WO2013077479A1 - 실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트 - Google Patents

실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트 Download PDF

Info

Publication number
WO2013077479A1
WO2013077479A1 PCT/KR2011/009029 KR2011009029W WO2013077479A1 WO 2013077479 A1 WO2013077479 A1 WO 2013077479A1 KR 2011009029 W KR2011009029 W KR 2011009029W WO 2013077479 A1 WO2013077479 A1 WO 2013077479A1
Authority
WO
WIPO (PCT)
Prior art keywords
probe
breast cancer
seq
primer pair
her2
Prior art date
Application number
PCT/KR2011/009029
Other languages
English (en)
French (fr)
Inventor
이혜영
김승일
박광화
김태우
이동섭
왕혜영
박상정
Original Assignee
엠앤디(주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 엠앤디(주) filed Critical 엠앤디(주)
Priority to PCT/KR2011/009029 priority Critical patent/WO2013077479A1/ko
Publication of WO2013077479A1 publication Critical patent/WO2013077479A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to an information providing method for diagnosing breast cancer using real-time reverse transcriptase polymerization and a kit for diagnosing breast cancer.
  • Human epidermal growth factor receptor 2 (HER2) receptor is a 185 kDa membrane glycoprotein with tyrosine kinase activity that plays an important role in the activation of subcellular signaling systems that regulate epithelial cell growth and differentiation (Akiyama T, Sudo C, Ogawara H, Toyoshima K, Yamamoto T. Science 1986; 232: 1644-6.). Amplification of the HER2 gene or overexpression of the HER2 protein in breast cancer patients is observed in 10-34% of breast cancer patients (Ross JS, Fletcher JA. Am J Clin Pathol 1999; 112: S53-67.).
  • HER2 status is important for the prognosis of patients and the treatment of Tratuzumab, an anti-HER2 monoclonal antibody (Cobleigh MA, Vogel CL, Tripathy D, Robert NJ, Scholl S, Fehrenbacher L, et al. J Clin Oncol 1999; 17: 2639-48 .; Shak S. Herceptin Multinational Inverstigator Study Group Semin Oncol 1999; 26: 71-7).
  • Tratuzumab (Herceptin), a targeted drug for HER2, has been shown to reduce recurrence and prolong survival after adjuvant therapy of metastatic breast cancer as well as metastatic breast cancer. It was also a very important factor (Salmon DJ, Leyland-Jones B, Shak S, Fuchs H, Paton V, Bajamonde A, et al. N Engl J Med 2001; 344: 783-92; Smith I, Procter M, Gelber RD , Nicolas S, Feyereislova A, Dowsett M, et al. Lancet 2007; 369: 29-36).
  • Fluorescein hybridization is known to be the most reliable at present, and because DNA itself is very stable, it can be performed in paraffin embedded tissues and is less sensitive to tissue state than immunohistochemical staining, and has a high reading agreement between pathologists.
  • the inspection process is complicated, and it is inconvenient to proceed through the fluorescence microscope in the dark at the time of reading, and it is impossible to permanently preserve the result and expensive due to the use of fluorescence (Lewis F, Jackson P, Lane S, Coast G, Hanby AM.Histopathology 2004: 45: 207-17.)
  • Korean Patent Publication No. 1020090079845 relates to 'protein markers for breast cancer monitoring, diagnosis and screening, and breast cancer monitoring, diagnosis and screening methods using the same', and Vitronectin, sVCAM-1 (Soluble Vascular cell adhesion molecule-1).
  • sCD40L Soluble CD40 ligand
  • EGF Epidermal growth factor
  • tPAI-1 total plasminogen activator inhibitor-1
  • ApoA-1 Apolipoprotein-A1
  • proApoA-1 Proapolipoprotein-A1
  • Kininogen VDBP
  • ApoA1 / proApoA1 the ratio of ApoA-1 to Proapolipoprotein-A1
  • CRP / Kininogen the ratio of CRP and Kininogen
  • Hemoglobin and MPO myeloperoxidase
  • Korean Patent Publication No. 1020090064378 relates to 'breast cancer-related genes and polypeptides', which provides a novel human gene A7322 with significantly increased expression in breast cancer and a novel expression with significantly increased expression in breast cancer.
  • One human gene F3374 which genes and polypeptides encoded by them, can be used as a target molecule for the diagnosis of breast cancer and for the development of a medicament for breast cancer, which screens for modulators of kinase activity of PBK / TOPK. The method is described.
  • the present invention solves the above problems and the object of the present invention is to provide an information providing method for the diagnosis of breast cancer using a real-time reverse transcriptase polymerization reaction.
  • Another object of the present invention is to provide a kit for diagnosing breast cancer.
  • the present invention comprises the steps of: a) isolating full-length RNA from cells obtained from the blood of a suspected cancer; b) synthesizing cDNA from the isolated full-length RNA; c) human synthesized cDNA At least one primer pair selected from the group consisting of primer pairs and probes capable of amplifying epidermal growth factor receptor (HER) 2, primer pairs and probes capable of amplifying glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and Performing real-time PCR using a probe; And d) comparing the amplified amount with the amount expressed for a normal person.
  • HER epidermal growth factor receptor
  • GPDH glyceraldehyde-3-phosphate dehydrogenase
  • Primers of the invention can be chemically synthesized using phosphoramidite solid support methods, or other well known methods. Such nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, “capsulation”, substitution with one or more homologs of natural nucleotides, and modifications between nucleotides, eg, uncharged linkages such as methyl phosphonate, phosphoester, phosph Modifications to poroamidates, carbamates, etc.) or charged linkers (eg, phosphorothioates, phosphorodithioates, etc.).
  • Nucleic acids may be selected from one or more additional covalently linked residues, such as proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), inserts (eg, acridine, psoralene, etc.). ), Chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents. Nucleic acid sequences of the invention can also be modified using a label that can provide a detectable signal directly or indirectly. Examples of labels include radioisotopes, fluorescent molecules, biotin, and the like.
  • the amplified target sequences can be labeled with a detectable labeling substance.
  • the labeling material may be a fluorescent, phosphorescent, chemiluminescent or radioactive material, but is not limited thereto.
  • the labeling substance may be fluorescein, phycoerythrin, rhodamine, lissamine Cy-5 or Cy-3.
  • real-time RT-PCR may be performed by labeling Cy-5 or Cy-3 at the 5'-end and / or 3 'end of the primer to label the target sequence with a detectable fluorescent label. .
  • the label using radioactive material is added to the PCR reaction solution by adding radioactive isotopes such as 32 P or 35 S to the PCR reaction solution during real-time RT-PCR, and the amplification product is radioactively incorporated into the amplification product.
  • radioactive isotopes such as 32 P or 35 S
  • the amplification product is radioactively incorporated into the amplification product.
  • One or more sets of oligonucleotide primers used to amplify a target sequence can be used.
  • Labeling is carried out in a variety of ways conventionally practiced in the art, such as nick translation methods, random priming methods (Multiprime DNA labeling systems booklet, "Amersham” (1989)) and chination methods (Maxam & Gilbert, Methods). in Enzymology, 65: 499 (1986)). Labels provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetric, X-ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, hybridization high frequency, nanocrystals.
  • the present invention is to measure the expression level at the mRNA level via RT-PCR.
  • a novel primer pair and a fluorescence-labeled probe specifically binding to the HER 2 and GAPDH genes but the primers and probes specified by specific nucleotide sequences in the present invention can be used, but are not limited thereto.
  • FAM and Quen (Quencher) means a fluorescent dye.
  • Real-time RT-PCR method applied to the present invention can be carried out through known procedures commonly used in the art.
  • the step of measuring the mRNA expression level can be used without limitation as long as it is a method capable of measuring the normal mRNA expression level, depending on the type of probe label used can be performed by radiometric measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. It doesn't work.
  • the fluorescence measurement method uses Cy-5 or Cy-3 at the 5'-end of a primer to perform real-time RT-PCR to label a target sequence with a detectable fluorescent label.
  • the labeled fluorescence may be measured using a fluorimeter.
  • the radioactivity measuring method is to add a radioactive isotope such as 32 P or 35 S to the PCR reaction solution when real-time RT-PCR is performed to label the amplification product, and then radioactive measuring apparatus, for example, Geiger counter (Geiger Radioactivity can be measured using a counter or a liquid scintillation counter.
  • a radioactive isotope such as 32 P or 35 S
  • radioactive measuring apparatus for example, Geiger counter (Geiger Radioactivity can be measured using a counter or a liquid scintillation counter.
  • a fluorescent-labeled probe is attached to the PCR product amplified by the realtime RT-PCR to emit fluorescence of a specific wavelength, and at the same time, the fluorescence measuring device of the realtime PCR device The mRNA expression level of the genes are measured in real time, and the measured values are calculated and visualized through a PC so that the examiner can easily check the expression level.
  • the diagnostic kit may be a kit for diagnosing breast cancer, which includes an essential element necessary for performing reverse transcriptase.
  • the reverse transcription polymerase kit may comprise each primer pair specific for the gene of the present invention.
  • the primer is a nucleotide having a sequence specific to the nucleic acid sequence of each marker gene, and may be about 7 bp to 50 bp in length, more preferably about 10 bp to 30 bp in length.
  • reverse transcriptase kits include test tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary), enzymes such as deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase, DNAse, RNAse inhibitor DEPC - May include DEPC-water, sterile water, and the like.
  • reaction buffers pH and magnesium concentrations vary
  • enzymes such as deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase
  • DNAse DNAse
  • RNAse inhibitor DEPC - May include DEPC-water, sterile water, and the like.
  • the term "information providing method for diagnosing cancer” in the present invention is to provide objective basic information necessary for diagnosing cancer as a preliminary step for diagnosis and excludes the clinical judgment or findings of the doctor.
  • primer refers to a short nucleic acid sequence that is capable of forming base pairs with complementary templates with nucleic acid sequences having short free 3-terminal hydroxyl groups and that serves as a starting point for template strand copying.
  • Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) at appropriate buffers and temperatures.
  • Primers of the invention are sense and antisense nucleic acids having 7 to 50 nucleotide sequences as primers specific for each marker gene. Primers can incorporate additional features that do not change the basic properties of the primers that serve as a starting point for DNA synthesis.
  • probe It is a single chain nucleic acid molecule and comprises a sequence complementary to a target nucleic acid sequence.
  • realtime RT-PCR refers to a target primer and label using cDNA produced after reverse transcription of RNA into complementary DNA (cDNA) using reverse transcriptase. It is a molecular biological polymerization method that amplifies a target using a target probe and simultaneously detects a signal generated from a label of a target probe on the amplified target.
  • the step of comparing the amplified amount with the amount amplified for a normal person is preferably performed by a standard or cutoff value, but is not limited thereto.
  • the method is 50 or more positive, 20 below the negative and 20 to 50 is a cutoff value based on the expression amount, but is not limited thereto.
  • the primer pair capable of amplifying the human epidermal growth factor receptor (HER) 2 is described in SEQ ID NOs: 5 and 6, and the probe has a nucleotide sequence set forth in SEQ ID NOs: 11 and 12.
  • the primer pair capable of amplifying the GAPDH is described in SEQ ID NO: 1 and 2
  • the probe preferably has a base sequence described in SEQ ID NO: 9, but is not limited thereto.
  • the present invention provides a method for amplifying a human epidermal growth factor receptor (HER) 2, one or more of a probe having a primer pair shown in SEQ ID NOs: 5 and 6 and a nucleotide sequence shown in SEQ ID NOs: 11 and 12; and GAPDH
  • primer pairs and probes for diagnosing breast cancer comprising at least one primer pair and a probe selected from the group consisting of the primer pairs set forth in SEQ ID NOs: 1 and 2 and the probes set forth in SEQ ID NO: 9.
  • the 5 'end of the probe is preferably labeled with a fluorescent material
  • the fluorescent material is preferably FAM or Cy-5, but is not limited thereto.
  • the present invention provides a composition for diagnosing breast cancer comprising the primer pair and probe of the present invention.
  • the present invention provides a kit for diagnosing breast cancer comprising the composition of the present invention.
  • the present invention compares GAPDH (Glyceraldehyde-3-phosphate dehydrogenase) and TBP (TATA-binding protein) using GAPDH and TBP as reference genes, based on Real-time RT-PCR method, which can produce simple and quantitative results. After amplifying the HER2 gene, the expression levels were compared and quantified, and the expression rates were compared with those of IHC and FISH.
  • GAPDH Glyceraldehyde-3-phosphate dehydrogenase
  • TBP TATA-binding protein
  • A is the result of sensitivity test conducted by mixing two probes produced in this experiment in HER2 gene
  • B is the result of sensitivity test conducted using the probe shown in the existing paper
  • C is one of the parts produced in this experiment. Sensitivity test results using only probes.
  • Table 1 is a comparison table of Ct values and expression patterns of GAPDH and TBP which are reference genes by real-time RT PCR.
  • GAPDH was tested using GADH and HER2, respectively, using dye, which is a conventional method using FAM, and comparing the Ct values and multiplex PCR using GAPDH dye Cy5.
  • Multiplex PCR of HER2 with FAM and GAPDH with Cy5 by dilution from 5 to 1 cell resulted in Ct values of 17.14 to 34.20 (Fig. 7-B) ranging from 10 5 to 1 cell.
  • the sensitivity was found to be 18.06 to 34.33, which was higher in the case of multiplex PCR than the result of PCR (Fig. 7-A).
  • MCF7 Three types of cell lines (MCF7, SKBR3, MDA-MB 231) corresponding to each breast cancer cell and human monocyte cell line (THP-1) were used as negative controls to confirm the expression of HER2. It was confirmed that the expression is high in BR3 (Fig. 8)
  • Tissue samples 55 with ICH results from Sinchon Severance Hospital were used to confirm the expression of HER2 by two methods.
  • the cut off of the expression of the HER2 gene used in the existing paper was set to 10 and the cut off of the expression of the newly produced HER2 gene was set to 25 below the negative and 50 above the positive (FIG. 9).
  • the expression of the newly produced HER2 gene was 43/55 (78%), which was higher than the expression of the HER2 gene of the previous paper 30/55 (54.5%) (Table 2).
  • Table 2 is a table of HER2 expression patterns according to the results of IHC.
  • Table 3 is a table of HER2 expression patterns according to the FISH results.
  • Tissue sample 31 containing both FISH and IHC results was used to confirm the expression of HER2 in the same manner as above.
  • the expression of the newly produced HER2 gene was positive in all 15 samples that were positive for FISH-IHC, but the expression of HER2 gene was 12/15 (80%) in the previous paper.
  • 9 samples were negatively produced.
  • the IHC result is 2+, and these samples need to be reconfirmed.
  • the gene expression was 22/31 (71%), which was higher than the expression of HER2 gene 21/31 (67.7%) in the previous paper (Table 4).
  • Table 4 is a table of HER2 expression patterns according to FISH and IHC results.
  • the present invention uses a gene amplification method using HER 2 mRNA based on the real-time RT-PCR method that can produce a simple and quantitative result, it can detect an invisible amount than the protein detection method Since an antigen antibody reaction is not used, a cheap test method can be provided. In addition, it was confirmed that the sensitivity is higher than the known sequence, and also there is no step to identify the band by using electrophoresis, it is easier to confirm the result.
  • Figure 2 is a newly prepared primer and probe position and primer and probe position used in the existing paper, A is a distribution of the expression pattern expressed using GAPDH and HER2 gene, B is the expression pattern appeared using TBP and HER2 gene. Is the distribution of,
  • 3 is a diagram confirming the sensitivity of the newly prepared site of HER2 using SK-BR3 cell line
  • FIG. 4 is a diagram confirming the sensitivity of the HER2 reference gene region using the SK-BR3 cell line
  • FIG. 5 is a diagram confirming the sensitivity of the newly prepared site of HER2 using SK-BR3 cell line
  • FIG. 6 is a diagram showing a comparison of expression patterns of HER2 gene using GAPDH and TBP gene
  • Figure 7 is a diagram confirming the sensitivity by the Dye change of GAPDH using SK-BR3 cell line
  • Figure 9 is a comparison of the expression pattern of HER2 gene by IHC, FISH, and real-time RT-PCR, showing the division of I ⁇ IHC 0/1 +, 2+, 3+ in each figure , F ⁇ FISH 0 (negative) / 1 (positive) is displayed, Reference is the value expressed after each test using a reference primer & probe associated with HER2, Cy5 is a multiplex by changing the dye of GAPDH to Cy5 This expression shows the expression level after PCR. Mix is confirmed by comparing the distribution of the expression values after performing multiplex PCR with newly produced HER2 related primer & probe (probe 2 sites) and GAPDH dye with Cy5. The figure is shown using the prism graph. In the figure, it can be seen that the case of 3 (mix) is clearly divided into negative and positive in the cut-off 50 lines rather than the case of 1 (Reference) and 2 (Cy5).
  • Paraffin blocks were cut into 4 ⁇ m thicknesses, attached to slides, and sufficiently dried, and immunohistochemical staining was performed using a BenchMark ST (Ventana medical system, USA) automatic immunostaining machine.
  • the primary antibody was diluted 1: 1,000 with polyclonal rabbit anti-human c-erbB-2 oncoprotein (A0485, DakoCytomation, Glostrup, Denmark). After staining the slides in this manner, it was determined by dividing into four grades, 0, 1+, 2+, 3+, depending on the degree of staining of the cell membrane of cancer cells.
  • Paraffin-fixed tissue blocks were cut to 4 ⁇ m thickness using a microtome and attached to slides, and then commercialized HER2 DNA probe kit (Vysis Inc, Downers Grove, IL, USA) was deparaffinized and hydrated. The experiment was conducted according to the manufacturer's instructions. HER2 expression was positive when the Amplification Index was 2.0 or more according to the degree of gene expression.
  • RNA isolated was quantified using NanoQuant system (TECAN).
  • composition of the real-time PCR reactions consisted of 25 mM TAPS (pH 9.3 at 25 ° C), 50 mM KCl, 2 mM MgCl 2 , 1 mM 2-mercaptoethanol, 200 ⁇ M each dNTP, 1 unit Taq polymerase (TAKARA) and Forward Add 10 pmole for primer and reverse primer, add 10 pmole for probe, and add 2ul of synthesized cDNA to make 20ul final volume.
  • TAPS pH 9.3 at 25 ° C
  • 50 mM KCl 50 mM KCl
  • 2 mM MgCl 2 1 mM 2-mercaptoethanol
  • 200 ⁇ M each dNTP 200 ⁇ M each dNTP
  • TAKARA 1 unit Taq polymerase
  • sequence represented by F, P-1, P-2 and R of Figure 2 is the sequence of the present invention, the part indicated by the solid line and broken line is the nucleotide sequence site used in the conventional paper.
  • the PCR reaction was performed once using CFX96 (BIO-RAD) at a denaturation temperature of 94 ° C. for 5 minutes, followed by 40 cycles of 30 seconds at denaturation temperature of 95 ° C. and 20 seconds at annealing temperature of 55 ° C.
  • the fluorescence was measured after each annealing process, and the fluorescence value increased with each cycle was measured.
  • SK-BR3 a breast cancer cell, was diluted step by step from 10 5 to 1 cell to draw a relative quantitative curve. At this time, the expression level of each HER2 was compared based on the expression level of GAPDH and TBP.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트에 관한 것이다.

Description

실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트
본 발명은 실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트에 관한 것이다.
Human epidermal growth factor receptor 2 (HER2) 수용체는 타이로신 키나아제 활동을 지닌 185kDa의 막 당단백질로 상피세포의 성장과 분화를 조절하는 세포하 신호전달체계의 활성화에 중요한 역할을 한다(Akiyama T, Sudo C, Ogawara H, Toyoshima K, Yamamoto T. Science 1986;232:1644-6.). 유방암 환자에서 HER2 유전자의 증폭이나 HER2 단백질의 과발현은 유방암 환자의 10~34%에서 관찰된다(Ross JS, Fletcher JA. Am J Clin Pathol 1999;112:S53-67.). HER2 상태에 대한 분석은 환자의 예후와 anti-HER2 단클론 항체인 Tratuzumab 치료에 중요하다(Cobleigh MA, Vogel CL, Tripathy D, Robert NJ, Scholl S, Fehrenbacher L, et al. J Clin Oncol 1999;17:2639-48.; Shak S. Herceptin Multinational Inverstigator Study Group Semin Oncol 1999;26:71-7).
최근 많은 임상 연구에서 HER2에 대한 표적치료제인 Tratuzumab (Herceptin) 이 전이성 유방암 뿐만 아니라 초기 유방암의 보조적 요법 후에도 재발률을 감소시키고 생존율을 연장시키는 결과가 나오면서 HER2 과발현 유무는 예후인자로서의 가치 뿐만 아니라 치료 계획에 있어서도 매우 중요한 요소가 되었다(Salmon DJ, Leyland-Jones B, Shak S, Fuchs H, Paton V, Bajamonde A, et al. N Engl J Med 2001;344:783-92; Smith I, Procter M, Gelber RD, Guillaume S, Feyereislova A, Dowsett M, et al. Lancet 2007;369:29-36).
초창기에는 HER2 유전자 증폭이나 단백질 과발현 유무를 알아보는 방법으로 Southern 또는 Western blotting이 쓰였으나 임상 적용은 되지 못하였으며, 암조직에서 유전자의 증폭을 측정하는 형광도소교잡법 (fluorescence in situ hybridization, FISH)과 단백질 발현을 찾는 면역조직화학염색법(immunohistochemistry, IHC)이 있다. 면역조직화학 염색 방법이 일차 선별검사로 가장 널리 쓰이고 있으나 기관별 차이가 있고 기술적인 정확성이나 결과의 재연성면에서 논란이 많다(Press MF, Sauter G, Bernstein L, Villalobos IE, Mirlacher M, Zhou JY, et al. Clin Cancer Res 2005;11:6598-607)
형광도소교잡법은 현재 가장 믿을만하다고 알려져 있으며, DNA 자체가 매우 안정적이므로 파라핀포매 조직에서 행할 수 있고 면역조직화학염색보다 조직의 상태에 민감하지 않으며 병리의사 간의 판독 일치율이 높은 장점이 있다. 그러나 검사과정이 복잡하고 판독시 암실에서 형광현미경을 통해 진행하여야 하는 불편함이 있으며 형광을 사용하기 때문에 결과의 영구보존이 불가능하며 비용이 비싸다는 단점이 있다(Lewis F, Jackson P, Lane S, Coast G, Hanby AM. Histopathology 2004:45:207-17.)
관련 선행특허로 대한민국특허공개번호 제1020090079845호는 '유방암 모니터링，진단 및 스크리닝용 단백질 마커 및 이를 이용한 유방암 모니터링，진단 및 스크리닝 방법'에 관한 것으로, Vitronectin, sVCAM-1(Soluble Vascular cell adhesion molecule-1), sCD40L(Soluble CD40 ligand), EGF(Epidermal growth factor), tPAI-1(Total plasminogen activator inhibitor-1), ApoA-1(Apolipoprotein-A1), proApoA-1(Proapolipoprotein-A1), Kininogen, VDBP(Vitamin D-binding protein), ApoA1/proApoA1(ApoA-1과 Proapolipoprotein-A1의 비율), CRP/Kininogen(CRP와 Kininogen의 비율), Hemoglobin 및 MPO(myeloperoxidase)로 구성된 군으로부터 선택되는 어느 하나의 단백질에 특이적으로 결합하는 항체를 포함하는 유방암 모니터링, 진단 및 스크리닝용 키트가 기재되어 있으며,
다른 관련 선행특허로 대한민국특허공개번호 제1020090064378호는 '유방암 관련 유전자 및 폴리펩티드'에 관한 것으로, 유방암에서 현저하게 발현이 증가하는 신규한 인간 유전자 A7322를 제공하고, 유방암에서 현저하게 발현이 증가하는 신규한 인간 유전자 F3374를 제공하며, 이런 유전자들 및 이들에 의해 암호화되는 폴리펩티드들은 유방암의 진단, 및 유방암에 대한 약제 개발을 위한 표적 분자로 이용될 수 있으며, PBK/TOPK의 키나아제 활성의 조절자를 스크리닝하는 방법이 기재되어 있다.
본 발명은 상기의 문제점을 해결하고 상기의 필요성에 의하여 안출된 것으로서 본 발명의 목적은 실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법을 제공하는 것이다.
본 발명의 다른 목적은 유방암진단용 키트를 제공하는 것이다.
상기의 목적을 달성하기 위하여 본 발명은 a) 암 의심환자의 혈액에서 얻은 세포로부터 전장 RNA를 분리하는 단계;b) 상기 분리된 전장 RNA로부터 cDNA를 합성하는 단계;c) 상기 합성된 cDNA를 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 프라이머쌍 및 프로브, 및 글리세르알데히드-3-인산 탈수소효소(GAPDH)를 증폭할 수 있는 프라이머쌍 및 프로브로 구성된 군으로부터 선택된 하나 이상의 프라이머쌍 및 프로브를 이용하여 실시간-PCR을 수행하는 단계; 및 d) 상기 증폭된 양을 정상인에 대해 발현된 양과 비교하는 단계;를 포함하는 유방암의 진단을 위한 정보제공방법을 제공한다.
일반적으로 사용되는 전장 RNA(Total RNA)를 분리하는 방법 및 이로부터 cDNA를 합성하는 방법은 공지된 방법을 통해 수행될 수 있으며, 이 과정에 대한 자세한 설명은 Joseph Sambrook 등, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); 및 Noonan, K. F. 등에 개시되어 있어 본 발명의 참조로서 삽입될 수 있다.
본 발명의 프라이머는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비제한적인 예로는 메틸화, "캡화", 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다. 핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예: 뉴클레아제, 독소, 항체, 시그날 펩타이드, 폴리-L-리신 등), 삽입제(예: 아크리딘, 프소랄렌 등), 킬레이트화제(예: 금속, 방사성 금속,철, 산화성 금속 등), 및 알킬화제를 함유할 수 있다. 본 발명의 핵산 서열은 또한 검출 가능한 시그널을 직접 또는 간접적으로 제공할 수 있는 표지를 이용하여 변형시킬 수 있다. 표지의 예로는 방사성 동위원소, 형광성 분자, 바이오틴 등이 있다.
본 발명의 방법에 있어서, 상기 증폭된 표적 서열(HER 2 및 GAPDH 유전자)은 검출가능한 표지 물질로 표지될 수 있다. 일 구현예에서, 상기 표지 물질은 형광, 인광, 화학발광단 또는 방사성을 발하는 물질일 수 있으나, 이에 제한되지 않는다. 바람직하게는, 상기 표지 물질은 루오리신(fluorescein), 피코에리트린 (phycoerythrin), 로다민, 리사민 (lissamine) Cy-5 또는 Cy-3일 수 있다. 표적 서열의 증폭시 프라이머의 5'-말단 및/또는 3' 말단에 Cy-5 또는 Cy-3를 표지하여 real-time RT-PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지될 수 있다.
또한, 방사성 물질을 이용한 표지는 real-time RT-PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하면 증폭 산물이 합성되면서 방사성이 증폭 산물에 혼입되어 증폭 산물이 방사성으로 표지될 수 있다. 표적 서열을 증폭하기 위해 이용된 하나 이상의 올리고뉴클레오티드 프라이머 세트를 이용할 수 있다.
표지는 당업계에서 통상적으로 실시되는 다양한 방법, 예컨대, 닉 트랜스레이션 (nick translation) 방법, 무작위 프라이밍 방법 (Multiprime DNA labelling systems booklet, "Amersham"(1989)) 및 카이네이션 방법 (Maxam & Gilbert, Methods in Enzymology, 65:499(1986))을 통해 실시될 수 있다. 표지는 형광, 방사능, 발색 측정, 중량 측정, X-선 회절 또는 흡수, 자기, 효소적 활성, 매스 분석, 결합 친화도, 혼성화 고주파, 나노크리스탈에 의하여 검출할 수 있는 시그널을 제공한다.
본 발명의 한 측면에 따르면, 본 발명에서는 RT-PCR을 통해 mRNA 수준에서 발현수준을 측정하게 된다. 이를 위하여 상기 HER 2 및 GAPDH 유전자에 특이적으로 결합하는 신규한 프라이머 쌍과 형광이 표지된 프로브가 요구되며, 본 발명에서 특정한 염기서열로 특정된 해당 프라이머 및 프로브를 사용할 수 있으나 이에 제한되는 것은 아니며, 이들 유전자에 특이적으로 결합하여 검출가능한 시그널을 제공하여 real-time RT-PCR을 수행할 수 있는 것이면, 제한 없이 사용될 수 있다. 상기에서 FAM과 Quen(Quencher)는 형광염료를 의미한다.
본 발명에 적용되는 real-time RT-PCR 방법은 당업계에서 통상적으로 사용되는 공지의 과정을 통해 수행될 수 있다.
mRNA 발현수준을 측정하는 단계는 통상의 mRNA 발현수준을 측정할 수 있는 방법이면 제한 없이 사용될 수 있으며, 사용한 프로브 표지의 종류에 따라 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있으나, 이에 제한되지 않는다. 증폭 산물을 검출하는 방법 중의 하나로서, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 real-time RT-PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 real-time RT-PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성 측정기구, 예를 들면, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다.
본 발명의 바람직한 일구현예에 따르면, 상기 realtime RT-PCR을 통해 증폭된 PCR 산물에 형광이 표지된 프로브가 붙어 특정 파장의 형광을 내게 되고, 증폭과 동시에 realtime PCR 장치의 형광 측정기에서 본 발명의 유전자들의 mRNA 발현수준을 실시간으로 측정하고, 측정된 값이 계산되어 PC를 통해 시각화 되게 되어 검사자는 쉽게 그 발현 정도를 확인할 수 있다.
본 발명의 다른 측면에 따르면 상기 진단 키트는 역전사 중합효소반응을 수행하기 위해 필요한 필수 요소를 포함하는 것을 특징으로 하는 유방암 진단용 키트일 수 있다. 역전사 중합효소반응 키트는 상기 본 발명의 유전자에 대한 특이적인 각각의 프라이머 쌍을 포함할 수 있다. 프라이머는 각 마커 유전자의 핵산서열에 특이적인 서열을 가지는 뉴클레오타이드로서, 약 7 bp 내지 50 bp의 길이, 보다 바람직하게는 약 10 bp 내지 30 bp 의 길이일 수 있다.
그 외 역전사 중합효소반응 키트는 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드(dNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNAse, RNAse 억제제 DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다.
본 발명에서 용어 "암 진단을 위한 정보제공방법"은 진단을 위한 예비적 단계로서 암의 진단을 위하여 필요한 객관적인 기초정보를 제공하는 것이며 의사의 임상학적 판단 또는 소견은 제외된다.
용어 "프라이머"는 짧은 자유 3말단 수산화기를 가지는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 중합효소 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성이 개시할 수 있다. 본 발명의 프라이머는, 각 마커 유전자 특이적인 프라이머로 7개 내지 50개의 뉴클레오타이드 서열을 가진 센스 및 안티센스 핵산이다. 프라이머는 DNA 합성의 개시점으로 작용하는 프라이머의 기본 성질을 변화시키지 않는 추가의 특징을 혼입할 수 있다.
용어 "프로브"는 단일쇄 핵산 분자이며, 타깃 핵산 서열에 상보적인 서열을 포함한다.
용어 "실시간 역전사 중합효소 반응(realtime RT-PCR)"이라 함은 역전사효소를 이용하여 RNA를 상보적인 DNA(cDNA)로 역전사 시킨 후에 만들어진 cDNA를 주형(template) 으로하여 타겟 프라이머와 표지를 포함하는 타겟 프로브를 이용해 타겟을 증폭함과 동시에 증폭된 타겟에 타겟 프로프의 표지에서 발생하는 신호를 정량적으로 검출해 내는 분자생물학적 중합방법이다.
본 발명의 일 구현예에 있어서, 상기 증폭된 양을 정상인에 대해 증폭된 양과 비교하는 단계는 표준 또는 컷오프 값에 의하여 수행되는 것이 바람직하나 이에 한정되지 아니한다.
본 발명의 다른 구현예에 있어서, 상기 방법은 발현 양 기준으로 50 이상은 양성, 20 아래는 음성이며 20~50은 컷오프값인 것이 바람직하나 이에 한정되지 아니한다.
본 발명의 다른 실시예에 있어서, 상기 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 프라이머쌍은 서열번호 5 및 6에 기재되고, 프로브는 서열번호 11 및 12에 기재된 염기서열을 가지는 프로브 중 하나 이상인 것이 바람직하나 이에 한정되지 아니하고, 상기 GAPDH를 증폭할 수 있는 프라이머쌍은 서열번호 1 및 2에 기재되고, 프로브는 서열번호 9에 기재된 염기서열을 가지는 것이 바람직하나 이에 한정되지 아니한다.
또 본 발명은 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 서열번호 5 및 6에 기재된 프라이머쌍과 서열번호 11 및 12에 기재된 염기서열을 가지는 프로브 중 하나 이상의 프로브;및 GAPDH를 증폭할 수 있는 서열번호 1 및 2에 기재된 프라이머쌍과 서열번호 9에 기재된 프로브로 구성된 군으로부터 선택된 하나 이상의 프라이머쌍 및 프로브를 포함하는 유방암의 진단을 위한 프라이머쌍 및 프로브를 제공한다.
본 발명의 일 구현예에 있어서, 상기 프로브의 5'말단은 형광물질로 표지된 것이 바람직하고, 상기 형광물질은 FAM 또는 Cy-5인 것이 바람직하나 이에 한정되지 아니한다.
또 본 발명은 상기 본 발명의 프라이머 쌍 및 프로브를 포함하는 유방암 진단용 조성물을 제공한다.
또 본 발명은 상기 본 발명의 조성물을 포함하는 유방암 진단용 키트를 제공한다.
이하 본 발명을 설명한다.
본 발명은 간편하고 정량적인 결과를 도출할 수 있는 Real-time RT-PCR법을 기초로 하여 reference gene인 GAPDH와 TBP를 이용한 GAPDH (Glyceraldehyde-3-phosphate dehydrogenase), TBP (TATA-binding protein) 대비 HER2 유전자를 증폭한 후 나타난 발현양을 비교 정량하여 발현율을 기존의 방법인 IHC와 FISH 결과와 비교하여 보았다.
이하 본 발명을 상세하게 설명한다.
유방암 cell line으로부터 HER2의 발현의 민감도 비교확인
기존 논문상에 나와있는 exon 5 부위의 HER2 유전자(도 1 Savino M, Parrella P, Copetti M, Barbano R, Murgo R, Fazio VM, Valori VM, Carella M, Garrubba M, Santini SA. Cell Oncol. 2009;31(3):203-11.)와 IHC와 FISH대비 62~65%의 민감도를 보여주고 있는 논문상에서 많이 이용된 exon 20부분(그림2의 1부분 Egervari K, Toth J, Nemes Z, Szollosi Z. Appl Immunohistochem Mol Morphol. 2009 May;17(3):247-54.와 도 2의 2부분 Cuadros M, Talavera P, Lopez FJ, Garcia-Perez I, Blanco A, Concha A. Pathobiology. 2010;77(1):38-45. Epub 2010 Feb 25.)에서 새로 제작된 HER2 유전자부위의 민감도를 비교하기 위하여(그림 2) 유방암 cell line인 SK-BR3를 105 부터 1 세포 까지 희석하여 민감도를 확인하였다. 그 결과 새로 제작된 HER2 유전자의 105에서 1세포까지의 Ct값은 각각 19.96에서 36.94로(도 3) 기존 논문상의 HER2 유전자의 105에서 10세포까지의 Ct값인 20.25에서 33.86보다 낮게 나와 새로 제작된 HER2유전자의 민감도가 높아졌음을 확인할 수 있었다(도 4).
또한 새로 제작된 HER2 유전자 부위의 probe를 2개를 넣었는데 이 부분이 기존의 방법과 민감도에서 어떠한 차이를 보이는지 유방암 cell line인 SK-BR3를 105 부터 1 세포까지 희석하여 민감도를 확인하였다. 그 결과 새로 제작된 HER2 유전자의 probe를 2개를 넣은 105에서 1세포까지의 Ct값은 각각 19.65에서 31.57(도 5-A)로 기존 논문상의 HER2 유전자의 probe를 하나 넣어 진행한 105에서 10세포까지의 Ct값인 각각 20.87에서 37.48(도 5-B)와 20.03에서 34.46(도 5-C)보다 낮게 나와 새로 제작된 HER2유전자의 probe를 2개를 넣은 경우가 probe를 하나만 넣어 진행된 결과 값보다 민감도가 높아졌음을 확인할 수 있었다.
A는 HER2 gene에서 본 실험에서 제작한 두 부위의 probe를 혼합하여 실시한 민감도 테스트 결과이며, B는 기존 논문상에 나타난 probe를 이용하여 실시한 민감도 테스트 결과이며, C는 본 실험에서 제작한 부위 중 한 부위의 probe만 이용하여 실시한 민감도 테스트 결과이다.
reference gene의 선택을 위한 GAPDH와 TBP의 비교
기존에 많이 사용되고 있는 reference gene인 GAPDH (Glyceraldehyde-3-phosphate dehydrogenase), TBP (TATA-binding protein) 중에서 본 실험의 HER2에 사용된 reference gene을 선택하기 위하여 임상샘플을 이용하여 두 gene의 발현양상을 비교하여 본 결과 GAPDH gene의 Ct값이 TBP gene의 Ct값보다 낮게 나왔으며 이에 따른 발현값을 비교해 본 결과에서도 GAPDH gene을 이용한 발현값이 TBP gene을 이용한 발현값보다 양성-음성의 구별이 차이가 있음을 확인할 수 있었고(표 1) 이 결과를 Graphpad Prism (Graphpad software, Inc)를 이용하여 두 방법의 분포도를 확인 하여 봤을 때 그 구별이 더 확실해 짐을 알 수 있었다. 즉 TBP gene의 발현값이 낮아 cut-off를 설정하는데에 애매모호한 데 비해 GAPDH gene이 TBP gene보다 발현양상의 값이 높아 25-50사이의 부분으로 cut-off를 설정하기 쉬워 본 실험에서는 reference gene으로 GAPDH를 사용하기로 하였다(도 6)
표 1
No. GAP TBP HER2 Expression(GAP-HER) Expression(TBP-HER)
1 21.44 28.31 22.24 65.34 54.57
2 24.81 28.44 22.36 621.67 54.95
3 27.59 30.19 29.57 28.84 1.25
4 25.48 30.03 29.71 6.06 1.01
5 22.03 27.15 21.83 130.69 32.45
6 24.98 30.24 29.34 5.54 1.52
7 22.18 28.91 25.17 14.32 10.85
8 30.06 33.09 32.28 24.42 1.42
9 31.06 34.72 33.23 25.28 2.28
10 20.29 27.81 20.89 75.06 98.36
11 19.46 28.46 19.42 116.97 427.57
12 23.12 28.62 25.06 29.65 9.58
13 23.89 27.91 23.88 114.56 13.27
14 28.47 32.87 32.65 6.28 0.95
15 25.67 30.34 26.29 74.03 13.45
16 26.84 32.06 30.46 9.25 2.46
17 25.62 30.74 27.90 23.43 5.82
18 23.20 28.46 26.91 8.69 2.38
19 21.20 27.70 24.23 13.93 9.00
20 21.97 28.69 24.81 15.89 11.96
21 22.87 28.25 27.36 5.06 1.51
22 21.23 27.55 26.00 4.17 2.38
23 16.97 24.10 23.80 1 1
24 24.98 30.24 29.34 5.54 1.52
25 26.84 32.06 30.46 9.25 2.46
26 25.62 30.74 27.90 23.43 5.82
27 23.20 28.46 26.91 8.69 2.38
28 21.20 27.70 24.23 13.93 9.00
29 21.97 28.69 24.81 15.89 11.96
30 22.18 28.91 25.17 14.32 10.85
31 30.06 33.09 32.28 24.42 1.42
32 31.06 34.72 33.23 25.28 2.28
33 20.29 27.81 20.89 75.06 98.36
34 19.46 28.46 19.42 116.97 427.57
35 23.12 28.62 25.06 29.65 9.58
36 22.87 28.25 27.36 5.06 1.51
37 21.23 27.55 26.00 4.17 2.38
38 23.89 27.91 23.88 114.56 13.27
39 21.44 28.31 22.24 65.34 54.57
40 24.81 28.44 22.36 621.67 54.95
41 27.59 30.19 29.57 28.84 1.25
42 25.48 30.03 29.71 6.06 1.01
43 28.47 32.87 32.65 6.28 0.95
44 25.67 30.34 26.29 74.03 13.45
45 22.03 27.15 21.83 130.69 32.45
표 1은 real-time RT PCR에 의한 reference gene인 GAPDH와 TBP의 Ct값과 발현양상 비교 표이다.
또한 GAPDH를 기존의 방법인 dye를 FAM으로 GAPDH와 HER2를 각각 테스트를 진행하여 Ct값을 비교하는 것과 GAPDH의 dye Cy5로 변경하여 multiplex PCR을 하여 각각의 결과를 유방암 cell line인 SK-BR3를 105 부터 1 세포 까지 희석하여 민감도를 비교하여 HER2는 FAM으로 GAPDH는 Cy5로 multiplex PCR을 한 결과에서는 105에서 1세포까지의 Ct값인 17.14에서 34.20(그림 7-B)로 나왔으며 dye가 FAM인 GAPDH와 HER2를 PCR한 결과에서는 그 민감도가 18.06에서 34.33으로 나와 각각 PCR하였을때의 결과보다 multiplex PCR을 한 경우에서 민감도가 높아졌음을 확인 할 수 있었다(도7-A)) .
Cell line별 HER2 발현양상
각각의 유방암세포에 해당되는 Cell line 세 종류 (MCF7, SKBR3, MDA-MB 231)와 사람의 단구세포 cell line (THP-1)을 음성 대조군으로 이용하여 HER2의 발현여부를 확인한 결과 MCF7과 SK-BR3에서 높게 발현되는 것을 확인할 수 있었다(도 8)
유방암 환자에서의 IHC와 FISH 그리고 HER2의 발현 양상비교
신촌 세브란스 병원에서 제공받은 ICH 결과가 있는 조직 샘플 55를 이용하여 두 가지의 방법으로 HER2의 발현 여부를 확인해 보았다. 기존 논문에서 사용된 HER2 유전자의 발현의 cut off는 10으로 설정하였으며 새로 제작된 HER2 유전자의 발현의 cut off를 25아래는 음성으로 50이상은 양성으로 설정하였으며(도 9) 그 결과를 비교 한 결과 새로 제작된 HER2 유전자의 발현이 43/55 (78%)로 기존 논문의 HER2 유전자의 발현 30/55 (54.5%)보다 높게 나타남을 확인할 수 있었다(표 2).
표 2
Figure PCTKR2011009029-appb-T000001
표 2는 IHC 결과별에 따른 HER2 발현양상 표이다.
또한 FISH 결과가 있는 조직샘플 31을 이용하여 위와 동일한 방법으로 HER2의 발현 여부를 확인해 보았다. 그 결과 새로 제작된 HER2 유전자의 발현이 22/31 (71%)로 기존 논문의 HER2 유전자의 발현 21/31 (67.7%)보다 높게 나타남을 확인 할 수 있었다(표 3).
표 3
Figure PCTKR2011009029-appb-T000002
표 3은 FISH 결과별에 따른 HER2 발현양상 표이다.
FISH와 IHC 결과가 모두 있는 조직샘플 31을 이용하여 위와 동일한 방법으로 HER2의 발현 여부를 확인해 보았다. 그 결과 FISH-IHC 양성인 15 샘플에서 새로 제작된 HER2 유전자의 발현이 모두 양성으로 나타났으나 기존 논문의 HER2 유전자 발현양상은 12/15 (80%)로 나타났으며 FISH 결과가 음성인 경우 기존논문의 HER2 유전자 발현에서 9샘플이 음성으로 새로 제작된 HER2 유전자 발현에서 7샘플이 음성으로 확인 되었으나 IHC의 결과는 2+로 이들 샘플에 대한 재확인이 필요할 것으로 보이며 전체 결과를 비교해 볼 때 새로 제작된 HER2 유전자의 발현이 22/31 (71%)로 기존 논문의 HER2 유전자의 발현 21/31 (67.7%)보다 높게 나타남을 확인할 수 있었다(표 4).
표 4
Figure PCTKR2011009029-appb-T000003
표 4는 FISH와 IHC 결과별에 따른 HER2 발현양상 표이다.
본 발명은 간편하고 정량적인 결과를 도출할 수 있는 실시간 RT-PCR법에 기초하여 HER 2 mRNA를 이용한 유전자 증폭 방법을 이용하기 때문에 단백질을 검출하는 방법보다 눈에 보이지 않은 정도의 양도 검출할 수 있고, 항원 항체 반응을 사용하지 않기 때문에 값싼 검사 방법을 제공할 수 있다. 또 기존에 알려진 서열에 비하여 더 민감도가 높다는 것을 확인할 수 있었고, 또한 전기 영동을 이용하여 밴드를 확인하는 단계가 없기 때문에 더 손쉽게 결과를 확인할 수 있다.
도 1은 기존 논문상에 나와 있는 primer와 probe 위치와 새로 제작된 primer와 probe 위치,
도 2는 새로 제작된 primer와 probe위치와 기존 논문상에 사용된 primer와 probe위치이며, A는 GAPDH와 HER2 gene을 이용하여 나타난 발현양상의 분포도이며, B는 TBP와 HER2 gene을 이용하여 나타난 발현양상의 분포도이고,
도 3은 SK-BR3 세포주를 이용한 HER2 새로 제작된 부위의 민감도를 확인한 그림이고,
도 4는 SK-BR3 세포주를 이용한 HER2 reference gene 부위의 민감도를 확인한 그림이고,
도 5는 SK-BR3 세포주를 이용한 HER2 새로 제작된 부위의 민감도를 확인한 그림이고,
도 6은 GAPDH와 TBP gene을 이용한 HER2 유전자의 발현양상의 비교를 나타낸 그림이고,
도 7은 SK-BR3 세포주를 이용한 GAPDH의 Dye 변경에 의한 민감도를 확인한 그림이고,
도 8은 세포주를 이용한 HER2 발현양상을 확인한 그림이고,
도 9는 IHC와 FISH, 그리고 real-time RT-PCR에 의한 HER2 유전자의 발현양상을 비교한 그림으로, 각각의 그림에서 I→IHC 0/1+, 2+, 3+ 의 구분을 표시한 것이며, F→FISH 0(음성)/ 1(양성)을 표시한 것이며, Reference는 HER2관련 reference primer&probe를 이용하여 각각 테스트를 진행 후 발현양을 나타낸 값이며, Cy5는 GAPDH의 dye를 Cy5로 변경하여 multiplex PCR을 진행 후 발현양을 나타낸 값이며, Mix는 새로 제작된 HER2관련 primer&probe(probe를 2부위 사용)와 GAPDH의 dye를 Cy5로 multiplex PCR을 진행 후 발현양을 나타낸 값의 분포에 대해 비교하여 확인하기 위하여 prism graph를 이용하여 나타낸 그림이다. 그림에서 보면 1(Reference)번과 2(Cy5)번의 경우보다는 3번(mix)의 경우가 cut-off 50선에서 뚜렷하게 음성과 양성으로 나눠지는 것을 확인할 수 있다.
이하, 본 발명의 실시예에 대하여 첨부된 도면을 참조하면서 상세히 설명하기로 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1: 재료
2010년 9월부터 2011년 5월까지 신촌 세브란스병원에서 유방암 수술을 받은 55명의 환자의 수술 시 적출한 생검 조직을 이용하였다. 환자에서 HER2의 발현여부는 면역조직화학 염색법과 형광동소교잡법을 수행하여 확인하였다. 또한 HER2의 발현 여부를 확인하기 위하여 유방암 Cell line인 SK-BR3, MCF7, MDA-MB 231을 사용하여 HER2의 발현 여부를 확인하였고, 대조 군으로 사람의 단구세포 Cell line인 THP-1을 사용하였다.
실시예 2: 면역조직화학염색법
파라핀 블록을 4 ㎛ 두께로 박절하여 슬라이드에 부착시키고 충분히 건조시킨 후 BenchMark ST (Ventana medical system, USA) 자동면역염색기기를 이용하여 면역조직화학염색을 시행하였다. 일차항체는 polyclonal rabbit anti-human c-erbB-2 oncoprotein (A0485, DakoCytomation, Glostrup, Denmark)을 1:1,000으로 희석하여 이용하였다. 이러한 방법으로 슬라이드를 염색한 후 암세포의 세포막에 염색되는 정도에 따라 4가지 등급, 즉 0, 1+, 2+, 3+으로 나누어 판정하였다.
실시예3: 형광동소교잡법
파라핀으로 고정되어 있는 조직 블록을 microtome을 이용하여 4 ㎛ 두께로 박절하여 슬라이드에 부착시킨 후, 탈파라핀화 및 함수 과정을 거쳐 상용화된 HER2 DNA probe kit (Vysis Inc, Downers Grove, IL, USA)를 이용하여 제조사의 지침에 따라 실험을 진행하였다. HER2 발현 여부는 유전자 발현 정도에 따라서 Amplification Index가 2.0 이상일 경우 양성으로 하여 진행하였다.
실시예 4: 분리된 조직에서 Total RNA 분리
환자에서 분리한 조직은 Trizol(Invitrogen)을 첨가한 후 BioMasher-II (Optima)를 이용하여 3,000rpm에서 조직을 균질화 시킨 후 제조업체의 프로토콜에 따라 Total RNA를 분리 하였다.
Cell line의 경우 각각의 Cell line의 세포 수를 1 x 106으로 맞춘 후 Trizol을 이용하여 Total RNA를 분리 하였다. 분리한 Total RNA는 NanoQuant system (TECAN)을 이용하여 정량 하였다.
실시예 5: 분리된 Total RNA로부터 cDNA 제작 및 Real-time PCR 수행
1) cDNA 합성
분리된 total RNA 2 ug, random primer (Invitrogen) 0.2 5 ug, dNTP(Cosmo genetech) 250 uM, Tris-HCl(pH 8.3) 50 mM, KCl 75 mM, MgCl2 3 mM, DTT 8 mM 와 MMLV 역전사 중합효소 200 units (Invitrogen)을 첨가하고 최종부피를 20 ul가 되도록 DEPC treated DW를 넣고 잘 섞은 후 합성 반응액을 thermocycler (ABI)에서 25℃에서 10 분, 37℃에서 50 분, 70℃에서 15 분간 반응시켜 cDNA를 합성한다.
2) Real-time PCR 수행
Real-time PCR의 반응물의 조성은 25 mM TAPS (pH 9.3 at 25°C), 50 mM KCl, 2 mM MgCl2, 1 mM 2-mercaptoethanol, 200 μM each dNTP, 1 unit Taq polymerase (TAKARA)와 Forward primer와 Reverse primer를 각각 10 pmole을 넣어주고, probe 또한 10 pmole을 넣어 주고, 합성된 cDNA를 2ul를 넣고 최종 부피를 20ul가 되게 수행한다. 각각의 프라이머와 프로브의 염기서열은 다음 표 5와 같다.
표 5
　 5' modificaion 5'-sequence-3' 3' modificaion
Primer GAPDH -F CAT CAC CAT CTT CCA GGA GCG AGA TCC(서열번호 1) 　
GAPDH -R CTC CAT GGT GGT GAA GAC GCC AGT G(서열번호 2) 　
HER2-F reference GGC TCT CAC ACT GAT AGA CAC C(서열번호 3) 　
HER2-R reference TCC CCA GCA GCG GGA GCC CTT AC(서열번호 4) 　
HER2-F1 new AAG CAT ACG TGA TGG CTG GTG T (서열번호 5) 　
HER2-R1 new TCT AAG AGG CAG CCA TAG GGC ATA(서열번호 6) 　
TBP-F 　 CACAGTGAATCTTGGTTGTAAACTTGA(서열번호 7) 　
TBP-R 　 AAACCGCTTGGGATTATATTC G(서열번호 8) 　
Probe GAPDH -cy5 Cy5 TCC ACG ACG TAC TCA GCG CCA GCA(서열번호 9) BHQ-2
HER2-P FAM (reference) TCT CGG GCC TGC CAC CCC TG(서열번호 10) BHQ-1
HER2-P1 FAM (new) ATA TGT CTC CCG CCT TCT GGG CAT CT(서열번호 11) BHQ-1
HER2-P2 FAM(new) CAT CCA CGG TGC AGC TGG TGA CAC A(서열번호 12) BHQ-1
TBP-P FAM AAGACCAATGCACTTCGTGCCCGA(서열번호 13) BHQ-1
한편, 도 2의 F, P-1,P-2 및 R로 표시된 서열은 본 발명의 서열이고, 실선과 끊어진 선으로 표시된 부분은 기존에 논문에서 사용한 염기서열 부위이다.
PCR 반응은 CFX96 (BIO-RAD) 이용하여 변성 온도 94℃에서 5분 동안 1회 수행하고, 변성 온도 95℃에서 30초, 어닐링 온도 55℃에서 20초인 사이클을 40회 반복하여 수행하였다. 또한 각각의 어닐링 과정 후 형광을 측정하는 과정을 추가 하여, 각 사이클 별로 증가되는 형광 값을 측정하였다.
실시예 6: 결과의 분석
각 실험의 결과는 CFX Manager software v1.6(BIO-RAD)을 이용하여 분석 하였다. 유방암 세포인 SK-BR3을 105 부터 1세포 까지 단계적으로 희석하여 상대적 정량 곡선을 그려서 Ct value를 이용하여 발현양을 비교 정량하여 발현율을 살펴 보았다. 이때 GAPDH와 TBP의 발현양을 기준으로 하여 각각의 HER2의 발현양을 비교 하였다.

Claims (9)

  1. a) 암 의심환자의 혈액에서 얻은 세포로부터 전장 RNA를 분리하는 단계;
    b) 상기 분리된 전장 RNA로부터 cDNA를 합성하는 단계;
    c) 상기 합성된 cDNA를 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 프라이머쌍 및 프로브, 및 글리세르알데히드 -3-인산 탈수소효소(GAPDH)를 증폭할 수 있는 프라이머쌍 및 프로브로 구성된 군으로부터 선택된 하나 이상의 프라이머쌍 및 프로브를 이용하여 실시간-PCR을 수행하는 단계; 및
    d) 상기 증폭된 양을 정상인에 대해 발현된 양과 비교하는 단계;를 포함하는 유방암의 진단을 위한 정보제공방법.
  2. 제 1항에 있어서, 상기 증폭된 양을 정상인에 대해 증폭된 양과 비교하는 단계는 표준 또는 컷오프 값에 의하여 수행되는 것을 특징으로 하는 유방암의 진단을 위한 정보제공방법.
  3. 제 1항 또는 2항에 있어서, 상기 방법은 발현 양 기준으로 50 이상은 양성, 20 아래는 음성이며 20~50은 컷오프값인 것을 특징으로 하는 유방암의 진단을 위한 정보제공방법.
  4. 제 1항에 있어서, 상기 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 프라이머쌍은 서열번호 5 및 6에 기재되고, 프로브는 서열번호 11 및 12에 기재된 염기서열을 가지는 프로브 중 하나 이상인 것을 특징으로 하는 유방암의 진단을 위한 정보제공방법.
  5. 제 1항에 있어서, 상기 GAPDH를 증폭할 수 있는 프라이머쌍은 서열번호 1 및 2에 기재되고, 프로브는 서열번호 9에 기재된 염기서열을 가지는 것을 특징으로 하는 유방암의 진단을 위한 정보제공방법.
  6. 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 서열번호 5 및 6에 기재된 프라이머쌍과 서열번호 11 및 12에 기재된 염기서열을 가지는 프로브 중 하나 이상의 프로브;및
    GAPDH를 증폭할 수 있는 서열번호 1 및 2에 기재된 프라이머쌍과 서열번호 9에 기재된 프로브로 구성된 군으로부터 선택된 하나 이상의 프라이머쌍 및 프로브를 포함하는 유방암의 진단을 위한 프라이머쌍 및 프로브.
  7. 제 6항에 있어서, 상기 프로브의 5'말단은 형광물질로 표지된 것을 특징으로 하는 는 유방암의 진단을 위한 프라이머쌍 및 프로브.
  8. 제 6항의 프라이머 쌍 및 프로브를 포함하는 유방암 진단용 조성물.
  9. 제8항의 조성물을 포함하는 유방암 진단용 키트.
PCT/KR2011/009029 2011-11-24 2011-11-24 실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트 WO2013077479A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2011/009029 WO2013077479A1 (ko) 2011-11-24 2011-11-24 실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2011/009029 WO2013077479A1 (ko) 2011-11-24 2011-11-24 실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트

Publications (1)

Publication Number Publication Date
WO2013077479A1 true WO2013077479A1 (ko) 2013-05-30

Family

ID=48469900

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/009029 WO2013077479A1 (ko) 2011-11-24 2011-11-24 실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트

Country Status (1)

Country Link
WO (1) WO2013077479A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150033452A (ko) * 2013-09-24 2015-04-01 엠앤디 (주) 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소연쇄반응 키트
KR20150100360A (ko) * 2014-02-25 2015-09-02 주식회사 옵티팜 개선된 유방암에 대한 정보제공 방법 및 그 진단용 키트

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
APOSTOLAKI, S. ET AL.: "Circulating HER2 mRNA-positive cells in the peripheral blood of patients with stage I and II breast cancer after the administration of adjuvant chemotherapy: evaluation of their clinical relevance", ANNALS OF ONCOLOGY, vol. 18, May 2007 (2007-05-01), pages 851 - 858 *
DATABASE GENBANK 21 November 2011 (2011-11-21), accession no. M 00246 *
DATABASE GENBANK 5 May 2008 (2008-05-05), accession no. C167147 *
GNATIADIS, M. ET AL.: "Prognostic value of the molecular detection of circulating tumor cells using multimarker reverse transcription-PCR assay for cytokeratin 19, mammaglobin A and HER2 in early breast cancer", CLINICAL CANCER RESEARCH, vol. 14, no. 9, 1 May 2008 (2008-05-01), pages 2593 - 2600 *
LYON, E. ET AL.: "Quantification of HER2/neu gene amplification by competitive PCR using fluorescent melting curve analysis", CLINICAL CHEMISTRY, vol. 47, no. 5, May 2001 (2001-05-01), pages 844 - 851 *
YOU, F. ET AL.: "Low-level expression ofHER2 and CK19 in normal peripheral blood mononuclear cells: relevance for detection of circulating tumor cells", A JOURNAL OF HEMATOLOGY AND ONCOLOGY, vol. 1, no. 2., 28 May 2008 (2008-05-28) *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150033452A (ko) * 2013-09-24 2015-04-01 엠앤디 (주) 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소연쇄반응 키트
WO2015046638A1 (ko) * 2013-09-24 2015-04-02 엠앤디(주) 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소 연쇄반응 키트
US20150299794A1 (en) * 2013-09-24 2015-10-22 M&D, Inc. Quantitative Reverse Transcription Polymerase Chain Reaction Kit for Breast Cancer Drug Screening Test and Early Diagnosis Using Tissue and Blood
KR101586847B1 (ko) * 2013-09-24 2016-01-21 주식회사 옵티팜 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소연쇄반응 키트
KR20150100360A (ko) * 2014-02-25 2015-09-02 주식회사 옵티팜 개선된 유방암에 대한 정보제공 방법 및 그 진단용 키트
WO2015129942A1 (ko) * 2014-02-25 2015-09-03 (주)옵티팜 개선된 유방암에 대한 정보제공 방법 및 그 진단용 키트
KR101586846B1 (ko) * 2014-02-25 2016-01-19 주식회사 옵티팜 개선된 유방암에 대한 정보제공 방법 및 그 진단용 키트

Similar Documents

Publication Publication Date Title
USRE44596E1 (en) Method for the detection of cancer
John et al. Overview of molecular testing in non-small-cell lung cancer: mutational analysis, gene copy number, protein expression and other biomarkers of EGFR for the prediction of response to tyrosine kinase inhibitors
ES2645754T3 (es) Conjunto de sondas de oligonucleótidos así como métodos y usos relacionados con el mismo
EP2890815B1 (en) Methods for diagnosis and treatment of cancer
CN106399555A (zh) 一种实时荧光定量pcr检测方法及其标准品和检测试剂盒
EP1915461B1 (en) Composition and method for determination of ck19 expression
KR101320633B1 (ko) 실시간 중합반응을 이용한 암의 진단을 위한 정보제공방법 및 이를 위한 암 진단용 키트
CA3077800A1 (en) Biomarkers useful for detection of types, grades and stages of human breast cancer
US20180363065A1 (en) Use of antisense long non-coding rnas for the diagnosis of prostate cancer
Guo et al. Serum microRNA-155 in early diagnosis and prognosis of breast cancer
WO2013077479A1 (ko) 실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트
KR20160022017A (ko) 재발 난소암 진단 또는 난소암 재발 예측용 mirna 마커 및 그 용도
KR101350747B1 (ko) 실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트
CN101365800B (zh) 用于确定ck19表达的组合物和方法
KR20220116931A (ko) 대장암 및 대장 용종 선별 방법 및 그 응용
KR101586846B1 (ko) 개선된 유방암에 대한 정보제공 방법 및 그 진단용 키트
WO2015083852A1 (ko) 개선된 자궁경부암 진단 방법 및 그 진단용 키트
EP3643791A1 (en) Method for predicting therapeutic effects of irinotecan, and kit for same
WO2024025247A1 (ko) 시스플라틴에 대하여 내성을 갖는 난소암의 진단을 위한 분석방법
CN113373229B (zh) 胃癌相关生物标志物及其应用
KR101528331B1 (ko) 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소연쇄반응 키트
WO2009047529A1 (en) Method of detecting the risk of cancer using genetic markers
WO2015093670A1 (ko) 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소연쇄반응 키트
KR101586847B1 (ko) 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소연쇄반응 키트
US20170211156A1 (en) Quantitative Reverse Transcription Polymerase Chain Reaction Kit for Breast Cancer Drug Screening Test and Early Diagnosis Using Tissue and Blood

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11876280

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11876280

Country of ref document: EP

Kind code of ref document: A1