WO2014189306A1 - 항 TNF-α/CXCL10 이중 타겟 항체 및 그의 용도 - Google Patents

항 TNF-α/CXCL10 이중 타겟 항체 및 그의 용도 Download PDF

Info

Publication number
WO2014189306A1
WO2014189306A1 PCT/KR2014/004579 KR2014004579W WO2014189306A1 WO 2014189306 A1 WO2014189306 A1 WO 2014189306A1 KR 2014004579 W KR2014004579 W KR 2014004579W WO 2014189306 A1 WO2014189306 A1 WO 2014189306A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
tnf
antibody
amino acid
variable region
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2014/004579
Other languages
English (en)
French (fr)
Korean (ko)
Other versions
WO2014189306A8 (ko
Inventor
강흔수
박소현
송영욱
신기철
이은영
이은봉
박영우
박범찬
이동희
김동진
윤선하
이기세
이현주
김경진
김희찬
유석호
장명희
장세일
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Research Institute of Bioscience and Biotechnology KRIBB
SNU R&DB Foundation
Metabolic Engineering Laboratories Co Ltd
Original Assignee
Korea Research Institute of Bioscience and Biotechnology KRIBB
SNU R&DB Foundation
Metabolic Engineering Laboratories Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP14801159.6A priority Critical patent/EP3000827B1/en
Application filed by Korea Research Institute of Bioscience and Biotechnology KRIBB, SNU R&DB Foundation, Metabolic Engineering Laboratories Co Ltd filed Critical Korea Research Institute of Bioscience and Biotechnology KRIBB
Priority to JP2016515273A priority patent/JP2016520595A/ja
Priority to US14/893,071 priority patent/US10087248B2/en
Priority to BR112015029224A priority patent/BR112015029224A2/pt
Priority to CN201480029427.2A priority patent/CN105263964A/zh
Priority to AU2014269287A priority patent/AU2014269287B2/en
Priority to HK16111369.2A priority patent/HK1223112A1/en
Priority to CA2913118A priority patent/CA2913118A1/en
Publication of WO2014189306A1 publication Critical patent/WO2014189306A1/ko
Anticipated expiration legal-status Critical
Priority to PH12015502601A priority patent/PH12015502601A1/en
Publication of WO2014189306A8 publication Critical patent/WO2014189306A8/ko
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/241Tumor Necrosis Factors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/02Nasal agents, e.g. decongestants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/04Antipruritics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00General protective or antinoxious agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/46Hybrid immunoglobulins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/545Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/64Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising a combination of variable region and constant region components
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Definitions

  • the present invention relates to a TNF-a / CXCL-10 double target antibody that specifically binds to TNF—a (tumor necrosis factor-alpha) and CXCLKKC—X—C motif chemokine 10).
  • the antibody is connected to Paul Lee peptide disulfide bond (disulfide bond) of the large heavy chain (heavy chain) with a molecular weight of smaller light chain (light chain) molecular weight to form a release dimer (heterodimer), body two releasing dual It is then connected by disulfide bonds to form tetraiiiers.
  • the polypeptide that makes a heavy chain is composed of four domains. From the N-terminus, the polypeptide consists of a variable region, a ball region, a constant region 2, and a constant region 3.
  • the polypeptide that forms a light chain consists of two domains. It consists of variable region and constant region from N-terminal. Among them, the conjugate of the variable region of the heavy chain and the variable region of the light chain is combined with one antigen.
  • the reaction between the labeled chemical marker, antigen, and its antibody ' reveals a high degree of specificity.
  • An antigenic site that interacts with an antibody is called an antigenic determinant or epitope, and the antigenic determinant and the variable region that is the antigen binding site of the antibody bind specifically do. Therefore, the antigen binding site can bind only one epitope, so that many antibodies can each provide specific immunity to antigens that carry specific determinants.
  • Bispecific antibodies have attracted attention as pharmaceuticals because of their high stability in blood and low antigenicity.
  • Bispecific antibodies can be roughly divided into two types. In the first case, the antibody is modified by recombinant DNA technology to have an antigen binding site capable of binding to two different antigens. In this case, one binding site is specific for an antigen and the second binding site is used. Can bind to two antigens simultaneously as antibodies specific for another antigen (Beck A et. Al., Nat Rev immunology 10; 345 352, 2010).
  • the second type of bispecific antibody is a very recently developed antibody that is a normal antibody with one antigen-binding site.
  • bispecific antibodies have the advantage of high target specificity because they can act by binding to specific toxic cells and target cells.
  • TNF- ⁇ blockers etanercept, infliximab, adal imumab, etc.
  • anakinra a recombinant interleukin ⁇ 1 receptor antagonist
  • inter leukin ⁇ 6 antagonists toci 1 izumab
  • CTLA4Ig abatacept
  • ⁇ eel 1 depleting agent rituximab
  • TNF- ⁇ tumor necrosis factor-alpha
  • B and T lymphocytes immune cells including B and T lymphocytes, non-immune cells, and various tumor cells
  • TNF-a is improperly produced in inflammatory diseases such as rheumatoid arthritis
  • various cells of the immune system are activated to induce cytotoxic effects, and reactions such as inflammation, tissue destruction, and organ damage appear.
  • TNF—a The main biological actions of TNF—a are first to regulate growth, differentiation and metabolism in various types of cells; Second, it stimulates lipolysis, inhibits lipoprotein lipase activity present in adipocytes, stimulates hepatic lipogenesis and induces cachexia; And third, induces apoptosi s.
  • TNF— ⁇ may exist in free form or in membrane-bound form. Both forms of TNF- ⁇ induce very strong inflammatory reactions in cells and promote disease states in tissues. TNF- ⁇ bound to the cell membrane exhibits cytotoxic and inflammatory effects through cell-to-cell contact, and is freed from the cell membrane by TNF- ⁇ converting enzyme (TACE) to exist outside the cell.
  • TACE TNF- ⁇ converting enzyme
  • TNF-a exhibits biological activity by binding to two receptors, TNF type I receptor (p55) or TNF type II receptor (p75), in bloodemia.
  • TNF type I receptor p55
  • TNF type II receptor p75
  • over-produced TNF-a stimulates macrophages in patients with rheumatoid arthritis to produce inflammatory mediators that amplify inflammatory reactions, and induce adhesion molecules in vascular endothelial cells to inflame more inflammatory cells. It is able to gather to the site where this occurred, causing fibroblasts to produce proteases that damage cartilage, bones and ligaments and worsen the disease.
  • TNF- ⁇ inhibitors were first commercialized and marketed after the first approval of etanercept from the US Food and Drug Administration for the treatment of rheumatoid arthritis in November 1998, and infliximab and adalimumab are on the market. It is becoming.
  • treatment reactions to TNF- ⁇ inhibitors vary from patient to patient, as the activity of the disease and its corresponding structural impairment, the effect on disease quality of life, and the symptoms and signs caused by the disease vary. It can vary.
  • the sensitivity to the drug, the manifestation of the effect, or side effects may also appear in various ways.
  • TNF-a inhibitors Different constituents, specific mechanisms of action, pharmacological mechanisms, and biopharmaceutical properties differ among the various types of TNF-a inhibitors.
  • Animal studies demonstrating the efficacy of TNF- ⁇ inhibitors use human TNF- ⁇ transgenic (Tg) mice, which develop arthritis similar to rheumatoid arthritis at 4-5 weeks of age, and from 9 to 10 weeks of age. Significant range of motion limitation of the lower limb joint is observed.
  • CXCL10 C-X-C motif chemokine 10
  • IP # 10 interferon gamma inducible protein 10
  • CXCL10 has cheino tactic activity and is known to be involved in mitogenic activity. It is secreted by a variety of cells, including endothelial cells, monocytes, fibroblasts and keratinocytes in response to IFN- ⁇ and also dermal macrophages and endothelial cells in delayed type hypersensitivity (DTH) in human skin. Turned out to be present in. In addition, it can be induced by IFN- ⁇ in dendritic cells as well as by induction by native IFN- ⁇ and can be induced in central nervous system cells by stimulation such as IFN-x, virus and lipopolysaccharide.
  • CXCR3 The receptor for CXCL10 has been identified as CXCR3, seven transmembrane receptors.
  • CXCR3 is expressed in activated T lymphocytes and monocytes, synovial cells, endothelial cells, Mi cells, and eosinophils.
  • Two different ligands of CXCR3, MIGdiionocyte / macrophage activating, I FN- ⁇ -inducible protein) and I—TACCIFN- -inducible T cell al ha chenioat tracUnt 1) are also known to bind CXCR3. Binding of CXCL10 to CXCR3 mediates calcium mobilization and chemotaxis in activated T cells and activated NK cells. Within the thymus CXCL10 was found to be a chemical attractant (chemoaUractant) for TCRa i3 + CD8 + T cells, TCRy ⁇ + T cells and ⁇ —type cells.
  • chemoaUractant chemical attractant
  • CXCL10 or its receptor, CXCR3 has been identified in a variety of other inflammatory and autoimmune diseases including multiple sclerosis, rheumatoid arthritis, ulcerative colitis, hepatitis, inflammatory myositis, spinal cord injury, systemic lupus erythematosus, transplant rejection, Sjogren's syndrome.
  • CXCL10 specifically acts on the inflammatory response or immune response other than the cheiiiot axis in these diseases, and how important it is as a therapeutic target.
  • Neutralizing multiple targets with one type of antibody may be a more effective therapeutic agent than monoclonal antibody therapies targeting single antigens in the treatment of autoimmune diseases, where numerous inflammatory mediators contribute to etiology.
  • Efforts to recognize two targets with antibodies made from a combination of two different antibodies have already been reported by several researchers. Recent studies (Bostrom et al. Science 2009) screen for antibodies that simultaneously neutralize vascular endothelial growth factor (VEGF) in antibody libraries that mutated the light chain CDRs of antibodies that recognize human epidermal growth factor receptor 2 (HER2). Succeeded.
  • VEGF vascular endothelial growth factor
  • the antibody is a bispecific dual antibody that recognizes both mediators that contribute to the pathogenesis of a disease, in particular, having the same structure as a normal IgG, predictable pharmacokinetic properties, and bi or monovalent. ) Has the advantage of making all antibodies.
  • many papers and patent documents are referenced and their citations are indicated.
  • the disclosures of cited papers and patent documents are The level of the technical field to which the present invention pertains and the content of the present invention are more clearly described by reference to the present specification as a whole.
  • the present inventors have tried to develop a bispecific antibody that specifically binds to TNF- ⁇ and CXCL10, and as a result, scFv having a heavy chain variable region and a light chain variable region of CXCL10 specific antibody is identified as a heavy chain constant region of TNF—a specific antibody.
  • An antibody was prepared in the form of a C-terminally bound antibody, and the antibody was confirmed to bispecifically bind to TNF—a and CXCL10, and TNF-a / CX—10 that specifically binds to TNF—a and CXCL10.
  • the present invention was completed by experimentally identifying that the dual target antibody has the ability of inhibiting TNF-a and inhibiting osteoclast differentiation.
  • an object of the present invention is to provide a TNF-a / CXCL-10 dual target antibody that specifically binds to TNF-a (tumor necrosis factor-alpha) and CXCL10 (C-X-C motif chemokine 10).
  • Another object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of immune diseases, including TNF-a / CXCL-10 dual target antibody.
  • the present invention provides a first antigen binding site that specifically binds to TNF- ⁇ (tumor necrosis factor-alpha), and an agent that specifically binds to CXCL10 (C—XC motif chemokine 10). 2 antigen binding site,
  • HCDR heavy chain complementarity determining region
  • HCDR2 comprising an amino acid of SEQ ID NO: 2
  • amino acid of SEQ ID NO: 3 A light chi complementarity determining region (LCDR) 1 comprising a heavy chain variable region (VH) comprising HCDR3, comprising an amino acid of SEQ ID NO: 5, an LCDR 2 comprising an amino acid of SEQ ID NO: 6,
  • a light chain variable region (VL) comprising LCDR3 comprising the amino acid of SEQ ID NO: 7,
  • the second antigen binding site is composed of HCDR1 SEQ ID NO: 10, SEQ ID NO: 18, SEQ ID NO: 22, and SEQ ID NO: 26 including amino acids selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 17, SEQ ID NO: 21, and SEQ ID NO: 25
  • a heavy chain variable region (VH) comprising an HCDR2 comprising an amino acid selected from the group comprising SEQ ID NO: 11, SEQ ID NO: 19, SEQ ID NO: 23, and SEQ ID NO: 27
  • LCDR1 comprising an amino acid selected from the group consisting of SEQ ID NO: 13, SEQ ID NO: 29, SEQ ID NO: 33, and SEQ ID NO: 37, and comprising an amino acid selected from the group consisting of SEQ ID NO: 14, SEQ ID NO: 30, SEQ ID NO: 34, and SEQ ID NO: 38
  • LCDR comprising an amino acid selected from the group consisting of LCDR2, SEQ ID NO: 15, SEQ ID NO: 31, SEQ ID NO: 35, and SEQ ID NO:
  • TNF-a / CXCL-10 dual target antibody is provided.
  • the present inventors have tried to develop a bispecific antibody that specifically binds to TNF— ⁇ and CXCL10.
  • scFv having a heavy chain variable region and a light chain variable region of a CXCL10 specific antibody is identified as a heavy chain constant region of a TNF— ⁇ specific antibody.
  • An antibody of the form C-terminally bound was prepared, and the antibody was confirmed to bispecifically bind to TNF— ⁇ and CXCL10, and TNF-a / CXCL-10 that specifically binds to TNF— ⁇ and CXCL10. It was experimentally found that the dual target antibody has TNF—a inhibitory activity and osteoclast differentiation inhibitory activity.
  • the antibody used in the present invention is a TNF- ⁇ / CXCL-10 dual target antibody that specifically binds a tumor necrosis factor-alpha (TNF-a) and a CXC motif chemokine 10 (CXCL10).
  • the antibody of the invention is a human antibody.
  • human antibody refers to an antibody from which the sequences of the variable and constant regions of the heavy and light chains are derived from humans, as described in the Examples below.
  • Engineering techniques were used to prepare TNF-a / CXCL-10 dual target human antibodies.
  • Human antibodies have advantages over non-human and chimeric antibodies: effector portions of human antibodies interact better with other parts of the human immune system (eg, complementarity-dependent cytotoxicity (CDC) or antibody-dependent cells). Cytotoxicity (ADCC) destroys the target cells more efficiently), which is why the immune response to antibodies introduced into the body is not exogenous to the exogenous non-human antibody or partially exogenous because the human immune system does not recognize human antibodies as foreign substances. Less compared to chimeric antibodies, etc.-.
  • human antibodies have a much shorter half-life in the human circulation than the half-life of human antibodies.
  • human antibodies introduced into vivo are more useful because they have substantially the same half-life as naturally occurring human antibodies, thereby reducing the dose and frequency of administration.
  • variable region refers to a portion of an antibody molecule that exhibits many variations in sequence while performing a function of specifically binding to an antigen, and CDRl, CDR2 and CDR3 are present in the variable region.
  • a framework region (FR) portion exists between the CDRs to support the CDR rings.
  • complementarity determining region is a ring-shaped region that is involved in the recognition of an antigen, and as the sequence of this region changes, the specificity of the antibody to the antigen is determined.
  • the term “panning” refers to a surface of a peptide having the property of binding to a target molecule (antibody, enzyme, cell surface receptor, etc.) from a phage library that displays the peptide on the coat of the phage. It refers to the process of selecting only phages that are expressed in.
  • the dual target antibody includes a first antigen binding site that specifically binds to TNF- ⁇ , and a second antigen binding site that specifically binds to CXCL10,
  • the first antigen binding site comprises a heavy chian complementarity determining region (HCDR) 1 consisting of the amino acid sequence of SEQ ID NO: 1, HCDR2 consisting of the amino acid sequence of SEQ ID NO: 2, HCDR3 consisting of the amino acid sequence of SEQ ID NO: 3
  • Light chian complementarity determining region (LCDR) 1 comprising a heavy chain variable region (VH) comprising amino acid sequence of SEQ ID NO: 5
  • LCDR2 consisting of the amino acid sequence of SEQ ID NO: 6
  • a light chain variable region (VL) comprising an LCDR3 composed of sequences
  • the second antigen binding site is HCDR1 comprising an amino acid selected from the group consisting of SEQ ID NOs: 9, 17, 21 and 25, HCDR2 comprising an amino acid selected from the group consisting of SEQ ID NOs: 10, 18, 22 and 26, sequence A heavy chain variable region (VH) comprising HCDR3 comprising an amino acid selected from the group consisting of numbers 11, 19, 23, and 27,
  • LCDR1 comprising an amino acid selected from the group consisting of SEQ ID NOs: 13, 29, 33, and 37
  • LCDR2 comprising an amino acid selected from the group consisting of SEQ ID NOs: 14, 30, 34, and 38, SEQ ID NOs: 15, 31, 35 and It is preferred to include, but is not limited to, a light chain comprising a light chain variable region (VL) comprising an LCDR3 comprising an amino acid selected from the group consisting of 39 or a fragment thereof.
  • VL light chain variable region
  • the second antigen binding site comprises a heavy chain variable region (VH) comprising HCDR1 comprising an amino acid of SEQ ID NO: 9, HCDR2 comprising an amino acid of SEQ ID NO: 10, HCDR3 comprising an amino acid of SEQ ID NO: 11, and ,
  • VH heavy chain variable region
  • VL light chain variable region
  • LCDR1 comprising an amino acid of SEQ ID NO: 13
  • LCDR2 comprising an amino acid of SEQ ID NO: 14
  • LCDR3 comprising an amino acid of SEQ ID NO: 15.
  • the second antigen binding site comprises a heavy chain variable region (VH) comprising HCDR1 comprising an amino acid of SEQ ID NO: 17, HCDR2 comprising an amino acid of SEQ ID NO: 18, HCDR3 comprising an amino acid of SEQ ID NO: 19, and a sequence A light chain variable region (VL) comprising an LCDR1 comprising an amino acid of No. 29, an LCDR2 comprising an amino acid of SEQ ID NO: 30, and an LCDR3 comprising an amino acid of SEQ ID NO: 31.
  • VH heavy chain variable region
  • VL sequence A light chain variable region
  • the second antigen binding site comprises a heavy chain variable region (VH) comprising HCDR1 comprising an amino acid of SEQ ID NO: 21, HCDR2 comprising an amino acid of SEQ ID NO: 22, HCDR3 comprising an amino acid of SEQ ID NO: 23, and a sequence A light chain variable region (VL) comprising an LCDR1 comprising an amino acid of No. 33, an LCDR2 comprising an amino acid of SEQ ID NO: 34, and an LCDR3 comprising an amino acid of SEQ ID NO: 35.
  • VH heavy chain variable region
  • VL sequence A light chain variable region
  • the second antigen binding site comprises a heavy chain variable region (VH) comprising HCDR1 comprising an amino acid of SEQ ID NO: 25, HCDR2 comprising an amino acid of SEQ ID NO: 26, HCDR3 comprising an amino acid of SEQ ID NO: 27, and a sequence A light chain variable region (VL) comprising LCDR1 comprising an amino acid of No. 37, LCDR2 comprising an amino acid of SEQ ID NO: 38, and 1XDR3 comprising an amino acid of SEQ ID NO: 39.
  • VH heavy chain variable region
  • VL sequence A light chain variable region
  • the first antigen binding site of the TNF-a / CXCL ′ 10 dual target antibody comprises a heavy chain variable region (VH) comprising an amino acid of SEQ ID NO: 4 and a light chain variable region (VL) comprising an amino acid of SEQ ID NO: 8 But is not limited thereto.
  • the second antigen binding site of the TNF-a / CXCL ′ 10 dual target antibody is a variable chain region (VH) comprising amino acids of SEQ ID NOs: 12, 20, 24 and 28 and amino acids of SEQ ID NOs: 16, 32, 36 and 40 It is preferred to include a light chain variable region (VL) including, but is not limited thereto.
  • VH variable chain region
  • VL light chain variable region
  • the TNF ⁇ a / CXa-10 dual target antibody comprises a heavy chain and a light chain of a first full length antibody that specifically binds TNF—a; And a heavy chain and a light chain of a second full length antibody that specifically binds CXCL10, wherein the first full length antibody And the heavy chain constant region O-terminus of the second full-length antibody is connected to each other, specifically, the light chain and the light chain of the first full-length antibody specifically binding to TNF— ⁇ ; And a fragment of a second full length antibody that specifically binds to CXCL10 and comprises a heavy chain and a light chain of a second antibody, wherein a fragment of the second antibody is linked to the heavy chain constant region C-terminus of the first full length antibody. (See FIG. 1).
  • the fragment of the TNF-a / CXCL-10 dual target antibody is preferably a single chain variable fragment (scF), but is not limited thereto.
  • scF single chain variable fragment
  • the TNF-a / CXCL-10 dual target antibody is preferably a linker between hing-body-antibody or hing-body-fragment, but is not limited thereto.
  • the present inventors cloned the gene of human CXCL10 to produce CXC.L10 antigen protein (see FIG. 2), and reacted with library phage to obtain scFv—phage that specifically binds to CXCL10.
  • the panning process was performed to infect E. coli and amplify it.
  • the titer of the colony to the metliptase of the phage subjected to the three-panning was amplified to 5.67 ⁇ 10 8- (see Table 1).
  • the inventors selected a monoclonal antibody from the group of three-paneled polyclonal phage antibody with a large _ phase binding capacity (see FIG. 3), and performed a ELISA analysis thereof to select a monoclonal antibody once more (Table 2). Reference). Fingerprinting and sequencing were performed to classify and test the monoclonal phages thus selected (see FIG. 4), through which the patterns and polypeptide sequences of the CDR regions of the VH and VL of the four selected monoclonal antibodies were obtained. (See Table 5 and Table 6).
  • the present inventors transformed 10E out of the four selected monoclonal phages into full-form IgG and inserted the heavy and light chains into the vector, respectively, and cotransformed them into host cells to prepare transformants. Through the whole Forms of the antibody were measured to determine the binding affinity for the CXCL10 antigen, it was confirmed that the value of 7 X 10-12 (see Table 8).
  • the present inventors cloned the selected 10E gene into a plasmid of Humira, an anti-TNF-a monoantibody, to prepare HuElO-101, a bispecific antibody for TNF-a and CXCL10 (see FIG. 1).
  • the molecular weight of the antibody thus prepared was confirmed to be about 187 kDa (see FIG. 6), and ELISA analysis confirmed that the binding force to TNF— ⁇ and CXCL10 was similar to that of HuElO-100 prepared through previous studies ( See FIG. 7).
  • the cytotoxicity of HuEl 101 antibody prepared by LAL test was 0.1 EU / IN. It confirmed that it was the following (refer FIG. 8).
  • the inventors evaluated the in vitro inhibition of TNF- ⁇ or CXCL10 of HuElO'101 prepared above. Specifically, it was confirmed that the HuE10-101 antibody had improved suppression ability compared to Humira using WEHI164 cells having a TNF-ci receptor (see FIGS. 41 and 42). It was confirmed that it has a CXCL10 inhibitory ability (see FIG. 43).
  • the invention is an expression vector comprising a polynucleotide encoding a first antigen binding site and an expression vector comprising a polynucleotide encoding a second antigen binding site is co-transformed into a host cell. It provides a transformant (co-transfection).
  • Polynucleotides encoding an antibody of the invention may be due to the degeneracy of codons or the above. In consideration of the codons preferred by the organism to express the antibody, various modifications can be made to the coding region within the range of not changing the amino acid sequence of the antibody expressed from the coding region, and the expression of the gene even in parts other than the coding region. Various modifications or formulas can be made without affecting Those skilled in the art will appreciate that such modified genes are also within the scope of the present invention. That is, as long as the polynucleotide of the present invention encodes a protein having equivalent activity, one or more nucleic acid bases may be substituted, deleted, inserted, or . Variations may be made by combinations thereof, and these are also included in the scope of the present invention. The sequence of such polynucleotides may be single or double stranded, and may be DNA molecules or RNA (mRNA) molecules.
  • mRNA RNA
  • expression control sequences such as promoters, terminators, enhancers, and the like, sequences for membrane targeting or secretion, etc., depending on the type of host cell in which the antibody is to be produced. It can be appropriately selected and various combinations depending on the purpose.
  • Expression vectors of the present invention include, but are not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors, and viral vectors.
  • Suitable expression vectors include signal sequences or leader sequences for membrane targeting or secretion in addition to expression control elements such as promoters, operators, initiation codons, termination codons, polyadenylation signals and enhancers and can be prepared in various ways depending on the purpose.
  • the promoter of the expression vector may be constitutive or inducible.
  • the signal sequence includes a PhoA signal sequence and a Q pA signal sequence when the host is Escherichia sp., And ⁇ -amylase signal sequence and subtilis when the host is Baci Hus sp.
  • the present invention comprises the steps of (a) culturing the transformant; And 2) the TNF- from the culture cultured in the step.
  • a method for preparing a TNF ′ a / CXCL10 dual target antibody comprising purifying a / CXCL-10 dual target antibody.
  • the antibody according to the present invention can be mass produced by culturing the transformed host cell. Suitable culture methods and media conditions depending on the type of host cell can be easily selected by those skilled in the art from known techniques known to those skilled in the art.
  • the host cell may be a prokaryote such as E. coli or Bacillus subtil is. It may also be eukaryotic cells derived from yeast, insect cells, plant cells or animal cells such as Saccharomyces cerevisiae. More preferably, the animal cell may be an autologous or allogeneic animal cell.
  • Transformants prepared by introducing into autologous or allogeneic animal cells may be used in cell therapies for administration to a subject to treat cancer.
  • the expression vector introduction method into the host cell may be any method known to those skilled in the art.
  • the invention is a pharmaceutically effective amount of the TNF-a / CXCL-10 dual target antibody; And (b) provides a pharmaceutical composition for the prevention or treatment of immune diseases comprising a pharmaceutically acceptable carrier.
  • the pharmaceutical composition for preventing and treating immune diseases alone or in combination with a conventional pharmaceutically acceptable carrier can be used as
  • the composition of the present invention can be usefully used as an immunosuppressive agent (i ⁇ LUIO-suppressant) for preventing graft rejection of tissues or organs mediated by immune response.
  • Graft rejection is a disease caused by the genetic background between the donor and the recipient of the graft (a cell, tissue, or organ as part of the transplanted organism) (1).
  • Graft Host diseases and (2) diseases caused by the recipient's recognition of the donor's graft as a foreign substance, ie graft rejection.
  • transplanted tissues and organs that cause rejection include heart, kidney, liver, medulla ossium, skin, cornea, lung, pancreas, intest inum uben, limbs, muscles, nerves.
  • Graft zone-host disease caused by cartilage transplantation, as well as, duodenum, small intestine (smal 1-bowel), and pancreatic-islet-cel 1.
  • composition of the present invention can be applied to the treatment and prevention of autoimmune diseases.
  • Autoimmune diseases are diseases that are caused by immune cells attacking themselves without distinguishing themselves from foreign substances.
  • autoimmune diseases include rheumatoid arthritis, systemic lupus erythematos is, E-hyperimi inoglobulin E, Hashimoto's thyroiditis, and Graves' disease.
  • Grave's Disease Multiple Sclerosis, Scleroderma, Scleroderma, Progressive Systemic Sclerosis, Myasthenia Gravis, Type I Diabetes, Uveitis allergic encephalomyelitis (allergic encephalomyelitis), ⁇ gucheo 1 nephritis (gloi erulonephr itis), vitiligo (Vitilligo), gutpae tipped Sindh name (Goodpasture syndrome), Vespa jet disease (Becet 's disease), Crohn's disease (Crohn' s Disease, Ankylosing Spondylitis, Uvei tis, Thrombocytopenic purpura, Pemphigus vulgaris, Diabetes, Autoimmune hemolytic anemia utoimmune Anemia, Cryoglobulinemia, Adrenal Protein Ditrophy (ALD) and Systemic Lupus Erythematosus (SLE).
  • ALD Adrenal Protein Ditrophy
  • SLE Systemic Lupus Erythemato
  • composition of the present invention can also be used for the treatment and prevention of skin manifestations of inflammatory and hyperproliferative skin diseases and immune mediated diseases.
  • diseases are for example psoriasis, atopic dermatitis, contact dermatitis, eczema Dermatitis (eczematous dermatitises), seborrhoeis dermatitis, lichen planus, pemphigus, bullous pemphigoid, vesicular epidermolysis bullosa, urtic icaria, angioedema angioedemas, vascul it ides, erythemas, cutaneous eosinophi 1 ias, lupus erythematosus, Systemic Lupus Erythematosus (SLE), acne And Alopecia areata.
  • compositions of the present invention can be used for the treatment or prevention of eye diseases or various autoimmune diseases.
  • these diseases include keratoconjunctivitis (keratoconjunct ivi t is), chungyeo l z l "conjunctivitis (vernal conjunct ivi t is), keratitis (keratitis), herpes keratitis (herpetic keratitis), epithelial corneal muscular atrophy (dystrophia epithel ial is corneae ), Corneal leukoma, ocular pemphigus, Mooren's ulcer, scleritis, Graves' opthalmopathy, Vogts Koyanagi- Vogt -Koyanag i — Ha r ad a synd r ome), sarcoidosis, and multiple myeloma.
  • compositions of the present invention may be used for chronic obstructive pulmonary disease (COPD), asthma (eg, bronchial asthma, allergic asthma, endogenous asthma, exogenous asthma and dust asthma), especially chronic or It can also be used to treat and prevent obstructive airway diseases such as chronic asthma (eg, terminal asthma and bronchial hyperresponsiveness), bronchitis, allergic rhinitis.
  • COPD chronic obstructive pulmonary disease
  • asthma eg, bronchial asthma, allergic asthma, endogenous asthma, exogenous asthma and dust asthma
  • chronic airway diseases such as chronic asthma (eg, terminal asthma and bronchial hyperresponsiveness), bronchitis, allergic rhinitis.
  • the pharmaceutically acceptable contained in 'the pharmaceutical compositions of this invention lactose, dextrose, sucrose, sorbitan frame, the manni, starch, gum acacia, calcium phosphate, alginates , Gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyridone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, stearic acid magnesium and mineral oil Including but not limited to It is not.
  • the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.
  • a lubricant e.g., talc, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, a sulfate, a glycerol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannito
  • the pharmaceutical composition of the present invention may be administered orally or parenterally, and in the case of parenteral administration, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, endothelial administration, topical administration , intranasal administration, intrapulmonary administration and rectal administration Or the like.
  • parenteral administration intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, endothelial administration, topical administration , intranasal administration, intrapulmonary administration and rectal administration Or the like.
  • oral compositions should be formulated to coat the active agent or to protect it from degradation in the stomach.
  • the pharmaceutical composition may also be administered by any device in which the active agent may migrate to the target cell.
  • Suitable dosages of the pharmaceutical compositions of the present invention vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion, and reaction response to the patient. Typically, the skilled practitioner can readily determine and prescribe a dosage effective for the desired treatment or prophylaxis. According to a preferred embodiment of the present invention, the pharmaceutical composition of the present invention and the daily dose is 0.001-100 rag / kg. As used herein, the term "pharmaceutically effective amount" means an amount sufficient to prevent or treat an immune disease.
  • compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container.
  • the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or may be in the form of axles, powders, suppositories, powders, granules, tablets or capsules, and may further include a dispersant or stabilizer.
  • the antibody composition of the present invention may be administered as a separate therapeutic agent or in combination with other therapeutic agents and may be administered sequentially or simultaneously with conventional therapeutic agents.
  • Antibodies can be introduced in vivo in the form of antibody-therapeutic conjugates to be used for the treatment of immune diseases.
  • Therapeutic agents include chemotherapeutic agents, radionuclides, immunotherapeutics, cytokines, chemokines, toxins, biological agents and enzyme inhibitors. Methods for binding antibiotics to antibodies are described, for example, in G. Gregoriadies, eel. Academic Press London, (1979); Arnon et al. , Recent Results in Cancer Res. , 75: 236 (1980); and Moo It on et al,, Immunolog. Res. , 62:47 (1982).
  • Preferred agents for coupling with the antibodies or antibody fragments of the invention are antibacterial, antiparasitic, antifungal and related agents, for example sulfonamides, penicillins and cephalosporins, aminoglycosides, tetracyclines, chloramphenicols, piperazine, chloroquine , Diaminopyridine, metronidide, isoniazid, rifampin, straptomycin, sulfone, erythromycin, polymyxin, nystatin, amphotericin, 5-fluorocytosine, 5-iodine—2 'deoxyuridine , 1-adamantaamine, adenine arabinoside, ammannitine, ribovarin and azithrothymidine (AZT), preferably ribovarin.
  • sulfonamides for example sulfonamides, penicillins and cephalosporins, aminoglycosides, tetracyclines, chloramphen
  • Immunomodulators that can be used as therapeutic agents in the antibody ⁇ therapeutic agent conjugate include, but are not limited to, lymphokines and cytokines.
  • the dual target antibody of the present invention is a bispecific antibody that effectively binds both TNF— ⁇ and CXCL10, TNF—a / CXCL10 can be recognized. It can be usefully used as an exogenous target antibody.
  • composition of the present invention comprises a TNF-a / CXa-10 supporting target antibody that effectively binds both TNF- ⁇ and CXCL10.
  • Dual target antibodies of the invention have superior TNF—a inhibitory activity and osteoclast differentiation inhibitory activity as compared to TNF-a or CXCL10 single target antibody.
  • composition of the present invention can be used for the prevention or treatment of immune diseases.
  • FIG. 1 is a schematic diagram of preparation of a TNFVII a / CXCL10 bispecific antibody.
  • Figure 2 shows the results of the purification of human CXCL10 protein purified using Ni-NTA column chromatography.
  • Fig. 3 shows the results of poly ⁇ phage EL ISA analysis of human CXCL10—His using phage pools after each panning.
  • the result is a BstNI fingerprint.
  • the scFv inserts were amplified from individual colonies and the amplified products were analyzed with 8% polyacrylamide gels limited to BstNI ' . Clones marked with blue letters show different groups.
  • Figure 6 shows the results of purity analysis of the purified HuElO- 101 double antibody.
  • Figure 7 is a graph measuring the binding force of the HuElO- 101 double antibody to the antigen.
  • FIG. 8 shows the results of examining the cytotoxicity of purified HuElO-101 dual antibodies.
  • 9 is a map of HuE10-101 expression vector for production cell line construction.
  • Figure 10 shows the results of the HuElO-101 expression according to the transfection conditions.
  • 11 is an image of colonies screened using DHFR.
  • 12 shows the results obtained by dot-blotting the HuElO-101 expression in a single clone selected using DHFR.
  • Figure 13 is the result of comparing the relative expression amount of single clones selected using DHFR by ELISA method.
  • FIG. 14 is a graph showing 29 clones selected according to a relatively high ELISA score in the results of FIG. 13.
  • 16 is a micrograph of preliminary cell lines growing in medium containing 100 nM MTX.
  • FIG. 17 shows the HuElO-101 expression levels of three clones with high expression rates at 100 nM MTX.
  • 19 shows the result of confirming the N-terminal amino acid sequence of HuElO-101.
  • 20 shows peptide mapping results of HuE10-K) l.
  • Fig. 25 shows evaluation results of anti-TNF- ⁇ inhibitory activity of Humira, Humira cloned antibody, HuE10-101, HuIL21R-101 and HuIL21R-100.
  • Fig. 26 is a graph showing the results of evaluating coins capacity of HuElO—101 for CXCL10.
  • NC negative control
  • PC positive control
  • PBMC peripheral blood mononuclear cell
  • PC positive control (left: Jurkat T cell, oh: PBMC)
  • Fig. 29 shows the results of measuring the inhibitory effect of osteoclast differentiation by anti—TNF— ⁇ and anti-CXCL10 (TRAP positive multinucleated cell count results).
  • FIG. 30 shows the results of TNF-Q neutralization evaluation in order to evaluate the efficacy of antibodies produced in production cell lines.
  • Figure 31 is a result of measuring the arthritis induction score after the administration of Humira and Humira clone antibody by concentration.
  • 35 is a result of measuring the arthritis induction score after HuElO-101 by concentration.
  • 36 shows the results of measuring weight change after administration of HuElO-101 by concentration.
  • Figure 37 shows the result of measuring the histological score after administration of HuElO-101 by concentration.
  • FIG. 41 shows the results of pathological changes of the Tgl97 mouse tissue obtained after the experiment.
  • Fig. 43 shows the result of comparing HuElO—101 produced in the producing cell line with the arthritis induction score and the histological score.
  • Fig. 47 shows the bones identified using micro CT in the K / BxN serum transfer arthritis mouse model.
  • 48 shows the results of histopathological lesions in the K / BxN serum transfer arthritis mouse model.
  • 49 is a schematic diagram of the evaluation of osteoclast differentiation capacity of HuElO-101 in LPS-induced inflammatory bone loss mouse model.
  • FIG. 51 shows the results of evaluating osteoclast differentiation capacity of HuElO-101 produced in production cell line in LPS-induced inflammatory bone loss mouse model.
  • FIG. 52 shows the results of quantitative analysis of osteoclast differentiation capacity of HuElO-101 produced in production cell line in LPS-induced inflammatory bone loss mouse model.
  • FIG. 53 is a schematic diagram of the efficacy evaluation of HuE10-101 in the collagen-induced arthritis mouse model.
  • Fig. 54 shows the result of confirming the cross-reaction of ⁇ hiElO 1 1 using three tissues of three non-overlapping tissues.
  • human CXCL10 protein was expressed and purified. Specifically, spleen, placenta, liver and kidney cDNA library mixes were inserted into the pET22b vector to amplify human CXCL10.
  • pET22b human CXCL10 plasmid
  • the obtained transformants were inoculated into LB plates containing ampicillin (ampicillin), and then cultured overnight, followed by shaking culture at 37 ° C. Then, when the OD600 value was 0.55, IPTG was added at a concentration of 0.5 mM, followed by incubation overnight, and centrifuged at 6 ° 500 rpm and 4 ° C. for 15 minutes to obtain a supernatant. The obtained supernatant was concentrated and reacted with Ni—NTA agarose, followed by elution after filling the agarose beads into a column. After concentration, a 15% SDS-PAGE gel was used and stained with coomassiae-.
  • Panning is based on the phage library expressing the peptide on the surface of the phage, and expresses only the phage expressing the peptide on the surface having the property of binding to the target molecule (antibody, enzyme, cell surface receptor, etc.). The process of selection. Phage panning was performed to prepare a group of phage antibodies for producing monoclonal antibodies of CXCL10. Purified human CXCL10 antigen 100 obtained in Example 1 was added to an Immunosorb tube (Nunc 470319) with 2 inf.
  • the eluted phages were amplified by infection with E. coli (XLl-Blue, stratagene, 200249). Phage amplified in the first panning 8 g of PBST (140 mM NaCKsigma, S7953-5 kg), 1.15 g of 10 mM Na 2 HP0 4 (Sigma, S7907-dibasic), 1.8 mM H 2 P0 4 (sigma, S— 5655— 500 g: monobasic) 0.2 g, 2.7 mM CKsigma p9541) 0.2 g, Twen 20 (sigma, pl379) 0.55%) wash By increasing the number of times in the phase (2nd: 13 times, 3rd: 23 times)
  • the cultured cell stocks were infected with Ml helper phage and incubated in 2XYTCMK, 5 niM MgCl 2 , 1 mM IPTG medium at 30 ° C. for 16 hours.
  • the cultured cells were centrifuged at 4500 rpm for 15 minutes at 4 ° C, and then the supernatant (1st to 3rd panning poly scFv-phage) was transferred to a new tube.
  • Scheme milk (4%) coated with two types of antigens (CXCLIO, a-myc) in 96-well immune plates (NUNC 439454) with 100 ng per well of coated complete solution at 4 ° C for 16 hours. Each well was blocked using. Each well was washed with PBS P ⁇ 20 (0.05%) 0.2 in, and then 100, 1, 2, and 3 panning poly scFV-phage were added to each well and reacted at room temperature for 2 hours.
  • Ml helper phages were infected with M () I of 1:20 and then 2XYTCM, 5 Incubated in mM MgCl 2> 1 mM IPTG medium for 16 hours at 30 ° C.
  • the cultured cells were centrifuged at 4,500 rpm for 15 minutes at 4 ° C., then the supernatant was taken off with 4% PEG 6, 000 and 3%.
  • NaCl was added to dissolve well and reacted on ice for 1 hour, after 4 ° C at 8,000 rpni for 20 minutes. After centrifugation at C, PBS was added to the pellets to dissolve, then centrifuged at 12,000 rpi for 10 minutes at 4 ° C. The supernatant was taken and transferred to a new tube for third panning to store monoclonal scFv—phage at 4 ° C.
  • the colony PCR product obtained above was obtained from 1% agarose gel (Seakem LE,
  • Example ⁇ 3-1> to in the analysis of single phage clones of each of the sequence identified by fingerprinting, 2XYTCM, 2% monoclonal cell glucose, 5 niM MgCl 2 medium (5 at 37 ° C 16
  • a DNA purification kit Nuclogen, 5112
  • pelB5 primer SEQ ID NO: 43: 5 '— CTAGATAACGAGGGCAAATCATG— 3'.
  • Sequence analysis (Solgent, Korea) was commissioned to identify the CDR regions of the VH and VL of the selected antibodies.
  • the heavy chain gene obtained by PCR was purified by DNA-gel extraction kit (Qiagen) to obtain pNATAB H vector 1 (10 ng), heavy chain (100 to 200 ng) 15! ⁇ , 10 X buffer 2 ⁇ , ligase ( One 1?, Distilled water was mixed and left at room temperature for 1 to 2 hours to connect with the vector.
  • the heavy chain gene-linked pNATAB H vector was transformed on ice with the cells for transformation (coli XL1-blue) for 30 minutes. After being left, transfection was performed by heat shock at 42 ° C. for 90 seconds, and then left for 5 minutes on ice, and then incubated at 37 ° C. for 1 hour by injecting LB medium 1 1.
  • the extracted total antibody DNA was co-transfected into 293E cells (Invi trogen) with PEI 40 ⁇ g, DNA 10 / g and light chain DNA 10 / zg.
  • Supernatants from day 2 to day 8 after transfection were obtained and purified using protein A beads, and ELISA was performed to measure the binding ability of the purified human CXCL10 antibody to antigen.
  • ELISA coated the recombinant human CXCL10 protein on a 96 well immunoplate at 100 ° C per well with a coated complete solution at 4 ° C. for 16 hours, and then blocked each well using skim milk (4%) dissolved in PBS. Wash well by adding 0.2 m £ of? 83-twen20 (0.05%) to each well, and then dilute the monoclonal antibody sequentially from 50 nM by 1/2 to 100 onto an antigen-coated plate. Reaction for 2 hours at. Each well was washed three times with 0.2 iti.g of PBS-source 20 (0.05%), and the secondary antibody, anti-human Fc ⁇ HRP, was reacted with 1: 4000 and reacted for 50 minutes at room temperature.
  • ScFv was cloned into the 3 'end of pNATABH :: Humira and named HuElO-101.
  • Humira an anti-TNF- ⁇ antibody, was prepared through gene synthesis based on the amino acid sequence of the heavy chain variable region (SEQ ID NO: 4) and the amino acid sequence of the light chain variable region (SEQ ID NO: 8).
  • PCR was performed to connect the E10 scFv to the heavy chain and variable region 3'-terminus of Humira in the vector including the heavy chain region of humira. Through this, two fragments were linked to form a single DNA fragment.
  • a pNATABH :: Hum ira / E10ScFv vector was prepared to express HuElO-1 by injecting into a pNATABH vector.
  • HEK 293E cells Invitrogen
  • pNATABH Humira in a 3: 7 ratio.
  • the supernatant was obtained four times at intervals from day 2 to day 8 obtained after transfection, and the expression level of the antibody was confirmed by Western blotting (FIG. 5), and purified using protein A beads. .
  • Western blotting was performed by collecting the cell cultures at intervals into each 1 ml tube and centrifuging at 5000 rpm for 5 minutes to remove the cells. ⁇ and 125 ⁇ of each supernatant were added to each 1 ml tube and boiled for 5 minutes. 40 ⁇ l of the 10% SDS-PAGE gel was loaded and electrophoresed, and then transferred to the membrane. After blocking the membrane with 4% skim milk for about 1 hour, the second antibody, anti-Fc-HP, was added at 1/4000 and shaken at room temperature for 4 hours. lxPBST to 3 times, and then wash the hinge results were obtained by the X-eu ray photosensitive film in a darkroom, and then sprinkled with 1 ml ECL solution to the membrane.
  • Humira showed a molecular weight of 50 and 25 k.Da of the heavy and light chains under reducing conditions, and a molecular weight of the heavy and light chains of HuElO-101 appeared at 83 and 25 kDa, respectively. It was confirmed that ScFv of EK) was fused to the heavy chain region of Humira to increase the molecular weight. Under non-white-reducing conditions, HuEl 101 was found to have a molecular weight of about 187 kDa (FIG. 6).
  • Example ⁇ 4-2> Investigation of the avidity of the bispecific antibody HuElO—101 to CXCL10 and TNF- ⁇ The same method as in Example ⁇ 4-2> to confirm the specific avidity of the bispecific antibody HuElO—101 to CXCL10 or TNF- ⁇ ELISA analysis was performed.
  • HuEl 100 antibodies were analyzed and compared in the same manner.
  • the HuElO-100 antibody was produced by connecting the E10 scFv to the variable region N-terminus of the Humira heavy chain, HuE10-l such as a double antibody to TNF- ⁇ and CXCL10, Compared with HuElO-101, the amount of expression is extremely low.
  • Humira was performed by producing 43.68 mg.
  • Chr n) -LAL (cat # C003.1, CAPE COD) was used to determine bacterial endotoxin of the purified antibody.
  • the concentration was prepared so as to be 0.03125 EU / !.
  • LAL 100 ⁇ was mixed with 100 ⁇ of reference toxin (CSE) at a concentration of 0.125 EU / ml and used for the experiment.
  • CSE reference toxin
  • LAL 100 ⁇ was prepared in 100 diluted samples.
  • the reference value is set using the protocolized file (Chromo LAL sett ing.pda).
  • X axis of standard curve is Log EU / ⁇
  • Y axis is Log Onset time.
  • the cytotoxicity level of the sample is determined by the software.
  • Lc were all sub-cloned into the pOptivec vector, and the enzyme site used for DNA linearization during transfection was Pvul inside the ampicillin gene.
  • CHO DG44 cells used as expression hosts were cultured using MEM—alpha (w /) + .10% FBS + AA medium. Upon cell passing, approximately 1-2 ⁇ 10 6 cells / well were removed from the bottom using 0.25% trypsin and one third was transferred to a new well containing 2 ml of medium. Cell line development proceeded at 96-well and 6-well plate levels.
  • FIG. 11 is a micrograph of colonies formed on 96 well plates.
  • the transfected cells grow in selection medium to form colonies.
  • FIG. 12 is a result of dot-blotting to confirm the expression of the colony of FIG.
  • the medium was 30 ⁇ and was detected by anti—Fc—HRP; clones with high expression, such as orange circles, had a darker blot.
  • Figure 13 compares the relative expression levels by ELISA method in three plates of monoclonal 16 plate plate.
  • Anti— Fab antibody ELISA folate coated with ng / well was blocked using PBS containing 5%) skim milk for 2 hours. . Thereafter, colonies were selected and 100 ⁇ added. After reaction at room temperature for 2 hours and washed three times with 0.05% PBST 200 ⁇ , anti—Fc ⁇ HRP was reacted with 100 ⁇ 1 hour to 1: 5, 000 and detected using 0PD.
  • the clones shown in purple are clones with relatively high expression rates.
  • ELISA quantitative high expression and single colony formation were selected two to three per plate.
  • the red dotted line in FIG. 14 represents the mean value, and the red colon is the selected colony.
  • MTX was added to MEM—alpha (w / o) + 10% dFBS + AA medium for amplification of HuElO-101 antibody expression.
  • the initial vertical-concentration induced degeneracy from 100 nM.
  • 29 clones of HuElO-101 selected above were dispensed at 5 ⁇ 10 5 cells per well. Colony formation was observed by switching to fresh medium every two days. When the cells were full, they were divided into 5 X 10 5 cells. After passing three times, the expression rate was confirmed by ELISA. Highly expressed clones of 100 nM completed clones were amplified with 1 y M.
  • FIG. 16 is a micrograph showing colonies forming one week after initially dispensing into 5 ⁇ 10 5 cells.
  • FIG. It was confirmed that colonies were formed by exchanging the medium every time.
  • the cells were filled in 6 wells, the cells were detached with trypsin and divided into new plates. Passing three times in this manner and then quantitated by ELISA. 6-6.
  • Quantification of HuE10-101 antibody was carried out by incubating cells depleted at each step in 5 ⁇ 10 5 cells / T-25 flask / 5 ml for 6 days. Batch was performed on cells decanted at 100 nM. Quantification using the ELISA method.
  • Single cell line separation was performed by limiting dilution using two cell groups (Humira CXCL10 cell line S7 3 ⁇ , Humira CXCL10 cell line S7 4 yM).
  • a single cell-derived cell line was obtained by seeding a 96 well plate at 1 cell / well.
  • the protein expression levels of the obtained single cell lines were analyzed by ELISA using culture medium cultured in a 24 well plate for 4 days, and a total of 20 single cell lines were selected and subjected to suspension culture in a 125 mL Erlennieyer flask (Table 9).
  • Selected 20 cell lines were suspended in floating cells, inoculated in a chemical composition medium to be 5 X cells / mL, inoculated and fed on a 34 ° C, 5% C0 2 incubator for 6 days at a stirring speed of 140 ⁇ 10 rpm. Cultured and the amount of expression was analyzed (Table 10).
  • N-terminal amino acid sequencing was analyzed by dividing the heavy and light chains of the antibody protein.
  • Glutamine amino acid is the first amino acid glutamine of the N-terminal sequence of a conventional antibody protein It is often present in a modified form with pyroglutaiiiate.
  • the heavy and light chains of HuElO-101 are both glutamic and aspartic acid, not glutamine, so there is little chance of specific modifications.
  • the N-terminal sequence of the heavy chain identified 16 amino acid sequences and the light chain identified 18 amino acid sequences.
  • the identified amino acid sequence was identical to the theoretical amino acid sequence.
  • HuE10-101 samples were precipitated with TCA to remove the storage buffer and denatured by treatment with 5 urea. After trypsin treatment, the antibody was cleaved into peptide fragments, and then PNGase-F was added and deglycosylated. Finally, the peptide was analyzed by LC-MS after removing the disulfide bond by adding DTT.
  • the N-terminal sequence of an antibody protein is more likely to produce post-translational modification (PTM) than other amino acids in the protein's expression process and may be associated with the activity of the antibody protein and other immunorejections.
  • PTM post-translational modification
  • Antibody-derived peptides cut by trypsin were subjected to LC-MS peptide mapping and LC-MS / MS sequencing analysis, where the theoretical peptide molecular weights were calculated to identify N-terminal peptides (FIG. 19A).
  • FIGS. 19A and 19C show N-terminal sequencing results of heavy and light chains of HuElO-101 by LC-MS / MS analysis, respectively.
  • the N ⁇ terminal sequences of the heavy and light chains of the HuElO-101 protein are the same peptides as the N-terminal sequences of the HuElO-101 protein.
  • Sequenced with molecular weight, the N-terminal sequence of the heavy chain was EVQLVESGGGLVQPGR and the N-terminal sequence of the light chain was identified DIQMTQSPSSLSASVGDR (FIG. 19).
  • Table 11 summarizes the theoretical molecular weight of the N-terminal sequence, the molecular weight identified in LC-MS, and the N-terminal sequence identified through ms / ms sequencing. Modifications such as pyridonecarboxylic acid form and cleavage, deamidation oxidation, which are the N-terminally modified forms of conventional proteins, were not found in HuEl 101 protein (Table 11).
  • HuE10-101 samples were precipitated with TCA to remove the storage buffer and denatured by treatment with 5 M urea. Then trypsin treatment to remove the antibody After cleavage into peptide fragments, PNGase-F was added and deglycosylated. Finally, the peptide was analyzed by LC-MS after removing the disulfide bond by adding DTT.
  • HuE10-101 has a total molecular weight of approximately 190 KDa and is composed of heavy and light chains, respectively.
  • the total amino acids consisted of 919 amino acids, 705 heavy chains, and 214 light chains (SEQ ID NO. 59 and 60).
  • a typical antibody protein has a 150 kDa molecular weight, but HuE10-10l protein has a heavy chain variable sequence coupled after the C-terminal 451 lysine of the heavy chain.
  • FIG. 20 is an eluted LC-MS chromatogram of tryptic peptides derived from HuElO-101 antibody as a result of peptide mapping analysis of the assay sample HuElO-101.
  • FIG. 20A the HT24 (m) (cle) peptide had a compound corresponding to 43Da at the N-terminus of the peptide of WSVLTVLHQDWLNGK, and the amino acid 319 asparagine was modified by deamination.
  • the LT13 (m) peptide of FIG. 20B was identified as a chemical binding peptide with an increased 43 Da compared to the theoretical molecular weight.
  • the remaining modified peptides identified in the peptide mapping table were finally identified by the LC-MS / MS peptide sequencing method as above (FIG. 21).
  • peptide mapping analysis of HuElO-101 showed 98.1% identical structure in the amino acid central structure, and only some of them were weakly deamined with chemically bound peptides and asparagine amino acids.
  • Adhesion evaluation was performed by coating 100 nM TNF- ⁇ or CXCL10 on two channels of the XPR GLC chip, and releasing the antibody. Initialize the GLC chip with 50% glycerol in the ProteOn XPR 36 for measurement and stabilize the chip by pouring the running buffer PBST L0 ⁇ Na-phosphate, 150 niM NaCl, 0.005% Tween20, pH 7.4) at 25 ° C. Let me go.
  • KD values were determined by setting the standard with PBS / T and then releasing HuEl 101 or Humira antibodies in a series of 5 concentrations diluted 1/2 of 5 nM and sending them to the coated area.
  • 100 nM TNF- ⁇ or CXCL10 was coated on the XPR GLC chip, and Humira or HuElO—101 was diluted from 5 nM by 1/2 to flow five concentrations to obtain a sensogram as shown in FIG. 23. .
  • Humira binds well to the antigen TNF- ⁇ but does not adhere to CXCL10 at all, while HuE10-101 is a double antibody that adheres well to CXCL10 as well as TNF ⁇ ⁇ .
  • Table 14 shows the KD value measurement results of the antibodies for each antigen obtained from the sensogram of FIG. 23.
  • ka is the binding constant
  • kd is the dissociation constant
  • KD is the dissociation constant obtained by dividing kd by ka.
  • Humira only measured the binding force to the antigen TNF— ⁇ and the KD was 0.116 nM.
  • the double antibody HuE10-101 showed a TNF- ⁇ binding force of 0.195 nM similar to Humira and a slightly weaker KD of 3.54 nM for CXCL10.
  • the low KD for CXCL10 seems to be due to the fact that kd is somewhat lower than that of TNF- ⁇ , in combination with the results in FIGS. 23 and 14.
  • HuEl 101 showed a binding capacity of 0.495 nM for TNF-a and 1.9 nM for CXCL10.
  • Humira which was used as a control, showed 0.5 nM of binding force only for TNF— ⁇ but did not bind as expected for CXCL10.
  • TNF- ⁇ or CXCL10 antigens were added to 96-well immunoplates and coated overnight at 4 ° C. 200 ⁇ / well was added to the scheme milk and incubated at room temperature for 2 hours. Then, HuElO-101 and Humira were each diluted in steps of 50 nM and half, respectively, in 100 ⁇ / well and incubated in silver for 2 hours. After two hours, three washes were performed with 0.053 ⁇ 4 »PBST 200 ⁇ / well. And anti-human FC-HRP (in goat) 1: 1000. After making into the skim milk PBS 100 l / well was added and incubated for 1 hour at room temperature.
  • HuElO-101 is a bispecific antibody (i speci fic) that binds well to both TNF- ⁇ and CXCL10 (FIG. 23).
  • HuElO-measured antigen binding capacity was confirmed to be 4.5 ⁇ 10 M (0.45 nM) and 1.9 ⁇ 9 M (1.9 nM), respectively.
  • Humira a control group, binds well to TNF- ⁇ as expected, but not to CXCL10. It was confirmed that no binding (FIG. 24). Its binding affinity is 1.
  • Humira (Abbott Laboratories) was used as a control antibody, Humira copy antibody (developed in the project), HuE10-101 was used as a candidate antibody. After diluting each antibody concentration by 1/2 step, the cells were cultured by adding hTNF- ⁇ , and then incubated in a 5% C0 2 , 37 ° C incubator with MTT (thiazolyl blue tetrazol ium), and then the cells were lysed. Absorbance was measured at a wavelength of 595 nm (FIG. 25).
  • Humira cloned antibodies, HuElO-101, HuIL21R-101 and HuIL21R-100 were found to have a TNF- ⁇ inhibitory activity at a lower concentration than Humira, a positive control group.
  • Humira it was confirmed that the inhibitory ability of the candidate antibody against TNF-a is improved compared to Humira (FIG. 25).
  • the experimental group was treated with HuE10-101 in the upper and lower chambers at concentrations of 50 ng / ml, 100 ng / ml and 200 ng / ml, and additionally treated with hCXCLlO in the lower chamber to create increased chemotaxis conditions by CXCL10. It was.
  • hCXCLlO was added to the lower chamber alone to determine whether chemotaxis was increased by CXCL10.
  • PC positive control group
  • osteoclast progenitor cells CD14 +
  • CD4 + cells were isolated from the blood, and the two cells were induced to differentiate into osteoclasts using a co-culture system, and TRAP (tartrate resistant acid phosphatase) Staining was performed and microscopic observation (FIG. 28).
  • TNF transgenic mouse model established by Keffer et al. In 1991 manipulated the TNF 3 'untranslated region (UTR) to inhibit TNF and introduced human TNF transgenic genes into the mouse. This increased the expression of TNF spontaneously induced arthritis. Arthritis induced by this method, similar to rheumatoid arthritis, showed synovial thickening, infiltration of inflammatory cells into the joint cavity, panus formation, and destruction of cartilage and luck.
  • UTR TNF 3 'untranslated region
  • the TNF transgenic mouse model confirms that TNF plays an important role in the development of arthritis by identifying the pathogenesis of arthritis induced by TNF. It provided an opportunity to prove it.
  • the TNF transgenic mouse model is useful for evaluating the efficacy of therapeutic agents associated with TNF.
  • TNF transgenic mouse model for evaluating the efficacy of dual antibodies against TNF.
  • Dual antibody efficacy evaluation using a TNF transgenic mouse model was conducted by a CR0 specialized institution in Greece.
  • the line used for efficacy evaluation is Tgl97 and is one of the human antibody evaluation models for rheumatoid arthritis recommended by the US Food and Drug Administration (FDA).
  • the Tgl97 strain was used to develop Infliximab (Renii cade®), a commercially available TNF— ⁇ antagonist.
  • Tgl97 strain Arthritis progression in the TNF transgenic mouse model, a Tgl97 strain, shows no clinical differences between sexes and weight loss as the disease progresses.
  • Pathological analysis of Tgl97 strains reveals inflammatory infiltration, synovial thickening, cartilage destruction, and bone erosion, very similar to rheumatoid arthritis.
  • the TglF transgenic mouse model of the Tgl97 strain will develop lesions from the 3rd week of the experiment. Models from parking 3 to 6, which are the early stages of lesions, are used to investigate the preventive effect. Therefore, the evaluation period was progressed from parking 3 to parking 9 to evaluate the efficacy of the double antibody that is the purpose of this experiment-. Clinical evaluation was performed by measuring the arthritis score and the change in body weight during the evaluation period.
  • histopathological evaluation was performed to evaluate the degree of arthritis lesion.
  • the histopathological characteristics of rheumatoid arthritis are overproliferation of articular synovial cells and destruction of cartilage tissues.
  • Mouse knee tissue was separated, fixed in formalin, decalcification, and a block made of paraffin to prepare a tissue section of 4 urn using micromum.
  • Hematoxylin and eosin (H & E) staining examined synovial inflammation, bone erosion, cartilage damage, and leukocyte infiltration. At this time, the evaluation was conducted by blind test so as not to know what sample. Histopathological evaluation was evaluated based on the following table.
  • the commercially available Humira 10 mg / kg and Humiri-replicating antibodies developed by the present inventors were administered to mice at 2 mg and 10 mg / kg doses, and clinical changes were observed and evaluated.
  • the arthritis scores of the Humira and Humira cloned antibodies were 1.48 in the Vehicle group and 0.22 in the 10 mg / kg control group, Humira.
  • the concentration of Humira clone antibody was 2 mg and 10 mg / kg, respectively, the values of 0.66 and 0.52 were shown (FIG. 31).
  • the TNF transgenic mouse model is characterized by clinically significant weight loss as the disease progresses. The weight change measurement was performed in the same manner as the arthritis score measurement schedule.
  • Humira was used as a control to evaluate the efficacy of HuIL21R-101, and experimental groups HuIL21R-101 were administered to mice at doses of 1 nig, 3 mg, and 10 mg / kg, respectively, and clinical changes were observed and evaluated. Induces Arthritis of HuIL21R— 101 It was 1.27 in the control group IG, which was a nodule- and vehicle group which measured the arthritis score, and 0.20 when the control group Humira was 10 mg / kg. When the concentration of the experimental group HuIL21R-101 was 1 mg, 3 mg, 10 mg / kg, respectively, the numerical values of 0.89, 0.73, 0.88 (Fig. 33).
  • HuIL21R-101 As a result of clinical evaluation of HuIL21R-101, the arthritis score of HuIL21R-101 did not decrease significantly and there was no significant weight gain compared to Humira. Based on the previous results of HLIIL21R-101 and the results of efficacy evaluation through the TNF transgenic mouse model, HuIL21R-101 was excluded from the final candidate antibody group.
  • Humira® was used as a control group, and HuE10-101, which was an experimental group, was administered to the mice at the dose of 6.9 mg and 13.8 mg / kg in the same amount as the control group and the mass, respectively. Clinical changes were observed and evaluated.
  • the arthr it is score of HuE10-101 was 1.65 in the Human Control IgG vehicle group and 0.06 in the control group Humira® at a concentration of 10 mg / kg.
  • the concentration of the experimental group HuElO-101 was 6.9 mg, 13.8 mg / kg, respectively, showed a value of 0.41, 0.07 (Fig. 35).
  • the TNF transgenic mouse model is characterized by clinically significant weight loss as the disease progresses.
  • the weight change measurement was performed in the same manner as the arthritis score measurement schedule.
  • the result was 18.92 g in the vehicle group and the concentration of control group Humira® was 10 mg / kg. When was 23.38 g.
  • the concentration of HLIEIO-101, the experimental group, was 6.9. When mg, 13.8 mg / kg was 21.08 g, 22.80 g (Fig. 36).
  • the arthritis score decreased similarly to the control Humira cloned antibody, and the arthritis score decreased as the concentration of HuElO-101 increased.
  • the weight decreased as the lesion progressed, and the body weight increased as the concentration of HuElO-101 increased, similar to the Humira clone antibody group.
  • the histopathological evaluation of HuElO-101 and arthritis-induced scores were compared and analyzed.3.75,1.65 for the Vehicle group and 0.75,0.06 for the Humira® group, respectively, and 6,9 mg / kg of HuElO-101, respectively.
  • the groups treated with 1.84, 0.41 and HuElO-101 at a concentration of 13.8 mg / kg were 0.75 and 0.07, respectively.
  • Three-week-old mice before drug administration had numbers of 1.33 and 0, respectively.
  • HuElO-101 and Humira® were used as treatments, it was confirmed that the two drugs had an equivalent therapeutic effect when the histopathological evaluation and the arthritis-induced scores were compared (FIG. 38).
  • HuElO-101 Clinical evaluation of the result compared to the control group although the Humira® not significantly induced arthritis score (arthritis score), as' concentration increases in HuE10-101 a result to decrease the score induced arthritis (arthritis score) could get In addition, as a result of measuring the weight change, the weight decreased as the lesion progressed, and the body weight increased as the concentration of HuE10-101 increased, similar to the Humira® group. 9-1-4. Evaluation of Efficacy of Dual Antibodies Produced in Production Cell Lines Using Humanized TNF Transgenic Mice
  • Humira® was used as a control of the retested experimental conditions, and HuE10-101, a test group, was divided into groups administered twice and three times a week at a dose of 13.8 mg / kg. Body weight changes and arthritic scores were measured from parking 3.5 to parking 9.5. As a result, the vehicle group showed 1.43, the Humira® group 0.34, the HuElO-101 group received the same number of humira® 0.28, and the HuE10-101 group administered three times a week (0.19). ).
  • the weight change measurement was performed in the same manner as the arthritis score measurement schedule.
  • the vehicle group was 15.87 g and the Humira® group was 20.50 g.
  • the group administered the same number of times as humira® showed 19.21 g, 20.58 g in the group administered three times a week (Fig. 40).
  • the arthritis score significantly decreased compared to the Humira® group of HuE10-101, and the arthritis score decreased as the concentration of HuElO-101 increased.
  • the weight decreased as the lesion progressed, and the body weight increased as the concentration of HuEl 101 increased, similar to the Humira® group (FIG. 42).
  • HuElO-101 The histopathological evaluation of HuElO-101 was compared with the arthritis-induced scores.
  • the vehicle group received 3.53, 1.435, Humira®, respectively, 1.22, 0.34, and HuElO-101, the same number of times as humira®, respectively. 1.44, 0.28, and HuElO-101, three times a week, respectively, 0.72. , 0.19.
  • cytokines were measured in mouse serum, and tissues were obtained to observe pathological changes and statistical analysis.
  • the present inventors noted that administration of serum from K / BxN spontaneous arthritis mice can cause arthritis relatively easily and that the duration of the experiment is short within 2 weeks, resulting in K / BxN serum transfer arthritis. A model was introduced.
  • K / BxN spontaneous arthritis mice used in the experiments were used more than 8 weeks of age, and the collected serum 150 ⁇ 6 weeks or more mice were administered intraperitoneally twice a day 0, day 2 to induce arthritis.
  • Day 1 clay 3 was administered HuE10-101.
  • the joints of the lower extremity of the mouse were analyzed by micro CT (NanoFocusRay) to analyze the condition of the bone joints of the mouse model of the K / BxN serum transfer arthritis that the experiment was completed.
  • the vehicle group that induced arthritis changed the shape of the joint irregularly, and the bone destruction progressed considerably.
  • the control group treated with the humira cloned antibody and the experimental group, HuElO-101 were found to have significantly reduced bone destruction compared to the vehicle.
  • the experimental group was observed almost no bone destruction similar to the group that did not receive the K / BxN serum, a negative control (Fig. 47).
  • Histopathological analysis was performed to obtain the tissues of the mouse model of K / BxN serum transfer arthritis after the experiment to determine whether morphological changes were observed in histopathologic changes.
  • vehicle group showed swelling around the joints, polymorphic leukocytes, lymphocyte infiltration, and synovial inflammation, thickening, and cartilage loss.
  • HuElO-101 treated group inflammation of the joint and destruction of cartilage were significantly suppressed.
  • H & E-dyed photos Analysis of synovial inflammation, bone erosion, and cartilage damage. Immune cell infiltration (leukocyte inf ltrat ion) was analyzed respectively.
  • LPS lipopolysaccharide
  • the increase in bone loss caused by LPS has not been elucidated in detail, but it is a signal transduction agent that activates MyD88 (myeloid differentia ion protein88) through TLR4 (Tol 1-Like Receptor4) in osteoblasts and is involved in bone resorption.
  • MyD88 myeloid differentia ion protein88
  • TLR4 Tol 1-Like Receptor4
  • Ib6 GM-CSFC granulocyte macrophage colony stimulating factor
  • PGE2 pros tag land in E2
  • N0 ni trie oxide
  • the biggest advantage of the LPS-induced inflammatory bone loss mouse model is that it can be built in a relatively short time, as in the arthritis mouse model (K / BxN serum transfer arthritis model).
  • Inflammatory bone loss mouse model induced by LPS induces inflammation by a single dose of LPS into the mouse skull.
  • HuE10-101 is then administered to the skull daily for 5 days (FIG. 49).
  • Inflammatory bone loss induced by LPS was confirmed by cranial analysis through micro CT scan. As a result, the degree of skull loss was confirmed in the vehicle group which induced bone loss by LPS administration, the control group of humira cloned antibody, the control group HuEl 101 treated group, and the negative control group (normal) LPS treated group. .
  • the degree of skull loss was confirmed in the vehicle group which induced bone loss with LPS and added only the antibody composition buffer, the humira® treated group, the control group, HuElO—101 treated group, and the normal control group that did not receive LPS. It was. As a result, it was confirmed that skull loss increased in the vehicle group. In the humira treatment group and HuElO-101 treatment group, it was confirmed that the skull loss is significantly reduced compared to the vehicle (Fig. 51).
  • the bone loss area was confirmed by an image analysis program (Image J) for a detailed analysis of the skull loss.
  • Image J image analysis program
  • the vehicle group showed 2.35 times more bone loss than the negative control group
  • the humira® treated group showed 2.15 times more bone loss than the negative control group and 0.9 times the vehicle.
  • HuElO-101 is 1.2 times compared to the negative control (P value: 0.0428) showed bone loss, 0.5 times compared to vehicle, and reduced by 48.79% (FIG. 52).
  • HuElO-101 In vivo of HuElO-101 produced from production cell line using LPS induced inflammatory bone loss mouse model. As a result of evaluating osteoclast differentiation ability, it was confirmed that HuElO-101 effectively inhibits osteoclast differentiation compared with humira®, as in the previous study.
  • Collagen-induced arthritis established by Trentham et al. In 1977, is a representative autoimmune arthritis model of rheumatoid arthritis that is currently the most widely used. Antibodies to collagen were found in the serum of rheumatoid arthritis patients, and the focus was on the fact that type II collagen present in the joint could act as an autoantigen.
  • the hallmark of the collagen-induced arthritis mouse model is that the clinical findings are similar to those of human rheumatoid arthritis. Similarities include association with class II MHC haplotypes, pathogenesis that reflects adaptive immunity by ⁇ and B cell responses specific to autoantigens, involvement of autoantibodies and complement systems in the destruction of joint tissues, and Proliferation, infiltration of lymphocytes and panus formation.
  • the present inventors have confirmed the result of the increase of CXCL10 in collagen-induced arthritis, which is an animal model of rheumatoid arthritis, through previous studies.
  • the symptom suppression experiment of collagen-induced arthritis by CXCL10 inhibitory antibody was confirmed that CXCL10 is involved in bone resorption and osteoclast differentiation promoting factor by rheumatoid arthritis.
  • Collagen-induced arthritis mouse model dissolves bovine-type ⁇ collagen (2, 4 mg / mL) with acetic acid (0.05-0.1 M) at 4 ° C and with abundant Freund's adjuvant. Suspended.
  • suspending material 0.1 mL of suspending material is first injected into the base of the tail of male DBA / 1J mice (5-9 weeks old), and after 3 weeks suspending material (0.1-0.2 ml) is added to the base of the tail (booster or second inject ion). ) Subcutaneously (FIG. 53).
  • Antibody drugs may bind to tissues when the same or related antigenic determining sites are expressed in human cells or tissues other than target cells.
  • cross reaction reactions on human tissues should always be performed at the non-clinical stage.
  • EnVision Detection System was used for immunohistochemical staining and cross-reaction was confirmed using 32 non-overlapping three tissues. As a result, it was confirmed that HuE10-101 did not bind nonspecifically to other tissues (FIG. 54).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Pulmonology (AREA)
  • Dermatology (AREA)
  • Otolaryngology (AREA)
  • Toxicology (AREA)
  • Rheumatology (AREA)
  • Transplantation (AREA)
  • Pain & Pain Management (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/KR2014/004579 2013-05-22 2014-05-22 항 TNF-α/CXCL10 이중 타겟 항체 및 그의 용도 Ceased WO2014189306A1 (ko)

Priority Applications (9)

Application Number Priority Date Filing Date Title
CA2913118A CA2913118A1 (en) 2013-05-22 2014-05-22 Anti-tnf-.alpha./cxcl10 double-targeting antibody and use thereof
JP2016515273A JP2016520595A (ja) 2013-05-22 2014-05-22 抗TNF−α/CXCL10二重ターゲット抗体及びその用途
US14/893,071 US10087248B2 (en) 2013-05-22 2014-05-22 Anti-TNF-α/CXCL10 double-targeting antibody and use thereof
BR112015029224A BR112015029224A2 (pt) 2013-05-22 2014-05-22 Anticorpo de alvo duplo tnf-alfa/cxcl10, transformante, método de produção de um anticorpo de alvo duplo tnf-alfa/cxcl10, composição farmacêutica e método de prevenção ou tratamento de uma doença imunológica
CN201480029427.2A CN105263964A (zh) 2013-05-22 2014-05-22 抗-TNF-α/CXCL10双靶向抗体及其应用
EP14801159.6A EP3000827B1 (en) 2013-05-22 2014-05-22 Anti-tnf-alpha/cxcl10 double-targeting antibody and use thereof
HK16111369.2A HK1223112A1 (en) 2013-05-22 2014-05-22 Anti-tnf-alpha/cxcl10 double-targeting antibody and use thereof
AU2014269287A AU2014269287B2 (en) 2013-05-22 2014-05-22 Anti-TNF-alpha/CXCL10 double-targeting antibody and use thereof
PH12015502601A PH12015502601A1 (en) 2013-05-22 2015-11-23 ANTI-TNF-a/CXCL10 DOUBLE-TARGETING ANTIBODY AND USE THEREOF

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20130057762 2013-05-22
KR20130057475 2013-05-22
KR10-2013-0057475 2013-05-22
KR10-2013-0057762 2013-05-22

Publications (2)

Publication Number Publication Date
WO2014189306A1 true WO2014189306A1 (ko) 2014-11-27
WO2014189306A8 WO2014189306A8 (ko) 2015-12-03

Family

ID=51933801

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/004579 Ceased WO2014189306A1 (ko) 2013-05-22 2014-05-22 항 TNF-α/CXCL10 이중 타겟 항체 및 그의 용도

Country Status (11)

Country Link
US (1) US10087248B2 (enExample)
EP (1) EP3000827B1 (enExample)
JP (1) JP2016520595A (enExample)
KR (1) KR101671955B1 (enExample)
CN (1) CN105263964A (enExample)
AU (1) AU2014269287B2 (enExample)
BR (1) BR112015029224A2 (enExample)
CA (1) CA2913118A1 (enExample)
HK (1) HK1223112A1 (enExample)
PH (1) PH12015502601A1 (enExample)
WO (1) WO2014189306A1 (enExample)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017220988A1 (en) 2016-06-20 2017-12-28 Kymab Limited Multispecific antibodies for immuno-oncology
CN113412282A (zh) * 2019-04-26 2021-09-17 Y 生物股份有限公司 与白细胞介素-17A及肿瘤坏死因子-α特异性结合的双靶向抗体

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3630836A1 (en) * 2017-05-31 2020-04-08 Elstar Therapeutics, Inc. Multispecific molecules that bind to myeloproliferative leukemia (mpl) protein and uses thereof
US10633458B2 (en) * 2018-04-10 2020-04-28 Y-Biologics Inc. Cell engaging binding molecules
WO2019197979A1 (en) * 2018-04-10 2019-10-17 Y-Biologics Inc. Cell engaging binding molecules
KR102088789B1 (ko) * 2018-06-20 2020-03-13 인하대학교 산학협력단 항 TNF/IFN scFv-Fc 이중 표적 항체 및 이의 이용
KR102385046B1 (ko) 2020-08-24 2022-04-13 에스큐엔지니어링(주) 드론에 탈부착 점검장치를 이용한 다목적 구조물 검사장치
CN117836318A (zh) * 2021-03-31 2024-04-05 加利福尼亚大学董事会 用于降解靶蛋白的双特异性结合剂-配体融合物
KR102357756B1 (ko) 2021-05-14 2022-02-09 유한회사 서해항공방제 드론을 이용한 유해 조수 및 곤충 방제장치 및 그를 구비하는 드론
CN114432502B (zh) * 2021-12-31 2023-02-03 中山大学附属第八医院(深圳福田) 一种负载op3-4多肽、抗cxcl9抗体的水凝胶及其制备方法与应用

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050053600A1 (en) * 2003-09-09 2005-03-10 Lane Thomas E. Methods for treating rheumatoid arthritis
KR20100097720A (ko) * 2007-11-30 2010-09-03 글락소 그룹 리미티드 항원-결합 작제물
US8258268B2 (en) * 2005-08-19 2012-09-04 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
KR20120125611A (ko) * 2009-12-29 2012-11-16 이머전트 프로덕트 디벨롭먼트 시애틀, 엘엘씨 이종이량체 결합 단백질 및 이의 용도
WO2013055958A1 (en) * 2011-10-11 2013-04-18 Genentech, Inc. Improved assembly of bispecific antibodies

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MX336813B (es) * 1996-02-09 2016-02-02 Abbvie Biotechnology Ltd Anticuerpos humanos que ligan el tnfa humano.
CN101189339A (zh) * 2005-03-22 2008-05-28 美得思达健康有限公司 诊断和治疗心血管疾病的递送系统和方法
NZ595225A (en) * 2005-05-16 2013-05-31 Abbott Biotech Ltd Use of tnf inhibitor for treatment of erosive polyarthritis
WO2006138690A2 (en) * 2005-06-17 2006-12-28 Abbott Laboratories Improved method of treating degenerative spinal disorders
NZ612578A (en) * 2005-08-19 2014-11-28 Abbvie Inc Dual variable domain immunoglobin and uses thereof
JP2012228248A (ja) * 2005-08-19 2012-11-22 Abbott Lab 二重可変ドメイン免疫グロブリン及びその使用
KR20130121601A (ko) 2012-04-27 2013-11-06 주식회사에이앤알쎄라퓨틱스 인간 항 cxcl-10 항체 및 이를 포함하는 류마티스 관절염 치료용 조성물

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050053600A1 (en) * 2003-09-09 2005-03-10 Lane Thomas E. Methods for treating rheumatoid arthritis
US8258268B2 (en) * 2005-08-19 2012-09-04 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
KR20100097720A (ko) * 2007-11-30 2010-09-03 글락소 그룹 리미티드 항원-결합 작제물
KR20120125611A (ko) * 2009-12-29 2012-11-16 이머전트 프로덕트 디벨롭먼트 시애틀, 엘엘씨 이종이량체 결합 단백질 및 이의 용도
WO2013055958A1 (en) * 2011-10-11 2013-04-18 Genentech, Inc. Improved assembly of bispecific antibodies

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ARNON ET AL., RECENT RESULTS IN CANCER RES., vol. 75, 1980, pages 236
BECK A, NAT REV IMMUNOLOGY, vol. 10, 2010, pages 345 - 352
BOSTROM, J, SCIENCE, vol. 323, 2009, pages 1610 - 1614
GENNARO: "Remington's Pharmaceutical Sciences 19th ed.,", 1995
MOOLTON ET AL., IMMUNOLOG. RES., vol. 62, 1982, pages 47
See also references of EP3000827A4

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017220988A1 (en) 2016-06-20 2017-12-28 Kymab Limited Multispecific antibodies for immuno-oncology
WO2017220990A1 (en) 2016-06-20 2017-12-28 Kymab Limited Anti-pd-l1 antibodies
WO2017220989A1 (en) 2016-06-20 2017-12-28 Kymab Limited Anti-pd-l1 and il-2 cytokines
CN113412282A (zh) * 2019-04-26 2021-09-17 Y 生物股份有限公司 与白细胞介素-17A及肿瘤坏死因子-α特异性结合的双靶向抗体
EP3960762A4 (en) * 2019-04-26 2022-08-31 Y-Biologics Inc. BISPECIFIC ANTIBODY THAT SPECIFICALLY BINDS IL-17A AND TNF-ALPHA
US12139530B2 (en) 2019-04-26 2024-11-12 Y-Biologics Inc. Bispecific antibody specifically binding to IL-17A and TNF-α
CN113412282B (zh) * 2019-04-26 2025-05-27 Y生物股份有限公司 与白细胞介素-17A及肿瘤坏死因子-α特异性结合的双靶向抗体

Also Published As

Publication number Publication date
EP3000827A4 (en) 2016-08-24
CA2913118A1 (en) 2014-11-27
EP3000827A1 (en) 2016-03-30
EP3000827B1 (en) 2020-04-22
CN105263964A (zh) 2016-01-20
HK1223112A1 (en) 2017-07-21
US20160108118A1 (en) 2016-04-21
US10087248B2 (en) 2018-10-02
BR112015029224A2 (pt) 2017-09-19
JP2016520595A (ja) 2016-07-14
AU2014269287B2 (en) 2016-08-25
AU2014269287A1 (en) 2015-12-10
PH12015502601A1 (en) 2016-02-29
KR20150010919A (ko) 2015-01-29
WO2014189306A8 (ko) 2015-12-03
KR101671955B1 (ko) 2016-11-07

Similar Documents

Publication Publication Date Title
WO2014189306A1 (ko) 항 TNF-α/CXCL10 이중 타겟 항체 및 그의 용도
TWI701259B (zh) 4﹘1bb抗體及其製備方法和應用
RU2509777C2 (ru) Анти-mif антитела
KR20190134614A (ko) B7-h3 항체, 이의 항원-결합 단편 및 이의 의학적 용도
WO1998046644A1 (fr) Nouvelle proteine et methode de production associee
JP7334912B2 (ja) 抗プレキシンa1アゴニスト抗体
KR102523150B1 (ko) 항-테나신 c 항체 및 이의 용도
CA3246923A1 (en) ANTIBODIES, MELTING PROTEIN AND RELATED USES
TW201915022A (zh) Il-5抗體、其抗原結合片段及醫藥用途
AU2015392603B2 (en) Agents binding specifically to human cadherin-17, human cadherin-5, human cadherin-6 and human cadherin-20 RGD motif
CN113166273A (zh) 具有il-7活性的双功能分子
JP2020534273A (ja) リシル−tRNA合成酵素N末端に特異的に結合する抗体を有効成分として含む免疫細胞の遊走関連疾患の予防又は治療用薬学的組成物
KR101525919B1 (ko) 자가면역 질환 예방 및 치료를 위한 tnfr2를 기반으로 하는 이중 항체
WO2024140994A1 (zh) 一种融合蛋白
CN116710484A (zh) Wars中和抗体及其用途
JP2021534204A (ja) 抗SIRPg化合物
US20220017632A1 (en) Anti-ox40 monoclonal antibody and application thereof
JP7688150B2 (ja) 抗OX40L抗体、抗OX40L及び抗TNFαの二重特異性抗体、並びにこれらの用途
CN119487194A (zh) 融合蛋白
KR20260005790A (ko) 항-blt1 항체 및 이의 용도
HK40056594A (en) Bifunctional molecules with il-7 activity
CN121609798A (zh) 一种抗ctla-4的纳米抗体及其制备方法和应用
CN117186235A (zh) 抗4-1BB/抗EGFRvⅢ的双特异抗体及其制备方法和应用
TW202222831A (zh) 抗-OX40L抗體、抗OX40L和抗-TNFα雙特異性抗體及其用途

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201480029427.2

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14801159

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2913118

Country of ref document: CA

Ref document number: 2016515273

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 14893071

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 12015502601

Country of ref document: PH

WWE Wipo information: entry into national phase

Ref document number: 2014801159

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2014269287

Country of ref document: AU

Date of ref document: 20140522

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112015029224

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: IDP00201508665

Country of ref document: ID

ENP Entry into the national phase

Ref document number: 112015029224

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20151123