvesicle surface antigens or a functional fragment thereof.
- the antigens typically comprise proteins or polypeptides but can be any component displayed on a microvesicle surface including lipids and/or carbohydrates.
- aptamers disclosed are nucleic acid molecules, including DNA and RNA, and variations thereof.
- the methods disclosed comprise diagnostic processes and techniques using one or more aptamer of the invention, to determine level or presence of relevant microvesicle surface antigens or a functional fragment thereof.
- an aptamer of the invention can also be used as a binding agent to capture, isolate, or enrich, a cell, cell fragment, vesicle or any other fragment or complex that comprises the surface antigens or functional fragments thereof.
- compositions and methods of the invention comprise individual oligonucleotides that are identified for use in assessing a biomarker profile.
- the invention further discloses compositions and methods of oligonucleotide pools that can be used to detect a biomarker profile in a given sample.
- aptamers and sequences disclosed in the compositions and methods of the invention may be identified herein in the form of DNA or RNA. Unless otherwise specified, one of skill in the art will appreciate that an aptamer may generally be synthesized as either form of nucleic acid and carry various chemical modifications and remain within the scope of the invention.
- the term aptamer may be used in the art to refer to a single oligonucleotide that binds specifically to a target of interest through mechanisms other than Watson crick base pairing, similar to binding of a monoclonal antibody to a particular antigen.
- the terms aptamer and oligonucleotide can be used interchangeably to refer to an oligonucleotide capable of
- -30- Docket No. 37901-820.601 distinguishing biological entities of interest (e.g, biomarkers) whether or not the specific entity has been identified or whether the precise mode of binding has been determined.
- biological entities of interest e.g, biomarkers
- An aptamer of the invention can also be used to provide in vitro or in vivo detection or imaging, to provide any appropriate diagnostic readout (e.g., diagnostic, prognostic or theranostic).
- diagnostic readout e.g., diagnostic, prognostic or theranostic
- an aptamer of the invention can also be used in for treatment or as a therapeutic to specifically target a cell, tissue or organ.
- SELEX Systematic Evolution of Ligands by Exponential Enrichment
- SELEX Systematic Evolution of Ligands by Exponential Enrichment
- Each SELEX-identified nucleic acid ligand, i.e., each aptamer is a specific ligand of a given target compound or molecule.
- the SELEX process is based on the unique insight that nucleic acids have sufficient capacity for forming a variety of two- and three-dimensional structures and sufficient chemical versatility available within their monomers to act as ligands (i.e., form specific binding pairs) with virtually any chemical compound, whether monomeric or polymeric. Molecules of any size or composition can serve as targets.
- SELEX relies as a starting point upon a large library or pool of single stranded oligonucleotides comprising randomized sequences.
- the oligonucleotides can be modified or unmodified DNA, RNA, or DNA/RNA hybrids.
- the pool comprises 100% random or partially random
- the pool comprises random or partially random oligonucleotides containing at least one fixed and/or conserved sequence incorporated within randomized sequence. In other examples, the pool comprises random or partially random oligonucleotides containing at least one fixed and/or conserved sequence at its 5' and/or 3' end which may comprise a sequence shared by all the molecules of the oligonucleotide pool.
- Fixed sequences are sequences such as hybridization sites for PCR primers, promoter sequences for RNA polymerases (e.g., T3, T4, T7, and SP6), restriction sites, or homopolymeric sequences, such as poly A or poly T tracts, catalytic cores, sites for selective binding to affinity columns, and other sequences to facilitate cloning and/or sequencing of an oligonucleotide of interest.
- conserveed sequences are sequences, other than the previously described fixed sequences, shared by a number of aptamers that bind to the same target.
- the oligonucleotides of the pool preferably include a randomized sequence portion as well as fixed sequences useful for efficient amplification.
- the oligonucleotides of the starting pool contain fixed 5' and 3' terminal sequences which flank an internal region of 30-50 random nucleotides.
- the randomized nucleotides can be produced in a number of ways including chemical synthesis and size selection from randomly cleaved cellular nucleic acids. Sequence variation in test nucleic acids can also be introduced or increased by mutagenesis before or during the selection/amplification iterations.
- the random sequence portion of the oligonucleotide can be of any length and can comprise ribonucleotides and/or deoxyribonucleotides and can include modified or non-natural nucleotides or
- Random oligonucleotides can be synthesized from phosphodiester-linked nucleotides using solid phase oligonucleotide synthesis techniques well known in the art. See, e.g., Froehler et al., Nucl. Acid Res. 14:5399-5467 (1986) and Froehler et al., Tet. Lett. 27:5575-5578 (1986). Random
- oligonucleotides can also be synthesized using solution phase methods such as triester synthesis methods. See, e.g., Sood et al., Nucl. Acid Res. 4:2557 (1977) and Hirose et al., Tet. Lett, 28:2449 (1978).
- Typical syntheses carried out on automated DNA synthesis equipment yield 10 14 -10 16 individual molecules, a number sufficient for most SELEX experiments. Sufficiently large regions of random sequence in the sequence design increases the likelihood that each synthesized molecule is likely to represent a unique sequence.
- the starting library of oligonucleotides may be generated by automated chemical synthesis on a DNA synthesizer. To synthesize randomized sequences, mixtures of all four nucleotides are added at each nucleotide addition step during the synthesis process, allowing for random incorporation of nucleotides. As stated above, in one embodiment, random oligonucleotides comprise entirely random sequences; however, in other embodiments, random oligonucleotides can comprise stretches of nonrandom or partially random sequences. Partially random sequences can be created by adding the four nucleotides in different molar ratios at each addition step.
- the starting library of oligonucleotides may be for example, RNA, DNA, or RNA/DNA hybrid.
- an RNA library is to be used as the starting library it is typically generated by transcribing a DNA library in vitro using T7 RNA polymerase or modified T7 RNA polymerases and purified.
- the library is then mixed with the target under conditions favorable for binding and subjected to step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity.
- the SELEX method includes steps of: (a) contacting the mixture with the target under conditions favorable for binding; (b) partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules; (c) dissociating the nucleic acid-target complexes; (d) amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand- enriched mixture of nucleic acids; and (e) reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity nucleic acid ligands to the target molecule.
- the SELEX method further comprises the steps of: (i) reverse transcribing the nucleic acids dissociated from the nucleic acid-target complexes before amplification in step (d); and (ii) transcribing the amplified nucleic acids from step (d) before restarting the process.
- a nucleic acid mixture comprising, for example, a 20 nucleotide randomized segment can have 4 20 candidate possibilities. Those which have the higher affinity constants for the target are most likely to bind to the target. After partitioning, dissociation
- a second nucleic acid mixture is generated, enriched for the higher binding affinity candidates. Additional rounds of selection progressively favor better ligands until the resulting nucleic acid mixture is predominantly composed of only one or a few sequences. These can then be cloned, sequenced and individually tested for binding affinity as pure ligands or aptamers.
- Cycles of selection and amplification are repeated until a desired goal is achieved. In the most general case, selection/amplification is continued until no significant improvement in binding strength is achieved on repetition of the cycle.
- the method is typically used to sample approximately 10 14 different nucleic acid species but may be used to sample as many as about 10 18 different nucleic acid species.
- nucleic acid aptamer molecules are selected in a 5 to 20 cycle procedure. In one embodiment, heterogeneity is introduced only in the initial selection stages and does not occur throughout the replicating process.
- the selection process is so efficient at isolating those nucleic acid ligands that bind most strongly to the selected target, that only one cycle of selection and amplification is required.
- Such an efficient selection may occur, for example, in a chromatographic-type process wherein the ability of nucleic acids to associate with targets bound on a column operates in such a manner that the column is sufficiently able to allow separation and isolation of the highest affinity nucleic acid ligands.
- the target- specific nucleic acid ligand solution may include a family of nucleic acid structures or motifs that have a number of conserved sequences and a number of sequences which can be substituted or added without significantly affecting the affinity of the nucleic acid ligands to the target.
- the aptamer pools can be identified through rounds of positive and negative selection to identify microvesicle indicative of a disease or condition.
- the invention further provides use of such aptamer pools to detect and/or quantify such microvesicles in a sample, thereby allowing a diagnosis, prognosis or theranosis to be provided.
- nucleic acid primary, secondary and tertiary structures are known to exist.
- the structures or motifs that have been shown most commonly to be involved in non- Watson-Crick type interactions are referred to as hairpin loops, symmetric and asymmetric bulges, pseudoknots and myriad combinations of the same.
- Almost all known cases of such motifs suggest that they can be formed in a nucleic acid sequence of no more than 30 nucleotides. For this reason, it is often preferred that SELEX procedures with contiguous randomized segments be initiated with nucleic acid sequences containing a randomized segment of between about 20 to about 50 nucleotides and in some embodiments, about 30 to about 40 nucleotides.
- the 5'-fixed:random:3 '-fixed sequence comprises a random sequence of about 30 to about 50 nucleotides.
- U.S. Pat. No. 5,567,588 and U.S. Pat. No. 5,861,254 describe SELEX based methods which achieve highly efficient partitioning between oligonucleotides having high and low affinity for a target molecule.
- U.S. Pat. No. 5,496,938 describes methods for obtaining improved nucleic acid ligands after the SELEX process has been performed.
- U.S. Pat. No. 5,705,337 describes methods for covalently linking a ligand to its target.
- SELEX can also be used to obtain nucleic acid ligands that bind to more than one site on the target molecule, and to obtain nucleic acid ligands that include non-nucleic acid species that bind to specific sites on the target.
- SELEX provides means for isolating and identifying nucleic acid ligands which bind to any envisionable target, including large and small biomolecules such as nucleic acid- binding proteins and proteins not known to bind nucleic acids as part of their biological function as well as cofactors and other small molecules.
- U.S. Pat. No. 5,580,737 discloses nucleic acid sequences identified through SELEX which are capable of binding with high affinity to caffeine and the closely related analog, theophylline.
- Counter-SELEX is a method for improving the specificity of nucleic acid ligands to a target molecule by eliminating nucleic acid ligand sequences with cross-reactivity to one or more non-target molecules.
- Counter-SELEX is comprised of the steps of: (a) preparing a candidate mixture of nucleic acids; (b) contacting the candidate mixture with the target, wherein nucleic acids having an increased affinity to the target relative to the candidate mixture may be partitioned from the remainder of the candidate mixture; (c) partitioning the increased affinity nucleic acids from the remainder of the candidate mixture; (d) dissociating the increased affinity nucleic acids from the target; e) contacting the increased affinity nucleic acids with one or more non-target molecules such that nucleic acid ligands with specific affinity for the non-target molecule(s) are removed; and (f) amplifying the nucleic acids with specific affinity only to the target molecule to yield a mixture of nucleic acids enriched for nucleic acid sequences with a
- oligonucleotides in their phosphodiester form may be quickly degraded in body fluids by intracellular and extracellular enzymes such as endonucleases and exonucleases before the desired effect is manifest.
- the SELEX method thus encompasses the identification of high-affinity nucleic acid ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/or base positions.
- nucleic acid ligands containing modified nucleotides are described, e.g., in U.S. Pat. No. 5,660,985, which describes oligonucleotides containing nucleotide derivatives chemically modified at the 2' position of ribose, 5 position of pyrimidines, and 8 position of purines, U.S. Pat. No. 5,756,703 which describes oligonucleotides containing various 2'-
- Modifications of the nucleic acid ligands contemplated in this invention include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrophobicity, hydrogen bonding, electrostatic interaction, and fluxionality to the nucleic acid ligand bases or to the nucleic acid ligand as a whole. Modifications to generate oligonucleotide populations which are resistant to nucleases can also include one or more substitute internucleotide linkages, altered sugars, altered bases, or combinations thereof.
- Such modifications include, but are not limited to, 2'- position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil; backbone modifications, phosphorothioate or allyl phosphate modifications, methylations, and unusual base-pairing combinations such as the isobases isocytidine and isoguanosine. Modifications can also include 3' and 5' modifications such as capping.
- oligonucleotides are provided in which the P(0)0 group is replaced by P(0)S ("thioate”), P(S)S ("dithioate”), P(0)NR 2 ("amidate”), P(0)R, P(0)OR', CO or CH 2 ("formacetal”) or 3'-amine (— NH— CH 2 -CH 2 -), wherein each R or R is independently H or substituted or unsubstituted alkyl.
- Linkage groups can be attached to adjacent nucleotides through an— O— ,— N— , or— S— linkage. Not all linkages in the oligonucleotide are required to be identical.
- the term phosphorothioate encompasses one or more non-bridging oxygen atoms in a phosphodiester bond replaced by one or more sulfur atoms.
- the oligonucleotides comprise modified sugar groups, for example, one or more of the hydroxyl groups is replaced with halogen, aliphatic groups, or functionalized as ethers or amines.
- the 2'-position of the furanose residue is substituted by any of an O-methyl, O-alkyl, O-allyl, S-alkyl, S-allyl, or halo group.
- modifications are known to one of ordinary skill in the art. Such modifications may be pre-SELEX process modifications or post-SELEX process modifications (modification of previously identified unmodified ligands) or may be made by incorporation into the SELEX process.
- nucleic acid ligands with both specificity for their SELEX target and improved stability, e.g., in vivo stability.
- Post-SELEX process modifications made to nucleic acid ligands may result in improved stability, e.g., in vivo stability without adversely affecting the binding capacity of the nucleic acid ligand.
- the SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides and non-oligonucleotide functional units as described in U.S. Pat. No. 5,637,459 and U.S. Pat. No. 5,683,867.
- the SELEX method further encompasses combining selected nucleic acid ligands with lipophilic or non-immunogenic high molecular weight compounds in a diagnostic or
- the aptamers with specificity and binding affinity to the target(s) of the present invention can be selected by the SELEX N process as described herein. As part of the SELEX process, the sequences selected to bind to the target are then optionally minimized to determine the minimal sequence having the desired binding affinity. The selected sequences and/or the minimized sequences are optionally optimized by performing random or directed mutagenesis of the sequence to increase binding affinity or alternatively to determine which positions in the sequence are essential for binding activity. Additionally, selections can be performed with sequences incorporating modified nucleotides to stabilize the aptamer molecules against degradation in vivo.
- an aptamer In order for an aptamer to be suitable for use as a therapeutic, it is preferably inexpensive to synthesize, safe and stable in vivo. Wild-type RNA and DNA aptamers are typically not stable is vivo because of their susceptibility to degradation by nucleases. Resistance to nuclease degradation can be greatly increased by the incorporation of modifying groups at the 2'-position.
- Aptamers that contain 2'-0-methyl (“2'-OMe”) nucleotides may overcome one or more potential drawbacks.
- Oligonucleotides containing 2'-OMe nucleotides are nuclease-resistant and inexpensive to synthesize.
- 2'-OMe nucleotides are ubiquitous in biological systems, natural polymerases do not accept 2'-OMe NTPs as substrates under physiological conditions, thus there are no safety concerns over the recycling of 2'-OMe nucleotides into host DNA.
- the SELEX method used to generate 2'-modified aptamers is described, e.g., in U.S. Provisional Patent Application Ser. No.
- the aptamers of the invention can be used in various methods to assess presence or level of biomarkers in a biological sample, e.g., biological entities of interest such as proteins, nucleic acids, or microvesicles.
- the aptamer functions as a binding agent to assess presence or level of the cognate target molecule. Therefore, in various embodiments of the invention directed to diagnostics, prognostics or theranostics, one or more aptamers of the invention are configured in a ligand-target based assay, where one or more aptamer of the invention is contacted with a selected biological sample, where the or more aptamer associates with or binds to its target molecules.
- Aptamers of the invention are used to identify candidate biosignatures based on the biological samples assessed and biomarkers detected.
- aptamers may themselves provide a biosignature for a particular condition or disease.
- a biosignature refers to a biomarker profile of a biological sample comprising a presence, level or other characteristic that can be assessed (including without limitation a sequence, mutation, rearrangement, translocation, deletion, epigenetic modification, methylation, post-translational modification, allele, activity, complex partners, stability, half life, and the like) of one or more biomarker of interest.
- Biosignatures can be used to evaluate diagnostic and/or prognostic criteria such as presence of disease, disease staging, disease monitoring, disease stratification, or surveillance for detection, metastasis or recurrence or progression of disease.
- methods of the invention using aptamers against microvesicle surface antigen are useful for correlating a biosignature comprising microvesicle antigens to a selected condition or disease.
- a biosignature can also be used clinically in making decisions concerning treatment modalities including therapeutic intervention.
- a biosignature can further be used clinically to make treatment decisions, including whether to perform surgery or what treatment standards should be used along with surgery (e.g., either pre-surgery or post-surgery).
- a biosignature of circulating biomarkers that indicates an aggressive form of cancer may call for a more aggressive surgical procedure and/or more aggressive therapeutic regimen to treat the patient.
- a biosignature can be used in any methods disclosed herein, e.g., to assess whether a subject is afflicted with disease, is at risk for developing disease or to assess the stage or progression of the disease.
- a biosignature can be used to assess whether a subject has prostate cancer, colon cancer, or other cancer as described herein.
- a biosignature can be used to determine a stage of a disease or condition, such as colon cancer.
- the biosignature/biomarker profile comprising a microvesicle can include assessment of payload within the microvesicle.
- one or more aptamer of the invention can be used to capture a microvesicle population, thereby providing readout of microvesicle antigens, and then the payload content within the captured microvesicles can be assessed, thereby providing further biomarker readout of the payload content.
- a biosignature for characterizing a phenotype may comprise any number of useful criteria.
- the term "phenotype" as used herein can mean any trait or characteristic that is
- a phenotype can be detected or identified in part or in whole using the compositions and/or methods of the invention.
- at least one criterion is used for each biomarker.
- at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90 or at least 100 criteria are used.
- a number of different criteria can be used when the subject is diagnosed with a cancer: 1) if the amount of microR A in a sample from a subject is higher than a reference value; 2) if the amount of a microRNA within cell type specific vesicles (i.e. vesicles derived from a specific tissue or organ) is higher than a reference value; or 3) if the amount of microRNA within vesicles with one or more cancer specific biomarkers is higher than a reference value. Similar rules can apply if the amount of microRNA is less than or the same as the reference.
- the method can further include a quality control measure, such that the results are provided for the subject if the samples meet the quality control measure. In some embodiments, if the criteria are met but the quality control is questionable, the subject is reassessed.
- a biosignature can be used in therapy related diagnostics to provide tests useful to diagnose a disease or choose the correct treatment regimen, such as provide a theranosis.
- Theranostics includes diagnostic testing that provides the ability to affect therapy or treatment of a diseased state.
- Theranostics testing provides a theranosis in a similar manner that diagnostics or prognostic testing provides a diagnosis or prognosis, respectively.
- theranostics encompasses any desired form of therapy related testing, including predictive medicine, personalized medicine, integrated medicine, pharmacodiagnostics and Dx/Rx partnering. Therapy related tests can be used to predict and assess drug response in individual subjects, i.e., to provide personalized medicine.
- Predicting a drug response can be determining whether a subject is a likely responder or a likely non-responder to a candidate therapeutic agent, e.g., before the subject has been exposed or otherwise treated with the treatment. Assessing a drug response can be monitoring a response to a drug, e.g., monitoring the subject's improvement or lack thereof over a time course after initiating the treatment. Therapy related tests are useful to select a subject for treatment who is particularly likely to benefit from the treatment or to provide an early and objective indication of treatment efficacy in an individual subject. Thus, a biosignature as disclosed herein may indicate that treatment should be altered to select a more promising treatment, thereby avoiding the great expense of delaying beneficial treatment and avoiding the financial and morbidity costs of administering an ineffective drug(s).
- compositions and methods of the invention can be used to identify or detect a biosignature that associated with selected diseases and disorders, which include, but are not limited to cardiovascular disease, cancer, infectious diseases, sepsis, neurological diseases, central nervous system related diseases, endovascular related diseases, and autoimmune related diseases.
- Therapy related diagnostics also aid in the prediction of drug toxicity, drug resistance or drug response.
- Therapy related tests may be developed in any suitable diagnostic testing format, which include, but are not limited to, e.g., immunohistochemical tests, clinical chemistry, immunoassay, cell-based technologies, nucleic acid tests or body imaging methods. Therapy related tests can further include but are not limited to, testing that aids in the
- a biosignature can be used to predict or monitor a subject's response to a treatment.
- a biosignature can be determined at different time points for a subject after initiating, removing, or altering a particular treatment.
- compositions and methods of the invention provide for a determination or prediction as to whether a subject is responding to a treatment is made based on a change in the amount of one or more components of a biosignature (i.e., the microRNA, vesicles and/or biomarkers of interest), an amount of one or more components of a particular biosignature, or the biosignature detected for the components.
- a subject's condition is monitored by determining a biosignature at different time points. The progression, regression, or recurrence of a condition is determined. Response to therapy can also be measured over a time course.
- the invention provides a method of monitoring a status of a disease or other medical condition in a subject, comprising isolating or detecting a biosignature from a biological sample from the subject, detecting the overall amount of the components of a particular biosignature, or detecting the biosignature of one or more components (such as the presence, absence, or expression level of a biomarker).
- the biosignatures are used to monitor the status of the disease or condition.
- One or more novel biosignatures of a vesicle can also be identified.
- one or more vesicles can be isolated from a subject that responds to a drug treatment or treatment regimen and compared to a reference, such as another subject that does not respond to the drug treatment or treatment regimen. Differences between the biosignatures can be determined and used to identify other subjects as responders or non-responders to a particular drug or treatment regimen.
- a biosignature is used to determine whether a particular disease or condition is resistant to a drug, in which case a physician need not waste valuable time with such drug treatment.
- a biosignature is determined for a sample obtained from a subject. The biosignature is used to assess whether the particular subject's disease has the biomarker associated with drug resistance. Such a determination enables doctors to devote critical time as well as the patient's financial resources to effective treatments.
- Biosignatures can be used in the theranosis of a cancer, such as identifying whether a subject suffering from cancer is a likely responder or non-responder to a particular cancer treatment.
- the subject methods can be used to theranose cancers including those listed herein, e.g., in the "Phenotypes" section below.
- lung cancer non-small cell lung cancer small cell lung cancer (including small cell carcinoma (oat cell cancer), mixed small cell/large cell carcinoma, and combined small cell carcinoma), colon cancer, breast cancer, prostate cancer, liver cancer, pancreatic cancer, brain cancer, kidney cancer, ovarian cancer, stomach cancer, melanoma, bone cancer, gastric cancer, breast cancer, glioma, glioblastoma, hepatocellular carcinoma, papillary renal carcinoma, head and neck squamous cell carcinoma, leukemia, lymphoma, myeloma, or other solid tumors.
- lung cancer non-small cell lung cancer small cell lung cancer (including small cell carcinoma (oat cell cancer), mixed small cell/large cell carcinoma, and combined small cell carcinoma)
- colon cancer breast cancer, prostate cancer, liver cancer, pancreatic cancer, brain cancer, kidney cancer, ovarian cancer, stomach cancer, melanoma, bone cancer, gastric cancer, breast cancer, glioma, glioblastoma, hepatocellular carcinoma, papillar
- a biosignature of circulating biomarkers including markers associated with a component present in a biological sample (e.g., cell, cell-fragment, cell-derived extracellular vesicle), in a sample from a biological sample (e.g., cell, cell-fragment, cell-derived extracellular vesicle), in a sample from a biological sample (e.g., cell, cell-fragment, cell-derived extracellular vesicle), in a sample from a
- the candidate treatment comprises a standard of care for the cancer.
- the treatment can be a cancer treatment such as radiation, surgery, chemotherapy or a combination thereof.
- the cancer treatment can be a therapeutic such as anti-cancer agents and chemotherapeutic regimens. Further drug associations and rules that are used in embodiments of the invention are found in U.S.
- Patent Application 12/658,770 filed February 12, 2010; International PCT Patent Publication WO/2010/093465, filed February 11, 2010; International PCT Patent Publication WO/201 1/056688, filed October 27, 2010; and U.S. Provisional Patent Application 61/427,788, filed December 28, 2010; all of which applications are incorporated by reference herein in their entirety. See, e.g., "Table 4: Rules Summary for Treatment Selection" of WO/201 1/056688.
- compositions and methods of the invention can be used to assess any useful biomarkers in a biological sample for charactering a phenotype associated with the sample.
- biomarkers include all sorts of biological entities such as proteins, nucleic acids, lipids, carbohydrates, complexes of any thereof, and microvesicles.
- Various molecules associated with a microvesicle surface or enclosed within the microvesicle can serve as biomarkers.
- the microvesicles themselves can also be used as biomarkers.
- the aptamers of the invention can be used to assess levels or presence of a microvesicle population. See, e.g., FIGs. 16B-16C.
- the aptamers of the invention can also be used to assess levels or presence of their specific target molecule. See, e.g., FIG. 16A.
- aptamers of the invention are used to capture or isolated a component present in a biological sample that has the aptamer's target molecule present. For example, if a given microvesicle surface antigen is present on a cell, cell fragment or cell-derived extracellular vesicle.
- a binding agent to the biomarker may be used to capture or isolate the cell, cell fragment or cell-derived extracellular vesicles. See, e.g., FIGs. 2A-2B, 16A. Such captured or isolated entities may be further characterized to assess additional surface antigens or internal "payload" molecules present (i.e., nucleic acid molecules, lipids, sugars, polypeptides or functional fragments thereof, or anything else present in the cellular milieu that may be used as a biomarker), where one or more biomarkers provide a biosignature to assess a desired phenotype, such a s disease or condition. See, e.g., FIG. 2F. Therefore, aptamers of the invention are used not only to assess one or more microvesicle surface antigen of interest but are also used to separate a component present in a biological sample, where the components themselves can be further assessed to identify a candidate biosignature.
- the methods of the invention can comprise multiplex analysis of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 50, 75 or 100 different biomarkers.
- an assay of a heterogeneous population of vesicles can be performed with a plurality of particles that are differentially labeled. There can be at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 50, 75 or 100 differentially labeled particles.
- the particles may be externally labeled, such as with a tag, or they
- Each differentially labeled particle can be coupled to a capture agent, such as a binding agent, for a vesicle, resulting in capture of a vesicle.
- a capture agent such as a binding agent
- the multiple capture agents can be selected to characterize a phenotype of interest, including capture agents against general vesicle biomarkers, cell- of-origin specific biomarkers, and disease biomarkers.
- One or more biomarkers of the captured vesicle can then be detected by a plurality of binding agents.
- the binding agent can be directly labeled to facilitate detection. Alternatively, the binding agent is labeled by a secondary agent.
- the binding agent may be an antibody for a biomarker on the vesicle, wherein the binding agent is linked to biotin.
- a secondary agent comprises streptavidin linked to a reporter and can be added to detect the biomarker.
- the captured vesicle is assayed for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 50, 75 or 100 different biomarkers.
- multiple detectors i.e., detection of multiple biomarkers of a captured vesicle or population of vesicles, can increase the signal obtained, permitted increased sensitivity, specificity, or both, and the use of smaller amounts of samples. Detection can be with more than one biomarker, including without limitation more than one general vesicle marker such as in Table 3.
- An immunoassay based method can be used to detect a biomarker of a vesicle.
- An example includes ELISA.
- a binding agent can be bound to a well.
- a binding agent such as an aptamer or antibody to an antigen of a vesicle can be attached to a well.
- a biomarker on the captured vesicle can be detected based on the methods described herein.
- FIG. 2A shows an illustrative schematic for a sandwich-type of immunoassay.
- the capture agent can be against a vesicle antigen of interest, e.g., a general vesicle biomarker, a cell-of-origin marker, or a disease marker.
- a vesicle antigen of interest e.g., a general vesicle biomarker, a cell-of-origin marker, or a disease marker.
- the captured vesicles are detected using fluorescently labeled binding agent (detection agent) against vesicle antigens of interest.
- Multiple capture binding agents can be used, e.g., in distinguishable addresses on an array or different wells of an immunoassay plate.
- the detection binding agents can be against the same antigen as the capture binding agent, or can be directed against other markers.
- the capture binding agent can be any useful binding agent, e.g., tethered aptamers, antibodies or lectins, and/or the detector antibodies can be similarly substituted, e.g., with detectable (e.g., labeled) aptamers, antibodies, lectins or other binding proteins or entities.
- one or more capture agents to a general vesicle biomarker, a cell-of-origin marker, and/or a disease marker are used along with detection agents against general vesicle biomarker, such as tetraspanin molecules including without limitation one or more of CD9, CD63 and CD81, or other markers in Table 3 herein.
- microvesicle surface antigens are disclosed herein, e.g. in Tables 3 or 4, or are known in the art, and examples useful in methods and compositions of the invention are disclosed of International Patent Publication No. WO/201 1/127219, entitled “Circulating Biomarkers for Disease” and filed April 6, 201 1.
- FIG. 2D presents an illustrative schematic for analyzing vesicles according to the methods of the invention.
- Capture agents are used to capture vesicles
- detectors are used to detect the captured vesicles
- the level or presence of the captured and detected microvesicles is used to characterize a phenotype.
- Capture agents, detectors and characterizing phenotypes can be any of those described herein.
- capture agents include antibodies or aptamers tethered to a substrate that recognize a vesicle
- detectors include labeled antibodies or aptamers to a vesicle antigen of interest, and characterizing a phenotype includes a diagnosis, prognosis, or theranosis of a disease.
- a population of vesicles is captured with one or more capture agents against general vesicle biomarkers (200).
- the captured vesicles are then labeled with detectors against cell-of-origin biomarkers (201) and/or disease specific biomarkers (202).
- the biosignature used to characterize the phenotype (203) can include the general vesicle markers (200) and the cell-of-origin biomarkers (201). If only disease detectors are used (202), the biosignature used to characterize the phenotype (203) can include the general vesicle markers (200) and the disease biomarkers (202). Alternately, detectors are used to detect both cell-of-origin biomarkers (201) and disease specific biomarkers (202). In this case, the biosignature used to characterize the phenotype (203) can include the general vesicle markers (200), the cell-of-origin biomarkers (201) and the disease biomarkers (202). The biomarkers combinations are selected to characterize the phenotype of interest and can be selected from the biomarkers and phenotypes described herein, e.g., in Tables 3 or 4.
- a population of vesicles is captured with one or more capture agents against cell-of-origin biomarkers (210) and/or disease biomarkers (211).
- the captured vesicles are then detected using detectors against general vesicle biomarkers (212). If only cell-of-origin capture agents are used (210), the biosignature used to characterize the phenotype (213) can include the cell-of- origin biomarkers (210) and the general vesicle markers (212).
- the biosignature used to characterize the phenotype (213) can include the disease biomarkers (211) and the general vesicle biomarkers (212). Alternately, capture agents to one or more cell-of-origin biomarkers (210) and one or more disease specific biomarkers (211) are used to capture vesicles. In this case, the biosignature used to characterize the phenotype (213) can include the cell-of- origin biomarkers (210), the disease biomarkers (211), and the general vesicle markers (213). The biomarkers combinations are selected to characterize the phenotype of interest and can be selected from the biomarkers and phenotypes described herein.
- the methods of the invention comprise capture and detection of microvesicles of interest using any combination of useful biomarkers.
- a microvesicle population can be captured using one or more binding agent to any desired combination of cell of origin, disease specific, or general vesicle markers.
- the captured microvesicles can then be detected using one or more binding agent to any desired combination of cell of origin, disease specific, or general vesicle markers.
- FIG. 2E represents a flow diagram of such configurations. Any one or more of a cell-of-origin biomarker (240), disease biomarkers (241), and general vesicle biomarker (242) is used to capture a microvesicle population.
- any one or more of a cell-of-origin biomarker (243), disease biomarkers (244), and general vesicle biomarker (245) is used to detect the captured microvesicle population.
- the biosignature of captured and detected microvesicles is then used to characterize a phenotype.
- the biomarkers combinations are selected to characterize the phenotype of interest and can be selected from the biomarkers and phenotypes described herein.
- a microvesicle payload molecule can be assessed as a member of a biosignature panel.
- a payload molecule comprises any of the biological entities contained within a cell, cell fragment or vesicle membrane. These entities include without limitation nucleic acids, e.g., mR A, microRNA, or DNA fragments; protein, e.g., soluble and membrane associated proteins; carbohydrates; lipids; metabolites; and various small molecules, e.g., hormones.
- the payload can be part of the cellular milieu that is encapsulated as a vesicle is formed in the cellular environment.
- the payload is analyzed in addition to detecting vesicle surface antigens.
- Specific populations of vesicles can be captured as described above then the payload in the captured vesicles can be used to characterize a phenotype.
- vesicles captured on a substrate can be further isolated to assess the payload therein.
- the vesicles in a sample are detected and sorted without capture. The vesicles so detected can be further isolated to assess the payload therein.
- vesicle populations are sorted by flow cytometry and the payload in the sorted vesicles is analyzed. In the scheme shown in FIG.
- a population of vesicles is captured and/or detected (220) using one or more of cell-of-origin biomarkers (220), disease biomarkers (221), and/or general vesicle markers (222).
- the payload of the isolated vesicles is assessed (223).
- a biosignature detected within the payload can be used to characterize a phenotype (224).
- a vesicle population can be analyzed in a plasma sample from a patient using antibodies against one or more vesicle antigens of interest.
- the antibodies can be capture antibodies which are tethered to a substrate to isolate a desired vesicle population.
- the antibodies can be directly labeled and the labeled vesicles isolated by sorting with flow cytometry.
- the presence or level of microRNA or mRNA extracted from the isolated vesicle population can be used to detect a biosignature.
- the biosignature is then used to diagnose, prognose or theranose the patient.
- vesicle or cellular payload is analyzed in a population (e.g., cells or vesicles) without first capturing or detected subpopulations of vesicles.
- a cellular or extracellular vesicle population can be generally isolated from a sample using centrifugation, filtration, chromatography, or other techniques as described herein and known in the art.
- the payload of such sample components can be analyzed thereafter to detect a biosignature and characterize a phenotype.
- FIG. 2F v a population of vesicles is isolated (230) and the payload of the isolated vesicles is assessed (231).
- a biosignature detected within the payload can be used to characterize a phenotype (232).
- a vesicle population is isolated from a plasma sample from a patient using size exclusion and membrane filtration. The presence or level of microRNA or mRNA extracted from the vesicle population is used to detect a biosignature. The biosignature is then used to diagnose, prognose or theranose the patient.
- the biomarkers used to detect a vesicle population can be selected to detect a microvesicle population of interest, e.g., a population of vesicles that provides a diagnosis, prognosis or theranosis of a selected condition or disease, including but not limited to a cancer, a premalignant condition, an inflammatory disease, an immune disease, an autoimmune disease or disorder, a cardiovascular disease or disorder, neurological disease or disorder, infectious disease or pain. See Section "Phenotypes" herein for more detail.
- the biomarkers are selected from the group consisting of EpCam
- transmembrane epithelial antigen of the prostate 1) KLK2 (kallikrein-related peptidase 2), SSX2 (synovial sarcoma, X breakpoint 2), SSX4 (synovial sarcoma, X breakpoint 4), PBP (prostatic binding protein), SPDEF (SAM pointed domain containing ets transcription factor), EGFR (epidermal growth factor receptor), and a combination thereof.
- One or more of these markers can provide a biosignature for a specific condition, such as to detect a cancer, including without limitation a carcinoma, a prostate cancer, a breast cancer, a lung cancer, a colorectal cancer, an ovarian cancer, melanoma, a brain cancer, or other type of cancer as disclosed herein.
- a binding agent to one or more of these markers is used to capture a microvesicle population, and an aptamer of the invention is used to assist in detection of the capture vesicles as described herein.
- an aptamer of the invention is used to capture a microvesicle population, and a binding agent to one or more of these markers is used to assist in detection of the capture vesicles as described herein.
- the binding agents can be any useful binding agent as disclosed herein or known in the art, e.g., antibodies or aptamers.
- the methods of characterizing a phenotype can employ a combination of techniques to assess a component or population of components present in a biological sample of interest.
- an aptamer of the invention can be used to assess a single cell, or a single extracellular vesicle or a population of cells or population of vesicles.
- a sample may be split into various aliquots, where each is analyzed separately. For example, protein content of one or more aliquot is determined and microRNA content of one or more other aliquot is determined. The protein content and microRNA content can be combined to characterize a phenotype.
- a component present in a biological sample of interest is isolated and the payload therein is assessed (e.g., capture a population of
- a population of vesicles with a given surface marker can be isolated by using a binding agent to a microvesicle surface marker. See, e.g., FIGs. 2A, 2B, 16A.
- the binding agent can be an aptamer that was identified to target the microvesicle surface marker using to the methods of the invention.
- the isolated vesicles is assessed for additional biomarkers such as surface content or payload, which can be contemporaneous to detection of the aptamer-specific target or the assessment of additional biomarkers can be before or subsequent to aptamer-specific target detection.
- a biosignature can be detected qualitatively or quantitatively by detecting a presence, level or concentration of a circulating biomarker, e.g., a microRNA, protein, vesicle or other biomarker, as disclosed herein.
- a biomarker can be detected by microarray analysis, polymerase chain reaction (PCR) (including PCR-based methods such as real time polymerase chain reaction (RT-)
- a biomarker such as a nucleic acid
- a biomarker can be amplified prior to detection.
- a biomarker can also be detected by immunoassay, immunoblot, immunoprecipitation, enzyme-linked immunosorbent assay (ELISA; EIA), radioimmunoassay (RIA), flow cytometry, or electron microscopy (EM).
- ELISA enzyme-linked immunosorbent assay
- RIA radioimmunoassay
- EM electron microscopy
- Biosignatures can be detected using aptamers of the invention that function as either as capture agents and detection agents, as described herein.
- a capture agent can comprise an antibody, aptamer or other entity which recognizes a biomarker and can be used for capturing the biomarker.
- Biomarkers that can be captured include circulating biomarkers, e.g., a protein, nucleic acid, lipid or biological complex in solution in a bodily fluid. Similarly, the capture agent can be used for capturing a vesicle.
- a detection agent can comprise an antibody or other entity which recognizes a biomarker and can be used for detecting the biomarker vesicle, or which recognizes a vesicle and is useful for detecting a vesicle.
- the detection agent is labeled and the label is detected, thereby detecting the biomarker or vesicle.
- the detection agent can be a binding agent, e.g., an antibody or aptamer.
- the detection agent comprises a small molecule such as a membrane protein labeling agent. See, e.g., the membrane protein labeling agents disclosed in Alroy et al., US. Patent Publication US 2005/0158708.
- vesicles are isolated or captured as described herein, and one or more membrane protein labeling agent is used to detect the vesicles.
- the antigen or other vesicle- moiety that is recognized by the capture and detection agents are interchangeable.
- a vesicle having a cell-of-origin specific antigen on its surface and a cancer-specific antigen on its surface is captured using a binding agent that is specific to a cells-specific antigen, e.g., by tethering the capture antibody or aptamer to a substrate, and then the vesicle is detected using a binding agent to a disease-specific antigen, e.g., by labeling the binding agent used for detection with a fluorescent dye and detecting the fluorescent radiation emitted by the dye.
- the target molecule for a binding agent (such as an aptamer of the invention) is informative as to assessing a condition or disease
- the same binding agent can be used to both capture a component comprising the target molecule (e.g., microvesicle surface antigen of interest) and also be modified to comprise a detectable label so as to detect the target molecule, e.g., binding agenti -antigen-binding agent 2 *, wherein the * signifies a detectable label; binding agenti and binding agent 2 may be the same binding agent or a different binding agent (e.g., same aptamer or different aptamer).
- binding agenti and binding agent 2 can be selected from wholly different categories of binding agents (e.g., antibody, aptamer, synthetic antibody, peptide-nucleic acid molecule, or any molecule that is configured to specifically bind to or associate with its target molecule). Such binding molecules can be selected solely based on their binding specificity for a target molecule.
- binding agents e.g., antibody, aptamer, synthetic antibody, peptide-nucleic acid molecule, or any molecule that is configured to specifically bind to or associate with its target molecule.
- binding molecules can be selected solely based on their binding specificity for a target molecule.
- Techniques of detecting biomarkers or capturing sample components using an aptamer of the invention include the use of a planar substrate such as an array (e.g., biochip or microarray), with molecules immobilized to the substrate as capture agents that facilitate the detection of a particular biosignature.
- the array can be provided as part of a kit for assaying one or more biomarkers. Additional examples of binding agents described above and useful in the compositions and methods of the invention are disclosed in International Patent Publication No. WO/201 1/127219, entitled “Circulating Biomarkers for Disease” and filed April 6, 201 1 , which application is incorporated by reference in its entirety herein.
- an array comprises a custom array comprising biomolecules selected to specifically identify biomarkers of interest.
- Customized arrays can be modified to detect biomarkers that increase statistical performance, e.g., additional biomolecules that identifies a biosignature which lead to improved cross-validated error rates in multivariate prediction models (e.g., logistic regression, discriminant analysis, or regression tree models).
- customized array(s) are constructed to study the biology of a disease, condition or syndrome and profile biosignatures in defined physiological states.
- Markers for inclusion on the customized array be chosen based upon statistical criteria, e.g., having a desired level of statistical significance in differentiating between phenotypes or physiological states.
- standard significance of p-value 0.05 is chosen to exclude or include biomolecules on the microarray.
- the p-values can be corrected for multiple comparisons.
- nucleic acids extracted from samples from a subject with or without a disease can be hybridized to a high density microarray that binds to thousands of gene sequences. Nucleic acids whose levels are significantly different between the samples with or without the disease can be selected as biomarkers to distinguish samples as having the disease or not.
- a customized array can be constructed to detect the selected biomarkers.
- customized arrays comprise low density microarrays, which refer to arrays with lower number of addressable binding agents, e.g., tens or hundreds instead of thousands.
- Low density arrays can be formed on a substrate.
- customizable low density arrays use PCR amplification in plate wells, e.g., TaqMan® Gene Expression Assays (Applied Biosystems by Life Technologies Corporation, Carlsbad, CA).
- An aptamer of the invention or other useful binding agent may be linked directly or indirectly to a solid surface or substrate. See, e.g., FIGs. 2A-2B, 9, 16A.
- a solid surface or substrate can be any physically separable solid to which a binding agent can be directly or indirectly attached including, but not limited to, surfaces provided by microarrays and wells, particles such as beads, columns, optical fibers, wipes, glass and modified or functionalized glass, quartz, mica, diazotized membranes (paper or nylon), polyformaldehyde, cellulose, cellulose acetate, paper, ceramics, metals, metalloids,
- plastics including acrylics, polystyrene, copolymers of styrene or other materials, polypropylene, polyethylene, polybutylene, polyurethanes, Teflon material, etc.), polysaccharides, nylon or nitrocellulose, resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses, plastics, ceramics, conducting polymers (including polymers such as polypyrole
- the substrate may be coated using passive or chemically-derivatized coatings with any number of materials, including polymers, such as dextrans, acrylamides, gelatins or agarose. Such coatings can facilitate the use of the array with a biological sample.
- an aptamer or other useful binding agent can be conjugated to a detectable entity or label.
- Appropriate labels include without limitation a magnetic label, a fluorescent moiety, an enzyme, a chemiluminescent probe, a metal particle, a non-metal colloidal particle, a polymeric dye particle, a pigment molecule, a pigment particle, an electrochemically active species, semiconductor nanocrystal or other nanoparticles including quantum dots or gold particles, fluorophores, quantum dots, or radioactive labels.
- Protein labels include green fluorescent protein (GFP) and variants thereof (e.g., cyan fluorescent protein and yellow fluorescent protein); and luminescent proteins such as luciferase, as described below.
- Radioactive labels include without limitation radioisotopes (radionuclides), such as 3x Hj, 11 / C-,, 14 C-,, 18 F ? , 32 n P, 35 c S, 64 / C-,u, 68 / G-,a, 86 v Y, 99 T Tc, 111 T In, 123 T I, 124 T I, 125 T I, 131 T I, 133 X v e, 177 T Lu, 211 A. t., or 213 D Bi-.
- radioisotopes radioisotopes
- Fluorescent labels include without limitation a rare earth chelate (e.g., europium chelate), rhodamine; fluorescein types including without limitation FITC, 5-carboxyfluorescein, 6-carboxy fluorescein; a rhodamine type including without limitation TAMRA; dansyl; Lissamine; cyanines; phycoerythrins; Texas Red; Cy3, Cy5, dapoxyl, NBD, Cascade Yellow, dansyl, PyMPO, pyrene, 7- diethylaminocoumarin-3-carboxylic acid and other coumarin derivatives, Marina BlueTM, Pacific BlueTM, Cascade BlueTM, 2-anthracenesulfonyl, PyMPO, 3,4,9, 10-perylene-tetracarboxylic acid, 2,7- difluorofluorescein (Oregon GreenTM 488-X), 5-carboxyfluorescein, Texas RedTM-X, Alexa Fluor 430, 5- carboxy
- the fluorescent label can be one or more of FAM, dRHO, 5-FAM, 6FAM, dR6G, JOE, HEX, VIC, TET, dTAMRA, TAMRA, NED, dROX, PET, BHQ, Gold540 and LIZ.
- an aptamer can be directly or indirectly labeled, e.g., the label is attached to the aptamer through biotin-streptavidin (e.g., synthesize a biotinylated aptamer, which is then capable of binding a streptavidin molecule that is itself conjugated to a detectable label; non- limiting example is streptavidin, phycoerythrin conjugated (SAPE)).
- biotin-streptavidin e.g., synthesize a biotinylated aptamer, which is then capable of binding a streptavidin molecule that is itself conjugated to a detectable label; non- limiting example is streptavidin, phycoerythrin conjugated (SAPE)
- Methods for chemical coupling using multiple step procedures include biotinylation, coupling of trinitrophenol (TNP) or digoxigenin using for example succinimide esters of these compounds.
- Biotinylation can be accomplished by, for example, the use of D-biotinyl-N-hydroxysuccinimide. Succinimide groups react effectively with amino groups at pH values above 7, and preferentially between about pH 8.0 and about pH 8.5. Alternatively, an aptamer is not labeled, but is later contacted with a second antibody that is labeled after the first antibody is bound to an antigen of interest.
- enzyme-substrate labels may also be used in conjunction with a composition or method of the invention.
- Such enzyme-substrate labels are available commercially (e.g., U.S. Pat. No. 4,275,149).
- the enzyme generally catalyzes a chemical alteration of a chromogenic substrate that can be measured using various techniques. For example, the enzyme may catalyze a color change in a substrate, which can be measured spectrophotometrically. Alternatively, the enzyme may alter the fluorescence or
- enzymatic labels include luciferases (e.g., firefly luciferase and bacterial luciferase; U.S. Pat. No. 4,737,456), luciferin, 2,3-dihydrophthalazinediones, malate dehydrogenase, urease, peroxidase such as horseradish peroxidase (HRP), alkaline phosphatase (AP), ⁇ -galactosidase, glucoamylase, lysozyme, saccharide oxidases (e.g., glucose oxidase, galactose oxidase, and glucose-6-phosphate dehydrogenase), heterocyclic oxidases (such as uricase and xanthine oxidase), lactoperoxidase, microperoxidase, and the like.
- luciferases e.g., firefly luciferase and bacterial luci
- enzyme-substrate combinations include, but are not limited to, horseradish peroxidase (HRP) with hydrogen peroxidase as a substrate, wherein the hydrogen peroxidase oxidizes a dye precursor (e.g., orthophenylene diamine (OPD) or 3,3',5,5'-tetramethylbenzidine hydrochloride (TMB)); alkaline phosphatase (AP) with para-nitrophenyl phosphate as chromogenic substrate; and ⁇ -D-galactosidase ( ⁇ -D-Gal) with a chromogenic substrate (e.g., p-nitrophenyl- ⁇ -D-galactosidase) or fluorogenic substrate 4-methylumbelliferyl ⁇ -D-galactosidase.
- HRP horseradish peroxidase
- OPD orthophenylene diamine
- TMB 3,3',5,5'-tetramethylbenzidine hydrochloride
- AP alkaline
- Aptamer(s) can be linked to a substrate such as a planar substrate.
- a planar array generally contains addressable locations (e.g., pads, addresses, or micro-locations) of biomolecules in an array format. The size of the array will depend on the composition and end use of the array. Arrays can be made containing from 2 different molecules to many thousands. Generally, the array comprises from two to as many as 100,000 or more molecules, depending on the end use of the array and the method of manufacture.
- a microarray for use with the invention comprises at least one biomolecule that identifies or captures a biomarker present in a biosignature of interest, e.g., a microRNA or other biomolecule or vesicle that makes up the biosignature. In some arrays, multiple substrates are used, either of different or identical compositions. Accordingly, planar arrays may comprise a plurality of smaller substrates.
- the present invention can make use of many types of arrays for detecting a biomarker, e.g., a biomarker associated with a biosignature of interest.
- Useful arrays or microarrays include without limitation DNA microarrays, such as cDNA microarrays, oligonucleotide microarrays and SNP microarrays, microRNA arrays, protein microarrays, antibody microarrays, tissue microarrays, cellular microarrays (also called transfection microarrays), chemical compound microarrays, and carbohydrate arrays (glycoarrays). These arrays are described in more detail above.
- microarrays comprise biochips that provide high-density immobilized arrays of recognition molecules (e.g., aptamers or antibodies), where biomarker binding is monitored indirectly (e.g., via fluorescence).
- An array or microarray that can be used to detect one or more biomarkers of a biosignature and comprising one or more aptamers can be made according to the methods described in U.S. Pat. Nos. 6,329,209; 6,365,418; 6,406,921 ; 6,475,808; and 6,475,809, and U.S. Patent Application Ser. No.
- Custom arrays to detect specific selections of sets of biomarkers described herein can be made using the methods described in
- microarrays can also be used to carry out the methods of the invention, including without limitation those from Affymetrix (Santa Clara, CA), Illumina (San Diego, CA), Agilent (Santa Clara, CA), Exiqon (Denmark), or Invitrogen (Carlsbad, CA).
- Custom and/or commercial arrays include arrays for detection proteins, nucleic acids, and other biological molecules and entities (e.g., cells, vesicles, virii) as described herein.
- multiple capture molecules are disposed on an array, e.g., proteins, peptides or additional nucleic acid molecules.
- the proteins are immobilized using methods and materials that minimize the denaturing of the proteins, that minimize alterations in the activity of the proteins, or that minimize interactions between the protein and the surface on which they are immobilized.
- the capture molecules can comprise one or more aptamer of the invention.
- an array is constructed for the hybridization of a pool of aptamers. The array can then be used to identify pool members that bind a sample, thereby facilitating characterization of a phenotype. See FIGs. 16B-16C and related disclosure for further details.
- Array surfaces useful may be of any desired shape, form, or size.
- Non-limiting examples of surfaces include chips, continuous surfaces, curved surfaces, flexible surfaces, films, plates, sheets, or tubes. Surfaces can have areas ranging from approximately a square micron to approximately 500 cm 2 . The area, length, and width of surfaces may be varied according to the requirements of the assay to be performed. Considerations may include, for example, ease of handling, limitations of the material(s) of which the surface is formed, requirements of detection systems, requirements of deposition systems (e.g., arrayers), or the like.
- arrays are situated within microwell plates having any number of wells.
- the bottoms of the wells may serve as surfaces for the formation of arrays, or arrays may be formed on other surfaces and then placed into wells.
- binding islands may be formed or molecules may be immobilized on a surface and a gasket having holes spatially arranged so that they correspond to the islands or biomolecules may be placed on the surface.
- a gasket is preferably liquid tight. A gasket may be placed on a surface at any time during the process of making the array and may be removed if separation of groups or arrays is no longer desired.
- the immobilized molecules can bind to one or more biomarkers or vesicles present in a biological sample contacting the immobilized molecules.
- the immobilized molecules modify or are modified by molecules present in the one or more vesicles contacting the immobilized molecules. Contacting the sample typically comprises overlaying the sample upon the array.
- Modifications or binding of molecules in solution or immobilized on an array can be detected using detection techniques known in the art.
- detection techniques include immunological techniques such as competitive binding assays and sandwich assays; fluorescence detection using
- Microarray technology can be combined with mass spectroscopy (MS) analysis and other tools.
- Electrospray interface to a mass spectrometer can be integrated with a capillary in a microfluidics device.
- eTag reporters that are fluorescent labels with unique and well-defined electrophoretic mobilities; each label is coupled to biological or chemical probes via cleavable linkages.
- the distinct mobility address of each eTag reporter allows mixtures of these tags to be rapidly deconvoluted and quantitated by capillary electrophoresis.
- This system allows concurrent gene expression, protein expression, and protein function analyses from the same sample Jain KK:
- a biochip can include components for a microfluidic or nanofluidic assay.
- a microfluidic device can be used for isolating or analyzing biomarkers, such as determining a biosignature.
- Microfluidic systems allow for the miniaturization and compartmentalization of one or more processes for isolating, capturing or detecting a vesicle, detecting a microRNA, detecting a circulating biomarker, detecting a biosignature, and other processes.
- the microfluidic devices can use one or more detection reagents in at least one aspect of the system, and such a detection reagent can be used to detect one or more biomarkers.
- the device detects a biomarker on an isolated or bound vesicle.
- Various probes, antibodies, proteins, or other binding agents can be used to detect a biomarker within the microfluidic system.
- the detection agents may be immobilized in different compartments of the microfluidic device or be entered into a hybridization or detection reaction through various channels of the device.
- a vesicle in a microfluidic device can be lysed and its contents detected within the microfluidic device, such as proteins or nucleic acids, e.g., DNA or R A such as miRNA or mRNA.
- the nucleic acid may be amplified prior to detection, or directly detected, within the microfluidic device.
- microfluidic system can also be used for multiplexing detection of various biomarkers.
- vesicles are captured within the microfluidic device, the captured vesicles are lysed, and a biosignature of microRNA from the vesicle payload is determined.
- the biosignature can further comprise the capture agent used to capture the vesicle.
- Novel nanofabrication techniques are opening up the possibilities for biosensing applications that rely on fabrication of high-density, precision arrays, e.g., nucleotide-based chips and protein arrays otherwise known as heterogeneous nanoarrays.
- Nanofluidics allows a further reduction in the quantity of fluid analyte in a microchip to nanoliter levels, and the chips used here are referred to as nanochips. See, e.g., Unger Met al., Biotechniques 1999; 27(5): 1008-14, Kartalov EP et al., Biotechniques 2006;
- Nanochips currently provide simple one step assays such as total cholesterol, total protein or glucose assays that can be run by combining sample and reagents, mixing and monitoring of the reaction.
- Gel-free analytical approaches based on liquid chromatography (LC) and nanoLC separations can be used in combination with the nanochips.
- kits can include, an aptamer of the invention, including as non-limiting examples, one or more reagents useful for preparing molecules for immobilization onto binding islands or areas of an array, reagents useful for detecting binding of a vesicle to immobilized molecules, and instructions for use.
- a rapid detection device that facilitates the detection of a particular biosignature in a biological sample.
- the device can integrate biological sample preparation with polymerase chain reaction (PCR) on a chip.
- PCR polymerase chain reaction
- the device can facilitate the detection of a particular biosignature of a vesicle in a biological sample, and an example is provided as described in Pipper et al, Angewandte Chemie, 47(21), p. 3900-3904 (2008), which is herein incorporated by reference in its entirety.
- a biosignature can be incorporated using micro-/nano-electrochemical system (MEMS/NEMS) sensors and oral fluid for diagnostic applications as described in Li et al, Adv Dent Res 18(1): 3-5 (2005), which is herein incorporated by reference in its entirety.
- MEMS/NEMS micro-/nano-electrochemical system
- assays using particles are also capable of use with an aptamer of the invention.
- Aptamers are easily conjugated with commercially available beads. See, e.g., Srinivas et al. Anal. Chem. 201 1 Oct. 21, Aptamer functionalized Microgel Particles for Protein Detection; See also, review article on aptamers as therapeutic and diagnostic agents, Brody and Gold, Rev. Mol. Biotech. 2000, 74:5-13.
- Multiparametric assays or other high throughput detection assays using bead coatings with cognate ligands and reporter molecules with specific activities consistent with high sensitivity automation can be used.
- a binding agent for a biomarker or vesicle such as a capture agent (e.g. capture antibody)
- a capture agent e.g. capture antibody
- Each binding agent for each individual binding assay can be coupled to a distinct type of microsphere (i.e., microbead) and the assay reaction takes place on the surface of the microsphere, such as depicted in FIG. 2B.
- a binding agent for a vesicle can be a capture antibody coupled to a bead. Dyed microspheres with discrete fluorescence intensities are loaded separately with their appropriate binding agent or capture probes. The different bead sets carrying different binding agents can be pooled as desired to generate custom bead arrays. Bead arrays are then incubated with the sample in a single reaction vessel to perform the assay.
- Bead-based assays can also be used with one or more aptamers of the invention.
- a bead substrate can provide a platform for attaching one or more binding agents, including aptamer(s).
- multiple different bead sets e.g., Illumina, Luminex
- multiple different bead sets can have different binding agents (specific to different target molecules).
- a bead can be conjugated to an aptamer of the invention used to detect the presence (quantitatively or qualitatively) of an antigen of interest, or it can also be used to isolate a component present in a selected biological sample (e.g., cell, cell- fragment or vesicle comprising the target molecule to which the aptamer is configured to bind or associate). Any molecule of organic origin can be successfully conjugated to a polystyrene bead through use of commercially available kits.
- One or more aptamers of the invention can be used with any bead based substrate, including but not limited to magnetic capture method, fluorescence activated cell sorting (FACS) or laser cytometry.
- Magnetic capture methods can include, but are not limited to, the use of magnetically activated cell sorter (MACS) microbeads or magnetic columns.
- MCS magnetically activated cell sorter
- bead or particle based methods that can be modified to use an aptamer of the invention include methods and bead systems described in U.S. Patent Nos. 4,551,435, 4,795,698, 4,925,788, 5, 108,933, 5,186,827, 5,200,084 or 5,158,871 ; 7,399,632;
- Isolation or detection of circulating biomarkers e.g., protein antigens, from a biological sample, or of the biomarker-comprising cells, cell fragments or vesicles may also be achieved using an aptamer of the invention in a cytometry process.
- aptamers of the invention can be used in an assay comprising using a particle such as a bead or microsphere
- the invention provides aptamers as binding agents, which may be conjugated to the particle.
- Flow cytometry can be used for sorting microscopic particles suspended in a stream of fluid. As particles pass through they can be selectively charged and on their exit can be deflected into separate paths of flow.
- Flow cytometry allows simultaneous multiparametric analysis of the physical and/or chemical characteristics of single cells flowing through an optical/electronic detection apparatus.
- a beam of light, usually laser light, of a single frequency (color) is directed onto a hydrodynamically focused stream of
- a number of detectors are aimed at the point where the stream passes through the light beam; one in line with the light beam (Forward Scatter or FSC) and several perpendicular to it (Side Scatter or SSC) and one or more fluorescent detectors.
- Each suspended particle passing through the beam scatters the light in some way, and fluorescent chemicals in the particle may be excited into emitting light at a lower frequency than the light source.
- This combination of scattered and fluorescent light is picked up by the detectors, and by analyzing fluctuations in brightness at each detector (one for each fluorescent emission peak), it is possible to deduce various facts about the physical and chemical structure of each individual particle.
- FSC correlates with the cell size and SSC depends on the inner complexity of the particle, such as shape of the nucleus, the amount and type of cytoplasmic granules or the membrane roughness.
- Flow cytometers can analyze several thousand particles every second in "real time” and can actively separate out and isolate particles having specified properties. They offer high-throughput automated quantification, and separation, of the set parameters for a high number of single cells during each analysis session.
- Flow cytometers can have multiple lasers and fluorescence detectors, allowing multiple labels to be used to more precisely specify a target population by their phenotype.
- a flow cytometer such as a multicolor flow cytometer, can be used to detect one or more vesicles with multiple fluorescent labels or colors.
- the flow cytometer can also sort or isolate different vesicle populations, such as by size or by different markers.
- the flow cytometer may have one or more lasers, such as 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 or more lasers.
- the flow cytometer can detect more than one color or fluorescent label, such as at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 different colors or fluorescent labels.
- the flow cytometer can have at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 fluorescence detectors.
- Examples of commercially available flow cytometers that can be used to detect or analyze one or more vesicles, to sort or separate different populations of vesicles, include, but are not limited to the MoFloTM XDP Cell Sorter (Beckman Coulter, Brea, CA), MoFloTM Legacy Cell Sorter (Beckman Coulter, Brea, CA), BD FACSAriaTM Cell Sorter (BD Biosciences, San Jose, CA), BDTM LSRII (BD Biosciences, San Jose, CA), and BD FACSCaliburTM (BD Biosciences, San Jose, CA).
- MoFloTM XDP Cell Sorter Beckman Coulter, Brea, CA
- MoFloTM Legacy Cell Sorter Beckman Coulter, Brea, CA
- BD FACSAriaTM Cell Sorter BD Biosciences, San Jose, CA
- BDTM LSRII BD Biosciences, San Jose, CA
- BD FACSCaliburTM BD Biosciences, San Jose, CA
- the flow cytometer can sort, and thereby collect or sort more than one population of vesicles based one or more characteristics. For example, two populations of vesicles differ in size, such that the vesicles within each population have a similar size range and can be differentially detected or sorted. In another embodiment, two different populations of vesicles are differentially labeled.
- the data resulting from flow-cytometers can be plotted in 1 dimension to produce histograms or seen in 2 dimensions as dot plots or in 3 dimensions with newer software.
- the regions on these plots can be sequentially separated by a series of subset extractions which are termed gates.
- Specific gating protocols exist for diagnostic and clinical purposes especially in relation to hematology.
- the plots are
- Fluorophores for labeling biomarkers may include those described in Ormerod, Flow Cytometry 2nd ed., Springer-Verlag, New York (1999), and in Nida et ah, Gynecologic Oncology 2005 ;4 889-894 which is incorporated herein by reference.
- a multiplexed assay including but not limited to a flow cytometry assay, one or more different target molecules can be assessed.
- at least one of the target molecules is a biomarker, e.g., a microvesicle surface antigen, assessed using an aptamer of the invention.
- One or more aptamer of the invention can be disposed on any useful planar or bead substrate.
- one or more aptamer of the invention is disposed on a microfluidic device, thereby facilitating assessing, characterizing or isolating a component of a biological sample comprising a polypeptide antigen of interest or a functional fragment thereof.
- the circulating antigen or a cell, cell fragment or cell-derived vesicles comprising the antigen can be assessed using one or more aptamers of the invention (alternatively along with additional binding agents).
- Microfluidic devices which may also be referred to as "lab-on-a-chip” systems, biomedical micro-electro-mechanical systems (bioMEMs), or multicomponent integrated systems, can be used for isolating and analyzing a vesicle.
- Such systems miniaturize and compartmentalize processes that allow for binding of vesicles, detection of biosignatures, and other processes.
- a microfluidic device can also be used for isolation of a vesicle through size differential or affinity selection.
- a microfluidic device can use one more channels for isolating a vesicle from a biological sample based on size or by using one or more binding agents for isolating a vesicle from a biological sample.
- a biological sample can be introduced into one or more microfluidic channels, which selectively allows the passage of a vesicle. The selection can be based on a property of the vesicle, such as the size, shape, deformability, or biosignature of the vesicle.
- a heterogeneous population of vesicles can be introduced into a microfluidic device, and one or more different homogeneous populations of vesicles can be obtained.
- different channels can have different size selections or binding agents to select for different vesicle populations.
- a microfluidic device can isolate a plurality of vesicles wherein at least a subset of the plurality of vesicles comprises a different biosignature from another subset of the plurality of vesicles.
- the microfluidic device can isolate at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 different subsets of vesicles, wherein each subset of vesicles comprises a different biosignature.
- the microfluidic device can comprise one or more channels that permit further enrichment or selection of a vesicle.
- a population of vesicles that has been enriched after passage through a first channel can be introduced into a second channel, which allows the passage of the desired vesicle or vesicle population to be further enriched, such as through one or more binding agents present in the second channel.
- Array-based assays and bead-based assays can be used with microfluidic device.
- the binding agent can be coupled to beads and the binding reaction between the beads and vesicle can be performed in a microfluidic device. Multiplexing can also be performed using a microfluidic device. Different compartments can comprise different binding agents for different populations of vesicles, where each population is of a different cell-of-origin specific vesicle population. In one embodiment, each population has a different biosignature.
- the hybridization reaction between the microsphere and vesicle can be performed in a microfluidic device and the reaction mixture can be delivered to a detection device.
- the detection device such as a dual or multiple laser detection system can be part of the microfluidic system and can use a laser to identify each bead or microsphere by its color-coding, and another laser can detect the hybridization signal associated with each bead.
- microfluidic devices can be used in the methods of the invention.
- microfluidic devices that may be used, or adapted for use with vesicles, include but are not limited to those described in U.S. Pat. Nos. 7,591,936, 7,581,429, 7,579, 136, 7,575,722, 7,568,399, 7,552,741, 7,544,506, 7,541,578, 7,518,726, 7,488,596, 7,485,214, 7,467,928, 7,452,713, 7,452,509, 7,449,096, 7,431,887, 7,422,725, 7,422,669, 7,419,822, 7,419,639, 7,413,709, 7,41 1,184, 7,402,229, 7,390,463, 7,381,471, 7,357,864, 7,351,592, 7,351,380, 7,338,637, 7,329,391, 7,323,140, 7,261,824, 7,258,837, 7,253,003, 7,238,
- microfluidic devices for use with the invention include devices comprising elastomeric layers, valves and pumps, including without limitation those disclosed in U.S. Patent Nos. 5,376,252, 6,408,878, 6,645,432, 6,719,868, 6,793,753, 6,899,137, 6,929,030, 7,040,338, 7,1 18,910, 7,144,616, 7,216,671, 7,250, 128, 7,494,555, 7,501,245, 7,601,270, 7,691,333, 7,754,010, 7,837,946; U.S. Patent Application Nos. 2003/0061687, 2005/0084421, 2005/01 12882, 2005/0129581, 2005/0145496,
- the devices are composed of elastomeric material.
- Certain devices are designed to conduct thermal cycling reactions (e.g., PCR) with devices that include one or more elastomeric valves to regulate solution flow through the device.
- the devices can comprise arrays of reaction sites thereby allowing a plurality of reactions to be performed.
- the devices can be used to assess circulating microRNAs in a multiplex fashion, including microRNAs isolated from vesicles.
- the microfluidic device comprises (a) a first plurality of flow channels formed in an elastomeric substrate; (b) a second plurality of flow channels formed in the elastomeric substrate that intersect the first plurality of flow channels to define an array of reaction sites, each reaction site located at an intersection of one of the first and second flow channels; (c) a plurality of isolation valves disposed along the first and second plurality of flow
- the method can comprise the steps of the steps of: (i) providing a microfluidic device, the microfluidic device comprising: a first fluidic channel having a first end and a second end in fluid communication with each other through the channel; a plurality of flow channels, each flow channel terminating at a terminal wall; wherein each flow channel branches from and is in fluid communication with the first fluidic channel, wherein an aqueous fluid that enters one of the flow channels from the first fluidic channel can flow out of the flow channel only through the first fluidic channel; and, an inlet in fluid communication with the first fluidic channel, the inlet for introducing a sample fluid; wherein each flow channel is associated with a valve that when closed isolates one end of the flow channel from the first fluidic channel, whereby an isolated reaction site is formed between the valve and the terminal wall; a control channel; wherein each the valve is a deflectable membrane which is deflected into the flow channel associated with the valve when an actuating force is applied to the control channel, thereby closing the steps of
- the microfluidic device can have one or more binding agents attached to a surface in a channel, or present in a channel.
- the microchannel can have one or more capture agents, such as a capture agent for one or more general microvesicle antigen in Table 3 or a cell-of-origin or cancer related antigen in Table 4, including without limitation EpCam, CD9, PCSA, CD63, CD81, PSMA, B7H3, PSCA, ICAM, STEAP, KLK2, SSX2, SSX4, PBP, SPDEF, and EGFR.
- the capture agent may be an aptamer selected by the methods of the invention.
- the surface of the channel can also be contacted with a blocking aptamer of the invention.
- a microchannel surface is treated with avidin and a capture agent, such as an antibody, that is biotinylated can be injected into the channel to bind the avidin.
- a capture agent such as an antibody
- the capture agents are present in chambers or other components of a microfluidic device.
- the capture agents can also be attached to beads that can be manipulated to move through the microfluidic channels.
- the capture agents are attached to magnetic beads. The beads can be manipulated using magnets.
- a biological sample can be flowed into the microfluidic device, or a microchannel, at rates such as at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50
- One or more vesicles can be captured and directly detected in the microfluidic device. Alternatively, the captured vesicle may be released and exit the microfluidic device prior to analysis. In another embodiment, one or more captured vesicles are lysed in the microchannel and the lysate can be analyzed, e.g., to examine payload within the vesicles. Lysis buffer can be flowed through the channel and lyse the captured vesicles.
- the lysis buffer can be flowed into the device or microchannel at rates such as at least about a, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 26, 27, 28, 29, 30, 35, 40, 45, or 50 ⁇ ⁇ minute, such as between about 1-50, 5-40, 10-30, 5-30 or 10-35 ⁇ per minute.
- the lysate can be collected and analyzed, such as performing RT-PCR, PCR, mass spectrometry, Western blotting, or other assays, to detect one or more biomarkers of the vesicle.
- phenotype can mean any trait or characteristic that is attributed to a biomarker profile that is identified using in part or in whole the compositions and/or methods of the invention.
- a phenotype can be a diagnostic, prognostic or theranostic determination based on a characterized biomarker profile for a sample obtained from a subject.
- a phenotype can be any observable characteristic or trait of, such as a disease or condition, a stage of a disease or condition, susceptibility to a disease or condition, prognosis of a disease stage or condition, a physiological state, or response / potential response to therapeutics.
- a phenotype can result from a subject's genetic makeup as well as the influence of environmental factors and the interactions between the two, as well as from epigenetic modifications to nucleic acid sequences.
- a phenotype in a subject can be characterized by obtaining a biological sample from a subject and analyzing the sample using the compositions and/or methods of the invention.
- characterizing a phenotype for a subject or individual can include detecting a disease or condition (including pre- symptomatic early stage detecting), determining a prognosis, diagnosis, or theranosis of a disease or condition, or determining the stage or progression of a disease or condition.
- Characterizing a phenotype can include identifying appropriate treatments or treatment efficacy for specific diseases, conditions, disease stages and condition stages, predictions and likelihood analysis of disease progression, particularly disease recurrence, metastatic spread or disease relapse.
- a phenotype can also be a clinically distinct type or subtype of a condition or disease, such as a cancer or tumor.
- Phenotype determination can also be a determination of a physiological condition, or an assessment of organ distress or organ rejection, such as post-transplantation.
- the compositions and methods described herein allow assessment of a subject on an individual basis, which can provide benefits of more efficient and economical decisions in treatment.
- the invention relates to the analysis of biomarkers such as microvesicles to provide a diagnosis, prognosis, and/or theranosis of a disease or condition.
- Theranostics includes diagnostic testing that provides the ability to affect therapy or treatment of a disease or disease state.
- Theranostics testing provides a theranosis in a similar manner that diagnostics or prognostic testing provides a diagnosis or prognosis, respectively.
- theranostics encompasses any desired form of therapy related
- -57- Docket No. 37901-820.601 testing including predictive medicine, personalized medicine, integrated medicine, pharmacodiagnostics and Dx/Rx partnering.
- Therapy related tests can be used to predict and assess drug response in individual subjects, i.e., to provide personalized medicine.
- Predicting a drug response can be determining whether a subject is a likely responder or a likely non-responder to a candidate therapeutic agent, e.g., before the subject has been exposed or otherwise treated with the treatment.
- Assessing a drug response can be monitoring a response to a drug, e.g., monitoring the subject's improvement or lack thereof over a time course after initiating the treatment.
- compositions and methods of the invention may indicate that treatment should be altered to select a more promising treatment, thereby avoiding the great expense of delaying beneficial treatment and avoiding the financial and morbidity costs of administering an ineffective drug(s).
- compositions and methods of the invention may help predict whether a subject is likely to respond to a treatment for a disease or disorder.
- Characterizating a phenotype includes predicting the responder / non-responder status of the subject, wherein a responder responds to a treatment for a disease and a non-responder does not respond to the treatment.
- Biomarkers such as microvesicles can be analyzed in the subject and compared against that of previous subjects that were known to respond or not to a treatment. If the biomarker profile in the subject more closely aligns with that of previous subjects that were known to respond to the treatment, the subject can be characterized, or predicted, as a responder to the treatment.
- the subject can be characterized, or predicted as a non- responder to the treatment.
- the treatment can be for any appropriate disease, disorder or other condition, including without limitation those disclosed herein.
- the phenotype comprises a disease or condition such as those listed in Tables 1 or 16.
- the phenotype can comprise detecting the presence of or likelihood of developing a tumor, neoplasm, or cancer, or characterizing the tumor, neoplasm, or cancer (e.g., stage, grade, aggressiveness, likelihood of metastatis or recurrence, etc).
- Cancers that can be detected or assessed by methods or compositions described herein include, but are not limited to, breast cancer, ovarian cancer, lung cancer, colon cancer, hyperplastic polyp, adenoma, colorectal cancer, high grade dysplasia, low grade dysplasia, prostatic hyperplasia, prostate cancer, melanoma, pancreatic cancer, brain cancer (such as a glioblastoma), hematological malignancy, hepatocellular carcinoma, cervical cancer, endometrial cancer, head and neck cancer, esophageal cancer, gastrointestinal stromal tumor (GIST), renal cell carcinoma (RCC) or gastric cancer.
- the colorectal cancer can be CRC Dukes B or Dukes C-D.
- the hematological malignancy can be B-Cell Chronic Lymphocytic Leukemia, B-Cell Lymphoma-DLBCL, B-Cell Lymphoma-DLBCL-germinal center-like, B-Cell Lymphoma-DLBCL- activated B-cell-like, and Burkitt's lymphoma.
- the phenotype can be a premalignant condition, such as actinic keratosis, atrophic gastritis, leukoplakia, erythroplasia, Lymphomatoid Granulomatosis, preleukemia, fibrosis, cervical dysplasia,
- Transformative viral infections such as HIV and HPV also present phenotypes that can be assessed according to the invention.
- a cancer characterized by the methods of the invention can comprise, without limitation, a carcinoma, a sarcoma, a lymphoma or leukemia, a germ cell tumor, a blastoma, or other cancers.
- Carcinomas include without limitation epithelial neoplasms, squamous cell neoplasms squamous cell carcinoma, basal cell neoplasms basal cell carcinoma, transitional cell papillomas and carcinomas, adenomas and adenocarcinomas (glands), adenoma, adenocarcinoma, linitis plastica insulinoma, glucagonoma, gastrinoma, vipoma, cholangiocarcinoma, hepatocellular carcinoma, adenoid cystic carcinoma, carcinoid tumor of appendix, prolactinoma, oncocytoma, hurthle cell adenoma, renal cell carcinoma, grawitz tumor, multiple endocrine adenomas, endometrioid adenoma, adnexal and skin appendage neoplasms, mucoepidermoid neoplasms, cystic, mucinous and serous
- Sarcoma includes without limitation Askin's tumor, botryodies, chondrosarcoma, Ewing's sarcoma, malignant hemangio endothelioma, malignant schwannoma, osteosarcoma, soft tissue sarcomas including: alveolar soft part sarcoma, angiosarcoma, cystosarcoma phyllodes, dermatofibrosarcoma, desmoid tumor, desmoplastic small round cell tumor, epithelioid sarcoma, extraskeletal chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma, hemangiopericytoma, hemangiosarcoma, kaposi's sarcoma, leiomyosarcoma, liposarcoma,
- lymphangiosarcoma lymphosarcoma, malignant fibrous histiocytoma, neurofibrosarcoma,
- Lymphoma and leukemia include without limitation chronic lymphocytic leukemia/small lymphocytic lymphoma, B-cell prolymphocytic leukemia,
- lymphoplasmacytic lymphoma such as Waldenstrom macroglobulinemia
- splenic marginal zone lymphoma plasma cell myeloma, plasmacytoma, monoclonal immunoglobulin deposition diseases, heavy chain diseases, extranodal marginal zone B cell lymphoma, also called malt lymphoma, nodal marginal zone B cell lymphoma (nmzl), follicular lymphoma, mantle cell lymphoma, diffuse large B cell lymphoma, mediastinal (thymic) large B cell lymphoma, intravascular large B cell lymphoma, primary effusion lymphoma, burkitt lymphoma/leukemia, T cell prolymphocytic leukemia, T cell large granular lymphocytic leukemia, aggressive NK cell leukemia, adult T cell leukemia/lymphoma, extranodal NK/T cell lymphoma, nasal type, enteropathy -type T cell lymphoma, he
- Germ cell tumors include without limitation germinoma, dysgerminoma, seminoma, nongerminomatous germ cell tumor, embryonal carcinoma, endodermal sinus turmor, choriocarcinoma, teratoma, polyembryoma, and gonadoblastoma.
- Blastoma includes without limitation nephroblastoma, medulloblastoma, and retinoblastoma.
- Other cancers include without limitation labial carcinoma, larynx carcinoma,
- hypopharynx carcinoma tongue carcinoma, salivary gland carcinoma, gastric carcinoma,
- adenocarcinoma thyroid cancer (medullary and papillary thyroid carcinoma), renal carcinoma, kidney parenchyma carcinoma, cervix carcinoma, uterine corpus carcinoma, endometrium carcinoma, chorion carcinoma, testis carcinoma, urinary carcinoma, melanoma, brain tumors such as glioblastoma, astrocytoma, meningioma, medulloblastoma and peripheral neuroectodermal tumors, gall bladder carcinoma, bronchial carcinoma, multiple myeloma, basalioma, teratoma, retinoblastoma, choroidea melanoma, seminoma, rhabdomyosarcoma, craniopharyngeoma, osteosarcoma, chondrosarcoma, myosarcoma, liposarcoma, fibrosarcoma, Ewing sarcoma, and plasmocytoma.
- the cancer under analysis may be a lung cancer including non-small cell lung cancer and small cell lung cancer (including small cell carcinoma (oat cell cancer), mixed small cell/large cell carcinoma, and combined small cell carcinoma), colon cancer, breast cancer, prostate cancer, liver cancer, pancreas cancer, brain cancer, kidney cancer, ovarian cancer, stomach cancer, skin cancer, bone cancer, gastric cancer, breast cancer, pancreatic cancer, glioma, glioblastoma, hepatocellular carcinoma, papillary renal carcinoma, head and neck squamous cell carcinoma, leukemia, lymphoma, myeloma, or a solid tumor.
- non-small cell lung cancer and small cell lung cancer including small cell carcinoma (oat cell cancer), mixed small cell/large cell carcinoma, and combined small cell carcinoma
- colon cancer breast cancer, prostate cancer, liver cancer, pancreas cancer, brain cancer, kidney cancer, ovarian cancer, stomach cancer, skin cancer, bone cancer, gastric cancer, breast cancer, pancreatic cancer, glioma, glioblast
- the cancer comprises an acute lymphoblastic leukemia; acute myeloid leukemia; adrenocortical carcinoma; AIDS-related cancers; AIDS-related lymphoma; anal cancer; appendix cancer; astrocytomas; atypical teratoid/rhabdoid tumor; basal cell carcinoma; bladder cancer; brain stem glioma; brain tumor (including brain stem glioma, central nervous system atypical teratoid/rhabdoid tumor, central nervous system embryonal tumors, astrocytomas, craniopharyngioma, ependymoblastoma, ependymoma, medulloblastoma, medulloepithelioma, pineal parenchymal tumors of intermediate differentiation, supratentorial primitive neuroectodermal tumors and pineoblastoma); breast cancer; bronchial tumors; Burkitt lymphoma; cancer of unknown primary site
- cervical cancer childhood cancers; chordoma; chronic lymphocytic leukemia; chronic myelogenous leukemia; chronic myeloproliferative disorders; colon cancer; colorectal cancer; craniopharyngioma; cutaneous T-cell lymphoma; endocrine pancreas islet cell tumors; endometrial cancer;
- ependymoblastoma ependymoblastoma
- ependymoma ependymoma
- esophageal cancer esthesioneuroblastoma
- Ewing sarcoma ependymoblastoma
- extracranial germ cell tumor extracranial germ cell tumor; extragonadal germ cell tumor; extrahepatic bile duct cancer; gallbladder cancer; gastric (stomach) cancer; gastrointestinal carcinoid tumor; gastrointestinal stromal cell tumor; gastrointestinal stromal tumor (GIST); gestational trophoblastic tumor; glioma; hairy cell leukemia; head and neck cancer; heart cancer; Hodgkin lymphoma; hypopharyngeal cancer; intraocular melanoma; islet cell tumors; Kaposi sarcoma; kidney cancer; Langerhans cell histiocytosis; laryngeal cancer; lip cancer;
- liver cancer malignant fibrous histiocytoma bone cancer; medulloblastoma; medulloepithelioma;
- melanoma Merkel cell carcinoma; Merkel cell skin carcinoma; mesothelioma; metastatic squamous neck cancer with occult primary; mouth cancer; multiple endocrine neoplasia syndromes; multiple myeloma; multiple myeloma/plasma cell neoplasm; mycosis fungoides; myelodysplastic syndromes;
- myeloproliferative neoplasms nasal cavity cancer; nasopharyngeal cancer; neuroblastoma; Non-Hodgkin lymphoma; nonmelanoma skin cancer; non-small cell lung cancer; oral cancer; oral cavity cancer;
- oropharyngeal cancer osteosarcoma; other brain and spinal cord tumors; ovarian cancer; ovarian epithelial cancer; ovarian germ cell tumor; ovarian low malignant potential tumor; pancreatic cancer; papillomatosis; paranasal sinus cancer; parathyroid cancer; pelvic cancer; penile cancer; pharyngeal cancer; pineal parenchymal tumors of intermediate differentiation; pineoblastoma; pituitary tumor; plasma cell neoplasm/multiple myeloma; pleuropulmonary blastoma; primary central nervous system (CNS) lymphoma; primary hepatocellular liver cancer; prostate cancer; rectal cancer; renal cancer; renal cell (kidney) cancer; renal cell cancer; respiratory tract cancer; retinoblastoma; rhabdomyosarcoma; salivary gland cancer; Sezary syndrome; small cell lung cancer; small intestine cancer; soft tissue sarcoma;
- CNS central nervous system
- squamous cell carcinoma squamous neck cancer; stomach (gastric) cancer; supratentorial primitive neuroectodermal tumors; T-cell lymphoma; testicular cancer; throat cancer; thymic carcinoma; thymoma; thyroid cancer; transitional cell cancer; transitional cell cancer of the renal pelvis and ureter; trophoblastic tumor; ureter cancer; urethral cancer; uterine cancer; uterine sarcoma; vaginal cancer; vulvar cancer; Waldenstrom macroglobulinemia; or Wilm's tumor.
- the methods of the invention can be used to characterize these and other cancers.
- characterizing a phenotype can be providing a diagnosis, prognosis or theranosis of one of the cancers disclosed herein.
- the cancer comprises an acute myeloid leukemia (AML), breast carcinoma, cholangiocarcinoma, colorectal adenocarcinoma, extrahepatic bile duct adenocarcinoma, female genital tract malignancy, gastric adenocarcinoma, gastroesophageal adenocarcinoma,
- AML acute myeloid leukemia
- breast carcinoma cholangiocarcinoma
- colorectal adenocarcinoma colorectal adenocarcinoma
- extrahepatic bile duct adenocarcinoma extrahepatic bile duct adenocarcinoma
- female genital tract malignancy gastric adenocarcinoma
- gastroesophageal adenocarcinoma gastroesophageal adenocarcinoma
- GIST gastrointestinal stromal tumors
- glioblastoma head and neck squamous carcinoma
- leukemia liver hepatocellular carcinoma
- low grade glioma lung bronchioloalveolar carcinoma
- BAC lung non-small cell lung cancer
- SCLC lung small cell cancer
- lymphoma male genital tract malignancy
- malignant solitary fibrous tumor of the pleura (MSFT) malignant solitary fibrous tumor of the pleura
- MSFT malignant solitary fibrous tumor of the pleura
- melanoma multiple myeloma
- neuroendocrine tumor nodal diffuse large B-cell lymphoma
- non epithelial ovarian cancer non-EOC
- ovarian surface epithelial carcinoma pancreatic adenocarcinoma, pituitary carcinomas, oligodendroglioma, prostatic adenocarcinoma, retroperitoneal or peritoneal carcinoma, retroperitoneal or
- the phenotype can also be an inflammatory disease, immune disease, or autoimmune disease.
- the disease may be inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), pelvic inflammation, vasculitis, psoriasis, diabetes, autoimmune hepatitis, Multiple Sclerosis, Myasthenia Gravis, Type I diabetes, Rheumatoid Arthritis, Psoriasis, Systemic Lupus Erythematosis
- the phenotype can also comprise a cardiovascular disease, such as atherosclerosis, congestive heart failure, vulnerable plaque, stroke, or ischemia.
- the cardiovascular disease or condition can be high blood pressure, stenosis, vessel occlusion or a thrombotic event.
- the phenotype can also comprise a neurological disease, such as Multiple Sclerosis (MS), Parkinson's Disease (PD), Alzheimer's Disease (AD), schizophrenia, bipolar disorder, depression, autism, Prion Disease, Pick's disease, dementia, Huntington disease (HD), Down's syndrome, cerebrovascular disease, Rasmussen's encephalitis, viral meningitis, neurospsychiatric systemic lupus erythematosus (NPSLE), amyotrophic lateral sclerosis, Creutzfeldt- Jacob disease, Gerstmann-Straussler-Scheinker disease, transmissible spongiform encephalopathy, ischemic reperfusion damage (e.g. stroke), brain trauma, microbial infection, or chronic fatigue syndrome.
- the phenotype may also be a condition such as fibromyalgia, chronic neuropathic pain, or peripheral neuropathic pain.
- the phenotype may also comprise an infectious disease, such as a bacterial, viral or yeast infection.
- the disease or condition may be Whipple's Disease, Prion Disease, cirrhosis, methicillin-resistant staphylococcus aureus, HIV, hepatitis, syphilis, meningitis, malaria, tuberculosis, or influenza.
- Viral proteins, such as HIV or HCV-like particles can be assessed in a vesicle, to characterize a viral condition.
- the phenotype can also comprise a perinatal or pregnancy related condition (e.g. preeclampsia or preterm birth), metabolic disease or condition, such as a metabolic disease or condition associated with iron metabolism.
- a perinatal or pregnancy related condition e.g. preeclampsia or preterm birth
- metabolic disease or condition such as a metabolic disease or condition associated with iron metabolism.
- hepcidin can be assayed in a vesicle to characterize an iron deficiency.
- the metabolic disease or condition can also be diabetes, inflammation, or a perinatal condition.
- compositions and methods of the invention can be used to characterize these and other diseases and disorders that can be assessed via biomarkers.
- characterizing a phenotype can be providing a diagnosis, prognosis or theranosis of one of the diseases and disorders disclosed herein.
- One or more phenotypes of a subject can be determined by analyzing one or more vesicles, such as vesicles, in a biological sample obtained from the subject.
- a subject or patient can include, but is not limited to, mammals such as bovine, avian, canine, equine, feline, ovine, porcine, or primate animals (including humans and non-human primates).
- a subject can also include a mammal of importance due to being endangered, such as a Siberian tiger; or economic importance, such as an animal raised on a farm for consumption by humans, or an animal of social importance to humans, such as an animal kept as a pet or in a zoo.
- Examples of such animals include, but are not limited to, carnivores such as cats and dogs; swine including pigs, hogs and wild boars; ruminants or ungulates such as cattle, oxen, sheep, giraffes, deer, goats, bison, camels or horses. Also included are birds that are endangered or kept in zoos, as well as fowl and more particularly domesticated fowl, i.e. poultry, such as turkeys and chickens, ducks, geese, guinea fowl. Also included are domesticated swine and horses (including race horses). In addition, any animal species connected to commercial activities are also included such as those animals connected to
- the subject can have a pre-existing disease or condition, such as cancer.
- the subject may not have any known pre-existing condition.
- the subject may also be non-responsive to an existing or past treatment, such as a treatment for cancer.
- a sample used and/or assessed via the compositions and methods of the invention includes any relevant biological sample that can be used for biomarker assessment, including without limitation sections of tissues such as biopsy or tissue removed during surgical or other procedures, bodily fluids, autopsy samples, frozen sections taken for histological purposes, and cell cultures.
- samples include blood and blood fractions or products (e.g., serum, buffy coat, plasma, platelets, red blood cells, and the like), sputum, malignant effusion, cheek cells tissue, cultured cells (e.g., primary cultures, explants, and transformed cells), stool, urine, other biological or bodily fluids (e.g., prostatic fluid, gastric fluid, intestinal fluid, renal fluid, lung fluid, cerebrospinal fluid, and the like), etc.
- blood and blood fractions or products e.g., serum, buffy coat, plasma, platelets, red blood cells, and the like
- sputum e.g., malignant effusion
- cheek cells tissue e.g., cultured cells (e.
- the sample can comprise biological material that is a fresh frozen & formalin fixed paraffin embedded (FFPE) block, formalin- fixed paraffin embedded, or is within an RNA preservative + formalin fixative. More than one sample of more than one type can be used for each patient.
- FFPE fresh frozen & formalin fixed paraffin embedded
- the sample used in the methods described herein can be a formalin fixed paraffin embedded (FFPE) sample.
- the FFPE sample can be one or more of fixed tissue, unstained slides, bone marrow core or clot, core needle biopsy, malignant fluids and fine needle aspirate (FNA).
- the fixed tissue comprises a tumor containing formalin fixed paraffin embedded (FFPE) block from a surgery or biopsy.
- the unstained slides comprise unstained, charged, unbaked slides from a paraffin block.
- bone marrow core or clot comprises a decalcified core.
- a formalin fixed core and/or clot can be paraffin-embedded.
- the core needle biopsy comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, e.g., 3-4, paraffin embedded biopsy samples.
- An 18 gauge needle biopsy can be used.
- the malignant fluid can comprise a sufficient volume of fresh pleural/ascitic fluid to produce a 5x5x2mm cell pellet.
- the fluid can be formalin fixed in a paraffin block.
- the core needle biopsy comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, e.g., 4-6, paraffin embedded aspirates.
- a sample may be processed according to techniques understood by those in the art.
- a sample can be without limitation fresh, frozen or fixed cells or tissue.
- a sample comprises formalin- fixed paraffin-embedded (FFPE) tissue, fresh tissue or fresh frozen (FF) tissue.
- FFPE formalin- fixed paraffin-embedded
- a sample can comprise cultured cells, including primary or immortalized cell lines derived from a subject sample.
- a sample can also refer to an extract from a sample from a subject.
- a sample can comprise DNA, RNA or protein extracted from a tissue or a bodily fluid. Many techniques and commercial kits are available for such purposes.
- the fresh sample from the individual can be treated with an agent to preserve RNA prior to further processing, e.g., cell lysis and extraction.
- Samples can include frozen samples collected for other purposes. Samples can be associated with relevant information such as age, gender, and
- a sample is typically obtained from a subject.
- a biopsy comprises the process of removing a tissue sample for diagnostic or prognostic evaluation, and to the tissue specimen itself.
- Any biopsy technique known in the art can be applied to the molecular profiling methods of the present invention.
- the biopsy technique applied can depend on the tissue type to be evaluated (e.g., colon, prostate, kidney, bladder, lymph node, liver, bone marrow, blood cell, lung, breast, etc.), the size and type of the tumor (e.g., solid or suspended, blood or ascites), among other factors.
- Representative biopsy techniques include, but are not limited to, excisional biopsy, incisional biopsy, needle biopsy, surgical biopsy, and bone marrow biopsy.
- An "excisional biopsy” refers to the removal of an entire tumor mass with a small margin of normal tissue surrounding it.
- An “incisional biopsy” refers to the removal of a wedge of tissue that includes a cross-sectional diameter of the tumor.
- Molecular profiling can use a "core-needle biopsy” of the tumor mass, or a “fine-needle aspiration biopsy” which generally obtains a suspension of cells from within the tumor mass. Biopsy techniques are discussed, for example, in Harrison's Principles of Internal Medicine, Kasper, et al., eds., 16th ed., 2005, Chapter 70, and throughout Part V.
- PCR Polymerase chain reaction
- the biological sample assessed using the compositions and methods of the invention can be any useful bodily or biological fluid, including but not limited to peripheral blood, sera, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen (including prostatic fluid), Cowper's fluid or pre-ejaculatory fluid, female ejaculate, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities,
- a biological sample may also include the blastocyl cavity, umbilical cord blood, or maternal circulation which may be of fetal or maternal origin.
- the biological sample may also be a cell culture, tissue sample or biopsy from which vesicles and other circulating biomarkers may be obtained.
- cells of interest can be cultured and vesicles isolated from the culture.
- biomarkers or more particularly biosignatures disclosed herein can be assessed directly from such biological samples
- nucleic acid or polypeptide biomarkers or functional fragments thereof e.g., identification of presence or levels of nucleic acid or polypeptide biomarkers or functional fragments thereof) using various methods, such as extraction of nucleic acid molecules from blood, plasma, serum or any of the foregoing biological samples, use of protein or antibody arrays to identify polypeptide (or functional fragment) biomarker(s), as well as other array, sequencing, PCR and proteomic techniques known in the art for identification and assessment of nucleic acid and polypeptide molecules.
- various methods such as extraction of nucleic acid molecules from blood, plasma, serum or any of the foregoing biological samples, use of protein or antibody arrays to identify polypeptide (or functional fragment) biomarker(s), as well as other array, sequencing, PCR and proteomic techniques known in the art for identification and assessment of nucleic acid and polypeptide molecules.
- one or more components present in such samples can be first isolated or enriched and further processed to assess the presence or levels of selected biomarkers, to assess a given biosignature (e.g., isolated microvesicles prior to profiling for protein and/or nucleic acid biomarkers).
- a given biosignature e.g., isolated microvesicles prior to profiling for protein and/or nucleic acid biomarkers.
- Table 1 presents a non-limiting listing of diseases, conditions, or biological states and corresponding biological samples that may be used for analysis according to the methods of the invention.
- Table 1 Examples of Biological Samples for Various Diseases
- Urological disorders benign prostatic hypertrophy Blood, serum, plasma, urine
- Hepatic disease/injury Cirrhosis, induced Blood, serum, plasma, urine
- Kidney disease/injury acute, sub-acute, chronic Blood, serum, plasma, urine
- CD Crohn's disease
- Blood derivatives include plasma and serum.
- Blood plasma is the liquid component of whole blood, and makes up approximately 55% of the total blood volume. It is composed primarily of water with small amounts of minerals, salts, ions, nutrients, and proteins in solution. In whole blood, red blood cells, leukocytes, and platelets are suspended within the plasma.
- Blood serum refers to blood plasma without fibrinogen or other clotting factors (i.e., whole blood minus both the cells and the clotting factors).
- the biological sample may be obtained through a third party, such as a party not performing the analysis of the biomarkers, whether direct assessment of a biological sample or by profiling one or more vesicles obtained from the biological sample.
- a third party such as a party not performing the analysis of the biomarkers, whether direct assessment of a biological sample or by profiling one or more vesicles obtained from the biological sample.
- the sample may be obtained through a clinician, physician, or other health care manager of a subject from which the sample is derived.
- the biological sample may obtained by the same party analyzing the vesicle.
- biological samples be assayed are archived (e.g., frozen) or ortherwise stored in under preservative conditions.
- a biological sample can comprise a vesicle or cell membrane fragment that is derived from a cell of origin and available extracellularly in a subject's biological fluid or extracellular milieu.
- Methods of the invention can include assessing one or more vesicles, including assessing vesicle populations.
- a vesicle as used herein, is a membrane vesicle that is shed from cells. Vesicles or membrane vesicles include without limitation: circulating microvesicles (cMVs), microvesicle, exosome, nanovesicle, dexosome, bleb, blebby, prostasome, microparticle, intralumenal vesicle, membrane fragment, intralumenal endosomal vesicle, endosomal-like vesicle, exocytosis vehicle, endosome vesicle, endosomal vesicle, apoptotic body, multivesicular body, secretory vesicle, phospholipid vesicle, liposomal vesicle, argosome, texasome, secresome, tolerosome, melanosome, on
- Vesicles may be produced by different cellular processes, the methods of the invention are not limited to or reliant on any one mechanism, insofar as such vesicles are present in a biological sample and are capable of being characterized by the methods disclosed herein. Unless otherwise specified, methods that make use of a species of vesicle can be applied to other types of vesicles. Vesicles comprise spherical structures with a lipid bilayer similar to cell membranes which surrounds an inner compartment which can contain soluble components, sometimes referred to as the payload. In some embodiments, the methods of the invention make use of exosomes, which are small secreted vesicles of about 40-100 nm in diameter. For a review of membrane vesicles, including types and characterizations, see Thery et ah, Nat Rev Immunol. 2009 Aug;9(8):581-93. Some properties of different types of vesicles include those in Table 2:
- PPS phosphatidylserine
- EM electron microscopy
- Vesicles include shed membrane bound particles, or "microparticles,” that are derived from either the plasma membrane or an internal membrane. Vesicles can be released into the extracellular environment from cells. Cells releasing vesicles include without limitation cells that originate from, or are derived from, the ectoderm, endoderm, or mesoderm. The cells may have undergone genetic,
- the cell can be tumor cells.
- a vesicle can reflect any changes in the source cell, and thereby reflect changes in the originating cells, e.g., cells having various genetic mutations.
- a vesicle is generated intracellularly when a segment of the cell membrane spontaneously invaginates and is ultimately exocytosed (see for example, Keller et al, Immunol. Lett. 107 (2): 102-8 (2006)).
- Vesicles also include cell-derived structures bounded by a lipid bilayer membrane arising from both herniated evagination (blebbing) separation and sealing of portions of the plasma membrane or from the export of any intracellular membrane -bounded vesicular structure containing various membrane-associated proteins of tumor origin, including surface-bound molecules derived from the host circulation that bind selectively to the tumor-derived proteins together with molecules contained in the vesicle lumen, including but not limited to tumor-derived microRNAs or intracellular proteins.
- Blebs and blebbing are further described in Charras et al., Nature Reviews
- a vesicle shed into circulation or bodily fluids from tumor cells may be referred to as a "circulating tumor-derived vesicle.”
- a vesicle When such vesicle is an exosome, it may be referred to as a circulating-tumor derived exosome (CTE).
- CTE circulating-tumor derived exosome
- a vesicle can be derived from a specific cell of origin.
- CTE as with a cell-of-origin specific vesicle, typically have one or more unique biomarkers that permit isolation of the CTE or cell-of-origin specific vesicle, e.g., from a bodily fluid and sometimes in a specific manner.
- a cell or tissue specific markers are used to identify the cell of origin.
- Examples of such cell or tissue specific markers are disclosed herein and can further be accessed in the Tissue-specific Gene Expression and Regulation (TiGER) Database, available at bioinfo.wilmer.jhu.edu/tiger/; Liu et al. (2008) TiGER: a database for tissue- specific gene expression and regulation.
- TiGER Tissue-specific Gene Expression and Regulation
- a vesicle can have a diameter of greater than about 10 nm, 20 nm, or 30 nm.
- a vesicle can have a diameter of greater than 40 nm, 50 nm, 100 nm, 200 nm, 500 nm, 1000 nm, 1500 nm, 2000 nm or greater than 10,000 nm.
- a vesicle can have a diameter of about 20-2000 nm, about 20-1500 nm, about 30-1000 nm, about 30-800 nm, about 30-200 nm, or about 30- 100 nm.
- the vesicle has a diameter of less than 10,000 nm, 2000 nm, 1500 nm, 1000 nm, 800 nm, 500 nm, 200 nm, 100 nm, 50 nm, 40 nm, 30 nm, 20 nm or less than 10 nm.
- the term "about" in reference to a numerical value means that variations of 10% above or below the numerical value are within the range ascribed to the specified value.
- Typical sizes for various types of vesicles are shown in Table 2. Vesicles can be assessed to measure the diameter of a single vesicle or any number of vesicles. For example, the range of diameters of a vesicle population or an average diameter of a vesicle population can be determined.
- Vesicle diameter can be assessed using methods known in the art, e.g., imaging technologies such as
- a diameter of one or more vesicles is determined using optical particle detection. See, e.g., U.S. Patent 7,751,053, entitled “Optical Detection and Analysis of Particles” and issued July 6, 2010; and U.S. Patent 7,399,600, entitled “Optical Detection and Analysis of Particles” and issued July 15, 2010.
- the methods of the invention comprise assessing vesicles directly such as in a biological sample without prior isolation, purification, or concentration from the biological sample.
- the amount of vesicles in the sample can by itself provide a biosignature that provides a diagnostic, prognostic or theranostic determination.
- the vesicle in the sample may be isolated, captured, purified, or concentrated from a sample prior to analysis.
- isolation, capture or purification as used herein comprises partial isolation, partial capture or partial purification apart from other components in the sample.
- Vesicle isolation can be performed using various techniques as described herein, e.g., chromatography, filtration, centrifugation, flow cytometry, affinity capture (e.g., to a planar surface or bead), and/or using microfluidics.
- FIGs. 13A-I and 16B-16C present an overview of a method of the invention for assessing microvesicles using an aptamer pool.
- Vesicles such as exosomes can be assessed to provide a phenotypic characterization by comparing vesicle characteristics to a reference.
- surface antigens on a vesicle are assessed.
- the surface antigens can provide an indication of the anatomical origin and/or cellular of the vesicles and other phenotypic information, e.g., tumor status.
- a patient sample e.g., a bodily fluid such as blood, serum or plasma
- a bodily fluid such as blood, serum or plasma
- the surface antigens may comprise any informative biological entity that can be detected on the vesicle membrane surface, including without limitation surface proteins, lipids, carbohydrates, and other membrane components.
- positive detection of colon derived vesicles expressing tumor antigens can indicate that the patient has colorectal cancer.
- methods of the invention can be used to characterize any disease or condition associated with an anatomical or cellular origin, by assessing, for example, disease-specific and cell-specific biomarkers of one or more vesicles obtained from a subject.
- the methods of the invention comprise assessing one or more vesicle payload to provide a phenotypic characterization.
- the payload with a vesicle comprises any informative biological entity that can be detected as encapsulated within the vesicle, including without limitation proteins and nucleic acids, e.g., genomic or cDNA, mR A, or functional fragments thereof, as well as microR As (miRs).
- methods of the invention are directed to detecting vesicle surface antigens (in addition or exclusive to vesicle payload) to provide a phenotypic characterization.
- vesicles can be characterized by using binding agents (e.g., antibodies or aptamers) that are specific to vesicle surface antigens, and the bound vesicles can be further assessed to identify one or more payload components disclosed therein.
- the levels of vesicles with surface antigens of interest or with payload of interest can be compared to a reference to characterize a phenotype.
- overexpression in a sample of cancer-related surface antigens or vesicle payload e.g., a tumor associated mRNA or microRNA, as compared to a reference, can indicate the presence of cancer in the
- biomarkers assessed can be present or absent, increased or reduced based on the selection of the desired target sample and comparison of the target sample to the desired reference sample.
- target samples include: disease; treated/not-treated; different time points, such as a in a longitudinal study; and non-limiting examples of reference sample: non-disease; normal; different time points; and sensitive or resistant to candidate treatment(s).
- a vesicle or a population of vesicles may be isolated, purified, concentrated or otherwise enriched prior to and/or during analysis.
- the terms "purified,” “isolated,” or similar as used herein in reference to vesicles or biomarker components are intended to include partial or complete purification or isolation of such components from a cell or organism.
- Analysis of a vesicle can include quantitiating the amount one or more vesicle populations of a biological sample.
- a heterogeneous population of vesicles can be quantitated, or a homogeneous population of vesicles, such as a population of vesicles with a particular biomarker profile, a particular biosignature, or derived from a particular cell type can be isolated from a heterogeneous population of vesicles and quantitated.
- Analysis of a vesicle can also include detecting, quantitatively or qualitatively, one or more particular biomarker profile or biosignature of a vesicle, as described herein.
- a vesicle can be stored and archived, such as in a bio-fluid bank and retrieved for analysis as desired.
- a vesicle may also be isolated from a biological sample that has been previously harvested and stored from a living or deceased subject.
- a vesicle may be isolated from a biological sample which has been collected as described in King et ah, Breast Cancer Res 7(5): 198-204 (2005).
- a vesicle can be isolated from an archived or stored sample.
- a vesicle may be isolated from a biological sample and analyzed without storing or archiving of the sample.
- a third party may obtain or store the biological sample, or obtain or store the vesicle for analysis.
- An enriched population of vesicles can be obtained from a biological sample.
- vesicles may be concentrated or isolated from a biological sample using size exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration,
- Size exclusion chromatography such as gel permeation columns, centrifugation or density gradient centrifugation, and filtration methods can be used.
- a vesicle can be isolated by differential centrifugation, anion exchange and/or gel permeation chromatography (for example, as described in US Patent Nos. 6,899,863 and 6,812,023), sucrose density gradients, organelle
- electrophoresis for example, as described in U.S. Patent No. 7,198,923
- magnetic activated cell sorting MMS
- nanomembrane ultrafiltration concentrator Various combinations of isolation or concentration methods can be used.
- vesicle can be isolated from a biological sample using a system that uses multiple antibodies that are specific to the most abundant proteins found
- a biological sample such as blood.
- a biological sample such as blood.
- Such a system can remove up to several proteins at once, thus unveiling the lower abundance species such as cell-of-origin specific vesicles.
- This type of system can be used for isolation of vesicles from biological samples such as blood, cerebrospinal fluid or urine.
- the isolation of vesicles from a biological sample may also be enhanced by high abundant protein removal methods as described in Chromy et al. J Proteome Res 2004; 3:1120-1127.
- the isolation of vesicles from a biological sample may also be enhanced by removing serum proteins using glycopeptide capture as described in Zhang et al, Mol Cell Proteomics 2005;4:144-155.
- vesicles from a biological sample such as urine may be isolated by differential centrifugation followed by contact with antibodies directed to cytoplasmic or anti-cytoplasmic epitopes as described in Pisitkun et al, Proc Natl Acad Sci USA, 2004;101:13368-13373.
- Plasma contains a large variety of proteins including albumin, immunoglobulins, and clotting proteins such as fibrinogen.
- About 60% of plasma protein comprises the protein albumin (e.g., human serum albumin or HSA), which contributes to osmotic pressure of plasma to assist in the transport of lipids and steroid hormones.
- Globulins make up about 35% of plasma proteins and are used in the transport of ions, hormones and lipids assisting in immune function.
- About 4% of plasma protein comprises fibrinogen which is essential in the clotting of blood and can be converted into the insoluble protein fibrin.
- blood proteins include: Prealbumin, Alpha 1 antitrypsin, Alpha 1 acid glycoprotein, Alpha 1 fetoprotein, Haptoglobin, Alpha 2 macroglobulin, Ceruloplasmin, Transferrin, complement proteins C3 and C4, Beta 2 microglobulin, Beta lipoprotein, Gamma globulin proteins, C- reactive protein (CRP), Lipoproteins (chylomicrons, VLDL, LDL, HDL), other globulins (types alpha, beta and gamma), Prothrombin and Mannose-binding lectin (MBL).
- CRP C- reactive protein
- Lipoproteins chylomicrons, VLDL, LDL, HDL
- other globulins types alpha, beta and gamma
- Prothrombin and Mannose-binding lectin MBL
- any of these proteins including classes of proteins, or derivatives thereof (such as fibrin which is derived from the cleavage of fibrinogen) can be selectively depleted from a biological sample prior to further analysis performed on the sample. Without being bound by theory, removal of such background proteins may facilitate more sensitive, accurate, or precise detection of the biomarkers of interest in the sample.
- Abundant proteins in blood or blood derivatives include without limitation albumin, IgG, transferrin, fibrinogen, IgA, oi2-Macroglobulin, IgM, 3 ⁇ 4 -Antitrypsin, complement C3, haptoglobulin, apolipoprotein Al, apolipoprotein A3, apolipoprotein B, ⁇ -Acid Glycoprotein, ceruloplasmin, complement C4, Clq, IgD, prealbumin (transthyretin), and plasminogen.
- Such proteins can be depleted using commercially available columns and kits. Examples of such columns comprise the Multiple Affinity Removal System from Agilent Technologies (Santa Clara, CA).
- This system include various cartridges designed to deplete different protein profiles, including the following cartridges with performance characteristics according to the manufacturer: Human 14, which eliminates approximately 94% of total protein (albumin, IgG, antitrypsin, IgA, transferrin, haptoglobin, fibrinogen, alpha2- macroglobulin, alpha 1 -acid glycoprotein (orosomucoid), IgM, apolipoprotein Al, apolipoprotein All, complement C3 and transthyretin); Human 7, which eliminates approximately 85 - 90% of total protein (albumin, IgG, IgA, transferrin, haptoglobin, antitrypsin, and fibrinogen); Human 6, which eliminates approximately 85 - 90% of total protein (albumin, IgG, IgA, transferrin, haptoglobin, and antitrypsin);
- the ProteoPrep® 20 Plasma Immunodepletion Kit from Sigma- Aldrich is intended to specifically remove the 20 most abundant proteins from human plasma or serum, which is about remove 97-98% of the total protein mass in plasma or serum (Sigma-Aldrich, St. Louis, MO).
- the ProteoPrep® 20 removes: albumin, IgG, transferrin, fibrinogen, IgA, a 2 - Microglobulin, IgM, a Antitrypsin, complement C3, haptoglobulin, apolipoprotein Al, A3 and B; Acid Glycoprotein, ceruloplasmin, complement C4, Clq; IgD, prealbumin, and plasminogen.
- Sigma-Aldrich also manufactures ProteoPrep® columns to remove albumin (HSA) and immunoglobulins (IgG).
- the ProteomeLab IgY-12 High Capacity Proteome Partitioning kits from Beckman Coulter (Fullerton, CA) are specifically designed to remove twelve highly abundant proteins (Albumin, IgG, Transferrin, Fibrinogen, IgA, a2-macroglobulin, IgM, a 1 -Antitrypsin, Haptoglobin, Orosomucoid, Apolipoprotein A-I, Apolipoprotein A-II) from the human biological fluids such as serum and plasma.
- the human biological fluids such as serum and plasma.
- such systems rely on immunodepletion to remove the target proteins, e.g., using small ligands and/or full antibodies.
- Albumin/Immunoglobulin Depletion Kit from Millipore (EMD Millipore Corporation, Billerica, MA, USA) is a magnetic bead based kit that enables high depletion efficiency (typically >99%) of Albumin and all Immunoglobulins (i.e., IgG, IgA, IgM, IgE and IgD) from human serum or plasma samples.
- the ProteoExtract ® Albumin/IgG Removal Kit also from Millipore, is designed to deplete >80% of albumin and IgG from body fluid samples.
- Similar protein depletion products include without limitation the following: AurumTM Affi-Gels Blue mini kit (Bio-Rad, Hercules, CA, USA); Vivapure® anti-HSA/IgG kit (Sartorius Stedim Biotech, Goettingen, Germany), Qproteome albumin/IgG depletion kit (Qiagen, Hilden, Germany); Seppro® MIXED12-LC20 column (GenWay Biotech, San Diego, CA, USA);
- Thromboplastin is a plasma protein aiding blood coagulation through conversion of prothrombin to thrombin. Thrombin in turn acts as a serine protease that converts soluble fibrinogen into insoluble strands of fibrin, as well as catalyzing many other coagulation-related reactions.
- thromboplastin is a protein that can be used to facilitate precipitation of fibrinogen/fibrin (blood clotting factors) out of plasma.
- a blood sample can be treated with thromboplastin to deplete fibrinogen/fibrin.
- Thromboplastin removal can be performed in addition to or as an alternative to immunoaffinity protein removal as described above using methods known in the art. Precipitation of other proteins and/or other sample particulate can also improve detection of circulating biomarkers such as vesicles in a sample. For example, ammonium sulfate treatment as known in the art can be used to precipitate immunoglobulins and other highly abundant proteins.
- the invention provides a method of detecting a presence or level of one or more circulating biomarker such as a microvesicle in a biological sample, comprising: (a) providing a circulating biomarker such as a microvesicle in a biological sample, comprising: (a) providing a circulating biomarker such as a microvesicle in a biological sample, comprising: (a) providing a circulating biomarker such as a microvesicle in a biological sample, comprising: (a) providing a
- the biological sample may comprise a bodily fluid, e.g., peripheral blood, sera, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or pre-ejaculatory fluid, female ejaculate, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates, blastocyl cavity fluid, umbilical cord blood, or a derivative of any thereof.
- a bodily fluid e.g., peripheral blood, sera
- the biological sample comprises peripheral blood, serum or plasma.
- Illustrative protocols and results from selectively depleting one or more abundant protein from blood plasma prior to vesicle detection can be found in Example 40 of International Patent Publication No. WO/2014/082083, filed November 26, 2013, which patent publication is incorporated by reference herein in its entirety.
- An abundant protein may comprise a protein in the sample that is present in the sample at a high enough concentration to potentially interfere with downstream processing or analysis. Typically, an abundant protein is not the target of any further analysis of the sample.
- the abundant protein may constitute at least 10 "5 , ⁇ 10 "3 , 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98 or at least 99% of the total protein mass in the sample.
- the abundant protein may constitute at least 10 "5 , ⁇ 10 "3 , 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5,
- the abundant protein is present at less than 10 "5 % of the total protein mass in the sample, e.g., in the case of a rare target of interest.
- the one or more abundant protein may comprise one or more of albumin, IgG, transferrin, fibrinogen, fibrin, IgA, a2-Marcroglobulin, IgM, al -Antitrypsin, complement C3, haptoglobulin, apolipoprotein Al, A3 and B; a 1 -Acid Glycoprotein, ceruloplasmin, complement C4, Clq, IgD, prealbumin (transthyretin), plasminogen, a derivative of any thereof, and a combination thereof.
- the one or more abundant protein in blood or a blood derivative may also comprise one or more of Albumin, Immunoglobulins, Fibrinogen, Prealbumin, Alpha 1 antitrypsin, Alpha 1 acid glycoprotein, Alpha 1 fetoprotein, Haptoglobin, Alpha 2 macroglobulin, Ceruloplasmin, Transferrin, complement proteins C3 and C4, Beta 2 microglobulin, Beta lipoprotein, Gamma globulin proteins, C-reactive protein (CRP), Lipoproteins (chylomicrons, VLDL, LDL, HDL), other globulins (types alpha, beta and gamma), Prothrombin, Mannose-binding lectin (MBL), a derivative of any thereof, and a combination thereof.
- Albumin Immunoglobulins
- Fibrinogen Prealbumin
- Prealbumin Alpha 1 antitrypsin
- Alpha 1 acid glycoprotein Alpha 1 fetoprotein
- Haptoglobin Haptoglobin
- selectively depleting the one or more abundant protein comprises contacting the biological sample with thromboplastin to initiate precipitation of fibrin.
- the one or more abundant protein may also be depleted by immunoaffinity, precipitation, or a combination thereof.
- the sample can be treated with thromboplastin to precipitate fibrin, and then the sample may be passed through a column to remove HSA, IgG, and other abundant proteins as desired.
- "Selectively depleting" the one or more abundant protein comprises depleting the abundant protein from the sample at a higher percentage than depletion another entity in the sample, such as another protein or microvesicle, including a target of interest for downstream processing or analysis.
- Selectively depleting the one or more abundant protein may comprise depleting the abundant protein at a 1.1 -fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6- fold, 7-fold, 8-fold, 9-fold, 10-fold, 1 1-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold, 900-fold, 1000-fold, 10 4 -fold, 10 5 -fold, 10 6 - fold, 10 7 -fold, 10 8 -fold, 10 9 -fold, 10 10 -fold, 10 u -
- selectively depleting the one or more abundant protein from the biological sample comprises depleting at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the one or more abundant protein.
- Removal of highly abundant proteins and other non-desired entities can further be facilitated with a non-stringent size exclusion step.
- the sample can be processed using a high molecular weight cutoff size exclusion step to preferentially enrich high molecular weight vesicles apart from lower molecular weight proteins and other entities.
- a sample is processed with a column (e.g., a gel filtration column) or filter having a molecular weight cutoff (MWCO) of 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10000, or greater than 10000 kiloDaltons (kDa).
- a 700 kDa filtration column is used. In such a step, the vesicles will be retained or flow more slowly than the column or filter than the lower molecular weight entities.
- a column e.g., a gel filtration column
- Isolation or enrichment of a vesicle from a biological sample can also be enhanced by use of sonication (for example, by applying ultrasound), detergents, other membrane-activating agents, or any combination thereof.
- sonication for example, by applying ultrasound
- detergents for example, by applying detergents
- other membrane-activating agents for example, detergents, other membrane-activating agents, or any combination thereof.
- ultrasonic energy can be applied to a potential tumor site, and without being bound by theory, release of vesicles from a tissue can be increased, allowing an enriched population of vesicles that can be analyzed or assessed from a biological sample using one or more methods disclosed herein.
- the consistency of the results can be optimized as desired using various concentration or isolation procedures.
- Such steps can include agitation such as shaking or vortexing, different isolation techniques such as polymer based isolation, e.g., with PEG, and concentration to different levels during filtration or other steps.
- agitation such as shaking or vortexing
- different isolation techniques such as polymer based isolation, e.g., with PEG
- concentration to different levels during filtration or other steps.
- concentration can be applied at various stages of testing the vesicle containing sample.
- the sample itself, e.g., a bodily fluid such as plasma or serum, is vortexed.
- the sample is vortexed after one
- sample treatment step e.g., vesicle isolation
- Agitation can occur at some or all appropriate sample treatment steps as desired.
- Additives can be introduced at the various steps to improve the process, e.g., to control aggregation or degradation of the biomarkers of interest.
- the results can also be optimized as desireable by treating the sample with various agents.
- agents include additives to control aggregation and/or additives to adjust pH or ionic strength.
- Additives that control aggregation include blocking agents such as bovine serum albumin (BSA), milk or
- StabilGuard® (a BSA-free blocking agent; Product code SG02, Surmodics, Eden Prairie, MN), chaotropic agents such as guanidium hydro chloride, and detergents or surfactants.
- Useful ionic detergents include sodium dodecyl sulfate (SDS, sodium lauryl sulfate (SLS)), sodium laureth sulfate (SLS, sodium lauryl ether sulfate (SLES)), ammonium lauryl sulfate (ALS), cetrimonium bromide, cetrimonium chloride, cetrimonium stearate, and the like.
- Non- ionic (zwitterionic) detergents include polyoxyethylene glycols, polysorbate 20 (also known as Tween 20), other polysorbates (e.g., 40, 60, 65, 80, etc), Triton-X (e.g., X100, XI 14), 3-[(3-cholamidopropyl)dimethylammonio]- l-propanesulfonate (CHAPS), CHAPSO, deoxycholic acid, sodium deoxycholate, NP-40, glycosides, octyl-thio-glucosides, maltosides, and the like.
- polyoxyethylene glycols also known as Tween 20
- other polysorbates e.g., 40, 60, 65, 80, etc
- Triton-X e.g., X100, XI 14
- CHAPSO deoxycholic acid
- sodium deoxycholate sodium deoxycholate
- NP-40 glycosides
- glycosides octy
- Pluronic F-68 a surfactant shown to reduce platelet aggregation, is used to treat samples containing vesicles during isolation and/or detection.
- F68 can be used from a 0.1% to 10% concentration, e.g., a 1%, 2.5% or 5% concentration.
- the pH and/or ionic strength of the solution can be adjusted with various acids, bases, buffers or salts, including without limitation sodium chloride (NaCl), phosphate -buffered saline (PBS), tris-buffered saline (TBS), sodium phosphate, potassium chloride, potassium phosphate, sodium citrate and saline-sodium citrate (SSC) buffer.
- NaCl sodium chloride
- PBS phosphate -buffered saline
- TBS tris-buffered saline
- SSC saline-sodium citrate
- NaCl is added at a concentration of 0.1% to 10%, e.g., 1%, 2.5% or 5% final concentration.
- Tween 20 is added to 0.005 to 2% concentration, e.g., 0.05%, 0.25% or 0.5 % final concentration.
- Blocking agents for use with the invention comprise inert proteins, e.g., milk proteins, nonfat dry milk protein, albumin, BSA, casein, or serum such as newborn calf serum (NBCS), goat serum, rabbit serum or salmon serum.
- the proteins can be added at a 0.1% to 10% concentration, e.g., 1%, 2%, 3%, 3.5%, 4%, 5%, 6%, 7%, 8%, 9% or 10% concentration.
- BSA is added to 0.1% to 10% concentration, e.g., 1%, 2%, 3%, 3.5%, 4%, 5%, 6%, 7%, 8%, 9% or 10% concentration.
- the sample is treated according to the methodology presented in U.S. Patent Application 1 1/632946, filed July 13, 2005, which application is incorporated herein by reference in its entirety.
- Commercially available blockers may be used, such as SuperBlock, StartingBlock, Protein-Free from Pierce (a division of Thermo Fisher Scientific, Rockford, IL).
- SSC/detergent e.g., 20X SSC with 0.5% Tween 20 or 0.1% Triton-X 100
- is added to 0.1% to 10% concentration e.g., at 1.0% or 5.0% concentration.
- the methods of detecting vesicles and other circulating biomarkers can be optimized as desired with various combinations of protocols and treatments as described herein.
- a detection protocol can be optimized by various combinations of agitation, isolation methods, and additives.
- the patient sample is vortexed before and after isolation steps, and the sample is treated with blocking
- agents including BSA and/or F68.
- Such treatments may reduce the formation of large aggregates or protein or other biological debris and thus provide a more consistent detection reading.
- a vesicle can be isolated from a biological sample by filtering a biological sample from a subject through a filtration module and collecting from the filtration module a retentate comprising the vesicle, thereby isolating the vesicle from the biological sample.
- the method can comprise filtering a biological sample from a subject through a filtration module comprising a filter (also referred to herein as a selection membrane); and collecting from the filtration module a retentate comprising the vesicle, thereby isolating the vesicle from the biological sample.
- the filter retains molecules greater than about 100 kiloDaltons. In such cases, microvesicles are generally found within the retentate of the filtration process whereas smaller entities such as proteins, protein complexes, nucleic acids, etc, pass through into the filtrate.
- the method can be used when determining a biosignature of one or more microvesicle.
- the method can also further comprise contacting the retentate from the filtration to a plurality of substrates, wherein each substrate is coupled to one or more capture agents, and each subset of the plurality of substrates comprises a different capture agent or combination of capture agents than another subset of the plurality of substrates.
- Also provided herein is a method of determining a biosignature of a vesicle in a sample comprising: filtering a biological sample from a subject with a disorder through a filtration module, collecting from the filtration module a retentate comprising one or more vesicles, and determining a biosignature of the one or more vesicles.
- the filtration module comprises a filter that retains molecules greater than about 100 or 150 kiloDaltons.
- the method disclosed herein can further comprise characterizing a phenotype in a subject by filtering a biological sample from a subject through a filtration module, collecting from the filtration module a retentate comprising one or more vesicles; detecting a biosignature of the one or more vesicles; and characterizing a phenotype in the subject based on the biosignature, wherein characterizing is with at least 70% sensitivity.
- characterizing comprises determining an amount of one or more vesicle having the biosignature.
- the characterizing can be from about 80% to 100% sensitivity.
- the method comprises filtering a biological sample from a subject through a filtration module; collecting from the filtration module a retentate comprising the plurality of vesicles, applying the plurality of vesicles to a plurality of capture agents, wherein the plurality of capture agents is coupled to a plurality of substrates, and each subset of the plurality of substrates is differentially labeled from another subset of the plurality of substrates; capturing at least a subset of the plurality of vesicles; and determining a biosignature for at least a subset of the captured vesicles.
- each substrate is coupled to one or more capture agents, and each subset of the plurality of substrates comprises a different capture agent or combination of capture agents as compared to another subset of the plurality of substrates.
- At least a subset of the plurality of substrates is intrinsically labeled, such as comprising one or more labels.
- the substrate can be a particle or bead, or any combination thereof.
- the filter retains molecules greater than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10000, or greater than 10000 kiloDaltons (kDa).
- the filtration module comprises a filter that retains molecules greater than about 100 or 150 kiloDaltons.
- the filtration module comprises a filter that retains molecules greater than about 9, 20, 100 or 150 kiloDaltons.
- the filtration module comprises a filter that retains molecules greater than about 7000 kDa.
- the method for multiplex analysis of a plurality of vesicles comprises filtering a biological sample from a subject through a filtration module, wherein the filtration module comprises a filter that retains molecules greater than about 100 kiloDaltons; collecting from the filtration module a retentate comprising the plurality of vesicles; applying the plurality of vesicles to a plurality of capture agents, wherein the plurality of capture agents is coupled to a microarray; capturing at least a subset of the plurality of vesicles on the microarray; and determining a biosignature for at least a subset of the captured vesicles.
- the filter retains molecules greater than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10000, or greater than 10000 kiloDaltons (kDa).
- the filtration module comprises a filter that retains molecules greater than about 100 or 150 kiloDaltons.
- the filtration module comprises a filter that retains molecules greater than about 9, 20, 100 or 150 kiloDaltons.
- the filtration module comprises a filter that retains molecules greater than about 7000 kDa.
- the biological sample can be clarified prior to isolation by filtration. Clarification comprises selective removal of cellular debris and other undesirable materials. For example, cellular debris and other components that may interfere with detection of the circulating biomarkers can be removed.
- the clarification can be by low-speed centrifugation, such as at about 5,000x g, 4,000x g, 3,000x g, 2,000x g, l,000x g, or less.
- the supernatant, or clarified biological sample, containing the vesicle can then be collected and filtered to isolate the vesicle from the clarified biological sample.
- the biological sample is not clarified prior to isolation of a vesicle by filtration.
- isolation of a vesicle from a sample does not use high-speed
- centrifugation such as ultracentrifugation.
- isolation may not require the use of centrifugal speeds, such as about 100,000x g or more.
- isolation of a vesicle from a sample uses speeds of less than 50,000 x g, 40,000 x g, 30,000 x g, 20,000 x g, 15,000 x g, 12,000 x g, or 10,000
- any number of applicable filter configurations can be used to filter a sample of interest.
- the filtration module used to isolate the circulating biomarkers from the biological sample can be used to isolate the circulating biomarkers from the biological sample
- the fiber can be a hollow polymeric fiber, such as a polypropylene hollow fiber.
- a biological sample can be introduced into the filtration module by pumping the sample fluid, such as a biological fluid as disclosed herein, into the module with a pump device, such as a peristaltic pump.
- the pump flow rate can vary, such as at about 0.25, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, or 10 mL/minute.
- the flow rate can be adjusted given the configuration, e.g., size and throughput, of the filtration module.
- the filtration module can be a membrane filtration module.
- the membrane filtration module can comprise a filter disc membrane, such as a hydrophilic polyvinylidene difluoride (PVDF) filter disc membrane housed in a stirred cell apparatus (e.g., comprising a magnetic stirrer).
- PVDF polyvinylidene difluoride
- the sample moves through the filter as a result of a pressure gradient established on either side of the filter membrane.
- the filter can comprise a material having low hydrophobic absorptivity and/or high hydrophilic properties.
- the filter can have an average pore size for vesicle retention and permeation of most proteins as well as a surface that is hydrophilic, thereby limiting protein adsorption.
- the filter can comprise a material selected from the group consisting of polypropylene, PVDF, polyethylene, polyfluoroethylene, cellulose, secondary cellulose acetate, polyvinylalcohol, and ethylenevinyl alcohol (EVAL®, Kuraray Co., Okayama, Japan). Additional materials that can be used in a filter include, but are not limited to, polysulfone and polyethersulfone.
- the filtration module can have a filter that retains molecules greater than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, 800, or 900 kiloDaltons (kDa), such as a filter that has a MWCO (molecular weight cut off) of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, 800, or 900 kDa, respectively.
- a filter that retains molecules greater than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250
- the filtration module has a MWCO of 1000 kDa, 1500 kDa, 2000 kDa, 2500 kDa, 3000 kDa, 3500 kDa, 4000 kDa, 4500 kDa, 5000 kDa, 5500 kDa, 6000 kDa, 6500 kDa, 7000 kDa, 7500 kDa, 8000 kDa, 8500 kDa, 9000 kDa, 9500 kDa, 10000 kDa, or greater than 10000 kDa.
- Ultrafiltration membranes with a range of MWCO of 9 kDa, 20 kDa and/or 150 kDa can be used.
- the filter within the filtration module has an average pore diameter of about 0.01 ⁇ to about 0.15 ⁇ , and in some embodiments from about 0.05 ⁇ to about 0.12 ⁇ . In some embodiments, the filter has an average pore diameter of about 0.06 ⁇ , 0.07 ⁇ , 0.08 ⁇ , 0.09 ⁇ , 0.1 ⁇ , 0.1 1 ⁇ or 0.2 ⁇ .
- the filtration module can be a commerically available column, such as a column typically used for concentrating proteins or for isolating proteins (e.g., ultrafiltration). Examples include, but are not limited to, columns from Millpore (Billerica, MA), such as Amicon® centrifugal filters, or from Pierce® (Rockford, IL), such as Pierce Concentrator filter devices. Useful columns from Pierce include disposable ultrafiltration centrifugal devices with a MWCO of 9 kDa, 20 kDa and/or 150 kDa. These concentrators consist of a high-performance regenerated cellulose membrane welded to a conical device.
- the filters can be as described in U.S. Patents 6,269,957 or 6,357,601, both of which applications are incorporated by reference in their entirety herein.
- the retentate comprising the isolated vesicle can be collected from the filtration module.
- the retentate can be collected by flushing the retentate from the filter.
- Selection of a filter composition having hydrophilic surface properties, thereby limiting protein adsorption, can be used, without being bound by theory, for easier collection of the retentate and minimize use of harsh or time-consuming collection techniques.
- the collected retentate can then be used subsequent analysis, such as assessing a biosignature of one or more vesicles in the retentate, as further described herein.
- the analysis can be directly performed on the collected retentate.
- the collected retentate can be further concentrated or purified, prior to analysis of one or more vesicles.
- the retentate can be further concentrated or vesicles further isolated from the retentate using size exclusion chromatography, density gradient centrifugation, differential centrifugation, immunoabsorbent capture, affinity purification, microfluidic separation, or combinations thereof, such as described herein.
- the retentate can undergo another step of filtration.
- the vesicle prior to isolation of a vesicle using a filter, the vesicle is concentrated or isolated using techniques including without limitation size exclusion chromatography, density gradient centrifugation, differential centrifugation, immunoabsorbent capture, affinity purification, microfluidic separation, or combinations thereof.
- Combinations of filters can be used for concentrating and isolating biomarkers.
- the biological sample may first be filtered through a filter having a porosity or pore size of between about 0.01 ⁇ to about 10 ⁇ , e.g., 0.01 ⁇ to about 2 ⁇ or about 0.05 ⁇ to about 1.5 ⁇ , and then the sample is filtered.
- a filter that retains molecules greater than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10000, or greater than 10000 kiloDaltons (kDa), such as a filter that has a MWCO (molecular weight cut off) of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, 800, 900,
- MWCO molecular weight cut off
- the filter has a pore size of about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0 or 10.0 ⁇ .
- the filter may be a syringe filter.
- the method comprises filtering the biological sample through a filter, such as a syringe filter, wherein the syringe filter has a porosity of greater than about 1 ⁇ , prior to filtering the sample through a filtration module comprising a filter that retains molecules greater than about 100 or 150 kiloDaltons.
- the filter is 1.2 ⁇ filter and the filtration is followed by passage of the sample through a 7 ml or 20 ml concentrator column with a 150 kDa cutoff. Multiple concentrator columns may be used, e.g., in series. For example, a 7000 MWCO filtration unit can be used before a 150 MWCO unit.
- the filtration module can be a component of a microfluidic device.
- Microfluidic devices which may also be referred to as "lab-on-a-chip” systems, biomedical micro-electro-mechanical systems (bioMEMs), or multicomponent integrated systems, can be used for isolating, and analyzing, vesicles.
- bioMEMs biomedical micro-electro-mechanical systems
- Such systems miniaturize and compartmentalize processes that allow for binding of vesicles, detection of biomarkers, and other processes, such as further described herein.
- the filtration module and assessment can be as described in Grant, R., et al., A filtration-based protocol to isolate human Plasma Membrane-derived Vesicles and exosomes from blood plasma, J Immunol Methods (201 1) 371: 143-51 (Epub 201 1 Jun 30), which reference is incorporated herein by reference in its entirety.
- a microfluidic device can also be used for isolation of a vesicle by comprising a filtration module.
- a microfluidic device can use one more channels for isolating a vesicle from a biological sample based on size from a biological sample.
- a biological sample can be introduced into one or more microfluidic channels, which selectively allows the passage of vesicles.
- the microfluidic device can further comprise binding agents, or more than one filtration module to select vesicles based on a property of the vesicles, for example, size, shape, deformability, biomarker profile, or biosignature.
- the retentate from a filtration step can be further processed before assessment of microvesicles or other biomarkers therein.
- the retentate is diluted prior to biomarker assessment, e.g., with an appropriate diluent such as a biologically compatible buffer.
- the retentate is serially diluted.
- the invention provides a method for detecting a microvesicle population from a biological sample comprising: a) concentrating the biological sample using a selection membrane having a pore size of from 0.01 ⁇ to about 10 ⁇ , or a molecular weight cut off (MWCO) from about 1 kDa to 10000 kDa; b) diluting a retentate from the concentration step into one or more aliquots; and c) contacting each of the one or more aliquots of retentate with one or more binding agent specific to a molecule of at least one microvesicle in the microvesicle population.
- MWCO molecular weight cut off
- the invention provides a method for detecting a microvesicle population from a biological sample comprising: a) concentrating the biological sample using a selection membrane having a pore size of from 0.01 ⁇ to about 10 ⁇ , or a molecular weight cut off (MWCO) from about 1 kDa to 10000 kDa; and b) contacting one or more aliquots of the retentate from the concentrating step with one or more binding agent specific to a molecule of at least one microvesicle in the microvesicle population.
- a selection membrane having a pore size of from 0.01 ⁇ to about 10 ⁇ , or a molecular weight cut off (MWCO) from about 1 kDa to 10000 kDa
- MWCO molecular weight cut off
- the selection membrane can be sized to retain the desired biomarkers in the retentate or to allow the desired biomarkers to pass through the filter into the filtrate.
- the filter membrane can be chosen to have a certain pore size or MWCO value.
- the selection membrane can have a pore size of about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0 or 10.0 ⁇ .
- the selection membrane can also have a MWCO of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10000 kDa.
- the retentate can be separated and/or diluted into any number of desired aliquots. For example, multiple aliquots without any dilution or the same dilution can be used to determine reproducibility. In another example, multiple aliquots at different dilutions can be used to construct a concentration curve. In an embodiment, the retentate is separated and/or diluted into at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350 or 400 aliquots. The aliquots can be at a same dilution or at different dilutions.
- a dilution factor is the ratio of the final volume of a mixture (the mixture of the diluents and aliquot) divided by the initial volume of the aliquot.
- the retentate can be diluted into one or more aliquots at a dilution factor of about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000 and/or 100000.
- the retentate can be diluted into one or more aliquot at a dilution factor of
- the retentate can be diluted into multiple aliquots.
- the retentate is diluted into one or more aliquots at a dilution factor of about 100, 250, 500, 1000, 10000 and 100000.
- the method can further comprise detecting an amount of microvesicles in each aliquot of retentate, e.g., that formed a complex with the one or more binding agent.
- the curve can be used to determine a linear range of the amount of microvesicles in each aliquot detected versus dilution factor.
- a concentration of the detected microvesicles for the biological sample can be determined using the amount of microvesicles determined in one or more aliquot within the linear range.
- the concentration can be compared to a reference concentration, e.g., in order to characterize a phenotype as described herein.
- the invention also provides a related method comprising filtering a biological sample from a subject through a filtration module and collecting a filtrate comprising the vesicle, thereby isolating the vesicle from the biological sample.
- a biological sample from a subject through a filtration module and collecting a filtrate comprising the vesicle, thereby isolating the vesicle from the biological sample.
- cells and other large entities can be retained in the retentate while microvesicles pass through into the filtrate.
- strategies to retain and filter microvesicles can be used in concert.
- a sample can be filtered with a selection membrane that allows microvesicles to pass through, thereby isolating the microvesicles from large particles (cells, complexes, etc).
- the filtrate comprising the microvesicle can then be filtered using a selection membrane that retains microvesicles, thereby isolating the microvesicles from smaller particles (proteins, nucleic acids, etc).
- the isolated microvesicles can be further assessed according to the methods of the invention, e.g., to characterize a phenotype.
- Vesicles can be isolated using a polymeric precipitation method. The method can be in combination with or in place of the other isolation methods described herein.
- the sample containing the vesicles is contacted with a formulation of polyethylene glycol (PEG).
- PEG polyethylene glycol
- the polymeric formulation is incubated with the vesicle containing sample then precipitated by centrifugation.
- the PEG can bind to the vesicles and can be treated to specifically capture vesicles by addition of a
- PEG4000 or PEG8000 may be used at a concentration of 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%, e.g., 4% or 8%.
- the vesicles are concentrated from a sample using the polymer precipitation method and the isolated vesicles are further separated using another approach.
- the second step can be used to identify a subpopulation of vesicles, e.g., that display certain biomarkers.
- the second separation step can comprise size exclusion, a binding agent, an antibody capture step, microbeads, as described herein.
- vesicles are isolated according to the ExoQuickTM and ExoQuick-TCTM kits from System Biosciences, Mountain View, CA USA. These kits use a polymer-based precipitation method to pellet vesicles. Similarly, the vesicles can be isolated using the Total Exosome Isolation (from Serum) or Total Exosome Isolation (from Cell Culture Media) kits from Invitrogen / Life Technologies (Carlsbad, CA USA). The Total Exosome Isolation reagent forces less-soluble components such as vesicles out of solution, allowing them to be collected by a short, low-speed centrifugation. The reagent is added to the biological sample, and the solution is incubated overnight at 2 °C to 8 °C. The precipitated vesicles are recovered by standard centrifugation.
- ExoQuickTM and ExoQuick-TCTM kits from System Biosciences, Mountain View, CA USA. These kits use a polymer-based precipitation method to pellet vesic
- Binding agents include agents that are capable of binding a target biomarker.
- a binding agent can be specific for the target biomarker, meaning the agent is capable of binding a target biomarker.
- the target can be any useful biomarker disclosed herein, such as a biomarker on the vesicle surface.
- the target is a single molecule, such as a single protein, so that the binding agent is specific to the single protein.
- the target can be a group of molecules, such as a family or proteins having a similar epitope or moiety, so that the binding agent is specific to the family or group of proteins.
- the group of molecules can also be a class of molecules, such as protein, DNA or R A.
- the binding agent can be a capture agent used to capture a vesicle by binding a component or biomarker of a vesicle.
- a capture agent comprises an antibody or fragment thereof, or an aptamer, that binds to an antigen on a vesicle.
- the capture agent can be optionally coupled to a substrate and used to isolate a vesicle, as further described herein.
- a binding agent is an agent that binds to a circulating biomarker, such as a vesicle or a component of a vesicle.
- the binding agent can be used as a capture agent and/or a detection agent.
- a capture agent can bind and capture a circulating biomarker, such as by binding a component or biomarker of a vesicle.
- the capture agent can be a capture antibody or capture antigen that binds to an antigen on a vesicle.
- a detection agent can bind to a circulating biomarker thereby facilitating detection of the
- a capture agent comprising an antibody or aptamer that is sequestered to a substrate can be used to capture a vesicle in a sample
- a detection agent comprising an antibody or aptamer that carries a label can be used to detect the captured vesicle via detection of the detection agent's label.
- a vesicle is assessed using capture and detection agents that recognize the same vesicle biomarkers.
- a vesicle population can be captured using a tetraspanin such as by using an anti-CD9 antibody bound to a substrate, and the captured vesicles can be detected using a fluorescently labeled anti-CD9 antibody to label the captured vesicles.
- a vesicle is assessed using capture and detection agents that recognize different vesicle biomarkers.
- a vesicle population can be captured using a cell-specific marker such as by using an anti-PCSA antibody bound to a substrate, and the captured vesicles can be detected using a fluorescently labeled anti-CD9 antibody to label the captured vesicles.
- the vesicle population can be captured using a general vesicle marker such as by using an anti-CD9 antibody bound to a substate, and the captured vesicles can be detected using a fluorescently labeled antibody to a cell-specific or disease specific marker to label the captured vesicles.
- a general vesicle marker such as by using an anti-CD9 antibody bound to a substate
- the captured vesicles can be detected using a fluorescently labeled antibody to a cell-specific or disease specific marker to label the captured vesicles.
- antigen as used herein is meant to encompass any entity that is capable of being bound by a binding agent, regardless of the type of binding agent or the immunogenicity of the biomarker.
- the antigen further encompasses a functional fragment thereof.
- an antigen can encompass a protein biomarker capable of being bound by a binding agent, including a fragment of the protein that is capable of being bound by a binding agent.
- a vesicle is captured using a capture agent that binds to a biomarker on a vesicle.
- the capture agent can be coupled to a substrate and used to isolate a vesicle, as further described herein.
- a capture agent is used for affinity capture or isolation of a vesicle present in a substance or sample.
- a binding agent can be used after a vesicle is concentrated or isolated from a biological sample.
- a vesicle can first be isolated from a biological sample before a vesicle with a specific biosignature is isolated or detected.
- the vesicle with a specific biosignature can be isolated or detected using a binding agent for the biomarker.
- a vesicle with the specific biomarker can be isolated or detected from a heterogeneous population of vesicles.
- a binding agent may be used on a biological sample comprising vesicles without a prior isolation or concentration step.
- a binding agent is used to isolate or detect a vesicle with a specific biosignature directly from a biological sample.
- a binding agent can be a nucleic acid, protein, or other molecule that can bind to a component of a vesicle.
- the binding agent can comprise DNA, R A, monoclonal antibodies, polyclonal antibodies, Fabs, Fab', single chain antibodies, synthetic antibodies, aptamers (DNA/RNA), peptoids, zDNA, peptide nucleic acids (PNAs), locked nucleic acids (LNAs), lectins, synthetic or naturally occurring chemical compounds (including but not limited to drugs, labeling reagents), dendrimers, or a combination thereof.
- the binding agent can be a capture antibody.
- the binding agent comprises a membrane protein labeling agent. See, e.g., the membrane protein labeling agents
- vesicles are isolated or captured as described herein, and one or more membrane protein labeling agent is used to detect the vesicles.
- a single binding agent can be employed to isolate or detect a vesicle.
- a combination of different binding agents may be employed to isolate or detect a vesicle.
- at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 50, 75 or 100 different binding agents may be used to isolate or detect a vesicle from a biological sample.
- the one or more different binding agents for a vesicle can form a biosignature of a vesicle, as further described below.
- Different binding agents can also be used for multiplexing. For example, isolation or detection of more than one population of vesicles can be performed by isolating or detecting each vesicle population with a different binding agent. Different binding agents can be bound to different particles, wherein the different particles are labeled. In another embodiment, an array comprising different binding agents can be used for multiplex analysis, wherein the different binding agents are differentially labeled or can be ascertained based on the location of the binding agent on the array. Multiplexing can be accomplished up to the resolution capability of the labels or detection method, such as described below. The binding agents can be used to detect the vesicles, such as for detecting cell-of-origin specific vesicles.
- a binding agent or multiple binding agents can themselves form a binding agent profile that provides a biosignature for a vesicle.
- One or more binding agents can be selected from Fig. 2 of International Patent Publication No. WO/201 1/127219, entitled “Circulating Biomarkers for Disease” and filed April 6, 201 1, which application is incorporated by reference in its entirety herein. For example, if a vesicle population is detected or isolated using two, three, four or more binding agents in a differential detection or isolation of a vesicle from a heterogeneous population of vesicles, the particular binding agent profile for the vesicle population provides a biosignature for the particular vesicle population.
- the vesicle can be detected using any number of binding agents in a multiplex fashion.
- the binding agent can also be used to form a biosignature for a vesicle.
- the biosignature can be used to characterize a phenotype.
- the binding agent can be a lectin.
- Lectins are proteins that bind selectively to polysaccharides and glycoproteins and are widely distributed in plants and animals.
- lectins such as those derived from Galanthus nivalis in the form of Galanthus nivalis agglutinin ("GNA”), Narcissus pseudonarcissus in the form of Narcissus pseudonarcissus agglutinin ("NPA”) and the blue green algae Nostoc ellipsosporum called "cyanovirin” (Boyd et al. Antimicrob Agents Chemother 41(7): 1521 1530, 1997; Hammar et al.
- High mannose glycoprotein refers to glycoproteins having mannose-mannose linkages in the form of a- 1 ⁇ 3 or a- 1 ⁇ 6 mannose-mannose linkages.
- the binding agent can be an agent that binds one or more lectins.
- Lectin capture can be applied to the isolation of the biomarker cathepsin D since it is a glycosylated protein capable of binding the lectins Galanthus nivalis agglutinin (GNA) and concanavalin A (ConA).
- GAA Galanthus nivalis agglutinin
- ConA concanavalin A
- the binding agent can be an antibody.
- a vesicle may be isolated using one or more antibodies specific for one or more antigens present on the vesicle.
- a vesicle can have CD63 on its surface, and an antibody, or capture antibody, for CD63 can be used to isolate the vesicle.
- a vesicle derived from a tumor cell can express EpCam, the vesicle can be isolated using an antibody for EpCam and CD63.
- Other antibodies for isolating vesicles can include an antibody, or capture antibody, to CD9, PSCA, TNFR, CD63, B7H3, MFG-E8, EpCam, Rab, CD81, STEAP, PCSA, PSMA, or 5T4.
- Other antibodies for isolating vesicles can include an antibody, or capture antibody, to DR3, STEAP, epha2, TMEM211, MFG-E8, Tissue Factor (TF), unc93A, A33, CD24, NGAL, EpCam, MUC17, TROP2, or TETS.
- the capture agent is an antibody to CD9, CD63, CD81, PSMA, PCSA, B7H3, EpCam, PSCA, ICAM, STEAP, or EGFR.
- the capture agent can also be used to identify a biomarker of a vesicle.
- a capture agent such as an antibody to CD9 would identify CD9 as a biomarker of the vesicle.
- a plurality of capture agents can be used, such as in multiplex analysis.
- the plurality of captures agents can comprise binding agents to one or more of: CD9, CD63, CD81, PSMA, PCSA, B7H3, EpCam, PSCA, ICAM, STEAP, and EGFR.
- the plurality of capture agents comprise binding agents to CD9, CD63, CD81, PSMA, PCSA, B7H3, MFG-E8, and/or EpCam. In yet other embodiments, the plurality of capture agents comprises binding agents to CD9, CD63, CD81, PSMA, PCSA, B7H3, EpCam, PSCA, ICAM, STEAP, and/or EGFR.
- the plurality of capture agents comprises binding agents to TMEM21 1, MFG-E8, Tissue Factor (TF), and/or CD24.
- the antibodies referenced herein can be immunoglobulin molecules or immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that specifically binds an antigen and synthetic antibodies.
- the immunoglobulin molecules can be of any class (e.g., IgG, IgE, IgM, IgD or IgA) or subclass of immunoglobulin molecule.
- Antibodies include, but are not limited to, polyclonal, monoclonal, bispecific, synthetic, humanized and chimeric antibodies, single chain antibodies, Fab fragments and F(ab')2 fragments, Fv or Fv' portions, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies, or epitope-binding fragments of any of the above.
- An antibody, or generally any molecule, "binds specifically" to an antigen (or other molecule) if the
- antibody binds preferentially to the antigen, and, e.g., has less than about 30%, 20%, 10%, 5% or 1% cross-reactivity with another molecule.
- the binding agent can also be a polypeptide or peptide.
- Polypeptide is used in its broadest sense and may include a sequence of subunit amino acids, amino acid analogs, or peptidomimetics. The subunits may be linked by peptide bonds.
- the polypeptides may be naturally occurring, processed forms of naturally occurring polypeptides (such as by enzymatic digestion), chemically synthesized or
- the polypeptides for use in the methods of the present invention may be chemically synthesized using standard techniques.
- the polypeptides may comprise D-amino acids (which are resistant to L- amino acid-specific proteases), a combination of D- and L-amino acids, ⁇ amino acids, or various other designer or non-naturally occurring amino acids (e.g., ⁇ -methyl amino acids, Ca- methyl amino acids, and Na-methyl amino acids, etc.) to convey special properties.
- Synthetic amino acids may include ornithine for lysine, and norleucine for leucine or isoleucine.
- polypeptides can have peptidomimetic bonds, such as ester bonds, to prepare polypeptides with novel properties.
- a polypeptide may be generated that incorporates a reduced peptide bond, i.e., R i-CH 2 -NH-R 2 , where R i and R 2 are amino acid residues or sequences.
- a reduced peptide bond may be introduced as a dipeptide subunit.
- Such a polypeptide would be resistant to protease activity, and would possess an extended half- live in vivo.
- Polypeptides can also include peptoids (N-substituted glycines), in which the side chains are appended to nitrogen atoms along the molecule's backbone, rather than to the a-carbons, as in amino acids.
- Polypeptides and peptides are intended to be used interchangeably throughout this application, i.e. where the term peptide is used, it may also include polypeptides and where the term polypeptides is used, it may also include peptides.
- the term "protein” is also intended to be used interchangeably throughout this application with the terms “polypeptides” and “peptides” unless otherwise specified.
- a vesicle may be isolated, captured or detected using a binding agent.
- the binding agent can be an agent that binds a vesicle "housekeeping protein," or general vesicle biomarker.
- the biomarker can be CD63, CD9, CD81, CD82, CD37, CD53, Rab-5b, Annexin V, MFG-E8 or other commonly observed vesicle markers include those listed in Table 3.
- any of the markers disclosed herein or in Table 3 can be selected in identifying a candidate biosignature for a disease or condition, where the one or more selected biomarkers have a direct or indirect role or function in mechanisms involved in the disease or condition.
- the binding agent can also be an agent that binds to a vesicle derived from a specific cell type, such as a tumor cell (e.g. binding agent for Tissue factor, EpCam, B7H3, RAGE or CD24) or a specific cell-of-origin.
- a tumor cell e.g. binding agent for Tissue factor, EpCam, B7H3, RAGE or CD24
- the binding agent used to isolate or detect a vesicle can be a binding agent for an antigen selected from Fig. 1 of International Patent Publication No. WO/201 1/127219, entitled “Circulating Biomarkers for Disease” and filed April 6, 201 1, which application is incorporated by reference in its entirety herein.
- the binding agent for a vesicle can also be selected from those listed in Fig. 2 of
- the binding agent can be for an antigen such as a tetraspanin, MFG-E8, Annexin V, 5T4, B7H3, caveolin, CD63, CD9, E-Cadherin, Tissue factor, MFG-
- a binding agent for a platelet can be a glycoprotein such as GpIa-IIa, GpIIb-IIIa, GpIIIb, Gplb, or GpIX.
- a binding agent can be for an antigen comprisine one or more of CD9, Erb2, Erb4, CD81, Erb3, MUC 16, CD63, DLL4, HLA-Drpe, B7H3, IFNAR, 5T4, PCSA, MICB, PSMA, MFG- E8, Mucl , PSA, Muc2, Unc93a, VEGFR2, EpCAM, VEGF A, TMPRSS2, RAGE, PSCA, CD40, Mucl 7, IL- 17-RA, and CD80.
- the binding agent can be one or more of CD9, CD63, CD81 , B7H3, PCSA, MFG-E8, MUC2, EpCam, RAGE and Mucl 7.
- One or more binding agents such as one or more binding agents for two or more of the antigens, can be used for isolating or detecting a vesicle.
- the binding agent used can be selected based on the desire of isolating or detecting a vesicle derived from a particular cell type or cell-of-origin specific vesicle.
- the binding agent can be to one or more vesicle marker in Table 4.
- a binding agent can also be linked directly or indirectly to a solid surface or substrate.
- a solid surface or substrate can be any physically separable solid to which a binding agent can be directly or indirectly attached including, but not limited to, surfaces provided by microarrays and wells, particles such as beads, columns, optical fibers, wipes, glass and modified or functionalized glass, quartz, mica, diazotized membranes (paper or nylon), polyformaldehyde, cellulose, cellulose acetate, paper, ceramics, metals, metalloids, semiconductive materials, quantum dots, coated beads or particles, other
- plastics including acrylics, polystyrene, copolymers of styrene or other materials, polypropylene, polyethylene, polybutylene, polyurethanes,
- polytetrafluoroethylene PTFE, Teflon®, etc.
- polysaccharides PTFE, Teflon®
- nylon or nitrocellulose resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses, plastics, ceramics, conducting polymers (including polymers such as polypyrole and polyindole); micro or nanostructured surfaces such as nucleic acid tiling arrays, nanotube, nanowire, or nanoparticulate decorated surfaces; or porous surfaces or gels such as methacrylates, acrylamides, sugar polymers, cellulose, silicates, or other fibrous or stranded polymers.
- PTFE polytetrafluoroethylene
- Teflon® Teflon®
- the substrate may be coated using passive or chemically-derivatized coatings with any number of materials, including polymers, such as dextrans, acrylamides, gelatins or agarose. Such coatings can facilitate the use of the array with a biological sample.
- an antibody used to isolate a vesicle can be bound to a solid substrate such as a well, such as commercially available plates (e.g. from Nunc, Milan Italy). Each well can be coated with the antibody.
- the antibody used to isolate a vesicle is bound to a solid substrate such as an array.
- the array can have a predetermined spatial arrangement of molecule interactions, binding islands, biomolecules, zones, domains or spatial arrangements of binding islands or binding agents deposited within discrete boundaries.
- the term array may be used herein to refer to multiple arrays arranged on a surface, such as would be the case where a surface bore multiple copies of an array. Such surfaces bearing multiple arrays may also be referred to as multiple arrays or repeating arrays.
- Arrays typically contain addressable moieties that can detect the presense of an entity, e.g., a vesicle in the sample via a binding event.
- An array may be referred to as a microarray. Arrays or
- micro-arrays include without limitation DNA microarrays, such as cDNA microarrays, oligonucleotide microarrays and SNP microarrays, microR A arrays, protein microarrays, antibody microarrays, tissue microarrays, cellular microarrays (also called transfection microarrays), chemical compound microarrays, and carbohydrate arrays (glycoarrays).
- DNA arrays typically comprise addressable nucleotide sequences that can bind to sequences present in a sample.
- MicroRNA arrays e.g., the MMChips array from the University of Louisville or commercial systems from Agilent, can be used to detect microRNAs.
- Protein microarrays can be used to identify protein-protein interactions, including without limitation identifying substrates of protein kinases, transcription factor protein- activation, or to identify the targets of biologically active small molecules.
- Protein arrays may comprise an array of different protein molecules, commonly antibodies, or nucleotide sequences that bind to proteins of interest.
- a protein array can be used to detect vesicles having certain proteins on their surface.
- Antibody arrays comprise antibodies spotted onto the protein chip that are used as capture molecules to detect proteins or other biological materials from a sample, e.g., from cell or tissue lysate solutions.
- antibody arrays can be used to detect vesicle-associated biomarkers from bodily fluids, e.g., serum or urine.
- Tissue microarrays comprise separate tissue cores assembled in array fashion to allow multiplex histological analysis.
- Cellular microarrays also called transfection microarrays, comprise various capture agents, such as antibodies, proteins, or lipids, which can interact with cells to facilitate their capture on addressable locations. Cellular arrays can also be used to capture vesicles due to the similarity between a vesicle and cellular membrane.
- Chemical compound microarrays comprise arrays of chemical compounds and can be used to detect protein or other biological materials that bind the compounds.
- Carbohydrate arrays (glycoarrays) comprise arrays of carbohydrates and can detect, e.g., protein that bind sugar moieties.
- a binding agent can also be bound to particles such as beads or microspheres.
- particles such as beads or microspheres.
- an antibody specific for a component of a vesicle can be bound to a particle, and the antibody-bound particle is used to isolate a vesicle from a biological sample.
- the microspheres may be magnetic or fluorescently labeled.
- a binding agent for isolating vesicles can be a solid substrate itself.
- latex beads such as aldehyde/sulfate beads (Interfacial Dynamics, Portland, OR) can be used.
- a binding agent bound to a magnetic bead can also be used to isolate a vesicle.
- a biological sample such as serum from a patient can be collected for colon cancer screening.
- the sample can be incubated with anti-CCSA-3 (Colon Cancer-Specific Antigen) coupled to magnetic microbeads.
- a low-density microcolumn can be placed in the magnetic field of a MACS Separator and the column is then washed with a buffer solution such as Tris-buffered saline.
- the magnetic immune complexes can then be applied to the column and unbound, non-specific material can be discarded.
- the CCSA-3 selected vesicle can be recovered by removing the column from the separator and placing it on a collection tube.
- a buffer can be added to the column and the magnetically labeled vesicle can be released by applying the plunger supplied with the column.
- the isolated vesicle can be diluted in IgG elution buffer and the
- -88- Docket No. 37901-820.601 complex can then be centrifuged to separate the microbeads from the vesicle.
- the pelleted isolated cell-of- origin specific vesicle can be resuspended in buffer such as phosphate -buffered saline and quantitated.
- a proteolytic enzyme such as trypsin can be used for the release of captured vesicles without the need for centrifugation.
- the proteolytic enzyme can be incubated with the antibody captured cell-of-origin specific vesicles for at least a time sufficient to release the vesicles.
- a binding agent such as an antibody, for isolating vesicles is preferably contacted with the biological sample comprising the vesicles of interest for at least a time sufficient for the binding agent to bind to a component of the vesicle.
- an antibody may be contacted with a biological sample for various intervals ranging from seconds days, including but not limited to, about 10 minutes, 30 minutes, 1 hour, 3 hours, 5 hours, 7 hours, 10 hours, 15 hours, 1 day, 3 days, 7 days or 10 days.
- a binding agent such as an antibody specific to an antigen listed in Fig. 1 of International Patent Publication No. WO/201 1/127219, entitled “Circulating Biomarkers for Disease” and filed April 6, 2011, which application is incorporated by reference in its entirety herein, or a binding agent listed in Fig. 2 of International Patent Publication No. WO/2011/127219, can be labeled to facilitate detection.
- Appropriate labels include without limitation a magnetic label, a fluorescent moiety, an enzyme, a chemiluminescent probe, a metal particle, a non-metal colloidal particle, a polymeric dye particle, a pigment molecule, a pigment particle, an electrochemically active species, semiconductor nanocrystal or other nanoparticles including quantum dots or gold particles, fluorophores, quantum dots, or radioactive labels.
- a magnetic label for example, a fluorescent moiety, an enzyme, a chemiluminescent probe, a metal particle, a non-metal colloidal particle, a polymeric dye particle, a pigment molecule, a pigment particle, an electrochemically active species, semiconductor nanocrystal or other nanoparticles including quantum dots or gold particles, fluorophores, quantum dots, or radioactive labels.
- a binding agent can be directly or indirectly labeled, e.g., the label is attached to the antibody through biotin-streptavidin.
- an antibody is not labeled, but is later contacted with a second antibody that is labeled after the first antibody is bound to an antigen of interest.
- the binding agent may be linked to a solid surface or substrate, such as arrays, particles, wells and other substrates described above.
- Methods for direct chemical coupling of antibodies, to the cell surface are known in the art, and may include, for example, coupling using glutaraldehyde or maleimide activated antibodies.
- Methods for chemical coupling using multiple step procedures include biotinylation, coupling of trinitrophenol (TNP) or digoxigenin using for example succinimide esters of these compounds.
- TNP trinitrophenol
- succinimide esters of these compounds include biotinylation, coupling of trinitrophenol (TNP) or digoxigenin using for example succinimide esters of these compounds.
- Biotinylation can be accomplished by, for example, the use of D-biotinyl-N-hydroxysuccinimide.
- Succinimide groups react effectively with amino groups at pH values above 7, and preferentially between about pH 8.0 and about pH 8.5.
- Biotinylation can be accomplished by, for example, treating the cells with dithiothreitol followed by the addition of biotin maleimide.
- assays using particles or microspheres are capable of use with a binding agent.
- a binding agent for example, antibodies or aptamers are easily conjugated with commercially available beads. See, e.g., Fan et al, Illumina universal bead arrays.
- Multiparametric assays or other high throughput detection assays using bead coatings with cognate ligands and reporter molecules with specific activities consistent with high sensitivity automation can be used.
- a binding agent for a biomarker or vesicle such as a capture agent (e.g. capture antibody)
- a capture agent e.g. capture antibody
- Each binding agent for each individual binding assay can be coupled to a distinct type of microsphere (i.e., microbead) and the assay reaction takes place on the surface of the microsphere, such as depicted in FIG. 2B.
- a binding agent for a vesicle can be a capture antibody or aptamer coupled to a bead.
- Dyed microspheres with discrete fluorescence intensities are loaded separately with their appropriate binding agent or capture probes.
- the different bead sets carrying different binding agents can be pooled as desired to generate custom bead arrays. Bead arrays are then incubated with the sample in a single reaction vessel to perform the assay.
- flow cytometry is used to assess a microvesicle population in a biological sample.
- the microvesicle population can be sorted from other particles (e.g., cell debris, protein aggregates, etc) in a sample by labeling the vesicles using one or more general vesicle marker.
- the general vesicle marker can be a marker in Table 3.
- Commonly used vesicle markers include tetraspanins such as CD9, CD63 and/or CD81.
- Vesicles comprising one or more tetraspanin are sometimes refered to as "Tet+" herein to indicate that the vesicles are tetraspanin-positive.
- the sorted microvesicles can be further assessed using methodology described herein. E.g., surface antigens on the sorted microvesicles can be detected using flow or other methods. In some embodiments, payload within the sorted microvesicles is assessed.
- a population of microvesicles is contacted with a labeled binding agent to a surface antigen of interest, the contacted microvesicles are sorted using flow cytometry, and payload with the microvesicles is assessed.
- the payload may be polypeptides, nucleic acids (e.g., mRNA or microRNA) or other biological entities as desired.
- nucleic acids e.g., mRNA or microRNA
- Such assessment is used to characterize a phenotype as described herein, e.g., to diagnose, prognose or theranose a cancer.
- flow sorting is used to distinguish microvesicle populations from other biological complexes.
- Ago2+/Tet+ and Ago2+/Tet- particles are detected using flow methodology to separate Ago2+ vesicles from vesicle-free Ago2+ complexes, respectively.
- Multiplex experiments comprise experiments that can simultaneously measure multiple analytes in a single assay. Vesicles and associated biomarkers can be assessed in a multiplex fashion. Different binding agents can be used for multiplexing different circulating biomarkers, e.g., microRNA, protein, or vesicle populations. Different biomarkers, e.g., different vesicle populations, can be isolated or detected using different binding agents. Each population in a biological sample can be labeled with a different circulating biomarkers, e.g., microRNA, protein, or vesicle populations. Different biomarkers, e.g., different vesicle populations, can be isolated or detected using different binding agents. Each population in a biological sample can be labeled with a different binding agents.
- signaling label such as a fluorophore, quantum dot, or radioactive label, such as described above.
- the label can be directly conjugated to a binding agent or indirectly used to detect a binding agent that binds a vesicle.
- the number of populations detected in a multiplexing assay is dependent on the resolution capability of the labels and the summation of signals, as more than two differentially labeled vesicle populations that bind two or more affinity elements can produce summed signals.
- Multiplexing of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 50, 75 or 100 different circulating biomarkers may be performed.
- one population of vesicles specific to a cell-of-origin can be assayed along with a second population of vesicles specific to a different cell-of- origin, where each population is labeled with a different label.
- a population of vesicles with a particular biomarker or biosignature can be assayed along with a second population of vesicles with a different biomarker or biosignature.
- hundreds or thousands of vesicles are assessed in a single assay.
- multiplex analysis is performed by applying a plurality of vesicles comprising more than one population of vesicles to a plurality of substrates, such as beads.
- Each bead is coupled to one or more capture agents.
- the plurality of beads is divided into subsets, where beads with the same capture agent or combination of capture agents form a subset of beads, such that each subset of beads has a different capture agent or combination of capture agents than another subset of beads.
- the beads can then be used to capture vesicles that comprise a component that binds to the capture agent.
- the different subsets can be used to capture different populations of vesicles.
- the captured vesicles can then be analyzed by detecting one or more biomarkers.
- Flow cytometry can be used in combination with a particle-based or bead based assay.
- Multiparametric immunoassays or other high throughput detection assays using bead coatings with cognate ligands and reporter molecules with specific activities consistent with high sensitivity automation can be used.
- beads in each subset can be differentially labeled from another subset.
- a binding agent or capture agent for a vesicle such as a capture antibody
- a binding agent for each individual binding assay can be coupled to a distinct type of microsphere (i.e., microbead) and the binding assay reaction takes place on the surface of the
- Microspheres can be distinguished by different labels, for example, a microsphere with a specific capture agent would have a different signaling label as compared to another microsphere with a different capture agent.
- microspheres can be dyed with discrete fluorescence intensities such that the fluorescence intensity of a microsphere with a specific binding agent is different than that of another microsphere with a different binding agent. Biomarkers bound by different capture agents can be differentially detected using different labels.
- a microsphere can be labeled or dyed with at least 2 different labels or dyes.
- the microsphere is labeled with at least 3, 4, 5, 6, 7, 8, 9, or 10 different labels.
- Different microspheres in a plurality of microspheres can have more than one label or dye, wherein various subsets of the microspheres have various ratios and combinations of the labels or dyes permitting detection of
- microspheres with different binding agents.
- the various ratios and combinations of labels and dyes can permit different fluorescent intensities.
- the various ratios and combinations maybe used to generate different detection patters to identify the binding agent.
- the microspheres can be labeled or dyed externally or may have intrinsic fluorescence or signaling labels. Beads can be loaded separately with their appropriate binding agents and thus, different vesicle populations can be isolated based on the different binding agents on the differentially labeled
- microspheres to which the different binding agents are coupled.
- multiplex analysis can be performed using a planar substrate, wherein the substrate comprises a plurality of capture agents.
- the plurality of capture agents can capture one or more populations of vesicles, and one or more biomarkers of the captured vesicles detected.
- the planar substrate can be a microarray or other substrate as further described herein.
- a vesicle may be isolated or detected using a binding agent for a novel component of a vesicle, such as an antibody for a novel antigen specific to a vesicle of interest.
- Novel antigens that are specific to a vesicle of interest may be isolated or identified using different test compounds of known composition bound to a substrate, such as an array or a plurality of particles, which can allow a large amount of chemical/structural space to be adequately sampled using only a small fraction of the space.
- the novel antigen identified can also serve as a biomarker for the vesicle.
- a novel antigen identified for a cell-of-origin specific vesicle can be a useful biomarker.
- agent or "reagent” as used in respect to contacting a sample can mean any entity designed to bind, hybridize, associate with or otherwise detect or facilitate detection of a target molecule, including target polypeptides, peptides, nucleic acid molecules, leptins, lipids, or any other biological entity that can be detected as described herein or as known in the art.
- agents/reagents are well known in the art, and include but are not limited to universal or specific nucleic acid primers, nucleic acid probes, antibodies, aptamers, peptoid, peptide nucleic acid, locked nucleic acid, lectin, dendrimer, chemical compound, or other entities described herein or known in the art.
- a binding agent can be identified by screening either a homogeneous or heterogeneous vesicle population against test compounds. Since the composition of each test compound on the substrate surface is known, this constitutes a screen for affinity elements.
- a test compound array comprises test compounds at specific locations on the substrate addressable locations, and can be used to identify one or more binding agents for a vesicle.
- the test compounds can all be unrelated or related based on minor variations of a core sequence or structure.
- the different test compounds may include variants of a given test compound (such as polypeptide isoforms), test compounds that are structurally or
- compositionally unrelated or a combination thereof.
- a test compound can be a peptoid, polysaccharide, organic compound, inorganic compound, polymer, lipids, nucleic acid, polypeptide, antibody, protein, polysaccharide, or other compound.
- the test compound can be natural or synthetic.
- the test compound can comprise or consist of linear or branched heteropolymeric compounds based on any of a number of linkages or combinations of linkages (e.g.,
- test compound can be spotted on a substrate or synthesized in situ, using standard methods in the art.
- test compound can be spotted or synthesized in situ in combinations in order to detect useful interactions, such as cooperative binding.
- the test compound can be a polypeptide with known amino acid sequence, thus, detection of a test compound binding with a vesicle can lead to identification of a polypeptide of known amino sequence that can be used as a binding agent.
- a homogenous population of vesicles can be applied to a spotted array on a slide containing between a few and 1,000,000 test polypeptides having a length of variable amino acids.
- the polypeptides can be attached to the surface through the C-terminus.
- the sequence of the polypeptides can be generated randomly from 19 amino acids, excluding cysteine.
- the binding reaction can include a non-specific competitor, such as excess bacterial proteins labeled with another dye such that the specificity ratio for each polypeptide binding target can be determined.
- a non-specific competitor such as excess bacterial proteins labeled with another dye such that the specificity ratio for each polypeptide binding target can be determined.
- the polypeptides with the highest specificity and binding can be selected. The identity of the polypeptide on each spot is known, and thus can be readily identified.
- homogeneous vesicle population such as a cell-of-origin specific vesicle is identified, such cell-of-origin specific vesicles may subsequently be isolated using such antigens in methods described hereafter.
- An array can also be used for identifying an antibody as a binding agent for a vesicle.
- Test antibodies can be attached to an array and screened against a heterogeneous population of vesicles to identify antibodies that can be used to isolate or identify a vesicle.
- a homogeneous population of vesicles such as cell-of-origin specific vesicles can also be screened with an antibody array.
- Other than identifying antibodies to isolate or detect a homogeneous population of vesicles, one or more protein biomarkers specific to the homogenous population can be identified.
- Commercially available platforms with test antibodies pre-selected or custom selection of test antibodies attached to the array can be used.
- an antibody array from Full Moon Biosystems can be screened using prostate cancer cell derived vesicles identifying antibodies to Bcl-XL, ERCC1, Keratin 15, CD81/TAPA-1, CD 9, Epithelial Specific Antigen (ESA), and Mast Cell Chymase as binding agents, and the proteins identified can be used as biomarkers for the vesicles.
- the biomarker can be present or absent, underexpressed or overexpressed, mutated, or modified in or on a vesicle and used in characterizing a condition.
- An antibody or synthetic antibody to be used as a binding agent can also be identified through a peptide array.
- Another method is the use of synthetic antibody generation through antibody phage display.
- Ml 3 bacteriophage libraries of antibodies e.g. Fabs
- Fabs antibodies
- Each phage particle displays a unique antibody and also encapsulates a vector that contains the encoding DNA.
- Highly diverse libraries can be constructed and represented as phage pools, which can be used in antibody selection for binding to immobilized antigens.
- Antigen-binding phages are retained by the immobilized antigen, and the nonbinding phages are removed by washing.
- the retained phage pool can be amplified by infection of an Escherichia coli host and the amplified pool can be used for additional rounds of selection to eventually obtain a population that is dominated by antigen-
- phase display and other methods known in the art, high affinity designer antibodies for vesicles can be generated.
- Bead-based assays can also be used to identify novel binding agents to isolate or detect a vesicle.
- a test antibody or peptide can be conjugated to a particle.
- a bead can be conjugated to an antibody or peptide and used to detect and quantify the proteins expressed on the surface of a population of vesicles in order to discover and specifically select for novel antibodies that can target vesicles from specific tissue or tumor types.
- Any molecule of organic origin can be successfully conjugated to a polystyrene bead through use of a commercially available kit according to manufacturer's instructions.
- Each bead set can be colored a certain detectable wavelength and each can be linked to a known antibody or peptide which can be used to specifically measure which beads are linked to exosomal proteins matching the epitope of previously conjugated antibodies or peptides.
- the beads can be dyed with discrete fluorescence intensities such that each bead with a different intensity has a different binding agent as described above.
- a purified vesicle preparation can be diluted in assay buffer to an appropriate concentration according to empirically determined dynamic range of assay.
- a sufficient volume of coupled beads can be prepared and approximately 1 ⁇ of the antibody-coupled beads can be aliqouted into a well and adjusted to a final volume of approximately 50 ⁇ .
- the beads can be washed to ensure proper binding conditions.
- An appropriate volume of vesicle preparation can then be added to each well being tested and the mixture incubated, such as for 15- 18 hours.
- a sufficient volume of detection antibodies using detection antibody diluent solution can be prepared and incubated with the mixture for 1 hour or more.
- the beads can then be washed before the addition of detection antibody (biotin expressing) mixture composed of streptavidin phycoereythin.
- detection antibody biotin expressing
- the beads can then be washed and vacuum aspirated several times before analysis on a suspension array system using software provided with an instrument.
- the identity of antigens that can be used to selectively extract the vesicles can then be elucidated from the analysis.
- Assays using imaging systems can be used to detect and quantify proteins expressed on the surface of a vesicle in order to discover and specifically select for and enrich vesicles from specific tissue, cell or tumor types.
- Antibodies, peptides or cells conjugated to multiple well multiplex carbon coated plates can be used. Simultaneous measurement of many analytes in a well can be achieved through the use of capture antibodies arrayed on the patterned carbon working surface. Analytes can then be detected with antibodies labeled with reagents in electrode wells with an enhanced electro-chemiluminescent plate. Any molecule of organic origin can be successfully conjugated to the carbon coated plate. Proteins expressed on the surface of vesicles can be identified from this assay and can be used as targets to specifically select for and enrich vesicles from specific tissue or tumor types.
- the binding agent can also be an aptamer to a specific target.
- the term "specific" as used herein in regards to a binding agent can mean that an agent has a greater affinity for its target than other targets,
- the methods for isolating or identifying vesicles can be used in combination with microfluidic devices.
- the methods of isolating or detecting a vesicle, such as described herien, can be performed using a microfluidic device.
- Microfluidic devices which may also be referred to as "lab-on-a-chip” systems, biomedical micro-electro-mechanical systems (bioMEMs), or multicomponent integrated systems, can be used for isolating and analyzing a vesicle.
- Such systems miniaturize and compartmentalize processes that allow for binding of vesicles, detection of biosignatures, and other processes.
- a microfluidic device can also be used for isolation of a vesicle through size differential or affinity selection.
- a microfluidic device can use one more channels for isolating a vesicle from a biological sample based on size or by using one or more binding agents for isolating a vesicle from a biological sample.
- a biological sample can be introduced into one or more microfluidic channels, which selectively allows the passage of a vesicle. The selection can be based on a property of the vesicle, such as the size, shape, deformability, or biosignature of the vesicle.
- a heterogeneous population of vesicles can be introduced into a microfluidic device, and one or more different homogeneous populations of vesicles can be obtained.
- different channels can have different size selections or binding agents to select for different vesicle populations.
- a microfluidic device can isolate a plurality of vesicles wherein at least a subset of the plurality of vesicles comprises a different biosignature from another subset of the plurality of vesicles.
- the microfluidic device can isolate at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 different subsets of vesicles, wherein each subset of vesicles comprises a different biosignature.
- the microfluidic device can comprise one or more channels that permit further enrichment or selection of a vesicle.
- a population of vesicles that has been enriched after passage through a first channel can be introduced into a second channel, which allows the passage of the desired vesicle or vesicle population to be further enriched, such as through one or more binding agents present in the second channel.
- Array-based assays and bead-based assays can be used with microfluidic device.
- the binding agent can be coupled to beads and the binding reaction between the beads and vesicle can be performed in a microfluidic device. Multiplexing can also be performed using a microfluidic device. Different compartments can comprise different binding agents for different populations of vesicles, where each population is of a different cell-of-origin specific vesicle population. In one embodiment, each population has a different biosignature.
- the hybridization reaction between the microsphere and vesicle can be performed in a microfluidic device and the reaction mixture can be delivered to a detection device.
- the detection device such as a dual or multiple laser detection system can be part of the microfluidic system and can use a laser to identify each bead or microsphere by its color-coding, and another laser can detect the hybridization signal associated with each bead.
- biomarkers such as vesicles can be combined as desired.
- a biological sample can be treated to prevent aggregation, remove undesired particulate and/or deplete highly abundant proteins.
- the steps used can be chosen to optimize downstream analysis steps.
- biomarkers such as vesicles can be isolated, e.g., by chromotography, centrifugation, density gradient, filtration, precipitation, or affinity techniques.
- any number of the later steps can be combined, e.g., a sample could be subjected to one or more of chromotography, centrifugation, density gradient, filtration and precipitation in order to isolate or concentrate all or most microvesicles.
- affinity techniques e.g., using binding agents to one or more target of interest, can be used to isolate or identify microvesicles carrying desired biomarker profiles.
- Microfluidic systems can be employed to perform some or all of these steps.
- An exemplary yet non- limiting isolation scheme for isolating and analysis of microvesicles includes the following: Plasma or serum collection -> highly abundant protein removal -> ultrafiltration - > nanomembrane concentration -> flow cytometry or particle-based assay.
- circulating biomarkers such as vesicles can be isolated or concentrated by at least about 2-fold, 3-fold, 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6- fold, 7-fold, 8-fold, 9-fold, 10-fold, 12-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold, 40-fold, 45-fold, 50-fold, 55-fold, 60-fold, 65-fold, 70-fold, 75-fold, 80-fold, 90-fold, 95-fold, 100-fold, 1 10-fold, 120-fold, 125-fold, 130-fold, 140-fold, 150-fold, 160-fold, 170-fold, 175-fold , 180-fold, 190-fold, 200-fold, 225- fold, 250-fold, 275-fold, 300-fold, 325-fold, 350-fold, 375-fold, 400-fold, 425-fold, 450-fold, 475-fold, 500-fold,
- the vesicles are isolated or concentrated concentrated by at least 1 order of magnitude, 2 orders of magnitude, 3 orders of magnitude, 4 orders of magnitude, 5 orders of magnitude, 6 orders of magnitude, 7 orders of magnitude, 8 orders of magnitude, 9 orders of magnitude, or 10 orders of magnitude or more.
- the circulating biomarkers can be assessed, e.g., in order to characterize a phenotype as described herein.
- the concentration or isolation steps themselves shed light on the phenotype of interest.
- affinity methods can detect the presence or level of specific biomarkers of interest.
- isolation and detection systems described herein can be used to isolate or detect circulating biomarkers such as vesicles that are informative for diagnosis, prognosis, disease stratification, theranosis, prediction of responder / non-responder status, disease monitoring, treatment monitoring and the like as related to such diseases and disorders. Combinations of the isolation techniques are within the scope of the invention.
- a sample can be run through a chromatography column
- Binding agents can be used before, during or after these steps.
- an aptamer provided by the methods of the invention can be used as a capture and/or detector agent for a biomarker such as a protein or microvesicle; a sample such as a bodily fluid can be contacted with an oligonucleotide probe library of the invention before microvesicles in the sample are isolated using one or more technique described herein (e.g., chromatography, centrifugation, flow cytometry, filtration, affinity isolation, polymer precipitation, etc); microvesicles in a sample are isolated using one or more technique described herein (e.g., chromatography, centrifugation, flow cytometry, filtration, affinity isolation, polymer precipitation, etc) before contacting the microvesicles with an aptamer or oligonucleotide probe library of the invention.
- Contaminants such as highly abundant proteins can be used as a biomarker such as a protein or microvesicle.
- the methods and compositions of the invention can be used in assays to detect the presence or level of one or more biomarker of interest.
- the biomarker can be any useful biomarker disclosed herein or known to those of skill in the art.
- the biomarker comprises a protein or polypeptide.
- protein protein
- polypeptide and “peptide” are used interchangeably unless stated otherwise.
- the biomarker can be a nucleic acid, including DNA, RNA, and various subspecies of any thereof as disclosed herein or known in the art.
- the biomarker can comprise a lipid.
- the biomarker can comprise a carbohydrate.
- the biomarker can also be a complex, e.g., a complex comprising protein, nucleic acids, lipids and/or carbohydrates.
- the biomarker comprises a microvesicle.
- the invention provides a method wherein a pool of aptamers is used to assess the presence and/or level of a population of microvesicles of interest without knowing the precise microvesicle antigen targeted by each member of the pool. See, e.g., FIGs. 16B-C.
- biomarkers associated with microvesicles are assessed according to the methods of the invention. See, e.g., FIGs. 2A-2F; FIG. 16A.
- a biosignature comprising more than one biomarker can comprise one type of biomarker or multiple types of biomarkers.
- a biosignature can comprise multiple proteins, multiple nucleic acids, multiple lipids, multiple carbohydrates, multiple biomarker complexes, multiple microvesicles, or a combination of any thereof.
- the biosignature may comprise one or more microvesicle, one or more protein, and one or more microRNA, wherein the one or more protein and/or one or more microRNA is optionally in association with the microvesicle as a surface antigen and/or payload, as appropriate.
- vesicles are detected using vesicle surface antigens.
- a commonly expressed vesicle surface antigen can be referred to as a "housekeeping protein," or general vesicle biomarker.
- the biomarker can be CD63, CD9, CD81, CD82, CD37, CD53, Rab-5b, Annexin V or MFG-
- Tetraspanins a family of membrane proteins with four transmembrane domains, can be used as general vesicle biomarkers.
- the tetraspanins include CD151, CD53, CD37, CD82, CD81, CD9 and CD63.
- TSPAN1 TSPAN1
- TSPAN2 TSPAN-2
- TSPAN3 TSPAN-3
- TSPAN4 TSPAN-4, NAG-2
- TSPAN5 TSPAN-5
- TSPAN6 TSPAN-6
- TSPAN7 CD231, TALLA-1, A15
- TSPAN8 CO-029
- TSPAN10 Oculospanin
- TSPAN1 1 CD151-like
- TSPAN12 NET-2
- TSPAN13 NET-6
- TSPAN14 TSPAN15
- TSPAN16 TSPAN16
- TSPAN17 TSPAN18
- TSPAN19 TSPAN20
- UPK1B UPK1B
- TSPAN21 UPla, UPK1A
- TSPAN22 RS, PRPH2
- TSPAN23 ROM1
- TSPAN24 CD 151
- TSPAN25 CD53
- CDH19 cadherin 19, type 2
- CDH20 cadherin 20, type 2
- CDH23 CDH23
- CDH10 CDH1 1 , CDH13, CDH15, CDH16, CDH17, CDH18, CDH19, CDH20, CDH22, CDH23, CDH24, CDH26, CDH28, CDH4, CDH5, CDH6, CDH7, CDH8, CDH9, CELSR1 , CELSR2, CELSR3, CLSTN1 , CLSTN2, CLSTN3, DCHS 1 ,
- biomarkers described herein can be used and/or assessed via the subject methods and compositions.
- exemplary biomarkers include without limitation those in Table 4.
- the markers can be detected as protein or as mRNA, which can be circulating freely or in a complex with other biological molecules.
- the markers in Table 4 can also be used for capture and/or detection of vesicles for characterizing phenotypes as disclosed herein. In some cases, multiple capture and/or detectors are used to enhance the characterization. See, e.g., FIGs. 2D-E.
- the markers can be detected as vesicle surface antigens and/or vesicle payload.
- the "Illustrative Class" indicates indications for which the markers are known markers.
- markers can also be used in alternate settings in certain instances.
- a marker which can be used to characterize one type disease may also be used to characterize another disease as appropriate.
- a tumor marker which can be used as a biomarker for tumors from various lineages.
- the biomarker references in Table 4 are those commonly used in the art. Gene aliases and descriptions can be found using a variety of online databases, including GeneCards® (www.genecards.org), HUGO Gene
- Ensembl www.ensembl.org
- gene symbols and names below correspond to those approved by HUGO
- protein names are those recommended by UniProtKB/Swiss-Prot. Common alternatives are provided as well.
- biomarkers are referred to by Ensembl reference numbers, which are of the form "ENSG” followed by a number, e.g., ENSG00000005893 which corresponds to LAMP2.
- Lymphotoxin Beta Receptor LYN, MET, MGMT, MLH1, MMR, MRP1, MS4A1, MSH2, MSH5, Myc, NFKB1, NFKB2, NFKBIA, NRAS, ODC1, OGFR, pi 6, p21, p27, p53, p95, PARP-1, PDGFC, PDGFR, PDGFRA, PDGFRB, PGP, PGR, PI3K, POLA, POLA1, PPARG, PPARGC1, PR, PTEN, PTGS2, PTPN12, RAF1, RARA, ROSl, RRM1, RRM2, RRM2B, RXRB, RXRG, SIK2, SPARC, SRC, SSTR1, SSTR2, SSTR3, SSTR4, SSTR5, Survivin, TK1, TLE3, TNF, TOPI, TOP2A, TOP2B, TS, TUBB3, TXN, TX
- HER2 HER2
- ERBB4 ERCCl
- FBXW7 FGFR1, FGFR2, FLT3, GNAl 1, GNAQ, GNAS, HER2, HNF1A, HRAS, IDHl, IDH2, JAK2, JAK3, KDR (VEGFR2), KRAS, MGMT, MGMT Promoter Methylation, microsatellite instability (MSI), MLH1, MPL, MSH2, MSH6, NOTCH 1, NPM1, NRAS, PD-1, PDGFRA, PD-L1, Pgp, PIK3CA, PMS2, PR, PTEN, PTPN11, RBI, RET, ROSl, RRM1, SMAD4, SMARCB1, SMO, SPARC, STK11, TLE3, TOP2A, TOPOl, TP53, TS, TUBB3, VHL
- Drug associated lpl9q co-deletion ABL1, AKT1, ALK, APC, AR, ARAF, ATM, BAPl, BRAF, targets BRCA1, BRCA2, CDH1, CHEK1, CHEK2, cKIT, cMET, CSF1R, CTNNB1,
- HER2 HER2
- ERBB4 ERCCl
- FBXW7 FGFR1, FGFR2, FLT3, GNAl 1, GNAQ, GNAS, HER2, HNF1A, HRAS, IDHl, IDH2, JAK2, JAK3, KDR (VEGFR2), KRAS, MGMT, MGMT Promoter Methylation, microsatellite instability (MSI), MLH1, MPL, MSH2, MSH6, NOTCH 1, NPM1, NRAS, PD-1, PDGFRA, PD-L1, Pgp, PIK3CA, PMS2, PR, PTEN, PTPN11, RBI, RET, ROSl, RRM1, SMAD4, SMARCB1, SMO, SPARC, STK11, TLE3, TOP2A, TOPOl, TP53, TS, TUBB3, VHL
- Drug associated TOP2A Chromosome 17 alteration, PBRMl (PB1/BAF180), BAPl, SETD2 (ANTI- targets HI STONE H3), MDM2, Chromosome 12 alteration, ALK, CTLA4, CD3, NY-ESO- 1 , MAGE-A, TP, EGFR
- Cancer treatment AR AREG (Amphiregulin), BRAF, BRCA1, cKIT, cMET, EGFR, EGFR associated w/T790M, EML4-ALK, ER, ERBB3, ERBB4, ERCCl, EREG, GNAl 1, GNAQ, markers hENT-1, Her2, Her2 Exon 20 insert, IGF1R, Ki67, KRAS, MGMT, MGMT, MGMT
- HSP90 IDH1, IDH2, IGF1R, IKBKE, IKZF1, IL13RA1, IL2, IL2RA (CD25), IL7R, INHBA, IRF4, IRS2, JAKl, JAK2, JAK3, JUN, KAT6A (MYST3), KDM5A, KDM5C, KDM6A, KDR (VEGFR2), KEAP1, KIT, KLHL6, KRAS, LCK, LRP1B, LTB, LTBR, MAP2K1, MAP2K2, MAP2K4, MAP3K1, MAPK, MCL1, MDM2, MDM4, MED 12, MEF2B, MEN1, MET, MGMT, MITF, MLH1, MLL, MLL2, MPL, MRE1 1A, MS4A1 (CD20), MSH2, MSH6, MTAP, MTOR, MUTYH, MYC, MYCL1, MYCN, MYD88, NF1, NF2, NFE
- TNFRSF14 TOPI, TOP2, TOP2A, TOP2B, TP53, TS, TSC1, TSC2, TSHR, TUBB3, TXN, TYMP, VDR, VEGF (VEGFA), VEGFC, VHL, WISP3, WTl, XDH, XPOl, YES1, ZAP70, ZNF217, ZNF703
- CYTH4 cytohesin-4
- Tissue (Breast) BIG H3, GCDFP-15, PR(B), GPR 30, CYFRA 21, BRCA 1, BRCA 2, ESR 1, ESR2
- HSPA8 Common vesicle HSPA8, CD63, Actb, GAPDH, CD9, CD81, ANXA2, HSP90AA1, ENOl, markers YWHAZ, PDCD6IP, CFLl, SDCBP, PKN2, MSN, MFGE8, EZR, YWHAG, PGKl,
- RAB1 1B PIGR, LGALS3, ITGB 1, EHD1, CLIC1, ATP1A1, ARF1, RAP1A, P4HB, MUC1, KRT10, HLA-A, FLOT1, CD59, Clorf58, BASP1, TACSTD1, STOM
- ANXAl LAMP2, DPP4, TSG101, HSPA1A, GDI2, CLTC, LAMP1, Cd86, ANPEP, TFRC, SLC3A2, RDX, RAP IB, RAB5C, RAB5B, MYH9, AMI, FN1, RAB1 1B, PIGR, LGALS3, ITGB 1, EHD1, CLIC1, ATP1A1, ARF1, RAP1A, P4HB, MUC1, KRT10, HLA-A, FLOT1, CD59, Clorf58, BASP1, TACSTD1, STOM
- Prostate Cancer FLNA DCRN, HER 3 (ErbB3), VCAN, CD9, GAL3, CDADC1, GM-CSF, EGFR, Vesicle Markers RANK, CSA, PSMA, ChickenlgY, B7H3, PCSA, CD63, CD3, MUC1, TGM2,
- Prostate Cancer NT5E CD73
- A33 ABL2
- ADAM 10 AFP
- ALA ALIX
- ALPL ALPL
- AMACR Apo Vesicle Markers J/CLU
- ASCA ASCA
- ASPH A- 10
- ASPH D01P
- AURKB B7H3, B7H4, BCNP
- BDNF CA125 (MUC16), CA-19-9, C-Bir (Flagellin), CD 10, CD151, CD24, CD3, CD41, CD44, CD46, CD59(MEM-43), CD63, CD66e CEA, CD81, CD9, CD A, CDADC1, C-erbB2, CRMP-2, CRP, CSA, CXCL12, CXCR3, CYFRA21 - 1 , DCRN, DDX- 1, DLL4, EGFR, EpCAM, EphA2, ERG, EZH2, FASL, FLNA, FRT, GAL3, GATA2, GM-CSF, Gro-alpha, HAP, HER3 (ErbB3), HSP70, HSPB 1, hVEGFR2, iC3b, IL-1B, IL6 R, IL6 Unc, IL7 R alpha/CD 127, IL8, INSIG-2, Integrin, KLK2, Label, LAMN, Mammaglobin, M-CSF,
- CD283/TLR3, CD41, CD46, CD49d (Integrin alpha 4, ITGA4), CD63, CD81, CD 9, CD90/THY1, CDH1, CDH2, CDKN1A cyclin-dependent kinase inhibitor (p21), CGA gene (coding for the alpha subunit of glycoprotein hormones), CLDN3- Claudin3, COX2 (PTGS2), CSE1L (Cellular Apoptosis Susceptibility), CXCR3, Cytokeratin 18, Eagl (KCNH1), EDIL3 (del-1), EDNRB - Endothelial Receptor Type B, EGFR, EpoR, EZH2 (enhancer of Zeste Homolog2), EZR, FABP5,
- GGPS1 Farnesyltransferase/geranylgeranyl diphosphate synthase 1
- Fatty acid synthase (FASN) Fatty acid synthase (FASN), FTL (light and heavy)
- GAL3, GDF15-Growth Differentiation Factor 15, Glol GM-CSF, GSTP1, H3F3A, HGF (hepatocyte growth factor), hK2 / Kif2a, HSP90AA1, HSPA1A / HSP70-1, HSPB 1, IGFBP-2, IGFBP-3, ILlalpha, IL- 6, IQGAP1, ITGAL (Integrin alpha L chain), Ki67, KLK1, KLK10, KLK1 1, KLK12, KLK13, KLK14, KLK15, KLK4, KLK5, KLK6, KLK7, KLK8, KLK9, Lamp-2, LDH-A, LGALS3BP, LGALS8, MMP 1, MMP 2, MMP 25, MMP 3,
- BDKRB2 CA215, CAVl-Caveolinl, CCR2 (CC chemokine receptor 2, CD192), CCR5 (CC chemokine receptor 5), CCT2 (TCP 1 -beta), CD 166/ALCAM, CD49b (Integrin alpha 2, ITGA4), CD90/THY1, CDH1, CDH2, CDKN1A cyclin-dependent kinase inhibitor (p21), CGA gene (coding for the alpha subunit of glycoprotein hormones), CHMP4B, CLDN3- Claudin3, CLSTN1 (Calsyntenin-1), COX2
- KCNH1 plasma membrane-K+-voltage gated channel
- EDIL3 del- 1
- EDNRB- Endothelial Receptor Type B Endoglin/CD105
- ENOX2 - Ecto-NOX disulphide Thiol exchanger 2 EPCA-2 Early prostate cancer antigen2, EpoR, EZH2 (enhancer of Zeste Homolog2), EZR, FABP5, Farnesyltransferase/geranylgeranyl diphosphate synthase 1 (GGPS1), Fatty acid synthase (FASN, plasma membrane protein), FTL (light and heavy), GDF15-Growth Differentiation Factor 15, Glol, GSTP1, H3F3A, HGF (hepatocyte growth factor), hK2 (KLK2), HSP90AA1, HSPA1A / HSP70- 1, IGFBP-2, IGFBP-3, IL1 alpha, IL-6, IQGAP1, ITGAL (Integrin alpha L chain
- CD284 TLR9 (CD289), TMPRSS1 / hepsin, TMPRSS2, TNFR1, TNFa,
- CD283/TLR3 Transferrin receptor/CD71/TRFR, uPA (urokinase plasminoge activator) , uPAR (uPA receptor) / CD87, VEGFR1, VEGFR2
- Prostate PCSA+ miR- 182, miR-663, miR-155, mirR-125a-5p, miR-548a-5p, miR-628-5p, miR-517*, cMVs
- miR-450a miR-920, hsa-miR-619, miR-1913, miR-224*, miR-502-5p, miR-888, miR-376a, miR-542-5p, miR-30b*, miR-1 179
- Prostate Cancer miR- 183-96- 182 cluster (miRs- 183, 96 and 182), metal ion transporter such as
- Prostate Cancer RAD23B FBP1, TNFRSF1A, NOTCH3, ETV1, BID, SIM2, ANXA1, BCL2
- GZMH HIST1H3B, HLA-A, HSP90AA1, NRGN, PRDX5, PTMA, RABAC1, RABAGAP1L, RPL22, SAP 18, SEPW1, SOX1
- PDGFRB PIM1, PRL, PSA, PSA, PSMA, PSMA, RAGE, RANK, ReglV, RUNX2, S 100-A4, seprase/FAP, SERPINB3, SIM2(C-15), SPARC, SPC, SPDEF, SPP1, STEAP, STEAP4, TFF3, TGM2, TIMP-1, TMEM21 1, Trail-R2, Trail-R4,
- Prostate Cancer miR- 148a miR-329, miR-9, miR-378*, miR-25, miR-614, miR-518c*, miR-378, miR-765, let-7f-2*, miR-574-3p, miR-497, miR-32, miR-379, miR-520g, miR-542- 5p, miR-342-3p, miR-1206, miR-663, miR-222
- miR-888 Inflammatory miR-588, miR- 1258, miR-16-2*, miR-938, miR-526b, miR-92b*, let-7d, miR-378*, Disease miR- 124, miR-376c, miR-26b, miR-1204, miR-574-3p, miR-195, miR-499-3p, miR- 21 10, miR-888
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Analytical Chemistry (AREA)
- Pathology (AREA)
- Biophysics (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Cell Biology (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Crystallography & Structural Chemistry (AREA)
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201480063091.1A CN105980615A (zh) | 2013-08-28 | 2014-08-28 | 寡核苷酸探针及其用途 |
| BR112016004153A BR112016004153A2 (pt) | 2013-08-28 | 2014-08-28 | "método para caracterizar uma doença ou distúrbio, kit, composição, método para gerar uma biblioteca de entrada, oligonucleotídeo, pluralidade de oligonucleotídeos e método para identificar um aptâmero |
| CA2922689A CA2922689A1 (en) | 2013-08-28 | 2014-08-28 | Oligonucleotide probes and uses thereof |
| AU2014312211A AU2014312211A1 (en) | 2013-08-28 | 2014-08-28 | Oligonucleotide probes and uses thereof |
| US14/915,249 US20160319361A1 (en) | 2013-08-28 | 2014-08-28 | Oligonucleotide probes and uses thereof |
| EP14840036.9A EP3039174B1 (en) | 2013-08-28 | 2014-08-28 | Oligonucleotide probes and uses thereof |
| JP2016537869A JP2016533752A (ja) | 2013-08-28 | 2014-08-28 | オリゴヌクレオチドプローブおよびその使用 |
| KR1020167007928A KR20160080815A (ko) | 2013-08-28 | 2014-08-28 | 올리고뉴클레오티드 프로브 및 이의 용도 |
| IL244236A IL244236A0 (en) | 2013-08-28 | 2016-02-22 | Oligonucleotide probes and their uses |
| AU2019200115A AU2019200115A1 (en) | 2013-08-28 | 2019-01-09 | Oligonucleotide probes and uses therof |
| IL26969319A IL269693A (en) | 2013-08-28 | 2019-09-26 | Oligonucleotide probes and their uses |
| US16/936,618 US20210062270A1 (en) | 2013-08-28 | 2020-07-23 | Oligonucleotide probes and uses thereof |
Applications Claiming Priority (20)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361871107P | 2013-08-28 | 2013-08-28 | |
| US61/871,107 | 2013-08-28 | ||
| US201361874621P | 2013-09-06 | 2013-09-06 | |
| US61/874,621 | 2013-09-06 | ||
| US201361900975P | 2013-11-06 | 2013-11-06 | |
| US61/900,975 | 2013-11-06 | ||
| US201361912471P | 2013-12-05 | 2013-12-05 | |
| US61/912,471 | 2013-12-05 | ||
| US201461924192P | 2014-01-06 | 2014-01-06 | |
| US61/924,192 | 2014-01-06 | ||
| US201461949216P | 2014-03-06 | 2014-03-06 | |
| US61/949,216 | 2014-03-06 | ||
| US201461974949P | 2014-04-03 | 2014-04-03 | |
| US61/974,949 | 2014-04-03 | ||
| US201461990085P | 2014-05-07 | 2014-05-07 | |
| US61/990,085 | 2014-05-07 | ||
| US201461994704P | 2014-05-16 | 2014-05-16 | |
| US61/994,704 | 2014-05-16 | ||
| US201462024436P | 2014-07-14 | 2014-07-14 | |
| US62/024,436 | 2014-07-14 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/915,249 A-371-Of-International US20160319361A1 (en) | 2013-08-28 | 2014-08-28 | Oligonucleotide probes and uses thereof |
| US16/936,618 Continuation US20210062270A1 (en) | 2013-08-28 | 2020-07-23 | Oligonucleotide probes and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2015031694A2 true WO2015031694A2 (en) | 2015-03-05 |
| WO2015031694A3 WO2015031694A3 (en) | 2015-06-04 |
Family
ID=52587490
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/053306 Ceased WO2015031694A2 (en) | 2013-08-28 | 2014-08-28 | Oligonucleotide probes and uses thereof |
Country Status (10)
| Country | Link |
|---|---|
| US (2) | US20160319361A1 (https=) |
| EP (1) | EP3039174B1 (https=) |
| JP (1) | JP2016533752A (https=) |
| KR (1) | KR20160080815A (https=) |
| CN (1) | CN105980615A (https=) |
| AU (2) | AU2014312211A1 (https=) |
| BR (1) | BR112016004153A2 (https=) |
| CA (1) | CA2922689A1 (https=) |
| IL (2) | IL244236A0 (https=) |
| WO (1) | WO2015031694A2 (https=) |
Cited By (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016145128A1 (en) | 2015-03-09 | 2016-09-15 | Caris Science, Inc. | Oligonucleotide probes and uses thereof |
| WO2016186853A1 (en) * | 2015-05-21 | 2016-11-24 | Indiana University Research & Technology Corporation | Methods of targeting ape1/ref-1 to inhibit hypoxia signaling genes |
| WO2017004243A1 (en) | 2015-06-29 | 2017-01-05 | Caris Science, Inc. | Therapeutic oligonucleotides |
| WO2017019918A1 (en) | 2015-07-28 | 2017-02-02 | Caris Science, Inc. | Targeted oligonucleotides |
| WO2017161357A1 (en) * | 2016-03-18 | 2017-09-21 | Caris Science, Inc. | Oligonucleotide probes and uses thereof |
| WO2017205686A1 (en) | 2016-05-25 | 2017-11-30 | Caris Science, Inc. | Oligonucleotide probes and uses thereof |
| WO2018081193A1 (en) * | 2016-10-25 | 2018-05-03 | Purdue Research Foundation | Conjugates for sensing |
| WO2018207024A1 (en) * | 2017-05-08 | 2018-11-15 | Augmanity Nano Ltd | Treatment of rapidly evolving biological entities |
| CN109414448A (zh) * | 2016-06-17 | 2019-03-01 | 豪夫迈·罗氏有限公司 | 用于减少PAPD5或PAPD7 mRNA治疗乙型肝炎感染的核酸分子 |
| EP3587589A1 (en) * | 2018-06-27 | 2020-01-01 | CS Genetics Limited | Reagents and methods for the analysis of circulating microparticles |
| WO2020020947A1 (en) * | 2018-07-26 | 2020-01-30 | Bracco Imaging Spa | Icam-1 aptamers, diagnostic and therapeutic uses thereof |
| US10564107B2 (en) | 2005-04-25 | 2020-02-18 | Trustees Of Boston University | Structured substrates for optical surface profiling |
| CN111684078A (zh) * | 2018-02-12 | 2020-09-18 | 豪夫迈·罗氏有限公司 | 通过评价肿瘤遗传异质性来预测对治疗的应答的方法 |
| US10928315B1 (en) | 2015-09-22 | 2021-02-23 | Trustees Of Boston University | Multiplexed phenotyping of nanovesicles |
| US10953034B2 (en) | 2017-10-16 | 2021-03-23 | Hoffmann-La Roche Inc. | Nucleic acid molecule for reduction of PAPD5 and PAPD7 mRNA for treating hepatitis B infection |
| CN112535886A (zh) * | 2020-11-12 | 2021-03-23 | 杭州苏铂科技有限公司 | 去除金纳米棒溶液中的ctab的方法 |
| US11262359B2 (en) | 2016-02-05 | 2022-03-01 | NanoView Biosciences, Inc. | Detection of exosomes having surface markers |
| US11279929B2 (en) | 2018-07-03 | 2022-03-22 | Hoffmann-La Roche, Inc. | Oligonucleotides for modulating Tau expression |
| CN115754293A (zh) * | 2022-11-07 | 2023-03-07 | 四川大学华西第二医院 | Vwf糖基化蛋白的检测试剂在制备筛查患肺癌风险的试剂盒中的用途 |
| US11859187B2 (en) | 2020-06-25 | 2024-01-02 | The Procter & Gamble Company | Aptamers for personal health care applications |
| US12510462B2 (en) | 2018-06-01 | 2025-12-30 | Unchained Labs | Compositions, systems, and methods for enhanced label-free and fluorescence-based detection of nanoparticles |
| EP4686766A1 (en) * | 2024-08-01 | 2026-02-04 | Siemens Healthineers AG | Biomarkers and methods for the early detection of hepatocellular carcinoma |
| WO2026074434A1 (en) * | 2024-10-01 | 2026-04-09 | Fondazione Istituto Italiano Di Tecnologia | Rad51/brca2 complex aptamers and uses thereof |
Families Citing this family (45)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4170031A1 (en) | 2012-10-23 | 2023-04-26 | Caris Science, Inc. | Aptamers and uses thereof |
| US10942184B2 (en) | 2012-10-23 | 2021-03-09 | Caris Science, Inc. | Aptamers and uses thereof |
| AU2013361323B2 (en) | 2012-12-19 | 2018-09-06 | Caris Science, Inc. | Compositions and methods for aptamer screening |
| PT3083997T (pt) * | 2013-12-20 | 2020-11-03 | Univ Lausanne | Utilizações diagnósticas, prognósticas e terapêuticas de rnas longos não codificadores para doenças cardíacas e medicina regenerativa |
| WO2016042202A1 (en) * | 2014-09-17 | 2016-03-24 | Wallac Oy | Method for determining the risk of preterm birth |
| WO2017112921A1 (en) * | 2015-12-24 | 2017-06-29 | The Arizona Board Of Regents On Behalf Of The University Of Arizona | Systems and methods for characterizing sepsis |
| EP3452591B1 (en) | 2016-05-02 | 2023-08-16 | Encodia, Inc. | Macromolecule analysis employing nucleic acid encoding |
| CA3042723A1 (en) * | 2016-11-02 | 2018-05-11 | Biois Co.,Ltd | Quantitative cluster analysis method of target protein by using next-generation sequencing and use thereof |
| US11408887B2 (en) | 2017-05-22 | 2022-08-09 | The National Institute for Biotechnology in the Negev Ltd. | Biomarkers for diagnosis of lung cancer |
| EP4276201A3 (en) | 2017-06-07 | 2024-01-17 | Gen-Probe Incorporated | Detecting babesia species nucleic acid in a sample |
| CN109251980A (zh) * | 2017-07-14 | 2019-01-22 | 中国人民解放军第八医院 | 膀胱癌组织t细胞图谱模型及其构建方法和构建系统 |
| JP2019020206A (ja) * | 2017-07-14 | 2019-02-07 | 株式会社島津製作所 | 質量分析を用いた認知機能障害疾患バイオマーカーの定量方法及び質量分析装置 |
| KR102243415B1 (ko) * | 2017-09-27 | 2021-04-22 | ㈜로제타엑소좀 | 크기 배제 크로마토그래피를 이용한 세포밖 소포체의 분석 방법 및 이의 용도 |
| JP7390027B2 (ja) | 2017-10-31 | 2023-12-01 | エンコディア, インコーポレイテッド | 核酸エンコーディングおよび/または標識を使用する解析のためのキット |
| CN108866215B (zh) * | 2017-12-01 | 2022-02-08 | 苏州百源基因技术有限公司 | 一种用于产气肠杆菌检测的实时荧光定量pcr试剂盒 |
| KR20210031927A (ko) * | 2018-07-17 | 2021-03-23 | 유니버시티 오브 워싱톤 | 압타머 기반 가역적 세포 선택과 관련된 조성물 및 방법 |
| US12331320B2 (en) | 2018-10-10 | 2025-06-17 | The Research Foundation For The State University Of New York | Genome edited cancer cell vaccines |
| US11608356B1 (en) * | 2019-02-22 | 2023-03-21 | Base Pair Biotechnologies, Inc. | Functional ligands to colistin |
| CN109880903B (zh) * | 2019-03-01 | 2021-12-14 | 南京医科大学 | 一种用于非小细胞肺癌辅助诊断的snp标志物及其应用 |
| CN113748217B (zh) * | 2019-03-01 | 2023-08-25 | 仁慈生物分析公司 | 用于靶实体检测的系统、组合物和方法 |
| CN110045099B (zh) * | 2019-04-01 | 2022-03-04 | 四川大学华西医院 | 一种慢性阻塞性肺疾病检测试剂盒 |
| MX2021012471A (es) * | 2019-04-11 | 2022-01-04 | Univ Arkansas | Aptameros de adn especificos de cd40 como adyuvantes de vacunas. |
| WO2020219923A1 (en) * | 2019-04-26 | 2020-10-29 | The Johns Hopkins University | Methods and materials for treating cancer |
| CN114072499B (zh) | 2019-04-30 | 2024-08-06 | Encodia公司 | 用于制备分析物的方法和相关试剂盒 |
| CN110412281B (zh) * | 2019-06-26 | 2022-09-09 | 四川大学华西医院 | Begain自身抗体检测试剂在制备肺癌筛查试剂盒中的用途 |
| WO2021076808A1 (en) * | 2019-10-15 | 2021-04-22 | Cornell University | Methods for detecting and inhibiting brain metastasis |
| WO2021183893A1 (en) * | 2020-03-13 | 2021-09-16 | The Translational Genomics Research Institute | Methods and kits for the detection of sars-cov-2 |
| JP2023525581A (ja) * | 2020-05-15 | 2023-06-16 | アレクシオン ファーマシューティカルズ, インコーポレイテッド | 補体の活性化を検出するための細胞外小胞の使用方法、並びに補体性疾患の処置を評価及び/又は監視するためのその使用 |
| CA3178255A1 (en) * | 2020-05-15 | 2021-11-18 | Krishna KANNAN | On demand synthesis of polynucleotide sequences |
| CN111621588A (zh) * | 2020-06-08 | 2020-09-04 | 华中农业大学 | 光亮果皮番茄品种选育的分子标记及其应用 |
| CN111830289B (zh) * | 2020-07-24 | 2023-01-03 | 长春理工大学 | 一种利用原子力显微术对生物素化抗体-IgE免疫复合物直接成像的方法 |
| WO2022032227A1 (en) * | 2020-08-07 | 2022-02-10 | The Board Of Trustees Of The University Of Arkansas | Nasal microbiome biomarkers for predicting the onset of bovine respiratory disease and treating the same |
| JP7623124B2 (ja) * | 2020-10-20 | 2025-01-28 | 大塚製薬株式会社 | 細胞外小胞の内包物の測定方法および測定キット |
| JP2024516096A (ja) | 2021-04-08 | 2024-04-12 | アローヘッド ファーマシューティカルズ インコーポレイテッド | 終末糖化産物受容体の発現を阻害するためのRNAi剤、その組成物、及び使用方法 |
| WO2023028035A1 (en) * | 2021-08-23 | 2023-03-02 | University Of Florida Research Foundation, Incorporated | Lipid enveloped recombinant aav particles for gene therapy use |
| KR20230083893A (ko) * | 2021-12-03 | 2023-06-12 | 고려대학교 산학협력단 | 번역 효율이 향상된 5'-utr, 이를 포함하는 합성 핵산 분자 및 이를 포함하는 백신 또는 치료제 조성물 |
| CN114137214B (zh) * | 2021-12-06 | 2024-03-01 | 上海市精神卫生中心(上海市心理咨询培训中心) | 用于预测应激后精神心理症状发生的免疫检测试剂盒及应用 |
| CN114410773B (zh) * | 2022-01-27 | 2024-05-03 | 宁波大学 | 用于预测或诊断抑郁症复发的标志物组合及其应用 |
| CN114438191B (zh) * | 2022-01-27 | 2024-04-30 | 宁波大学 | 缺氧诱导因子1α作为标志物在抑郁症复发诊断中的应用 |
| CN119522134A (zh) * | 2022-05-18 | 2025-02-25 | 生物辐射实验室股份有限公司 | 用于自动化数字聚合酶链式反应的系统和方法 |
| CN120435568A (zh) * | 2022-11-17 | 2025-08-05 | 普瓦捷大学 | 用于确定微卫星不稳定性状态的方法、试剂盒及其用途 |
| CN116286834A (zh) * | 2023-03-01 | 2023-06-23 | 武汉大学中南医院 | 一种特异性识别sST2蛋白的核酸适配体及其应用 |
| CN121794401A (zh) * | 2023-05-04 | 2026-04-03 | 宾夕法尼亚州大学信托人 | 使用红细胞检测肿瘤源性核酸 |
| CN117230203B (zh) * | 2023-11-14 | 2024-02-06 | 首都医科大学附属北京儿童医院 | 检测myod1基因突变的引物探针组及其试剂盒 |
| CN119959532B (zh) * | 2025-01-03 | 2025-11-11 | 中国科学院精密测量科学与技术创新研究院 | 细胞色素c在制备elisa试剂盒方面的新用途 |
Citations (128)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4275149A (en) | 1978-11-24 | 1981-06-23 | Syva Company | Macromolecular environment control in specific receptor assays |
| US4551435A (en) | 1983-08-24 | 1985-11-05 | Immunicon, Inc. | Selective removal of immunospecifically recognizable substances from solution |
| US4666828A (en) | 1984-08-15 | 1987-05-19 | The General Hospital Corporation | Test for Huntington's disease |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4737456A (en) | 1985-05-09 | 1988-04-12 | Syntex (U.S.A.) Inc. | Reducing interference in ligand-receptor binding assays |
| US4795698A (en) | 1985-10-04 | 1989-01-03 | Immunicon Corporation | Magnetic-polymer particles |
| US4801531A (en) | 1985-04-17 | 1989-01-31 | Biotechnology Research Partners, Ltd. | Apo AI/CIII genomic polymorphisms predictive of atherosclerosis |
| US4925788A (en) | 1986-10-24 | 1990-05-15 | Immunicon Corporation | Immunoassay system and procedure based on precipitin-like interaction between immune complex and Clq or other non-immunospecific factor |
| WO1991019813A1 (en) | 1990-06-11 | 1991-12-26 | The University Of Colorado Foundation, Inc. | Nucleic acid ligands |
| US5108933A (en) | 1988-09-16 | 1992-04-28 | Immunicon Corporation | Manipulation of colloids for facilitating magnetic separations |
| WO1992007065A1 (en) | 1990-10-12 | 1992-04-30 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Modified ribozymes |
| US5158871A (en) | 1988-02-12 | 1992-10-27 | University Of Connecticut | Method of using magnetic particles for isolating, collecting and assaying diagnostic ligates |
| US5186827A (en) | 1991-03-25 | 1993-02-16 | Immunicon Corporation | Apparatus for magnetic separation featuring external magnetic means |
| EP0527905A1 (en) | 1990-05-10 | 1993-02-24 | Pharmacia Biosensor Ab | MICROFLUIDIC STRUCTURE AND METHOD FOR ITS MANUFACTURE. |
| US5192659A (en) | 1989-08-25 | 1993-03-09 | Genetype Ag | Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes |
| US5200084A (en) | 1990-09-26 | 1993-04-06 | Immunicon Corporation | Apparatus and methods for magnetic separation |
| WO1993022684A1 (en) | 1992-04-29 | 1993-11-11 | Affymax Technologies N.V. | Factorial chemical libraries |
| US5270163A (en) | 1990-06-11 | 1993-12-14 | University Research Corporation | Methods for identifying nucleic acid ligands |
| US5272057A (en) | 1988-10-14 | 1993-12-21 | Georgetown University | Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase |
| US5496938A (en) | 1990-06-11 | 1996-03-05 | Nexstar Pharmaceuticals, Inc. | Nucleic acid ligands to HIV-RT and HIV-1 rev |
| US5567588A (en) | 1990-06-11 | 1996-10-22 | University Research Corporation | Systematic evolution of ligands by exponential enrichment: Solution SELEX |
| US5580737A (en) | 1990-06-11 | 1996-12-03 | Nexstar Pharmaceuticals, Inc. | High-affinity nucleic acid ligands that discriminate between theophylline and caffeine |
| US5637459A (en) | 1990-06-11 | 1997-06-10 | Nexstar Pharmaceuticals, Inc. | Systematic evolution of ligands by exponential enrichment: chimeric selex |
| US5648214A (en) | 1990-06-11 | 1997-07-15 | University Research Corporation | High-affinity oligonucleotide ligands to the tachykinin substance P |
| US5660985A (en) | 1990-06-11 | 1997-08-26 | Nexstar Pharmaceuticals, Inc. | High affinity nucleic acid ligands containing modified nucleotides |
| US5683867A (en) | 1990-06-11 | 1997-11-04 | Nexstar Pharmaceuticals, Inc. | Systematic evolution of ligands by exponential enrichment: blended SELEX |
| US5705337A (en) | 1990-06-11 | 1998-01-06 | Nexstar Pharmaceuticals, Inc. | Systematic evolution of ligands by exponential enrichment: chemi-SELEX |
| US5707796A (en) | 1990-06-11 | 1998-01-13 | Nexstar Pharmaceuticals, Inc. | Method for selecting nucleic acids on the basis of structure |
| US5736330A (en) | 1995-10-11 | 1998-04-07 | Luminex Corporation | Method and compositions for flow cytometric determination of DNA sequences |
| WO1998018480A1 (en) | 1996-10-25 | 1998-05-07 | Nexstar Pharmaceuticals, Inc. | Vascular endothelial growth factor (vegf) nucleic acid ligand complexes |
| US5756701A (en) | 1996-01-16 | 1998-05-26 | Gull Laboratories, Inc. | Specific oligonucleotide primer pairs and probes for discriminating specific analytes |
| US5763177A (en) | 1990-06-11 | 1998-06-09 | Nexstar Pharmaceuticals, Inc. | Systematic evolution of ligands by exponential enrichment: photoselection of nucleic acid ligands and solution selex |
| US5817635A (en) | 1993-08-09 | 1998-10-06 | Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. | Modified ribozymes |
| US5861254A (en) | 1997-01-31 | 1999-01-19 | Nexstar Pharmaceuticals, Inc. | Flow cell SELEX |
| US6011020A (en) | 1990-06-11 | 2000-01-04 | Nexstar Pharmaceuticals, Inc. | Nucleic acid ligand complexes |
| US6051698A (en) | 1997-06-06 | 2000-04-18 | Janjic; Nebojsa | Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes |
| EP1065378A2 (en) | 1999-06-28 | 2001-01-03 | California Institute of Technology | Microfabricated elastomeric valve and pump systems |
| US6269957B1 (en) | 1998-12-04 | 2001-08-07 | Orbital Biosciences, Llc | Ultrafiltration device and method of forming same |
| US6329209B1 (en) | 1998-07-14 | 2001-12-11 | Zyomyx, Incorporated | Arrays of protein-capture agents and methods of use thereof |
| US20030061687A1 (en) | 2000-06-27 | 2003-04-03 | California Institute Of Technology, A California Corporation | High throughput screening of crystallization materials |
| US6599331B2 (en) | 1997-10-14 | 2003-07-29 | Luminex Corporation | Precision fluorescently dyed particles and methods of making and using same |
| US6623526B1 (en) | 1999-01-08 | 2003-09-23 | Corin Limited | Knee prosthesis |
| US6645432B1 (en) | 2000-05-25 | 2003-11-11 | President & Fellows Of Harvard College | Microfluidic systems including three-dimensionally arrayed channel networks |
| US6719868B1 (en) | 1998-03-23 | 2004-04-13 | President And Fellows Of Harvard College | Methods for fabricating microfluidic structures |
| US6773812B2 (en) | 2000-04-06 | 2004-08-10 | Luminex Corporation | Magnetically-responsive microspheres |
| US6812023B1 (en) | 2000-04-27 | 2004-11-02 | Anosys, Inc. | Methods of producing membrane vesicles |
| US20050084421A1 (en) | 2003-04-03 | 2005-04-21 | Fluidigm Corporation | Microfluidic devices and methods of using same |
| US6899137B2 (en) | 1999-06-28 | 2005-05-31 | California Institute Of Technology | Microfabricated elastomeric valve and pump systems |
| US6899863B1 (en) | 1999-01-27 | 2005-05-31 | Anosys, Inc., Institute Curie | Method for preparing membrane vesicles |
| US20050129581A1 (en) | 2003-04-03 | 2005-06-16 | Fluidigm Corporation | Microfluidic devices and methods of using same |
| US20050145496A1 (en) | 2003-04-03 | 2005-07-07 | Federico Goodsaid | Thermal reaction device and method for using the same |
| US20050158708A1 (en) | 2001-06-06 | 2005-07-21 | Iris Alroy | Methods and compositions related to tagging of membrane surface proteins |
| US6929030B2 (en) | 1999-06-28 | 2005-08-16 | California Institute Of Technology | Microfabricated elastomeric valve and pump systems |
| US20050201901A1 (en) | 2004-01-25 | 2005-09-15 | Fluidigm Corp. | Crystal forming devices and systems and methods for using the same |
| US20050214173A1 (en) | 2004-01-25 | 2005-09-29 | Fluidigm Corporation | Integrated chip carriers with thermocycler interfaces and methods of using the same |
| US20050252773A1 (en) | 2003-04-03 | 2005-11-17 | Fluidigm Corporation | Thermal reaction device and method for using the same |
| US20060006067A1 (en) | 2004-06-07 | 2006-01-12 | Fluidigm Corporation | Optical lens system and method for microfluidic devices |
| US7118661B2 (en) | 2002-09-30 | 2006-10-10 | The Regents Of The University Of California | Nanolaminate microfluidic device for mobility selection of particles |
| US7118910B2 (en) | 2001-11-30 | 2006-10-10 | Fluidigm Corporation | Microfluidic device and methods of using same |
| US7125711B2 (en) | 2002-12-19 | 2006-10-24 | Bayer Healthcare Llc | Method and apparatus for splitting of specimens into multiple channels of a microfluidic device |
| US7135147B2 (en) | 2002-07-26 | 2006-11-14 | Applera Corporation | Closing blade for deformable valve in a microfluidic device and method |
| US7138062B2 (en) | 2002-02-26 | 2006-11-21 | Agilent Technologies, Inc. | Mobile phase gradient generation microfluidic device |
| US7141978B2 (en) | 2000-12-01 | 2006-11-28 | Protasis Corporation | Microfluidic device with multiple microcoil NMR detectors enabling fluidic series communication |
| US7144616B1 (en) | 1999-06-28 | 2006-12-05 | California Institute Of Technology | Microfabricated elastomeric valve and pump systems |
| US7189581B2 (en) | 2002-04-30 | 2007-03-13 | Wisconsin Alumni Research Foundation | Method of obtaining a sample concentration of a solution in a microfluidic device |
| US7189368B2 (en) | 2001-09-17 | 2007-03-13 | Gyros Patent Ab | Functional unit enabling controlled flow in a microfluidic device |
| US7189580B2 (en) | 2001-10-19 | 2007-03-13 | Wisconsin Alumni Research Foundation | Method of pumping fluid through a microfluidic device |
| US7195986B1 (en) | 2002-03-08 | 2007-03-27 | Caliper Life Sciences, Inc. | Microfluidic device with controlled substrate conductivity |
| US7198923B1 (en) | 1999-11-18 | 2007-04-03 | Novartis Vaccines And Diagnostics, Inc. | Method for the preparation of purified HCV RNA by exosome separation |
| US7201881B2 (en) | 2002-07-26 | 2007-04-10 | Applera Corporation | Actuator for deformable valves in a microfluidic device, and method |
| US7229538B2 (en) | 2002-09-17 | 2007-06-12 | Fan-Gang Tseng | Microfluidic device with network micro channels |
| US7233865B2 (en) | 2003-12-30 | 2007-06-19 | Caliper Life Sciences, Inc. | Method for determining diffusivity and molecular weight in a microfluidic device |
| US7238324B2 (en) | 2002-08-08 | 2007-07-03 | Electronics And Telecommunications Research Institute | Microfluidic device for the controlled movement of fluid |
| US7238255B2 (en) | 2001-12-31 | 2007-07-03 | Gyros Patent Ab | Microfluidic device and its manufacture |
| US7253003B2 (en) | 2001-10-19 | 2007-08-07 | Wisconsin Alumni Research Foundation | Method for monitoring the environment within a microfluidic device |
| US7258837B2 (en) | 2001-12-05 | 2007-08-21 | University Of Washington | Microfluidic device and surface decoration process for solid phase affinity binding assays |
| US7261824B2 (en) | 2002-05-16 | 2007-08-28 | Micronit Microfluidics B.V. | Method of fabrication of a microfluidic device |
| WO2007103572A2 (en) | 2006-03-09 | 2007-09-13 | Aethlon Medical, Inc. | Extracorporeal removal of microvesicular particles |
| US7274316B2 (en) | 2004-11-17 | 2007-09-25 | Luminex Corporation | System and method for managing data from a flow analyzer |
| US7323140B2 (en) | 2001-03-28 | 2008-01-29 | Handylab, Inc. | Moving microdroplets in a microfluidic device |
| US7329391B2 (en) | 2003-12-08 | 2008-02-12 | Applera Corporation | Microfluidic device and material manipulating method using same |
| US7338637B2 (en) | 2003-01-31 | 2008-03-04 | Hewlett-Packard Development Company, L.P. | Microfluidic device with thin-film electronic devices |
| US7351592B2 (en) | 2000-08-23 | 2008-04-01 | David Storek | Microfluidic device and method with trapping of sample in cavities having lids that can be opened or closed |
| US7351380B2 (en) | 2004-01-08 | 2008-04-01 | Sandia Corporation | Microfluidic structures and methods for integrating a functional component into a microfluidic device |
| US7357864B2 (en) | 2003-03-11 | 2008-04-15 | Kawamura Institute Of Chemical Research | Microfluidic device |
| US7381471B2 (en) | 2002-07-15 | 2008-06-03 | University Of Virginia Patent Foundation | Hybrid polymers for functional tuning of microfluidic device surfaces |
| US7390463B2 (en) | 2001-09-07 | 2008-06-24 | Corning Incorporated | Microcolumn-based, high-throughput microfluidic device |
| US7399632B2 (en) | 1999-07-07 | 2008-07-15 | Angioblast Systems, Incorporated | Mesenchymal precursor cell |
| US7399600B2 (en) | 2002-04-29 | 2008-07-15 | Robert Jeffrey Geddes Carr | Optical detection and analysis of particles |
| US7402229B2 (en) | 2004-03-31 | 2008-07-22 | Intel Corporation | Fabrication and use of semipermeable membranes and gels for the control of electrolysis in a microfluidic device |
| US7411184B2 (en) | 2003-11-12 | 2008-08-12 | Commissariat A L'energie Atomique | Microfluidic device comprising an electrospray nose |
| US7413709B2 (en) | 2003-02-12 | 2008-08-19 | Agilent Technologies, Inc. | PAEK-based microfluidic device with integrated electrospray emitter |
| US7419822B2 (en) | 2002-10-04 | 2008-09-02 | Noo Li Jeon | Microfluidic device for enabling fluidic isolation among interconnected compartments within the apparatus and methods relating to same |
| US7419639B2 (en) | 2004-05-12 | 2008-09-02 | The Board Of Trustees Of The Leland Stanford Junior University | Multilayer microfluidic device |
| US7422725B2 (en) | 2003-05-01 | 2008-09-09 | Enplas Corporation | Sample handling unit applicable to microchip, and microfluidic device having microchips |
| US7422669B2 (en) | 2000-01-12 | 2008-09-09 | Ut-Battelle, Llc | Microfluidic device and method for focusing, segmenting, and dispensing of a fluid stream |
| US7431887B2 (en) | 2000-08-24 | 2008-10-07 | David Storek | Microfluidic device and method with trapping of sample in cavities having lids that can be opened or closed |
| US7449096B2 (en) | 1999-06-22 | 2008-11-11 | Manfred Berndt | Apparatus for the operation of a microfluidic device |
| US7452509B2 (en) | 2002-07-26 | 2008-11-18 | Applied Biosystems Inc. | Microfluidic device including displaceable material trap, and system |
| US7452713B2 (en) | 2000-02-29 | 2008-11-18 | Stmicroelectronics S.R.L. | Process for manufacturing a microfluidic device with buried channels |
| US7467928B2 (en) | 2002-12-12 | 2008-12-23 | Board Of Trustees Of The University Of Arkansas | Microfluidic device utilizing magnetohydrodynamics and method for fabrication thereof |
| US7485214B2 (en) | 2003-12-23 | 2009-02-03 | Stmicroelectronics S. R. L. | Microfluidic device and method of locally concentrating electrically charged substances in a microfluidic device |
| US7488596B2 (en) | 2004-12-17 | 2009-02-10 | Samsung Electronics Co., Ltd. | Microfluidic device comprising electrolysis device for cell lysis and method for electrochemically lysing cells using the same |
| US7501245B2 (en) | 1999-06-28 | 2009-03-10 | Helicos Biosciences Corp. | Methods and apparatuses for analyzing polynucleotide sequences |
| US7518726B2 (en) | 2005-04-12 | 2009-04-14 | Caliper Lifesciences, Inc. | Compact optical detection system for a microfluidic device |
| US7541578B2 (en) | 2005-12-23 | 2009-06-02 | Industrial Technology Research Institute | Microfluidic device and manufacturing method thereof |
| US7544506B2 (en) | 2003-06-06 | 2009-06-09 | Micronics, Inc. | System and method for heating, cooling and heat cycling on microfluidic device |
| US7552741B2 (en) | 2005-06-07 | 2009-06-30 | Fuji Xerox Co., Ltd. | Fluid controlling method, microfluidic device and process for fabricating the same |
| US7568399B2 (en) | 2006-01-05 | 2009-08-04 | Integrated Sensing Systems, Inc. | Microfluidic device |
| US7575722B2 (en) | 2004-04-02 | 2009-08-18 | Eksigent Technologies, Inc. | Microfluidic device |
| US7579136B2 (en) | 2005-05-10 | 2009-08-25 | Samsung Electronics Co., Ltd. | Microfluidic device and method of manufacturing the same |
| US7581429B2 (en) | 2006-01-06 | 2009-09-01 | Integrated Sensing Systems, Inc. | Microfluidic device and method of operation |
| US7591936B2 (en) | 2002-12-04 | 2009-09-22 | Commissariat A L'energie Atomique | Microfluidic device wherein the liquid/fluid interface is stabilized |
| US7640947B2 (en) | 2001-04-06 | 2010-01-05 | Fluidigm Corporation | Microfabricated fluidic circuit elements and applications |
| US7691333B2 (en) | 2001-11-30 | 2010-04-06 | Fluidigm Corporation | Microfluidic device and methods of using same |
| WO2010065765A2 (en) | 2008-12-04 | 2010-06-10 | Aethlon Medical, Inc. | Affinity capture of circulating biomarkers |
| WO2010072410A2 (en) | 2008-12-23 | 2010-07-01 | Universiteit Leiden | Methods for immobilizing microvesicles, means and methods for detecting them, and uses thereof |
| WO2010093465A1 (en) | 2009-02-11 | 2010-08-19 | Caris Mpi, Inc. | Molecular profiling of tumors |
| WO2010141862A2 (en) | 2009-06-05 | 2010-12-09 | Mayo Foundation For Medical Education And Research | Methods and materials for isolating exosomes |
| WO2011056688A2 (en) | 2009-10-27 | 2011-05-12 | Caris Life Sciences, Inc. | Molecular profiling for personalized medicine |
| WO2011066589A1 (en) | 2009-11-30 | 2011-06-03 | Caris Life Sciences Luxembourg Holdings | Methods and systems for isolating, storing, and analyzing vesicles |
| US7955802B2 (en) | 2006-12-13 | 2011-06-07 | Luminex Corporation | Systems and methods for multiplex analysis of PCR in real time |
| US8008019B2 (en) | 2007-11-28 | 2011-08-30 | Luminex Molecular Diagnostics | Use of dual-tags for the evaluation of genomic variable repeat regions |
| WO2011127219A1 (en) | 2010-04-06 | 2011-10-13 | Caris Life Sciences Luxembourg Holdings | Circulating biomarkers for disease |
| US8124015B2 (en) | 2006-02-03 | 2012-02-28 | Institute For Systems Biology | Multiplexed, microfluidic molecular assay device and assay method |
| WO2012174282A2 (en) | 2011-06-16 | 2012-12-20 | Caris Life Sciences Luxembourg Holdings, S.A.R.L. | Biomarker compositions and methods |
| WO2013022995A2 (en) | 2011-08-08 | 2013-02-14 | Caris Life Sciences Luxembourg Holdings, S.A.R.L. | Biomarker compositions and methods |
| WO2014082083A1 (en) | 2012-11-26 | 2014-05-30 | Caris Science, Inc. | Biomarker compositions and methods |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5800992A (en) * | 1989-06-07 | 1998-09-01 | Fodor; Stephen P.A. | Method of detecting nucleic acids |
| US6582908B2 (en) * | 1990-12-06 | 2003-06-24 | Affymetrix, Inc. | Oligonucleotides |
| US20030204075A9 (en) * | 1999-08-09 | 2003-10-30 | The Snp Consortium | Identification and mapping of single nucleotide polymorphisms in the human genome |
| WO2011109451A1 (en) * | 2010-03-01 | 2011-09-09 | Aptamatrix, Inc. | Library compositions and methosds for acyclic identification of aptamers |
| US7888035B2 (en) * | 2008-10-30 | 2011-02-15 | Caris Mpi, Inc. | Methods for assessing RNA patterns |
| WO2010056337A2 (en) * | 2008-11-12 | 2010-05-20 | Caris Mpi, Inc. | Methods and systems of using exosomes for determining phenotypes |
| US20140148348A1 (en) * | 2010-01-13 | 2014-05-29 | Christine Kuslich | Dectection of gastrointestinal disorders |
| WO2011106376A2 (en) * | 2010-02-23 | 2011-09-01 | The General Hospital Corporation | Use of microvesicles in the treatment of medical conditions |
| EP2542696B1 (en) * | 2010-03-01 | 2016-09-28 | Caris Life Sciences Switzerland Holdings GmbH | Biomarkers for theranostics |
-
2014
- 2014-08-28 CN CN201480063091.1A patent/CN105980615A/zh active Pending
- 2014-08-28 CA CA2922689A patent/CA2922689A1/en not_active Abandoned
- 2014-08-28 US US14/915,249 patent/US20160319361A1/en not_active Abandoned
- 2014-08-28 AU AU2014312211A patent/AU2014312211A1/en not_active Abandoned
- 2014-08-28 WO PCT/US2014/053306 patent/WO2015031694A2/en not_active Ceased
- 2014-08-28 JP JP2016537869A patent/JP2016533752A/ja active Pending
- 2014-08-28 KR KR1020167007928A patent/KR20160080815A/ko not_active Ceased
- 2014-08-28 BR BR112016004153A patent/BR112016004153A2/pt not_active IP Right Cessation
- 2014-08-28 EP EP14840036.9A patent/EP3039174B1/en active Active
-
2016
- 2016-02-22 IL IL244236A patent/IL244236A0/en unknown
-
2019
- 2019-01-09 AU AU2019200115A patent/AU2019200115A1/en not_active Abandoned
- 2019-09-26 IL IL26969319A patent/IL269693A/en unknown
-
2020
- 2020-07-23 US US16/936,618 patent/US20210062270A1/en active Pending
Patent Citations (154)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4275149A (en) | 1978-11-24 | 1981-06-23 | Syva Company | Macromolecular environment control in specific receptor assays |
| US4551435A (en) | 1983-08-24 | 1985-11-05 | Immunicon, Inc. | Selective removal of immunospecifically recognizable substances from solution |
| US4666828A (en) | 1984-08-15 | 1987-05-19 | The General Hospital Corporation | Test for Huntington's disease |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4683202B1 (https=) | 1985-03-28 | 1990-11-27 | Cetus Corp | |
| US4801531A (en) | 1985-04-17 | 1989-01-31 | Biotechnology Research Partners, Ltd. | Apo AI/CIII genomic polymorphisms predictive of atherosclerosis |
| US4737456A (en) | 1985-05-09 | 1988-04-12 | Syntex (U.S.A.) Inc. | Reducing interference in ligand-receptor binding assays |
| US4795698A (en) | 1985-10-04 | 1989-01-03 | Immunicon Corporation | Magnetic-polymer particles |
| US4925788A (en) | 1986-10-24 | 1990-05-15 | Immunicon Corporation | Immunoassay system and procedure based on precipitin-like interaction between immune complex and Clq or other non-immunospecific factor |
| US5158871A (en) | 1988-02-12 | 1992-10-27 | University Of Connecticut | Method of using magnetic particles for isolating, collecting and assaying diagnostic ligates |
| US5108933A (en) | 1988-09-16 | 1992-04-28 | Immunicon Corporation | Manipulation of colloids for facilitating magnetic separations |
| US5272057A (en) | 1988-10-14 | 1993-12-21 | Georgetown University | Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase |
| US5192659A (en) | 1989-08-25 | 1993-03-09 | Genetype Ag | Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes |
| US5376252A (en) | 1990-05-10 | 1994-12-27 | Pharmacia Biosensor Ab | Microfluidic structure and process for its manufacture |
| EP0527905A1 (en) | 1990-05-10 | 1993-02-24 | Pharmacia Biosensor Ab | MICROFLUIDIC STRUCTURE AND METHOD FOR ITS MANUFACTURE. |
| US5270163A (en) | 1990-06-11 | 1993-12-14 | University Research Corporation | Methods for identifying nucleic acid ligands |
| US5648214A (en) | 1990-06-11 | 1997-07-15 | University Research Corporation | High-affinity oligonucleotide ligands to the tachykinin substance P |
| US5958691A (en) | 1990-06-11 | 1999-09-28 | Nexstar Pharmaceuticals, Inc. | High affinity nucleic acid ligands containing modified nucleotides |
| US5763177A (en) | 1990-06-11 | 1998-06-09 | Nexstar Pharmaceuticals, Inc. | Systematic evolution of ligands by exponential enrichment: photoselection of nucleic acid ligands and solution selex |
| US6011020A (en) | 1990-06-11 | 2000-01-04 | Nexstar Pharmaceuticals, Inc. | Nucleic acid ligand complexes |
| WO1991019813A1 (en) | 1990-06-11 | 1991-12-26 | The University Of Colorado Foundation, Inc. | Nucleic acid ligands |
| US5475096A (en) | 1990-06-11 | 1995-12-12 | University Research Corporation | Nucleic acid ligands |
| US5496938A (en) | 1990-06-11 | 1996-03-05 | Nexstar Pharmaceuticals, Inc. | Nucleic acid ligands to HIV-RT and HIV-1 rev |
| US5567588A (en) | 1990-06-11 | 1996-10-22 | University Research Corporation | Systematic evolution of ligands by exponential enrichment: Solution SELEX |
| US5580737A (en) | 1990-06-11 | 1996-12-03 | Nexstar Pharmaceuticals, Inc. | High-affinity nucleic acid ligands that discriminate between theophylline and caffeine |
| US5637459A (en) | 1990-06-11 | 1997-06-10 | Nexstar Pharmaceuticals, Inc. | Systematic evolution of ligands by exponential enrichment: chimeric selex |
| US5707796A (en) | 1990-06-11 | 1998-01-13 | Nexstar Pharmaceuticals, Inc. | Method for selecting nucleic acids on the basis of structure |
| US5660985A (en) | 1990-06-11 | 1997-08-26 | Nexstar Pharmaceuticals, Inc. | High affinity nucleic acid ligands containing modified nucleotides |
| US5705337A (en) | 1990-06-11 | 1998-01-06 | Nexstar Pharmaceuticals, Inc. | Systematic evolution of ligands by exponential enrichment: chemi-SELEX |
| US5683867A (en) | 1990-06-11 | 1997-11-04 | Nexstar Pharmaceuticals, Inc. | Systematic evolution of ligands by exponential enrichment: blended SELEX |
| US5200084A (en) | 1990-09-26 | 1993-04-06 | Immunicon Corporation | Apparatus and methods for magnetic separation |
| US5698687A (en) | 1990-10-12 | 1997-12-16 | Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. | Modified ribozymls |
| US5672695A (en) | 1990-10-12 | 1997-09-30 | Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. | Modified ribozymes |
| WO1992007065A1 (en) | 1990-10-12 | 1992-04-30 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Modified ribozymes |
| US5186827A (en) | 1991-03-25 | 1993-02-16 | Immunicon Corporation | Apparatus for magnetic separation featuring external magnetic means |
| WO1993022684A1 (en) | 1992-04-29 | 1993-11-11 | Affymax Technologies N.V. | Factorial chemical libraries |
| US5817635A (en) | 1993-08-09 | 1998-10-06 | Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. | Modified ribozymes |
| US6057107A (en) | 1995-10-11 | 2000-05-02 | Luminex Corporation | Methods and compositions for flow cytometric determination of DNA sequences |
| US5736330A (en) | 1995-10-11 | 1998-04-07 | Luminex Corporation | Method and compositions for flow cytometric determination of DNA sequences |
| US5756701A (en) | 1996-01-16 | 1998-05-26 | Gull Laboratories, Inc. | Specific oligonucleotide primer pairs and probes for discriminating specific analytes |
| WO1998018480A1 (en) | 1996-10-25 | 1998-05-07 | Nexstar Pharmaceuticals, Inc. | Vascular endothelial growth factor (vegf) nucleic acid ligand complexes |
| US5861254A (en) | 1997-01-31 | 1999-01-19 | Nexstar Pharmaceuticals, Inc. | Flow cell SELEX |
| US6051698A (en) | 1997-06-06 | 2000-04-18 | Janjic; Nebojsa | Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes |
| US6599331B2 (en) | 1997-10-14 | 2003-07-29 | Luminex Corporation | Precision fluorescently dyed particles and methods of making and using same |
| US7445844B2 (en) | 1997-10-14 | 2008-11-04 | Luminex Corporation | Precision fluorescently dyed polymeric microparticles and methods of making and using same |
| US6719868B1 (en) | 1998-03-23 | 2004-04-13 | President And Fellows Of Harvard College | Methods for fabricating microfluidic structures |
| US6329209B1 (en) | 1998-07-14 | 2001-12-11 | Zyomyx, Incorporated | Arrays of protein-capture agents and methods of use thereof |
| US6365418B1 (en) | 1998-07-14 | 2002-04-02 | Zyomyx, Incorporated | Arrays of protein-capture agents and methods of use thereof |
| US6406921B1 (en) | 1998-07-14 | 2002-06-18 | Zyomyx, Incorporated | Protein arrays for high-throughput screening |
| US6475808B1 (en) | 1998-07-14 | 2002-11-05 | Zyomyx, Incorporated | Arrays of proteins and methods of use thereof |
| US6475809B1 (en) | 1998-07-14 | 2002-11-05 | Zyomyx, Incorporated | Protein arrays for high-throughput screening |
| US6269957B1 (en) | 1998-12-04 | 2001-08-07 | Orbital Biosciences, Llc | Ultrafiltration device and method of forming same |
| US6357601B1 (en) | 1998-12-04 | 2002-03-19 | Orbital Biosciences Llc | Ultrafiltration device and method of forming same |
| US6623526B1 (en) | 1999-01-08 | 2003-09-23 | Corin Limited | Knee prosthesis |
| US6899863B1 (en) | 1999-01-27 | 2005-05-31 | Anosys, Inc., Institute Curie | Method for preparing membrane vesicles |
| US7449096B2 (en) | 1999-06-22 | 2008-11-11 | Manfred Berndt | Apparatus for the operation of a microfluidic device |
| US7494555B2 (en) | 1999-06-28 | 2009-02-24 | California Institute Of Technology | Microfabricated elastomeric valve and pump systems |
| US7754010B2 (en) | 1999-06-28 | 2010-07-13 | California Institute Of Technology | Microfabricated elastomeric valve and pump systems |
| US6793753B2 (en) | 1999-06-28 | 2004-09-21 | California Institute Of Technology | Method of making a microfabricated elastomeric valve |
| US7040338B2 (en) | 1999-06-28 | 2006-05-09 | California Institute Of Technology | Microfabricated elastomeric valve and pump systems |
| US7601270B1 (en) | 1999-06-28 | 2009-10-13 | California Institute Of Technology | Microfabricated elastomeric valve and pump systems |
| US20050112882A1 (en) | 1999-06-28 | 2005-05-26 | California Institute Of Technology | Microfabricated elastomeric valve and pump systems |
| US6899137B2 (en) | 1999-06-28 | 2005-05-31 | California Institute Of Technology | Microfabricated elastomeric valve and pump systems |
| US7501245B2 (en) | 1999-06-28 | 2009-03-10 | Helicos Biosciences Corp. | Methods and apparatuses for analyzing polynucleotide sequences |
| US6408878B2 (en) | 1999-06-28 | 2002-06-25 | California Institute Of Technology | Microfabricated elastomeric valve and pump systems |
| EP1065378A2 (en) | 1999-06-28 | 2001-01-03 | California Institute of Technology | Microfabricated elastomeric valve and pump systems |
| US7144616B1 (en) | 1999-06-28 | 2006-12-05 | California Institute Of Technology | Microfabricated elastomeric valve and pump systems |
| US6929030B2 (en) | 1999-06-28 | 2005-08-16 | California Institute Of Technology | Microfabricated elastomeric valve and pump systems |
| US7250128B2 (en) | 1999-06-28 | 2007-07-31 | California Institute Of Technology | Method of forming a via in a microfabricated elastomer structure |
| US7216671B2 (en) | 1999-06-28 | 2007-05-15 | California Institute Of Technology | Microfabricated elastomeric valve and pump systems |
| US7399632B2 (en) | 1999-07-07 | 2008-07-15 | Angioblast Systems, Incorporated | Mesenchymal precursor cell |
| US7198923B1 (en) | 1999-11-18 | 2007-04-03 | Novartis Vaccines And Diagnostics, Inc. | Method for the preparation of purified HCV RNA by exosome separation |
| US7422669B2 (en) | 2000-01-12 | 2008-09-09 | Ut-Battelle, Llc | Microfluidic device and method for focusing, segmenting, and dispensing of a fluid stream |
| US7452713B2 (en) | 2000-02-29 | 2008-11-18 | Stmicroelectronics S.R.L. | Process for manufacturing a microfluidic device with buried channels |
| US6773812B2 (en) | 2000-04-06 | 2004-08-10 | Luminex Corporation | Magnetically-responsive microspheres |
| US6812023B1 (en) | 2000-04-27 | 2004-11-02 | Anosys, Inc. | Methods of producing membrane vesicles |
| US6645432B1 (en) | 2000-05-25 | 2003-11-11 | President & Fellows Of Harvard College | Microfluidic systems including three-dimensionally arrayed channel networks |
| US20030061687A1 (en) | 2000-06-27 | 2003-04-03 | California Institute Of Technology, A California Corporation | High throughput screening of crystallization materials |
| US7351592B2 (en) | 2000-08-23 | 2008-04-01 | David Storek | Microfluidic device and method with trapping of sample in cavities having lids that can be opened or closed |
| US7431887B2 (en) | 2000-08-24 | 2008-10-07 | David Storek | Microfluidic device and method with trapping of sample in cavities having lids that can be opened or closed |
| US7141978B2 (en) | 2000-12-01 | 2006-11-28 | Protasis Corporation | Microfluidic device with multiple microcoil NMR detectors enabling fluidic series communication |
| US7323140B2 (en) | 2001-03-28 | 2008-01-29 | Handylab, Inc. | Moving microdroplets in a microfluidic device |
| US7640947B2 (en) | 2001-04-06 | 2010-01-05 | Fluidigm Corporation | Microfabricated fluidic circuit elements and applications |
| US20050158708A1 (en) | 2001-06-06 | 2005-07-21 | Iris Alroy | Methods and compositions related to tagging of membrane surface proteins |
| US7390463B2 (en) | 2001-09-07 | 2008-06-24 | Corning Incorporated | Microcolumn-based, high-throughput microfluidic device |
| US7189368B2 (en) | 2001-09-17 | 2007-03-13 | Gyros Patent Ab | Functional unit enabling controlled flow in a microfluidic device |
| US7189580B2 (en) | 2001-10-19 | 2007-03-13 | Wisconsin Alumni Research Foundation | Method of pumping fluid through a microfluidic device |
| US7253003B2 (en) | 2001-10-19 | 2007-08-07 | Wisconsin Alumni Research Foundation | Method for monitoring the environment within a microfluidic device |
| US7691333B2 (en) | 2001-11-30 | 2010-04-06 | Fluidigm Corporation | Microfluidic device and methods of using same |
| US7837946B2 (en) | 2001-11-30 | 2010-11-23 | Fluidigm Corporation | Microfluidic device and methods of using same |
| US7118910B2 (en) | 2001-11-30 | 2006-10-10 | Fluidigm Corporation | Microfluidic device and methods of using same |
| US7258837B2 (en) | 2001-12-05 | 2007-08-21 | University Of Washington | Microfluidic device and surface decoration process for solid phase affinity binding assays |
| US7238255B2 (en) | 2001-12-31 | 2007-07-03 | Gyros Patent Ab | Microfluidic device and its manufacture |
| US7138062B2 (en) | 2002-02-26 | 2006-11-21 | Agilent Technologies, Inc. | Mobile phase gradient generation microfluidic device |
| US7195986B1 (en) | 2002-03-08 | 2007-03-27 | Caliper Life Sciences, Inc. | Microfluidic device with controlled substrate conductivity |
| US7399600B2 (en) | 2002-04-29 | 2008-07-15 | Robert Jeffrey Geddes Carr | Optical detection and analysis of particles |
| US7751053B2 (en) | 2002-04-29 | 2010-07-06 | Robert Jeffrey Geddes Carr | Optical detection and analysis of particles |
| US7189581B2 (en) | 2002-04-30 | 2007-03-13 | Wisconsin Alumni Research Foundation | Method of obtaining a sample concentration of a solution in a microfluidic device |
| US7261824B2 (en) | 2002-05-16 | 2007-08-28 | Micronit Microfluidics B.V. | Method of fabrication of a microfluidic device |
| US7381471B2 (en) | 2002-07-15 | 2008-06-03 | University Of Virginia Patent Foundation | Hybrid polymers for functional tuning of microfluidic device surfaces |
| US7452509B2 (en) | 2002-07-26 | 2008-11-18 | Applied Biosystems Inc. | Microfluidic device including displaceable material trap, and system |
| US7201881B2 (en) | 2002-07-26 | 2007-04-10 | Applera Corporation | Actuator for deformable valves in a microfluidic device, and method |
| US7135147B2 (en) | 2002-07-26 | 2006-11-14 | Applera Corporation | Closing blade for deformable valve in a microfluidic device and method |
| US7238324B2 (en) | 2002-08-08 | 2007-07-03 | Electronics And Telecommunications Research Institute | Microfluidic device for the controlled movement of fluid |
| US7229538B2 (en) | 2002-09-17 | 2007-06-12 | Fan-Gang Tseng | Microfluidic device with network micro channels |
| US7118661B2 (en) | 2002-09-30 | 2006-10-10 | The Regents Of The University Of California | Nanolaminate microfluidic device for mobility selection of particles |
| US7419822B2 (en) | 2002-10-04 | 2008-09-02 | Noo Li Jeon | Microfluidic device for enabling fluidic isolation among interconnected compartments within the apparatus and methods relating to same |
| US7591936B2 (en) | 2002-12-04 | 2009-09-22 | Commissariat A L'energie Atomique | Microfluidic device wherein the liquid/fluid interface is stabilized |
| US7467928B2 (en) | 2002-12-12 | 2008-12-23 | Board Of Trustees Of The University Of Arkansas | Microfluidic device utilizing magnetohydrodynamics and method for fabrication thereof |
| US7125711B2 (en) | 2002-12-19 | 2006-10-24 | Bayer Healthcare Llc | Method and apparatus for splitting of specimens into multiple channels of a microfluidic device |
| US7338637B2 (en) | 2003-01-31 | 2008-03-04 | Hewlett-Packard Development Company, L.P. | Microfluidic device with thin-film electronic devices |
| US7413709B2 (en) | 2003-02-12 | 2008-08-19 | Agilent Technologies, Inc. | PAEK-based microfluidic device with integrated electrospray emitter |
| US7357864B2 (en) | 2003-03-11 | 2008-04-15 | Kawamura Institute Of Chemical Research | Microfluidic device |
| US20050145496A1 (en) | 2003-04-03 | 2005-07-07 | Federico Goodsaid | Thermal reaction device and method for using the same |
| US20050129581A1 (en) | 2003-04-03 | 2005-06-16 | Fluidigm Corporation | Microfluidic devices and methods of using same |
| US20050084421A1 (en) | 2003-04-03 | 2005-04-21 | Fluidigm Corporation | Microfluidic devices and methods of using same |
| US7666361B2 (en) | 2003-04-03 | 2010-02-23 | Fluidigm Corporation | Microfluidic devices and methods of using same |
| US20050252773A1 (en) | 2003-04-03 | 2005-11-17 | Fluidigm Corporation | Thermal reaction device and method for using the same |
| US7422725B2 (en) | 2003-05-01 | 2008-09-09 | Enplas Corporation | Sample handling unit applicable to microchip, and microfluidic device having microchips |
| US7544506B2 (en) | 2003-06-06 | 2009-06-09 | Micronics, Inc. | System and method for heating, cooling and heat cycling on microfluidic device |
| US7411184B2 (en) | 2003-11-12 | 2008-08-12 | Commissariat A L'energie Atomique | Microfluidic device comprising an electrospray nose |
| US7329391B2 (en) | 2003-12-08 | 2008-02-12 | Applera Corporation | Microfluidic device and material manipulating method using same |
| US7485214B2 (en) | 2003-12-23 | 2009-02-03 | Stmicroelectronics S. R. L. | Microfluidic device and method of locally concentrating electrically charged substances in a microfluidic device |
| US7233865B2 (en) | 2003-12-30 | 2007-06-19 | Caliper Life Sciences, Inc. | Method for determining diffusivity and molecular weight in a microfluidic device |
| US7351380B2 (en) | 2004-01-08 | 2008-04-01 | Sandia Corporation | Microfluidic structures and methods for integrating a functional component into a microfluidic device |
| US20050201901A1 (en) | 2004-01-25 | 2005-09-15 | Fluidigm Corp. | Crystal forming devices and systems and methods for using the same |
| US20050214173A1 (en) | 2004-01-25 | 2005-09-29 | Fluidigm Corporation | Integrated chip carriers with thermocycler interfaces and methods of using the same |
| US7704735B2 (en) | 2004-01-25 | 2010-04-27 | Fluidigm Corporation | Integrated chip carriers with thermocycler interfaces and methods of using the same |
| US7402229B2 (en) | 2004-03-31 | 2008-07-22 | Intel Corporation | Fabrication and use of semipermeable membranes and gels for the control of electrolysis in a microfluidic device |
| US7575722B2 (en) | 2004-04-02 | 2009-08-18 | Eksigent Technologies, Inc. | Microfluidic device |
| US7419639B2 (en) | 2004-05-12 | 2008-09-02 | The Board Of Trustees Of The Leland Stanford Junior University | Multilayer microfluidic device |
| US20060006067A1 (en) | 2004-06-07 | 2006-01-12 | Fluidigm Corporation | Optical lens system and method for microfluidic devices |
| US7274316B2 (en) | 2004-11-17 | 2007-09-25 | Luminex Corporation | System and method for managing data from a flow analyzer |
| US7488596B2 (en) | 2004-12-17 | 2009-02-10 | Samsung Electronics Co., Ltd. | Microfluidic device comprising electrolysis device for cell lysis and method for electrochemically lysing cells using the same |
| US7518726B2 (en) | 2005-04-12 | 2009-04-14 | Caliper Lifesciences, Inc. | Compact optical detection system for a microfluidic device |
| US7579136B2 (en) | 2005-05-10 | 2009-08-25 | Samsung Electronics Co., Ltd. | Microfluidic device and method of manufacturing the same |
| US7552741B2 (en) | 2005-06-07 | 2009-06-30 | Fuji Xerox Co., Ltd. | Fluid controlling method, microfluidic device and process for fabricating the same |
| US7541578B2 (en) | 2005-12-23 | 2009-06-02 | Industrial Technology Research Institute | Microfluidic device and manufacturing method thereof |
| US7568399B2 (en) | 2006-01-05 | 2009-08-04 | Integrated Sensing Systems, Inc. | Microfluidic device |
| US7581429B2 (en) | 2006-01-06 | 2009-09-01 | Integrated Sensing Systems, Inc. | Microfluidic device and method of operation |
| US8124015B2 (en) | 2006-02-03 | 2012-02-28 | Institute For Systems Biology | Multiplexed, microfluidic molecular assay device and assay method |
| WO2007103572A2 (en) | 2006-03-09 | 2007-09-13 | Aethlon Medical, Inc. | Extracorporeal removal of microvesicular particles |
| US7955802B2 (en) | 2006-12-13 | 2011-06-07 | Luminex Corporation | Systems and methods for multiplex analysis of PCR in real time |
| US8008019B2 (en) | 2007-11-28 | 2011-08-30 | Luminex Molecular Diagnostics | Use of dual-tags for the evaluation of genomic variable repeat regions |
| WO2010065765A2 (en) | 2008-12-04 | 2010-06-10 | Aethlon Medical, Inc. | Affinity capture of circulating biomarkers |
| WO2010072410A2 (en) | 2008-12-23 | 2010-07-01 | Universiteit Leiden | Methods for immobilizing microvesicles, means and methods for detecting them, and uses thereof |
| WO2010093465A1 (en) | 2009-02-11 | 2010-08-19 | Caris Mpi, Inc. | Molecular profiling of tumors |
| WO2010141862A2 (en) | 2009-06-05 | 2010-12-09 | Mayo Foundation For Medical Education And Research | Methods and materials for isolating exosomes |
| WO2011056688A2 (en) | 2009-10-27 | 2011-05-12 | Caris Life Sciences, Inc. | Molecular profiling for personalized medicine |
| WO2011066589A1 (en) | 2009-11-30 | 2011-06-03 | Caris Life Sciences Luxembourg Holdings | Methods and systems for isolating, storing, and analyzing vesicles |
| WO2011127219A1 (en) | 2010-04-06 | 2011-10-13 | Caris Life Sciences Luxembourg Holdings | Circulating biomarkers for disease |
| WO2012174282A2 (en) | 2011-06-16 | 2012-12-20 | Caris Life Sciences Luxembourg Holdings, S.A.R.L. | Biomarker compositions and methods |
| WO2013022995A2 (en) | 2011-08-08 | 2013-02-14 | Caris Life Sciences Luxembourg Holdings, S.A.R.L. | Biomarker compositions and methods |
| WO2014082083A1 (en) | 2012-11-26 | 2014-05-30 | Caris Science, Inc. | Biomarker compositions and methods |
Non-Patent Citations (61)
| Title |
|---|
| "Genome Analysis: A Laboratory Manual Series", vol. 1 -4, 1998, COLD SPRING HARBOR LABORATORY PRESS |
| "Harrison's Principles of Internal Medicine", 2005 |
| "PCR Protocols: A Guide to Methods and Applications", 1990, ACADEMIC PRESS |
| "The Handbook--A Guide to Fluorescent Probes and Labeling Technologies" |
| ALTSCHUL S F ET AL., J MOL. BIOL., vol. 215, no. 3, 1990, pages 403 - 10 |
| ALTSCHUL S F ET AL., NUCLEIC ACIDS RES., vol. 25, no. 17, 1997, pages 3389 - 402 |
| AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1989, JOHN WILEY AND SONS |
| BOYD ET AL., ANTIMICROB AGENTS CHEMOTHER, vol. 41, no. 7, 1997, pages 1521 1530 |
| BRODY; GOLD, REV. MOL. BIOTECH., vol. 74, 2000, pages 5 - 13 |
| CERCHIA, L.; V. DE FRANCISCIS: "Nucleic Acid Aptamers Against Protein Kinases", CURRENT MEDICINAL CHEMISTRY, vol. 18.27, 2011, pages 4152 - 4158 |
| CHARRAS ET AL., NATURE REVIEWS MOLECULAR AND CELL BIOLOGY, vol. 9, no. 11, 2008, pages 730 - 736 |
| CHAUDRY MA; SALES K; RUF P; LINDHOFER H; WINSLET MC, BR. J. CANCER, vol. 96, no. 7, April 2007 (2007-04-01), pages 1013 - 9 |
| CHEN ET AL.: "Microfluidic isolation and transcriptome analysis of serum vesicles", LAB ON A CHIP, 8 December 2009 (2009-12-08) |
| CHERVENAK ET AL., BIOCHEMISTRY, vol. 34, no. 16, 1995, pages 5685 5695 |
| CHROMY ET AL., JPROTEOME RES, vol. 3, 2004, pages 1120 - 1127 |
| COLCHER, D.; GOEL, A.; PAVLINKOVA, G.; BERESFORD, G.; BOOTH, B.; BATRA, S. K.: "Effects of genetic engineering on the pharmacokinetics of antibodies", Q. J. NUCL. MED., vol. 43, 1999, pages 132 - 139 |
| COTTEN ET AL., NUCL. ACID RES., vol. 19, 1991, pages 2629 - 2635 |
| CUTILLAS ET AL., MOL CELL PROTEOMICS, vol. 4, 2005, pages 1038 - 1051 |
| CUTILLAS ET AL., PROTEOMICS, vol. 5, 2005, pages 101 - 112 |
| FAN ET AL.: "Illumina universal bead arrays", METHODS ENZYMOL., vol. 410, 2006, pages 57 - 73 |
| FROEHLER ET AL., NUCL. ACID RES., vol. 14, 1986, pages 5399 - 5467 |
| FROEHLER ET AL., TET. LETT., vol. 27, 1986, pages 5575 - 5578 |
| GRANT, R. ET AL.: "A filtration-based protocol to isolate human Plasma Membrane-derived Vesicles and exosomes from blood plasma", J IMMUNOL METHODS, vol. 371, 30 June 2011 (2011-06-30), pages 143 - 51, XP028254111, DOI: doi:10.1016/j.jim.2011.06.024 |
| HAMMAR ET AL., ANN N YACAD SCI, vol. 724, 1994, pages 166 169 |
| HICKE, B. J.; STEPHENS, A. W.: "Escort aptamers: a delivery service for diagnosis and therapy", J. CLIN. INVEST., vol. 106, 2000, pages 923 - 928, XP002280743, DOI: doi:10.1172/JCI11324 |
| HIROSE ET AL., TET. LETT., vol. 28, 1978, pages 2449 |
| HOBBS ET AL., BIOCHEMISTRY, vol. 12, 1973, pages 5138 - 5145 |
| HOFACKER ET AL., MONATSHEFTE F. CHEMIE, vol. 125, 1994, pages 167 - 188 |
| HOFACKER, I. L.: "Vienna RNA secondary structure server", NUCLEIC ACIDS RES., vol. 31, 2003, pages 3429 - 3431, XP002460707, DOI: doi:10.1093/nar/gkg599 |
| JAIN KK: "Proteomics of Human Body Fluids: Principles, Methods and Applications", vol. 1, 2007, HUMANA PRESS, article "Integrative Omics, Pharmacoproteomics, and Human Body Fluids" |
| KAKU ET AL., ARCH BIOCHEM BIOPHYS, vol. 279, no. 2, 1990, pages 298 304 |
| KARTALOV EP ET AL., BIOTECHNIQUES, vol. 40, no. l, 2006, pages 85 - 90 |
| KAUR H; YUNG L-YL: "Probing High Affinity Sequences of DNA Aptamer against VEGFies", PLOS ONE, vol. 7, no. 2, 2012, pages e31196 |
| KELLER ET AL., IMMUNOL. LETT., vol. 107, no. 2, 2006, pages 102 - 8 |
| KING ET AL., BREAST CANCER RES, vol. 7, no. 5, 2005, pages 198 - 204 |
| LAKOWICZ J R: "Principles of Fluorescence Spectroscopy", 1999, PLENUM PRESS |
| LI ET AL., ADV DENT RES, vol. 18, no. 1, 2005, pages 3 - 5 |
| MATHEWS, D.; SABINA, J.; ZUCKER, M.; TURNER, H.: "Expanded sequence dependence of thermodynamic parameters provides robust prediction of RNA secondary structure", J. MOL. BIOL., vol. 288, 1999, pages 911 - 940 |
| MERE L ET AL.: "Miniaturized FRET assays and microfluidics: key components for ultra-high-throughput screening", DRUG DISCOVERY TODAY, vol. 4, no. 8, 1999, pages 363 - 369, XP001022898, DOI: doi:10.1016/S1359-6446(99)01377-X |
| MITKEVICH, OLGA V. ET AL.: "DNA aptamers detecting generic amyloid epitopes", PRION, vol. 6.4, 2012, pages 400 - 406 |
| MULLER, J. ET AL.: "Selection of high affinity DNA-aptamer for activated protein C using capillary electrophoresis", RESEARCH IN PHARMACEUTICAL SCIENCES, vol. 7.5, 2012, pages S987 |
| NIDA ET AL., GYNECOLOGIC ONCOLOGY, vol. 4, 2005, pages 889 - 894 |
| ORMEROD: "Flow Cytometry", 1999, SPRINGER-VERLAG |
| PERBAL: "A Practical Guide to Molecular Cloning", 1988, JOHN WILEY & SONS |
| PIPPER ET AL., ANGEWANDTE CHEMIE, vol. 47, no. 21, 2008, pages 3900 - 3904 |
| PISITKUN ET AL., PROC NATL ACAD SCI USA, vol. 101, 2004, pages 13368 - 13373 |
| REFF; HEARD, CRITICAL REVIEWS IN ONCOLOGY/HEMATOLOGY, vol. 40, 2001, pages 25 - 35 |
| ROKHLIN ET AL.: "5E10: a prostate-specific surface-reactive monoclonal antibody", CANCER LETT., vol. 131, 1998, pages 129 - 36 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS |
| See also references of EP3039174A4 |
| SOOD ET AL., NUCL. ACID RES., vol. 4, 1977, pages 2557 |
| SPROAT ET AL., NUCL. ACID RES., vol. 19, 1991, pages 733 - 738 |
| SRINIVAS ET AL.: "Aptamer functionalized Microgel Particles for Protein Detection", ANAL. CHEM., 21 October 2011 (2011-10-21) |
| SUCHANEK, M. ET AL.: "Photo-leucine and photo-methionine allow identification of protein-protein interactions", NAT. METHODS, vol. 2, 2005, pages 261 - 267 |
| THERY ET AL., NAT REV IMMUNOL., vol. 9, no. 8, August 2009 (2009-08-01), pages 581 - 93 |
| TUCKER ET AL., J. CHROMATOGRAPHY B., vol. 732, 1999, pages 203 - 212 |
| UNGER M ET AL., BIOTECHNIQUES, vol. 27, no. 5, 1999, pages 1008 - 14 |
| WATSON ET AL.: "Recombinant DNA", SCIENTIFIC AMERICAN BOOKS |
| WILBUR; LIPMAN, PROC NATL ACAD SCI USA, vol. 80, 1983, pages 726 - 30 |
| WU, JIE ET AL.: "Identification, Characterization and Application of a G-Quadruplex Structured DNA Aptamer against Cancer Biomarker Protein Anterior Gradient Homolog 2", PLOS ONE, vol. 7.9, 2012, pages e46393 |
| ZHANG ET AL., MOL CELL PROTEOMICS, vol. 4, 2005, pages 144 - 155 |
Cited By (60)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10564107B2 (en) | 2005-04-25 | 2020-02-18 | Trustees Of Boston University | Structured substrates for optical surface profiling |
| US11275030B2 (en) | 2005-04-25 | 2022-03-15 | Trustees Of Boston University | Structured substrates for optical surface profiling |
| WO2016145128A1 (en) | 2015-03-09 | 2016-09-15 | Caris Science, Inc. | Oligonucleotide probes and uses thereof |
| WO2016186853A1 (en) * | 2015-05-21 | 2016-11-24 | Indiana University Research & Technology Corporation | Methods of targeting ape1/ref-1 to inhibit hypoxia signaling genes |
| US10772859B2 (en) | 2015-05-21 | 2020-09-15 | Indiana University Research And Technology Corporation | Methods of targeting APE/Ref-1 to inhibit hypoxia signaling genes |
| US11091765B2 (en) | 2015-06-29 | 2021-08-17 | Caris Science, Inc. | Therapeutic oligonucleotides |
| WO2017004243A1 (en) | 2015-06-29 | 2017-01-05 | Caris Science, Inc. | Therapeutic oligonucleotides |
| WO2017019918A1 (en) | 2015-07-28 | 2017-02-02 | Caris Science, Inc. | Targeted oligonucleotides |
| US11725023B2 (en) | 2015-07-28 | 2023-08-15 | Caris Science, Inc. | Therapeutic oligonucleotides |
| US10941176B2 (en) | 2015-07-28 | 2021-03-09 | Caris Science, Inc. | Therapeutic oligonucleotides |
| US11573177B2 (en) | 2015-09-22 | 2023-02-07 | Trustees Of Boston University | Multiplexed phenotyping of nanovesicles |
| US10928315B1 (en) | 2015-09-22 | 2021-02-23 | Trustees Of Boston University | Multiplexed phenotyping of nanovesicles |
| US11262359B2 (en) | 2016-02-05 | 2022-03-01 | NanoView Biosciences, Inc. | Detection of exosomes having surface markers |
| US12038439B2 (en) | 2016-02-05 | 2024-07-16 | Unchained Labs | Detection of exosomes having surface markers |
| US11332748B2 (en) | 2016-03-18 | 2022-05-17 | Caris Science, Inc. | Oligonucleotide probes and uses thereof |
| CN109715802A (zh) * | 2016-03-18 | 2019-05-03 | 卡里斯科学公司 | 寡核苷酸探针及其用途 |
| EP4339288A2 (en) | 2016-03-18 | 2024-03-20 | Caris Science, Inc. | Oligonucleotide probes and uses thereof |
| US10731166B2 (en) | 2016-03-18 | 2020-08-04 | Caris Science, Inc. | Oligonucleotide probes and uses thereof |
| WO2017161357A1 (en) * | 2016-03-18 | 2017-09-21 | Caris Science, Inc. | Oligonucleotide probes and uses thereof |
| IL261832B (en) * | 2016-03-18 | 2022-12-01 | Caris Science Inc | Oligonucleotide probes and uses thereof |
| US20230250437A1 (en) * | 2016-03-18 | 2023-08-10 | Caris Science, Inc. | Oligonucleotide probes and uses thereof |
| JP2019516393A (ja) * | 2016-03-18 | 2019-06-20 | カリス サイエンス インコーポレイテッド | オリゴヌクレオチドプローブおよびその使用 |
| EP3828272A1 (en) | 2016-03-18 | 2021-06-02 | Caris Science, Inc. | Oligonucleotide probes and uses thereof |
| IL261832B2 (en) * | 2016-03-18 | 2023-04-01 | Caris Science Inc | Oligonucleotide probes and their uses |
| IL263170B2 (en) * | 2016-05-25 | 2023-05-01 | Caris Science Inc | Oligonucleotide probes and their uses |
| WO2017205686A1 (en) | 2016-05-25 | 2017-11-30 | Caris Science, Inc. | Oligonucleotide probes and uses thereof |
| AU2023237051B2 (en) * | 2016-05-25 | 2025-05-08 | Caris Science, Inc. | Oligonucleotide probes and uses thereof |
| IL263170A (en) * | 2016-05-25 | 2018-12-31 | Caris Science Inc | Oligonucleotide probes and their uses |
| US12606814B2 (en) | 2016-05-25 | 2026-04-21 | Caris Science, Inc. | Oligonucleotide probes and uses thereof |
| US11293017B2 (en) | 2016-05-25 | 2022-04-05 | Caris Science, Inc. | Oligonucleotide probes and uses thereof |
| AU2017271579B2 (en) * | 2016-05-25 | 2023-10-19 | Caris Science, Inc. | Oligonucleotide probes and uses thereof |
| US11191775B2 (en) | 2016-06-17 | 2021-12-07 | Hoffmann-La Roche Inc. | PAPD5 and PAPD7 inhibitors for treating a hepatitis B infection |
| CN109414448A (zh) * | 2016-06-17 | 2019-03-01 | 豪夫迈·罗氏有限公司 | 用于减少PAPD5或PAPD7 mRNA治疗乙型肝炎感染的核酸分子 |
| US11534452B2 (en) | 2016-06-17 | 2022-12-27 | Hoffmann-La Roche Inc. | Nucleic acid molecules for reduction of PAPD5 or PAPD7 mRNA for treating hepatitis B infection |
| WO2018081193A1 (en) * | 2016-10-25 | 2018-05-03 | Purdue Research Foundation | Conjugates for sensing |
| WO2018207024A1 (en) * | 2017-05-08 | 2018-11-15 | Augmanity Nano Ltd | Treatment of rapidly evolving biological entities |
| CN110913910A (zh) * | 2017-05-08 | 2020-03-24 | 奥曼尼提纳米有限公司 | 快速进化的生物实体的治疗 |
| US11484546B2 (en) | 2017-10-16 | 2022-11-01 | Hoffman-La Roche Inc. | Nucleic acid molecule for reduction of PAPD5 and PAPD7 mRNA for treating hepatitis B infection |
| US12303525B2 (en) | 2017-10-16 | 2025-05-20 | Hoffman-La Roche Inc. | Nucleic acid molecule for reduction of PAPD5 and PAPD7 mRNA for treating hepatitis B infection |
| US10953034B2 (en) | 2017-10-16 | 2021-03-23 | Hoffmann-La Roche Inc. | Nucleic acid molecule for reduction of PAPD5 and PAPD7 mRNA for treating hepatitis B infection |
| CN111684078A (zh) * | 2018-02-12 | 2020-09-18 | 豪夫迈·罗氏有限公司 | 通过评价肿瘤遗传异质性来预测对治疗的应答的方法 |
| CN111684078B (zh) * | 2018-02-12 | 2024-04-19 | 豪夫迈·罗氏有限公司 | 通过评价肿瘤遗传异质性来预测对治疗的应答的方法 |
| US12510462B2 (en) | 2018-06-01 | 2025-12-30 | Unchained Labs | Compositions, systems, and methods for enhanced label-free and fluorescence-based detection of nanoparticles |
| AU2018429361B2 (en) * | 2018-06-27 | 2025-10-23 | Cs Genetics Limited | Methods for the analysis of circulating microparticles |
| US20210254136A1 (en) * | 2018-06-27 | 2021-08-19 | Cs Genetics Limited | Methods for the Analysis of Circulating Microparticles |
| EP3587589A1 (en) * | 2018-06-27 | 2020-01-01 | CS Genetics Limited | Reagents and methods for the analysis of circulating microparticles |
| WO2020002862A1 (en) * | 2018-06-27 | 2020-01-02 | Cs Genetics Limited | Methods for the analysis of circulating microparticles |
| US11279929B2 (en) | 2018-07-03 | 2022-03-22 | Hoffmann-La Roche, Inc. | Oligonucleotides for modulating Tau expression |
| US11753640B2 (en) | 2018-07-03 | 2023-09-12 | Hoffmann-La Roche Inc. | Oligonucleotides for modulating Tau expression |
| US12163131B2 (en) | 2018-07-03 | 2024-12-10 | Hoffmann-La Roche Inc. | Oligonucleotides for modulating Tau expression |
| US11274308B2 (en) | 2018-07-26 | 2022-03-15 | Bracco Imaging S.P.A. | ICAM-1 aptamers, diagnostic and therapeutic uses thereof |
| WO2020020947A1 (en) * | 2018-07-26 | 2020-01-30 | Bracco Imaging Spa | Icam-1 aptamers, diagnostic and therapeutic uses thereof |
| US11859187B2 (en) | 2020-06-25 | 2024-01-02 | The Procter & Gamble Company | Aptamers for personal health care applications |
| US12359205B2 (en) | 2020-06-25 | 2025-07-15 | The Procter & Gamble Company | Aptamers for personal health care applications |
| CN112535886B (zh) * | 2020-11-12 | 2022-07-12 | 杭州苏铂科技有限公司 | 去除金纳米棒溶液中的ctab的方法 |
| CN112535886A (zh) * | 2020-11-12 | 2021-03-23 | 杭州苏铂科技有限公司 | 去除金纳米棒溶液中的ctab的方法 |
| CN115754293A (zh) * | 2022-11-07 | 2023-03-07 | 四川大学华西第二医院 | Vwf糖基化蛋白的检测试剂在制备筛查患肺癌风险的试剂盒中的用途 |
| EP4686766A1 (en) * | 2024-08-01 | 2026-02-04 | Siemens Healthineers AG | Biomarkers and methods for the early detection of hepatocellular carcinoma |
| WO2026027357A1 (en) * | 2024-08-01 | 2026-02-05 | Siemens Healthineers Ag | Biomarkers and methods for the early detection of hepatocellular carcinoma |
| WO2026074434A1 (en) * | 2024-10-01 | 2026-04-09 | Fondazione Istituto Italiano Di Tecnologia | Rad51/brca2 complex aptamers and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US20210062270A1 (en) | 2021-03-04 |
| IL244236A0 (en) | 2016-04-21 |
| AU2014312211A1 (en) | 2016-03-10 |
| CN105980615A (zh) | 2016-09-28 |
| BR112016004153A2 (pt) | 2019-09-17 |
| EP3039174B1 (en) | 2019-10-16 |
| IL269693A (en) | 2019-11-28 |
| US20160319361A1 (en) | 2016-11-03 |
| EP3039174A4 (en) | 2017-09-27 |
| WO2015031694A3 (en) | 2015-06-04 |
| KR20160080815A (ko) | 2016-07-08 |
| EP3039174A2 (en) | 2016-07-06 |
| AU2019200115A1 (en) | 2019-01-31 |
| CA2922689A1 (en) | 2015-03-05 |
| JP2016533752A (ja) | 2016-11-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2021269417B2 (en) | Aptamers and uses thereof | |
| US20210062270A1 (en) | Oligonucleotide probes and uses thereof | |
| US20220170021A1 (en) | Oligonucleotide probes and uses thereof | |
| US10942184B2 (en) | Aptamers and uses thereof | |
| US9939443B2 (en) | Compositions and methods for aptamer screening | |
| US20170356903A1 (en) | Oligonucleotide probes and uses thereof | |
| US20200376022A1 (en) | Oligonucleotide probes and uses thereof | |
| EP3314027A1 (en) | Therapeutic oligonucleotides | |
| WO2017019918A1 (en) | Targeted oligonucleotides | |
| EP3268476A1 (en) | Oligonucleotide probes and uses thereof | |
| CA2979361C (en) | Method of preparing oligonucleotide libraries | |
| Class et al. | Patent application title: COMPOSITIONS AND METHODS FOR APTAMER SCREENING Inventors: David Spetzler (Paradise Valley, AZ, US) Valeriy Domenyuk (Tempe, AZ, US) Tassilo Hornung (Tempe, AZ, US) Günter Mayer (Bonn, DE) Michael Famulok (Bonn, DE) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14840036 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 244236 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2922689 Country of ref document: CA Ref document number: 2016537869 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14915249 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2014840036 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2014840036 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112016004153 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2014312211 Country of ref document: AU Date of ref document: 20140828 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20167007928 Country of ref document: KR Kind code of ref document: A |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14840036 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 112016004153 Country of ref document: BR Kind code of ref document: A2 Effective date: 20160225 |