WO2013186754A2 - Method for detecting and identifying enterohemorrhagic escherichia coli - Google Patents
Method for detecting and identifying enterohemorrhagic escherichia coli Download PDFInfo
- Publication number
- WO2013186754A2 WO2013186754A2 PCT/IB2013/054888 IB2013054888W WO2013186754A2 WO 2013186754 A2 WO2013186754 A2 WO 2013186754A2 IB 2013054888 W IB2013054888 W IB 2013054888W WO 2013186754 A2 WO2013186754 A2 WO 2013186754A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- primers
- ehec
- seq
- crispr
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
- C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
- C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- the invention relates to the identification of Shiga toxin producing E. coli (STEC) that constitutes a severe risk for human health.
- STEM Shiga toxin producing E. coli
- Shiga toxin-producing Escherichia coli are a diverse group of E. coli belonging to over 400 E. coli ⁇ . ⁇ serotypes, some of which cause outbreaks and sporadic cases of foodborne illness ranging from diarrhoea to hemorrhagic colitis (HC) and the haemolytic uremic syndrome (HUS). According to their human pathogenicity the latter strains were also designated as enterohaemorrhagic E. coli (EH EC) (Lcvine 1987, Nataro and Kaper 1998). Numerous cases of HC and HUS have been attributed to EH EC serotype 0157:H7 strains, but it has now been recognized that other serotypes of STEC belong to the EHEC group.
- EH EC enterohaemorrhagic E. coli
- serotypes of STEC are implicated in outbreaks and sporadic cases of HC and HUS. These comprise serotypes 026:[H11], 045:[H2], O103:[H2], 0111 :[H8], 0121 :[H19], 0145:[H28], 0157:[H7] and their non-motile derivatives.
- EHEC enterohaemorrhagic E. coli
- PCT WO 201 1/018762 describes a method involving the combined detection of the genes six I, stx2, eae, nleB and espK to predict the presence of EHEC in a sample.
- the inventors have now identified discriminative genetic markers associated with several STEC strains constituting a severe risk for human health.
- they have identified genetic markers located within CRISP s (Clustered Regularly Interspaced Short Palindromic Repeats) sequences of EHEC strains with high virulence for humans.
- CRISP s Simple Regularly Interspaced Short Palindromic Repeats
- CRISPRs are present within the genomes of many bacterial species, including E. coli. They consist of tandem sequences containing direct repeats of 21 to 47 bp long and separated by spacers of similar size. Spacers are derived from foreign nucleic acids, such as phages or plasmids, and it has been hypothesized that they can protect bacteria from subsequent infection by homologous phages and plasmids.
- the inventors have sequenced the CRISPR loci of various EHEC strains which are associated with the world's most frequent clinical cases, and have identified different spacers that can be used for a specific identification of the EHEC serotypes 0157:[H7], 0145:[H28], O103:[H2], 01 1 1 :[H8], 0121 :[H19], 045:[H2], 026:[H11], O104:[H4] and their non motile derivatives, which are responsible for the majority of EHEC infections in humans.
- an object of the present invention is a method for identifying the serotypc(s) of EHEC suspected to be present in a sample, wherein said method comprises detecting the presence or the absence, in said sample or DNA isolated therefrom, of the following E. coli CRISPRs sequences: a) CRISPRs sequences for identifying EH EC 0157:[H7] wherein said CRISPRs sequences are selected among:
- a CRISPR sequence for identifying EHEC 026:[H11] wherein said CRISPR sequence is the sequence SEQ ID NO: 10, and wherein the presence of said CRISPR sequence is indicative of the presence of EHEC 026:[H11].
- said method comprises performing a PCR assay on said sample or DNA isolated therefrom, with primers designed for amplifying said CRISPR sequences, and checking for the presence of the corresponding amplification products.
- said PCR assay is performed with a combination of primers comprising:
- primers for detecting EHEC 0157:[H7] wherein said primers consist of :
- primers targeting both the CRISPR sequences SEQ ID NO: 1 and SEQ ID NO: 2, wherein said primers are defined by the following sequences:
- CTTAGTGTGTTCCCCGCGC (SEQ ID NO: 12) and - a set of primers targeting the CRISPR sequence SEQ ID NO: 3 wherein said primers are defined by the following sequences:
- primers targeting the CRISPR sequence SEQ ID NO: 4 wherein said primers are defined by the following sequences:
- primers for detecting EH EC 0145:[H28] wherein said primers consist of:
- primers targeting the CRISPR sequence SEQ ID NO: 5 wherein said primers are defined by the following sequences:
- primers for detecting EHEC 01 1 1 :[H8] wherein said primers consist of:
- primers for detecting EHEC 0121 :[H19] wherein said primers consist of:
- primers for detecting EH EC O103:[H2] and/or EH EC 045:[H2] wherein said primers consist of:
- primers targeting the CRISPR sequence SEQ ID NO: 8 wherein said primers are defined by the following sequences:
- GAGTCTATCAGCGACACTACC SEQ ID NO: 24
- primers for detecting EHEC O104:[H4] wherein said primers consist of: - a set of primers targeting the CRISPR sequence SEQ ID NO: 9, wherein said primers are defined by the following sequences:
- GGAACTCACCGAGCGCCG (SEQ ID NO: 26);
- primers for detecting EHEC 026:[H1 1] wherein said primers consist of:
- ATAAACCGATCTCCTCATCCTC SEQ ID NO: 31 );
- the amplification products can be detected by any appropriate method for detection of PCR products. For instance, they can be detected by means of probes derived from the respective target sequences.
- SEQ ID NO: 1 and SEQ ID NO: 2 defined by the following sequence: CGATCAATCCGAATATGAGCGGT (SEQ ID NO: 32), and a probe allowing the detection of amplification products derived from SEQ ID NO: 3, defined by the following sequence: CACTGTTTTGGTGACGGTTTATCC (SEQ ID NO: 33), and/or a probe allowing the detection of amplification products derived from SEQ ID NO: 4, defined by the following sequence: ACAAAAACTGTCACCAAAGTGTTC (SEQ ID NO: 34);
- SEQ ID NO: 7 defined by the following sequence:
- EHEC enterohemorrhagic Escherichia coli
- Escherichia coli strains both positive for stx and eae
- Typical EHEC strains include in particular EHEC 0157:H7, 0145:H28, O103:H2, 01 1 1 :H8, 0121 :H19, 026:H 11 and 045 :H2 serotypes and their non-motile derivatives.
- Said method comprises the detection of the espK gene and of one or more of the following target genes: espV, ureD, Z2098, Zl 151, Zl 153, 1154, Zl 155, Z1156, and Z6065.
- E. coli gene targets correspond to non LEE-encoded type III effectors derived from various genomic O-islands: 01-43, OI-44, OI-50, 01-57 and 01-71.
- said method comprises performing a PGR assay on said sample or DNA isolated therefrom with a combination of primers comprising a set of primers derived from espK and a set of primers derived from at least one oiespV, ureD, Z2098, Z1151, Z1153, Z1154, Z1155, 7.1156, and Z6065;
- the combination of primers further comprises a set of primers derived from stxl and a set of primers derived from .s .v .
- the method of the invention does not necessitate the detection of the eae gene.
- Primers derived from espK, espV, ureD, Z2098, Z1 151 , Z1153, Z1154, Zl 155, Zl J 56, Z6065, stxl or stx2 and suitable for use in the PGR assay of the invention, as well as probes allowing the detection of the amplification products obtained with these primers, can easily be designed by one of skill in the art, on the basis of the sequences of these genes available in the databases, for instance within the annotated sequence of Escherichia coli 0157:H7 (strain EDL933) available in GenBank under accession number AE005174.2 .
- CTGAAAAGAGCCAGAACGTGC (SEQ ID NO: 48)
- a set of primers targeting Z6065 defined by the following sequences: GCACTGGCCCTTGTTGCTCAGGC (SEQ ID NO: 60) GCTCTTCCAGTGAGAATGTCTTTCCGG (SEQ ID NO: 61 )
- Non-limitative examples of probes for detecting the amplification products are given bellow:
- Zl 151 defined by the following sequence:
- TCGTCAGGCACTGTCTGAAACTGCTCC (SEQ ID NO: 75);
- the invention provides a method for predicting whether a sample contains typical enterohemorrhagic Escherichia coli (EHEC) of at least one of EHEC 0157:[H7], 0145:[H28], O103:[H2], Oi l 1 :[H8], 0121 :[H19], 026:[H11] and 045:[H2] serotypes, and further identifying the serotype(s) of said EHEC, wherein said method comprises:
- the PCR assays of the invention can be used for testing any sample of a substance potentially containing EHEC, such as food samples, water samples, soil samples, etc.
- PCR assays of the invention can be carried out using any method suitable for PCR amplification of target sequences, using any of the various natural or engineered enzymes available for this purpose.
- Alternative methods such as nucleic acid sequence-based amplification (NASBA), branched DNA, strand displacement amplification or the loop-mediated isothermal amplification (LAMP) method (Compton 1991 , Chang 1991 , Walker et al.1992, Notomi et al., 2000) can also be used.
- NASBA nucleic acid sequence-based amplification
- LAMP loop-mediated isothermal amplification
- Particularly preferred methods are those involving real time PCR amplification as described by Ian M. Mackay in "Real-time PCR in Microbiology : from diagnosis to characterization " (2007) Caister Academic Press, Norfolk, UK.
- Real time PCR also called quantitative real time polymerase chain reaction (qPCR) or kinetic polymerase chain reaction
- qPCR quantitative real time polymerase chain reaction
- kinetic polymerase chain reaction kinetic polymerase chain reaction
- Non-limiting examples of suitable fluorescent labels include 6-carboxyl- fluorescein (FAM), tetrachloro-6-carboxyfluorescein (TET), 6-carboxy-X-rhodamine (ROX).
- suitable quenchers for labelling dual-labelled probes include 6-carboxy-tetramethyl-rhodamine (TAMRA).
- TAMRA 6-carboxy-tetramethyl-rhodamine
- DABCYL Non-Fluorescent Quenchers such as quenchers of the Black Hole Quencher family (BHQ), or including a minor groove binder group (MGB).
- Each of the PCR assays of the invention can be carried out by performing a separate PCR reaction for each target sequence to be detected (simplex PCR). However, in many cases it will be preferred to carry out multiplex PCR, allowing amplification of several target sequences in a single reaction.
- a macroarray i.e. a preformed structure such as a substrate upon which the desired DNA primers have been spotted.
- Such a macroarray allows the routine performance of multiplex PCR assays described herein.
- GeneDisc® macroarray Pall-GencDisc Technology, Bruz, France
- Beutin et al. Beutin et al.2009
- the assay may also comprise a negative amplification control to ensure any detected products are true positives and also an inhibition control to ensure that the DNA from the sample is able to be amplified and hence that no false negatives are generated.
- the invention also encompasses the primer sets and the probes defined above, allowing carrying out the PGR assays of the invention, as well as kits associating these primer sets and these probes, eventually associated with reagents to perform a PGR reaction. These kits may also comprise instructions for performing said amplification reaction.
- the amplification products using the primers of the invention are also part of the invention.
- a kit of the invention comprises a combination of primers comprising:
- SEQ ID NO: 12 and a set of primers defined by the sequences SEQ ID NO: 13 and SEQ ID NO: 14, and/or a set of primers defined by the sequences SEQ ID NO: 15 and SEQ ID NO: 16;
- said kit also comprises:
- a probe allowing the detection of amplification products derived from SEQ ID NO: 1 and SEQ ID NO: 2, and a probe allowing the detection of amplification products derived from SEQ ID NO: 3, and/or a probe allowing the detection of amplification products derived from SEQ ID NO: 4, as defined above;
- a kit of the invention comprises:
- said kit also comprises a probe allowing the detection of amplification products derived from espK, and one or more probe(s) selected among: a probe allowing the detection of amplification products derived from espV, a probe allowing the detection of amplification products derived from ureD, or a probe allowing the detection of amplification products derived from Z2098, a probe allowing the detection of amplification products derived from ZJ 151, a probe allowing the detection of amplification products derived from Z1153, a probe allowing the detection of amplification products derived from Zl 154, a probe allowing the detection of amplification products derived from Z1155, a probe allowing the detection of amplification products derived from Z1156, a probe allowing the detection of amplification products derived from Z6065.
- a probe allowing the detection of amplification products derived from espV a probe allowing the detection of amplification products derived from ureD, or a probe allowing the detection of amplification products
- kits according to the second embodiment described above may further comprise a set of primers targeting stxl and a set of primers targeting stx2, and preferably a probe allowing the detection of amplification products derived from stxl, and a probe allowing the detection of amplification products derived from stx2.
- EXAMPLE 1 IDENTIFICATION OF DNA SEQUENCES DERIVED FROM THE CRISPRS LOCI OF E. COLI FOR SPECIFIC IDENTIFICATION OF ENTEROHAEMORRHAGIC E. COLI (EHEC)
- the STEC EHEC type was defined on the presence of six- and eae-genes.
- EHEC strains were defined as harbouring both a stx gene ⁇ stxl and/or stx 2) and eae, while STEC strains harboured stx only.
- EHEC coli strains of serotypes 091 :[H21], OH3:[H21], O104:[H21], also named atypical EHEC, which are less frequently involved in hemorrhagic diseases than other EHEC, but are a frequent cause of diarrhea.
- St.v-negative derivatives of EHEC strains were designated as EHEC-like and were defined based on their nle gene profile, eae subtype and serotype as described by Bugarel et al. (2010; 201 1 ) except for the EHEC-like strains of serotype 026 :H 1 1 which were identified based on the presence of the gene espK and their allelic type 2 of the arcA gene (Bugarel et al., 2011).
- EPEC strains were defined as described by Bugarel et al. (2011).
- Apathogenic E. coli were defined as stx- and eae- negative strains.
- the CRISPR loci of E. coli strains were PGR amplified with the primers listed in Table II.
- the double stranded DNA sequencing of the CRISPR amplicons was performed by Eurofins MWG Operon (Courtaboeuf, France) using the sequencing primers listed in Table II.
- the LightCycler® 1536 (Roche, Meylan, France) was used to perform high- throughput real-time PGR amplifications.
- the Bravo liquid dispenser automat (Agilent Technologies, Massy, France) equipped with a chiller and the PlateLoc thermal microplate sealer (Agilent Technologies) were used.
- the PGR reactions contained 0.5 ⁇ sample and I ⁇ master mix containing lx RealTime ready DNA Probes master (Roche) (corresponding to ().7x final), 300 nM each primer and 300 nM each probe (corresponding to 200 nM final each). Amplifications were performed using FAM- or HEX-labeled TaqMan® probes.
- Primers and probes used for PGR amplifications are listed in Table III.
- the LightCycler® 1536 real-time PGR system was used with the following thermal profile: 95°C for 1 min followed by 35 cycles of 95°C for 0 s (ramp: 4.8°C/s) and 60°C for 30 s (ramp: 2.5°C/s) and a final cooling step at 40°C for 30s.
- the software settings were Dual color hydrolysis probes/UPL probes and Master Control. Table III
- coli strains including 75 strains of EHEC 0157:[H7] (Table I).
- the PCR tests proved to be highly sensitive and specific for EHEC 0157:[H7]. Sensitivity of the assays was ranging from 92.0% to 97.3% with only few 0157:[H7] strains being not detected by each assay. The specificity of the PCR tests was high, ranging from 99.6 to 100%.
- the PCR assay SP 0157 B was the unique test giving cross reaction with very few strains of serogroup 055.
- the CRISPR locus of EHEC 0145:[H28] has been characterized (SEQ ID NO: 5) by sequencing one of the two CRISPR loci identified in E. coli.
- a PCR assay (SP_0145) has been designed from this CRISPR sequence to target EHEC 0145:[H28].
- SP_0145 has been designed from this CRISPR sequence to target EHEC 0145:[H28].
- 955 E. coli strains that were investigated with this PCR test, only the 29 EHEC 0145:[H28] and 4 EPEC 028:H28 strains were tested positive. Sensitivity and specificity of the PCR assay SP_0145 were respectively of 100% and 99.5%.
- the CRISPR locus of EHEC 0121 :[H 19] has been sequenced in this study (SEQ ID NO: 7).
- a PCR assay (SP 0121 ) has been designed from this sequence to target EHEC 0121 :[H19].
- SP 0121 The CRISPR locus of EHEC 0121 :[H 19] has been sequenced in this study.
- a PCR assay (SP 0121 ) has been designed from this sequence to target EHEC 0121 :[H19].
- 955 E. coli strains tested by the PCR assay SP 0121 only one O104:H7 and the 12 EHEC 0121 :[H19] strains were tested positive, showing that this PCR test was highly sensitive (100%) and specific (99.9%).
- PCR assay SP_0405 Based on the sequence determination of the CRISPR locus of EHEC 045:[H2] (SEQ ID NO: 8) and the sequence of the CRISPR locus of EHEC O103:H2, issued from strain 12009 (accession number APO 10958), a PCR assay (SP_045) has been designed and tested positive one strain f EHEC 045 :H2 and all the 38 EHEC O103:H2 strains investigated in this study. Thus, the PCR assay SP 045 has shown high sensitivity (100%) for EHEC O103:[H2] and 045:[H2]. This test has 98.6% specificity when tested on a large panel of E.
- the CRISPR locus of EHEC O104:[H4] has been sequenced in this study (SEQ ID NO: 9).
- a PCR assay (SP O 104) has been designed from this sequence to target EHEC O104:[H4].
- the PCR assay targeting the CRISPR locus of E. coli O104:H4 has been evaluated on a panel of 1303 strains of E. coli that included the 186 known O-serogroups and 56 H-types. This PCR assay gave positive results for the 48 O104:H4 isolates (including one Or:H4 isolate) related to the outbreak occurring in May 201 1 , and to one O104:H4 clinical isolate reported in 2001 .
- EXAMPLE 2 IDENTIFICATION OF GENETIC MARKERS FOR IDENTIFYING SHIGA TOXIN-PRODUCING ESCHERICHIA COLI (STEC) ASSOCIATED WITH HIGH VIRULENCE FOR HUMANS
- Nomenclature of ORFs and mobile elements refers to sequence of E. coli 0157:H7 EDL933 (GenBank AE005174)
- Primers and probes used for PCR amplifications of the genetic markers espK, Z1151, Z1153, Z1154, Z1155, Z1156 and Z6065 are listed in Table VI. Primers and probes for the detection of stx J, stx2 and eae, were described previously (Bugarel et al. 2010). Amplification of the genes stxl, stx2 and eae were used as internal controls and for group assignment purposes.
- the distribution of the different genetic markers espK, Z1151, Z1153, Z1154. Z1155, Z1156 and Z6065 among the different E. coli pathogroups is shown in Table VII below. Overall, the genetic markers investigated were mostly detected in EH EC strains with frequencies ranging from 51.9% (Z6065) to 90.8% (espK). These markers were less associated with EPEC strains with frequencies ranging from 17.7% (ZII54) to 53.8% (Z1155) and rarely detected in STEC (3.4 to 20.7%) and non-pathogenic E. coli (3.6 to 9.4%).
- EPEC strains with frequencies ranging from 31.2% (espKIZll56) to 61 .8% (espK/ ⁇ 155), STEC strains with frequencies of 6.7% to 23.5% and non-pathogenic E. coli strains with frequencies between 7.9% and 13.7%.
- each genetic marker espK, Z1151, Z1153, Z1154, Z1155, Z1156 and Z6065 was significantly different according to EHEC serotypes (Table VIII).
- the genetic marker Z6065 is the unique genetic marker able to detect EHEC O104:H4 (stx positive, eae negative, aggR positive) that has been involved in the large German outbreak in 201 1.
- EHEC strains of top 7 EHEC serotypes were detected.
- all EHEC strains of the top 7 serotypes were tested positive, with the exception of 1 to 2 strains of EHEC 0121 :[H 19] which tested negative with espK/Z1154 and espK/Z6065 respectively; one strain of O103:[H2] that failed to be detected with espK/Z1154 and 7 to 8 strains of EHEC 026:[H11] which were found negative with all tested associations of genetic markers.
- only few EHEC strains did not react with the genetic markers tested here.
- EHEC / . coli strains both six and cue positive
- the introduction of the genetic marker Z6065 allows detecting in addition EHEC O104:H4 (six positive, eae negative, aggR positive) that has been involved in the large German outbreak in 201 1.
- Shiga toxin Shiga toxin
- EH EC enterohemorrhagic E. coli
- HC Hemorrhagic colitis
- HUS Hemolytic Uremic Syndrome
- STEC strains associated with human infections harbor other factors which might be used to distinguish STEC strains constituting a severe risk for human health from STEC strains that are not associated with severe and epidemic disease.
- EH EC 0157:H7, Ol l l , O103 and 026 Genome sequencing of EH EC strains (EH EC 0157:H7, Ol l l , O103 and 026) has also pointed out other genetic markers, such as e.sp V whose role in disease has not been evaluated. This gene is located on 01-44 of EH EC 0157:H7 but its prevalence in other E. coli pathogroups has not been documented yet.
- the EH EC type strains (n 340) and were defined on the presence of stx- and eae-genes.
- espK/espV represent strains giving a positive result for espK and/or espV
- espK/ureD represent strains giving a positive result for espK and/or ureD
- espK/Z2098 represent strains giving a positive result for Z2098 and/or espK
- each genetic marker ureD, espV, espK, and Z2098 was significantly different according to EHEC serotypes. Distribution of each genetic marker in various EHEC serogroups is reported in Table XI. Except espV which was not detected in any EHEC 045:[H2], all the other genetic markers investigated were found highly prevalent in EHEC strains of the top 7 serotypes, with frequencies ranging from 71.4% (prevalence of ureD in O103:[H2]) to 100%.
- espK/espV represent strains giving a positive result for espK and/or espV
- espK/ureD represent strains giving a positive result for espK and/or ureD
- espK/Z2098 represent strains giving a positive result for Z2098 and/or espK
- the genetic markers ureD, espV, espK, Z2098, Zl 151, Z1153, Zl 154, Zl 155, Zl 156 and Z6065 were detected at different frequencies among the EHEC serotypes. We explored the various associations of these genetic markers to search for the best combinations of markers giving the higher specificity and sensitivity for detecting EHEC. Association of the genetic marker espK with one of the other nine genetic markers allows detecting most of the typical EHEC strains and in particular those belonging to the top7 EHEC serotypes. The genetic markers esp V, ureD and Z2098 were shown the best candidates to be combined with espK for detecting EHEC.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BR112014031370-9A BR112014031370B1 (pt) | 2012-06-14 | 2013-06-14 | Método para a identificação de serotipo(s) de escherichia coli enterohemorrágica em uma amostra |
| JP2015516741A JP6166365B2 (ja) | 2012-06-14 | 2013-06-14 | 腸出血性大腸菌を検出及び同定する方法 |
| US14/407,884 US10190175B2 (en) | 2012-06-14 | 2013-06-14 | Method for detecting and identifying enterohemorrhagic Escherichia coli |
| CN201380030965.9A CN104619860B (zh) | 2012-06-14 | 2013-06-14 | 用于检测和鉴定肠出血性大肠杆菌的方法 |
| CA2875919A CA2875919C (en) | 2012-06-14 | 2013-06-14 | Method for detecting and identifying enterohemorrhagic escherichia coli. |
| ES13747516.6T ES2659469T3 (es) | 2012-06-14 | 2013-06-14 | Método para detectar e identificar Escherichia Coli enterohemorrágica |
| EP13747516.6A EP2861762B1 (en) | 2012-06-14 | 2013-06-14 | Method for detecting and identifying enterohemorrhagic escherichia coli |
| MX2014015130A MX357697B (es) | 2012-06-14 | 2013-06-14 | Método para detectar e identificar escherichia colienterohemorrágica. |
| KR1020157000638A KR102065053B1 (ko) | 2012-06-14 | 2013-06-14 | 장출혈성 대장균의 검출 및 식별 방법 |
| AU2013276084A AU2013276084B2 (en) | 2012-06-14 | 2013-06-14 | Method for detecting and identifying enterohemorrhagic Escherichia coli |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP12171941.3A EP2674501A1 (en) | 2012-06-14 | 2012-06-14 | Method for detecting and identifying enterohemorrhagic Escherichia coli |
| EP12171941.3 | 2012-06-14 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2013186754A2 true WO2013186754A2 (en) | 2013-12-19 |
| WO2013186754A3 WO2013186754A3 (en) | 2014-02-20 |
Family
ID=48949190
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2013/054888 Ceased WO2013186754A2 (en) | 2012-06-14 | 2013-06-14 | Method for detecting and identifying enterohemorrhagic escherichia coli |
Country Status (12)
| Country | Link |
|---|---|
| US (1) | US10190175B2 (enExample) |
| EP (2) | EP2674501A1 (enExample) |
| JP (1) | JP6166365B2 (enExample) |
| KR (1) | KR102065053B1 (enExample) |
| CN (1) | CN104619860B (enExample) |
| AU (1) | AU2013276084B2 (enExample) |
| BR (1) | BR112014031370B1 (enExample) |
| CA (1) | CA2875919C (enExample) |
| CL (1) | CL2014003377A1 (enExample) |
| ES (1) | ES2659469T3 (enExample) |
| MX (1) | MX357697B (enExample) |
| WO (1) | WO2013186754A2 (enExample) |
Cited By (38)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9068179B1 (en) | 2013-12-12 | 2015-06-30 | President And Fellows Of Harvard College | Methods for correcting presenilin point mutations |
| US9163284B2 (en) | 2013-08-09 | 2015-10-20 | President And Fellows Of Harvard College | Methods for identifying a target site of a Cas9 nuclease |
| US9228207B2 (en) | 2013-09-06 | 2016-01-05 | President And Fellows Of Harvard College | Switchable gRNAs comprising aptamers |
| US9322037B2 (en) | 2013-09-06 | 2016-04-26 | President And Fellows Of Harvard College | Cas9-FokI fusion proteins and uses thereof |
| US9322006B2 (en) | 2011-07-22 | 2016-04-26 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| WO2016087621A1 (en) * | 2014-12-03 | 2016-06-09 | Qiagen Gmbh | Highly specific and sensitive methods for detecting enterohemorrhagic escherichia coli serotypes o157:h7 and/or o145:h28 |
| WO2016115441A1 (en) * | 2015-01-16 | 2016-07-21 | Kansas State University Research Foundation | Co-detection and association of multiple genes from the same genome in a sample |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US9725714B2 (en) | 2013-03-14 | 2017-08-08 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9834791B2 (en) | 2013-11-07 | 2017-12-05 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
| US9885026B2 (en) | 2011-12-30 | 2018-02-06 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US10000772B2 (en) | 2012-05-25 | 2018-06-19 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| WO2020051301A1 (en) * | 2018-09-06 | 2020-03-12 | Hygiena, Llc | Sequences and their use for detection and characterization of escherichia coli serotype o157:h7 |
| US10731181B2 (en) | 2012-12-06 | 2020-08-04 | Sigma, Aldrich Co. LLC | CRISPR-based genome modification and regulation |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
Families Citing this family (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10378027B2 (en) | 2013-03-15 | 2019-08-13 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
| US10760064B2 (en) | 2013-03-15 | 2020-09-01 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
| WO2014204578A1 (en) | 2013-06-21 | 2014-12-24 | The General Hospital Corporation | Using rna-guided foki nucleases (rfns) to increase specificity for rna-guided genome editing |
| US9512446B1 (en) | 2015-08-28 | 2016-12-06 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
| AU2016316845B2 (en) | 2015-08-28 | 2022-03-10 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
| US9926546B2 (en) | 2015-08-28 | 2018-03-27 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
| CN105779584A (zh) * | 2015-12-18 | 2016-07-20 | 珠海出入境检验检疫局检验检疫技术中心 | 大肠杆菌o111检测用的引物和探针组、试剂盒及pcr检测方法 |
| CN105821124A (zh) * | 2016-04-06 | 2016-08-03 | 山东省滨州畜牧兽医研究院 | 一种大肠杆菌 o26、o45、o121血清型三重pcr检测试剂盒及其引物组 |
| ES2992912T3 (en) | 2017-04-21 | 2024-12-19 | Massachusetts Gen Hospital | Variants of cpf1 (cas12a) with altered pam specificity |
| AU2018273986A1 (en) | 2017-05-25 | 2019-12-12 | The General Hospital Corporation | Bipartite base editor (BBE) architectures and type-II-C-Cas9 zinc finger editing |
| US10101328B1 (en) | 2017-12-29 | 2018-10-16 | Clear Labs, Inc. | Detection of microorganisms in food samples and food processing facilities |
| SG11201903333SA (en) * | 2017-12-29 | 2019-08-27 | Clear Labs Inc | Automated priming and library loading services |
| US10597714B2 (en) | 2017-12-29 | 2020-03-24 | Clear Labs, Inc. | Automated priming and library loading device |
| CN108950033B (zh) * | 2018-07-26 | 2022-01-11 | 江苏省农业科学院 | 同时检测肠出血性大肠杆菌o45和o145的纳米pcr试剂盒及其应用 |
| CN111100862B (zh) * | 2018-10-26 | 2023-09-29 | 厦门大学 | 一种检测细菌血清型的方法 |
| EP3921417A4 (en) | 2019-02-04 | 2022-11-09 | The General Hospital Corporation | VARIANTS OF ADENINE DNA BASES WITH REDUCED OFF-TARGET RNA EDIT |
| US20230279442A1 (en) | 2021-12-15 | 2023-09-07 | Versitech Limited | Engineered cas9-nucleases and method of use thereof |
| CN116903710B (zh) * | 2023-09-12 | 2023-11-14 | 山东省农业科学院畜牧兽医研究所 | 噬菌体靶向蛋白分子及其在鉴定o103抗原血清型的产志贺毒素大肠杆菌中的应用 |
| WO2026006542A2 (en) | 2024-06-26 | 2026-01-02 | Yale University | Compositions and methods for crispr/cas9 based reactivation of human angelman syndrome |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011018762A1 (en) | 2009-08-11 | 2011-02-17 | Agence Nationale Chargee De La Securite Sanitaire De L'alimentation, De L'environnement Et Du Travail | An assay for determining a molecular risk assessment of a complex polymicrobial sample suspected to contain an ehec |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2002355074A (ja) * | 2001-01-24 | 2002-12-10 | Univ Tsukuba | 腸管出血性病原性大腸菌o157:h7に特異的な核酸分子およびポリペプチド並びにこれらの使用方法 |
| US20060051751A1 (en) * | 2002-01-23 | 2006-03-09 | Gehua Wang | Major virulence factor detection and verocytontoxin type 2 subtype from clinical e. coli isolates using a one-step multiplex pcr |
-
2012
- 2012-06-14 EP EP12171941.3A patent/EP2674501A1/en not_active Withdrawn
-
2013
- 2013-06-14 EP EP13747516.6A patent/EP2861762B1/en active Active
- 2013-06-14 US US14/407,884 patent/US10190175B2/en active Active
- 2013-06-14 CA CA2875919A patent/CA2875919C/en active Active
- 2013-06-14 WO PCT/IB2013/054888 patent/WO2013186754A2/en not_active Ceased
- 2013-06-14 CN CN201380030965.9A patent/CN104619860B/zh active Active
- 2013-06-14 ES ES13747516.6T patent/ES2659469T3/es active Active
- 2013-06-14 BR BR112014031370-9A patent/BR112014031370B1/pt active IP Right Grant
- 2013-06-14 AU AU2013276084A patent/AU2013276084B2/en active Active
- 2013-06-14 JP JP2015516741A patent/JP6166365B2/ja active Active
- 2013-06-14 MX MX2014015130A patent/MX357697B/es active IP Right Grant
- 2013-06-14 KR KR1020157000638A patent/KR102065053B1/ko active Active
-
2014
- 2014-12-12 CL CL2014003377A patent/CL2014003377A1/es unknown
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011018762A1 (en) | 2009-08-11 | 2011-02-17 | Agence Nationale Chargee De La Securite Sanitaire De L'alimentation, De L'environnement Et Du Travail | An assay for determining a molecular risk assessment of a complex polymicrobial sample suspected to contain an ehec |
Non-Patent Citations (24)
| Title |
|---|
| BUGAREL M; BEUTIN L; FACH P.: "Low-density macroarray targeting non-locus of enterocyte effacement effectors (nle genes) and major virulence factors of Shiga toxin- producing Escherichia coli (STEC): a new approach for molecular risk assessment of STEC isolates", APPL ENVIRON MICROBIOL., vol. 76, no. 1, January 2010 (2010-01-01), pages 203 - 11, XP009127973, DOI: doi:10.1128/AEM.01921-09 |
| BUGAREL M; BEUTIN L; MARTIN A; GILL A; FACH P.: "Micro-array for the identification of Shiga toxin-producing Escherichia coli (STEC) seropathotypes associated with Hemorrhagic Colitis and Hemolytic Uremic Syndrome in humans", INT J FOOD MICROBIOL., vol. 142, no. 3, pages 318 - 29, XP027219916 |
| BUGAREL M; BEUTIN L; SCHEUTZ F; LOUKIADIS E; FACH P: "Identification of genetic markers for differentiation of Shiga toxin-producing, enteropathogenic, and avirulent strains of Escherichia coli 026", APPL ENVIRON MICROBIOL., vol. 77, no. 7, April 2011 (2011-04-01), pages 2275 - 81, XP055039698, DOI: doi:10.1128/AEM.02832-10 |
| BUGAREL M; MARTIN A; FACH P; BEUTIN L.: "Virulence gene profiling of enterohemorrhagic (EHEC) and enteropathogenic (EPEC) Escherichia coli strains: a basis for molecular risk assessment of typical and atypical EPEC strains", BMC MICROBIOL., vol. 11, 21 June 2011 (2011-06-21), pages 142, XP021102743, DOI: doi:10.1186/1471-2180-11-142 |
| CERGOLE-NOVELLA MC; NISHIMURA LS; DOS SANTOS LF; IRINO K; VAZ TM; BERGAMINI AM; GUTH BE: "Distribution of virulence profiles related to new toxins and putative adhesins in Shiga toxin-producing Escherichia coli isolated from diverse sources in Brazil", FEMS MICROBIOL LETT., vol. 274, no. 2, 25 July 2007 (2007-07-25), pages 329 - 34 |
| CHANG, C.: "Branched DNA Amplification Multimers for the Sensitive, Direct Detection of Human Hepatitis Viruses", NUCLEIC ACIDS SYMPOSIUM SERIES, 1991, pages 197 - 200 |
| COMPTON, J.: "Nucleic Acid Sequence-Based Amplification", NATURE, vol. 350, no. 6313, 1991, pages 91 - 92, XP000176319, DOI: doi:10.1038/350091a0 |
| COOMBES BK; WICKHAM ME; MASCARENHAS M; GRUENHEID S; FINLAY BB; KARMALI MA: "Molecular analysis as an aid to assess the public health risk of non-0157 Shiga toxin- producing Escherichia coli strains", APPL ENVIRON MICROBIOL., vol. 74, no. 7, April 2008 (2008-04-01), pages 2153 - 60, XP002564138, DOI: doi:10.1128/AEM.02566-07 |
| CREUZBURG K; MIDDENDORFB; MELLMANN A; MARTALER T; HOLZ C; FRUTH A; KARCH H; SCHMIDT H.: "Evolutionary analysis and distribution of type III effector genes in pathogenic Escherichia coli from human, animal and food sources", ENVIRON MICROBIOL., vol. 13, February 2011 (2011-02-01), pages 2 |
| FRANK C; WERBER D; CRAMER JP; ASKAR M; FABER M; AN DER HEIDEN M; BERNARD H; FRUTH A; PRAGER R; SPODE A: "HUS Investigation Team. Epidemic profile of Shiga-toxin-producing Escherichia coli 0104:H4 outbreak in Germany", N ENGL J MED., vol. 365, no. 19, 10 November 2011 (2011-11-10), pages 1771 - 80 |
| GAULT G; WEILL FX; MARIANI-KURKDJIAN P; JOURDAN-DA SILVA N; KING L; ALDABE B; CHARRON M; ONG N; CASTOR C; MACE M: "Outbreak of haemolytic uraemic syndrome and bloody diarrhoea due to Escherichia coli 0104:H4, south- west France", EURO SURVEILL., vol. 16, no. 26, 30 June 2011 (2011-06-30) |
| IMAMOVIC L; TOZZOLI R; MICHELACCI V; MINELLI F; MARZIANO ML; CAPRIOLI A; MORABITO S.: "OI-57, a genomic island of Escherichia coli 0157, is present in other seropathotypes of Shiga toxin-producing E. coli associated with severe human disease", INFECT IMMUN., vol. 78, no. 11, November 2010 (2010-11-01), pages 4697 - 704 |
| J. APPL. MICROBIOL., vol. 106, no. 4, pages 1122 - 1132 |
| KARMALI, M. A.; M. MASCARENHAS; S. SHEN; K. ZIEBELL; S. JOHNSON; R. REID-SMITH; J. ISAAC- RENTON; C. CLARK; K. RAHN; J. B. KAPER: "Association of genomic 0 island 122 of Escherichia coli EDL 933 with verocytotoxin-producing Escherichia coli seropathotypes that are linked to epidemic and/or serious disease", J. CLIN. MICROBIOL., vol. 41, 2003, pages 4930 - 4940 |
| LEVINE, M. M.: "Escherichia coli That Cause Diarrhea - Enterotoxigenic, Enteropathogenic, Enteroinvasive, Enterohemorrhagic, and Enteroadherent", J. INFECT. DIS., vol. 155, 1987, pages 377 - 389, XP001000816 |
| MACKAY, 1.: "Real-time PCR in Microbiology, from diagnosis to characterization", 2007, CAISTER ACADEMIC PRESS |
| NATARO, J. P.; J. B. KAPER: "Diarrheagenic Escherichia coli", CLINICAL MICROBIOL. REV., vol. 11, 1998, pages 142 - 201, XP002244492 |
| NOTOMI, T.; OKAYAMA, H.; MASUBUCHI, H.; YONEKAWA, T.; WATANABE, K.; AMINO, N.; HASE, T.: "Loop-Mediated Isothermal Amplification of DNA", NUCLEIC ACIDS RESEARCH, vol. 28, no. 12, 2000, pages E63, XP003018858, DOI: doi:10.1093/nar/28.12.e63 |
| SCHEUTZ F; NIELSEN EM; FRIMODT-MOLLER J; BOISEN N; MORABITO S; TOZZOLI R; NATARO JP; CAPRIOLI A: "Characteristics of the enteroaggregative Shiga toxin/verotoxin-producing Escherichia coli 0104:H4 strain causing the outbreak of haemolytic uraemic syndrome in Germany", EURO SURVEILL., vol. 16, no. 24, May 2011 (2011-05-01) |
| SPEARS KJ; ROE AJ; GALLY DL: "A comparison of enteropathogenic and enterohaemorrhagic Escherichia coli pathogenesis", FEMS MICROBIOL LETT., vol. 255, no. 2, February 2006 (2006-02-01), pages 187 - 202, XP002634275, DOI: doi:10.1111/j.1574-6968.2006.00119.x |
| STRUELENS MJ; PALM D; TAKKINEN J.: "Enteroaggregative, Shiga toxin-producing Escherichia coli 0104:H4 outbreak: new microbiological findings boost coordinated investigations by European public health laboratories", EURO SURVEILL., vol. 16, no. 24, 16 June 2011 (2011-06-16) |
| TOBE T; BEATSON SA; TANIGUCHI H; ABE H; BAILEY CM; FIVIAN A; YOUNIS R; MATTHEWS S; MARCHES 0; FRANKEL G: "An extensive repertoire of type III secretion effectors in Escherichia coli 0157 and the role of lambdoid phages in their dissemination", PROC NATL ACAD SCI U S A., vol. 103, no. 40, 3 October 2006 (2006-10-03), pages 14941 - 6, XP002634274, DOI: doi:10.1073/pnas.0604891103 |
| VLISIDOU I; MARCHES 0; DZIVA F; MUNDY R; FRANKEL G; STEVENS MP: "Identification and characterization of EspK, a type III secreted effector protein of enterohaemorrhagic Escherichia coli 0157:H7", FEMS MICROBIOL LETT., vol. 263, no. 1, October 2006 (2006-10-01), pages 32 - 40, XP002604107, DOI: doi:10.1111/J.1574-6968.2006.00410.X |
| WALKER, G.; FRAISER, M.; SCHRAM, J.; LITTLE, M.; NADEAU, J.; DOUGLAS P.; MALINOWSKI, D.: "Strand Displacement Amplification-An Isothermal, In Vitro DNA Amplification Technique", NUCLEIC ACIDS RESEARCH, vol. 20, no. 7, 1992, pages 1691 - 1696 |
Cited By (159)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12006520B2 (en) | 2011-07-22 | 2024-06-11 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US9322006B2 (en) | 2011-07-22 | 2016-04-26 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US9885026B2 (en) | 2011-12-30 | 2018-02-06 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US11939604B2 (en) | 2011-12-30 | 2024-03-26 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US10954498B2 (en) | 2011-12-30 | 2021-03-23 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US10711257B2 (en) | 2011-12-30 | 2020-07-14 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US10435678B2 (en) | 2011-12-30 | 2019-10-08 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US10570419B2 (en) | 2012-05-25 | 2020-02-25 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10988780B2 (en) | 2012-05-25 | 2021-04-27 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11634730B2 (en) | 2012-05-25 | 2023-04-25 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11549127B2 (en) | 2012-05-25 | 2023-01-10 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11674159B2 (en) | 2012-05-25 | 2023-06-13 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11814645B2 (en) | 2012-05-25 | 2023-11-14 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11479794B2 (en) | 2012-05-25 | 2022-10-25 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11473108B2 (en) | 2012-05-25 | 2022-10-18 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11401532B2 (en) | 2012-05-25 | 2022-08-02 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11332761B2 (en) | 2012-05-25 | 2022-05-17 | The Regenis of Wie University of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11970711B2 (en) | 2012-05-25 | 2024-04-30 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11293034B2 (en) | 2012-05-25 | 2022-04-05 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10000772B2 (en) | 2012-05-25 | 2018-06-19 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10626419B2 (en) | 2012-05-25 | 2020-04-21 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10113167B2 (en) | 2012-05-25 | 2018-10-30 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10612045B2 (en) | 2012-05-25 | 2020-04-07 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11242543B2 (en) | 2012-05-25 | 2022-02-08 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US12123015B2 (en) | 2012-05-25 | 2024-10-22 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11186849B2 (en) | 2012-05-25 | 2021-11-30 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10227611B2 (en) | 2012-05-25 | 2019-03-12 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US12215343B2 (en) | 2012-05-25 | 2025-02-04 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10266850B2 (en) | 2012-05-25 | 2019-04-23 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10301651B2 (en) | 2012-05-25 | 2019-05-28 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10308961B2 (en) | 2012-05-25 | 2019-06-04 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11028412B2 (en) | 2012-05-25 | 2021-06-08 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10337029B2 (en) | 2012-05-25 | 2019-07-02 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10351878B2 (en) | 2012-05-25 | 2019-07-16 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10358658B2 (en) | 2012-05-25 | 2019-07-23 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10358659B2 (en) | 2012-05-25 | 2019-07-23 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10385360B2 (en) | 2012-05-25 | 2019-08-20 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10400253B2 (en) | 2012-05-25 | 2019-09-03 | The Regents Of The University Of California | Methods and compositions or RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10407697B2 (en) | 2012-05-25 | 2019-09-10 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10415061B2 (en) | 2012-05-25 | 2019-09-17 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10421980B2 (en) | 2012-05-25 | 2019-09-24 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10428352B2 (en) | 2012-05-25 | 2019-10-01 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11008589B2 (en) | 2012-05-25 | 2021-05-18 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10443076B2 (en) | 2012-05-25 | 2019-10-15 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11008590B2 (en) | 2012-05-25 | 2021-05-18 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10487341B2 (en) | 2012-05-25 | 2019-11-26 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11001863B2 (en) | 2012-05-25 | 2021-05-11 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10513712B2 (en) | 2012-05-25 | 2019-12-24 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10519467B2 (en) | 2012-05-25 | 2019-12-31 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10526619B2 (en) | 2012-05-25 | 2020-01-07 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10533190B2 (en) | 2012-05-25 | 2020-01-14 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10550407B2 (en) | 2012-05-25 | 2020-02-04 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10563227B2 (en) | 2012-05-25 | 2020-02-18 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10597680B2 (en) | 2012-05-25 | 2020-03-24 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10577631B2 (en) | 2012-05-25 | 2020-03-03 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10988782B2 (en) | 2012-05-25 | 2021-04-27 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10982231B2 (en) | 2012-05-25 | 2021-04-20 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10982230B2 (en) | 2012-05-25 | 2021-04-20 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US12180503B2 (en) | 2012-05-25 | 2024-12-31 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11274318B2 (en) | 2012-05-25 | 2022-03-15 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10900054B2 (en) | 2012-05-25 | 2021-01-26 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10640791B2 (en) | 2012-05-25 | 2020-05-05 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10669560B2 (en) | 2012-05-25 | 2020-06-02 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10676759B2 (en) | 2012-05-25 | 2020-06-09 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10793878B1 (en) | 2012-05-25 | 2020-10-06 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10774344B1 (en) | 2012-05-25 | 2020-09-15 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10752920B2 (en) | 2012-05-25 | 2020-08-25 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US12180504B2 (en) | 2012-05-25 | 2024-12-31 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10745716B2 (en) | 2012-12-06 | 2020-08-18 | Sigma-Aldrich Co. Llc | CRISPR-based genome modification and regulation |
| US10731181B2 (en) | 2012-12-06 | 2020-08-04 | Sigma, Aldrich Co. LLC | CRISPR-based genome modification and regulation |
| US9725714B2 (en) | 2013-03-14 | 2017-08-08 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9803194B2 (en) | 2013-03-14 | 2017-10-31 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9809814B1 (en) | 2013-03-14 | 2017-11-07 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US11312953B2 (en) | 2013-03-14 | 2022-04-26 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9909122B2 (en) | 2013-03-14 | 2018-03-06 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US10125361B2 (en) | 2013-03-14 | 2018-11-13 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US9163284B2 (en) | 2013-08-09 | 2015-10-20 | President And Fellows Of Harvard College | Methods for identifying a target site of a Cas9 nuclease |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US12559737B2 (en) | 2013-09-06 | 2026-02-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US9340800B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | Extended DNA-sensing GRNAS |
| US9737604B2 (en) | 2013-09-06 | 2017-08-22 | President And Fellows Of Harvard College | Use of cationic lipids to deliver CAS9 |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US9340799B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | MRNA-sensing switchable gRNAs |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US9228207B2 (en) | 2013-09-06 | 2016-01-05 | President And Fellows Of Harvard College | Switchable gRNAs comprising aptamers |
| US9322037B2 (en) | 2013-09-06 | 2016-04-26 | President And Fellows Of Harvard College | Cas9-FokI fusion proteins and uses thereof |
| US9388430B2 (en) | 2013-09-06 | 2016-07-12 | President And Fellows Of Harvard College | Cas9-recombinase fusion proteins and uses thereof |
| US12584118B2 (en) | 2013-09-06 | 2026-03-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US12473573B2 (en) | 2013-09-06 | 2025-11-18 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US11390887B2 (en) | 2013-11-07 | 2022-07-19 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
| US10190137B2 (en) | 2013-11-07 | 2019-01-29 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
| US9834791B2 (en) | 2013-11-07 | 2017-12-05 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
| US10640788B2 (en) | 2013-11-07 | 2020-05-05 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAs |
| US9068179B1 (en) | 2013-12-12 | 2015-06-30 | President And Fellows Of Harvard College | Methods for correcting presenilin point mutations |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US12215365B2 (en) | 2013-12-12 | 2025-02-04 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US12398406B2 (en) | 2014-07-30 | 2025-08-26 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10920285B2 (en) | 2014-12-03 | 2021-02-16 | Qiagen Gmbh | Highly specific and sensitive methods for detecting enterohemorrhagic Escherichia coli serotypes O157:H7 and/or O145:H28 |
| WO2016087621A1 (en) * | 2014-12-03 | 2016-06-09 | Qiagen Gmbh | Highly specific and sensitive methods for detecting enterohemorrhagic escherichia coli serotypes o157:h7 and/or o145:h28 |
| WO2016115441A1 (en) * | 2015-01-16 | 2016-07-21 | Kansas State University Research Foundation | Co-detection and association of multiple genes from the same genome in a sample |
| US10233505B2 (en) | 2015-01-16 | 2019-03-19 | Kansas State University Research Foundation | Co-detection and association of multiple genes from the same genome in a sample |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US12043852B2 (en) | 2015-10-23 | 2024-07-23 | President And Fellows Of Harvard College | Evolved Cas9 proteins for gene editing |
| US12344869B2 (en) | 2015-10-23 | 2025-07-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11999947B2 (en) | 2016-08-03 | 2024-06-04 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US12084663B2 (en) | 2016-08-24 | 2024-09-10 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US12516308B2 (en) | 2017-03-09 | 2026-01-06 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US12435331B2 (en) | 2017-03-10 | 2025-10-07 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US12359218B2 (en) | 2017-07-28 | 2025-07-15 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
| WO2020051301A1 (en) * | 2018-09-06 | 2020-03-12 | Hygiena, Llc | Sequences and their use for detection and characterization of escherichia coli serotype o157:h7 |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| US12570972B2 (en) | 2019-03-19 | 2026-03-10 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12509680B2 (en) | 2019-03-19 | 2025-12-30 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12281303B2 (en) | 2019-03-19 | 2025-04-22 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12624353B2 (en) | 2019-03-19 | 2026-05-12 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12624354B2 (en) | 2019-03-19 | 2026-05-12 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| US12031126B2 (en) | 2020-05-08 | 2024-07-09 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104619860B (zh) | 2018-01-30 |
| JP2015519075A (ja) | 2015-07-09 |
| MX2014015130A (es) | 2015-08-06 |
| CA2875919A1 (en) | 2013-12-19 |
| US20150176064A1 (en) | 2015-06-25 |
| ES2659469T3 (es) | 2018-03-15 |
| KR20150030783A (ko) | 2015-03-20 |
| AU2013276084A1 (en) | 2015-01-29 |
| JP6166365B2 (ja) | 2017-07-19 |
| BR112014031370A2 (pt) | 2017-07-25 |
| WO2013186754A3 (en) | 2014-02-20 |
| AU2013276084B2 (en) | 2019-04-04 |
| US10190175B2 (en) | 2019-01-29 |
| CL2014003377A1 (es) | 2015-08-07 |
| BR112014031370B1 (pt) | 2022-06-07 |
| EP2861762B1 (en) | 2017-12-13 |
| EP2674501A1 (en) | 2013-12-18 |
| EP2861762A2 (en) | 2015-04-22 |
| AU2013276084A8 (en) | 2015-02-12 |
| CA2875919C (en) | 2021-08-31 |
| KR102065053B1 (ko) | 2020-01-10 |
| CN104619860A (zh) | 2015-05-13 |
| MX357697B (es) | 2018-07-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2875919C (en) | Method for detecting and identifying enterohemorrhagic escherichia coli. | |
| Perelle et al. | Detection by 5′-nuclease PCR of Shiga-toxin producing Escherichia coli O26, O55, O91, O103, O111, O113, O145 and O157: H7, associated with the world's most frequent clinical cases | |
| Liu et al. | High-resolution melt curve PCR assay for specific detection of E. coli O157: H7 in beef | |
| US10724106B2 (en) | Method for determining the presence of diarrhoea causing pathogens | |
| CA2925168C (en) | Detection of methicillin-resistant staphylococcus aureus in biological samples | |
| You et al. | A novel DNA microarray for rapid diagnosis of enteropathogenic bacteria in stool specimens of patients with diarrhea | |
| KR101837781B1 (ko) | Ehec를 함유한 것이 의심되는 복합 다균성 시료의 분자 위해성 평가 분석 | |
| US8883488B2 (en) | Detection of food threat agents and food-borne pathogens | |
| Youmans et al. | Development and accuracy of quantitative real-time polymerase chain reaction assays for detection and quantification of enterotoxigenic Escherichia coli (ETEC) heat labile and heat stable toxin genes in travelers' diarrhea samples | |
| Taminiau et al. | Validation of real-time PCR for detection of six major pathogens in seafood products | |
| Nessa et al. | Usefulness of a multiplex PCR for detection of diarrheagenic Escherichia coli in a diagnostic microbiology laboratory setting | |
| Yang et al. | Development of rapid real-time PCR and most-probable-number real-time PCR assays to quantify enterotoxigenic strains of the species in the Bacillus cereus group | |
| Ferdous | Shiga toxin-producing Escherichia coli (STEC) from Humans in the Netherlands: Novel diagnostic approach, molecular characterization and phylogenetic background | |
| Beneduce et al. | Occurrence and characterization of Escherichia coli O157 and other serotypes in raw meat products in Morocco | |
| Oyong et al. | High resolution melting (HRM)-coupled multiplex real-time PCR for rapid identification and virulence gene profiling of enterohemorrhagic Escherichia coli (EHEC) O157: H7 from slaughterhouse pigs | |
| Gyles | Evaluation of PCR and PCR-RFLP protocols for identifying Shiga toxins |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13747516 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2875919 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2014/015130 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2015516741 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2014003377 Country of ref document: CL Ref document number: 14407884 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15003768 Country of ref document: CO |
|
| ENP | Entry into the national phase |
Ref document number: 20157000638 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013747516 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2013276084 Country of ref document: AU Date of ref document: 20130614 Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112014031370 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112014031370 Country of ref document: BR Kind code of ref document: A2 Effective date: 20141215 |