WO2015093670A1 - 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소연쇄반응 키트 - Google Patents

조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소연쇄반응 키트 Download PDF

Info

Publication number
WO2015093670A1
WO2015093670A1 PCT/KR2013/011978 KR2013011978W WO2015093670A1 WO 2015093670 A1 WO2015093670 A1 WO 2015093670A1 KR 2013011978 W KR2013011978 W KR 2013011978W WO 2015093670 A1 WO2015093670 A1 WO 2015093670A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
amplifying
nos
probes
primer pairs
Prior art date
Application number
PCT/KR2013/011978
Other languages
English (en)
French (fr)
Inventor
왕혜영
김연
이혜영
Original Assignee
(주)옵티팜
연세대학교 원주산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)옵티팜, 연세대학교 원주산학협력단 filed Critical (주)옵티팜
Priority to PCT/KR2013/011978 priority Critical patent/WO2015093670A1/ko
Priority to CA2934618A priority patent/CA2934618A1/en
Priority to US15/104,592 priority patent/US20160348181A1/en
Publication of WO2015093670A1 publication Critical patent/WO2015093670A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer

Definitions

  • the present invention relates to a method for screening and early diagnosis of a therapeutic agent for breast cancer using tissues and blood, and a reverse transcription-quantitative polymerase chain reaction kit.
  • Human epidermal growth factor receptor 2 (HER2) is an ErbB-like oncogene family, and HER2 testing is very important in the treatment of breast cancer. In particular, overexpression of HER2 is found in 20-30% of breast cancer patients, who have a poor prognosis, have more severe breast cancer patterns, and have a 5-year survival rate compared to those who do not.
  • Herceptin (Roche) is used to treat these patients with HER2 overexpression.
  • Herceptin is a humanized monoclonal antibody that directly targets the extracellular domain of the HER2 receptor and is currently used as a chemotherapy for the treatment of metastatic breast cancer and neo-adjuvant patients.
  • FISH fluorescence in situ hybridization
  • IHC immunohistochemical staining
  • the IHC method is used as a method of overexpression of the HER2 protein on the surface of cancer cells
  • the FISH method is used as a method to determine the overexpression of the HER2 gene on the chromosome.
  • the IHC method is the method most widely used as the primary screening test, but it is different for each test institute, and controversial issues arise from technical accuracy and reproducibility of results.
  • the FISH method is known to have a better concordance rate than the IHC method, and is better than the IHC method in sensitivity and specificity.
  • the inspection process is very complicated and fluorescence inspection method, it is known that the permanent preservation of the results is impossible.
  • the value of the fluorescent probe is very expensive, it is known that it is impossible to perform in small hospitals.
  • Korean Patent Publication No. 1020090079845 relates to 'protein markers for breast cancer monitoring, diagnosis and screening, and breast cancer monitoring, diagnostic and screening methods using the same'
  • Korean Patent Publication No. 1020090064378 describes' breast cancer related genes and Polypeptide's.
  • the present invention solves the above problems and the object of the present invention is to provide an information providing method for the diagnosis of breast cancer using reverse transcription quantitative polymerization.
  • Another object of the present invention is to provide a kit for diagnosing breast cancer.
  • the present invention comprises the steps of: a) separating full-length RNA from cells obtained from tissues or blood of suspected cancer; b) synthesizing cDNA from the isolated full-length RNA; c) the synthesized cDNA Primer pairs and probes capable of amplifying human epidermal growth factor receptor (HER) 2, primer pairs and probes capable of amplifying estrogen receptors, primer pairs capable of amplifying progesterone receptors, and Probes, primer pairs and probes capable of amplifying cytokeratin 19, primer pairs and probes capable of amplifying epithelial cell adhesion molecules (EpCAM), primer pairs and probes capable of amplifying human telomerase reverse transcriptase (hTERT) Primer pairs and probes that can amplify Ki67, primer pairs and probes that can amplify Vimentin, and amplify Cyclin D1 Primer pairs and probes, primer pairs and probes that can amplify E-cadherin (cad), primer pairs and
  • a method for separating totally used full RNA and synthesizing cDNA therefrom can be carried out through a known method.
  • a method for separating totally used full RNA and synthesizing cDNA therefrom can be carried out through a known method.
  • For a detailed description of this process see Joseph Sambrook et al., Molecular Cloning, A Laboratory Manual. , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And Noonan, K.F. And the like can be incorporated as a reference of the present invention.
  • Primers of the invention can be chemically synthesized using phosphoramidite solid support methods, or other well known methods. Such nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, “capsulation”, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, eg, uncharged linkages such as methyl phosphonate, phosphoester, phosph Modifications to poroamidates, carbamates, etc.) or charged linkers (eg, phosphorothioates, phosphorodithioates, etc.).
  • Nucleic acids may be selected from one or more additional covalently linked residues, such as proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), inserts (eg, acridine, psoralene, etc.). ), Chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents. Nucleic acid sequences of the invention can also be modified using a label that can provide a detectable signal directly or indirectly. Examples of labels include radioisotopes, fluorescent molecules, biotin, and the like.
  • the amplified target sequences (HER 2, GAPDH gene, etc.) can be labeled with a detectable labeling substance.
  • the labeling material may be, but is not limited to, a fluorescent, phosphorescent, chemiluminescent or radioactive material.
  • the labeling substance may be fluorescein, phycoerythrin, rhodamine, lissamine Cy-5 or Cy-3.
  • RT-PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end and / or 3 'end of the primer, the target sequence may be labeled with a detectable fluorescent labeling substance.
  • the label using the radioactive material may be added to the PCR reaction solution by adding radioactive isotopes such as 32 P or 35 S to the PCR reaction solution during RT-PCR, and the amplification products may be radioactively incorporated into the amplification products while the amplification products are synthesized.
  • radioactive isotopes such as 32 P or 35 S
  • the amplification products may be radioactively incorporated into the amplification products while the amplification products are synthesized.
  • One or more sets of oligonucleotide primers used to amplify a target sequence can be used.
  • Labeling is carried out in a variety of ways conventionally practiced in the art, such as nick translation methods, random priming methods (Multiprime DNA labeling systems booklet, "Amersham” (1989)) and chination methods (Maxam & Gilbert, Methods). in Enzymology, 65: 499 (1986)). Labels provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetric, X-ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, hybridization high frequency, nanocrystals.
  • the present invention is to measure the expression level at the mRNA level via RT-PCR.
  • a novel primer pair and fluorescence-labeled probe specifically binding to the HER 2 and GAPDH genes are required.
  • the primers and probes specified by specific nucleotide sequences may be used, but are not limited thereto. It may be used without limitation as long as it can perform RT-PCR by specifically binding to these genes to provide a detectable signal.
  • FAM and Quen (Quencher) means a fluorescent dye.
  • RT-PCR method applied to the present invention can be carried out through known procedures commonly used in the art.
  • the step of measuring the mRNA expression level can be used without limitation as long as it is a method capable of measuring the normal mRNA expression level, depending on the type of probe label used can be performed by radiometric measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. It doesn't work.
  • the fluorescence measurement method uses Cy-5 or Cy-3 at the 5'-end of a primer to perform real-time RT-PCR to label a target sequence with a detectable fluorescent label.
  • the labeled fluorescence may be measured using a fluorimeter.
  • the radiometric method is performed by adding radioisotopes such as 32 P or 35 S to the PCR reaction solution to label the amplification products when performing RT-PCR, followed by radioactive measuring apparatuses such as Geiger counters or the like. Radioactivity can be measured using a liquid scintillation counter.
  • a fluorescently labeled probe is attached to the PCR product amplified by RT-PCR to emit fluorescence of a specific wavelength, and at the same time amplification of the genes of the present invention in the fluorescence meter of the PCR device.
  • the mRNA expression level is measured in real time, and the measured value is calculated and visualized through a PC so that the examiner can easily check the expression level.
  • the diagnostic kit may be a kit for diagnosing breast cancer, which includes an essential element necessary for performing reverse transcriptase.
  • the reverse transcription polymerase kit may comprise each primer pair specific for the gene of the present invention.
  • the primer is a nucleotide having a sequence specific to the nucleic acid sequence of each marker gene, and may be about 7 bp to 50 bp in length, more preferably about 10 bp to 30 bp in length.
  • reverse transcriptase kits include test tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary), enzymes such as deoxynucleotides (dNTPs), Taq-polymerases and reverse transcriptases, DNAse, RNAse inhibitors, DEPC-water, sterile water, and the like.
  • reaction buffers pH and magnesium concentrations vary
  • enzymes such as deoxynucleotides (dNTPs), Taq-polymerases and reverse transcriptases, DNAse, RNAse inhibitors, DEPC-water, sterile water, and the like.
  • the term "information providing method for diagnosing cancer” in the present invention is to provide objective basic information necessary for diagnosing cancer as a preliminary step for diagnosis and excludes the clinical judgment or findings of the doctor.
  • primer refers to a short nucleic acid sequence that is capable of forming base pairs with complementary templates with nucleic acid sequences having short free 3-terminal hydroxyl groups and that serves as a starting point for template strand copying.
  • Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) at appropriate buffers and temperatures.
  • Primers of the invention are sense and antisense nucleic acids having 7 to 50 nucleotide sequences as primers specific for each marker gene. Primers can incorporate additional features that do not change the basic properties of the primers that serve as a starting point for DNA synthesis.
  • probe is a single chain nucleic acid molecule and includes a sequence that is complementary to a target nucleic acid sequence.
  • realtime RT-PCR refers to a target primer and label using cDNA produced after reverse transcription of RNA into complementary DNA (cDNA) using reverse transcriptase. It is a molecular biological polymerization method that amplifies a target using a target probe and simultaneously detects a signal generated from a label of a target probe on the amplified target.
  • the primer pair capable of amplifying the human epidermal growth factor receptor (HER) 2 is set forth in SEQ ID NOS: 1-2, 3-4, and 6-7, and the probe is SEQ ID NO: 5 , 8 and 9, primer pairs capable of amplifying the estrogen receptor are described in SEQ ID NOs: 10 to 11, and 13 to 14, probes are described in SEQ ID NOs: 12 and 15, and the progesterone Primer pairs capable of amplifying a receptor (progesterone receptor) are described in SEQ ID NOs: 16 to 17, and 19 to 20, probes are described in SEQ ID NOs: 18 and 21, and the glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
  • GPDH glyceraldehyde-3-phosphate dehydrogenase
  • Primer pairs and probes capable of amplifying a are described in SEQ ID NOs: 22 to 23, and 24, respectively.
  • Primer pairs and probes capable of amplifying the epithelial cell adhesion molecules (EpCAM) are SEQ ID NOs: 25 to 26, 27.
  • a primer pair and probe capable of amplifying the cytokeratin 19 are described in SEQ ID NOs: 28-29, and 30, respectively, and a primer pair capable of amplifying the human telomerase reverse transcriptase (hTERT), and Probes are set forth in SEQ ID NOs: 31 to 32, and 33, respectively, and primer pairs and probes capable of amplifying Ki67 are set forth in SEQ ID NOs: 34 to 35, and 36, respectively, and capable of amplifying the Vimentin.
  • hTERT human telomerase reverse transcriptase
  • Primer pairs and probes are described in SEQ ID NOs: 37-38, and 39, respectively, and primer pairs and probes capable of amplifying the Cyclin D1 are described in SEQ ID NOs: 40-41, and 42, respectively, and E Primer pairs and probes capable of amplifying cadherin (cad) are described in SEQ ID NOs: 43-44, and 45, respectively, and primer pairs and probes capable of amplifying the snail are SEQ ID NOs: 46-44, respectively.
  • primer pairs and probes capable of amplifying the phosphatase and tensin homolog are described in SEQ ID NOs: 49 to 50, and 51, respectively.
  • Primer pairs and probes capable of amplifying are preferably the primer pairs and probes set forth in SEQ ID NOs: 52-53, and 54, respectively, but are not limited thereto.
  • the present invention also provides primer pairs as set forth in SEQ ID NOS: 1 to 2, 3 to 4, and 6 to 7, which can amplify human epidermal growth factor receptor (HER) 2, and probes described in SEQ ID NOs: 5, 8 and 9, and estrogens.
  • primer pairs set forth in SEQ ID NOs: 22 to 23, and 24 capable of amplifying the primer pairs set forth in 19 to 20 and the probe set forth in SEQ ID NOs: 18 and 21, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and The primer pairs as shown in SEQ ID NOs: 25 to 26, and 27, respectively, capable of amplifying probes, epithelial cell adhesion molecules (EpCAMs), and the probes as shown in SEQ ID Nos.
  • GPDH glyceraldehyde-3-phosphate dehydrogenase
  • SEQ ID NOs: 31 to 32 capable of amplifying the primer pairs and probes described in 29, and 30, and human telomerase reverse transcriptase (hTERT), and SEQ ID NOs: Primer pairs and probes described in 34 to 35, and 36, and Vimentin can be amplified, respectively.
  • Primer pairs and probes described in SEQ ID NOs: 37 to 38, and 39 respectively, to amplify Cyclin D1.
  • Amplification of the primer pairs and probes: 40 to 41, and 42, the primer pairs and probes set forth in SEQ ID NOs: 43 to 44, and 45 which can amplify E-cadherin (cad), and snail, respectively.
  • SEQ ID NOS: 46 to 47, and 48, respectively, to SEQ ID NOS: 49 to 50, and 51, respectively, capable of amplifying the primer pairs and probes, phosphatase and tensin homolog (PTEN)It provides;
  • (NPTN Neuroplastin) a primer pair and a probe composition for the diagnosis of breast cancer consisting of a pair of primers and probes described in each SEQ ID NO: 52 to 53, and 54 that can be amplified primer pairs and probes, neuro-sustaining plastic.
  • the 5 'end of the probe is preferably labeled with a fluorescent material, but is not limited thereto.
  • the present invention provides a composition for diagnosing breast cancer comprising the primer pair and the probe composition of the present invention as an active ingredient.
  • the present invention provides a kit for diagnosing breast cancer comprising the composition of the present invention.
  • the present invention provides a kit for early or stage-specific diagnosis of breast cancer comprising the composition of the present invention.
  • IHC is amplified by expressing quantitative expression of HER2 gene using GAPDH, a reference gene, based on RT-qPCR method, which can produce simple and quantitative results. And compared with FISH results.
  • the present invention has been completed to help more effectively treat and diagnose breast cancer through expression of HER2 and blood-related markers expressed in blood as well as tissue samples for effective treatment.
  • the present invention can help more effectively treat and diagnose breast cancer through the expression of HER2 expressed in blood and cancer-related markers in blood as well as tissue samples.
  • FIG. 1 is HER2 sensitivity confirmation of RT-qPCR using SK-BR-3 cell line
  • Figure 2 is an improved HER2 sensitivity confirmation of one-tube nested RT-qPCR using SK-BR-3 cell line
  • 3 is a comparison of expression patterns of HER2 mRNA using breast cancer cell line
  • 16 is a comparison of HER2 expression in blood of normal and breast cancer patient groups
  • CTC marker-specific expression Snail, E-cadherin, Cyclin D1, PTEN, NPTN
  • 35 to 36 confirm the expression pattern of epithelial antigen by stage of breast cancer patients.
  • FFPE Form Fixed Paraffin Embbeded tissue from 199 patients at Sinchon Severance Hospital.
  • IHC immunohistochemical staining
  • FISH fluorescence in situ
  • breast cancer cell lines SK-BR3, MCF7, and MDA-MB 231 were used to confirm the expression of HER2.
  • Paraffin blocks were cut into 4 ⁇ m thicknesses, attached to slides, and sufficiently dried, and immunohistochemical staining was performed using a BenchMark ST (Ventana medical system, USA) automatic immunostaining machine.
  • the primary antibody was diluted 1: 1,000 with polyclonal rabbit anti-human c-erbB-2 oncoprotein (A0485, DakoCytomation, Glostrup, Denmark). After staining the slides in this manner, it was determined by dividing the slide into four grades, 0, 1+, 2+, 3+, depending on the degree of staining of the HER2 protein on the cell membrane of cancer cells. Among them, 0, 1+ was diagnosed as HER2 negative, 3+ was diagnosed as positive, and 2+ was diagnosed as positive or FISH according to the clinical information of the patient.
  • HER2 IHC In the HER2 IHC method, patients with 2+ came out, the tissue block fixed with paraffin was cut to 4 ⁇ m thickness using a microtome, attached to the slide, and then commercialized HER2 DNA through deparaffinization and water treatment.
  • the probe kit (Vysis Inc, Downers Grove, IL, USA) was used in accordance with the manufacturer's instructions.
  • HER2 expression was positive when the Amplification Index was 2.2 or higher, depending on gene expression.
  • RNA isolated was quantified using NanoQuant system (TECAN).
  • RNA Isolated total RNA 0.5 ⁇ 3ug, random primer (Invitrogen) 0.25ug, dNTP (Intron) 250 uM, Tris-HCl (pH 8.3) 50 mM, KCl 75 mM, MgCl 2 3 mM, DTT 8 mM and MMLV reverse transcriptase
  • Add 200 units Add DEPC treated DW to a final volume of 30 ul, mix well, and react the synthetic reaction solution for 10 minutes at 25 °C, 50 minutes at 37 °C, and 15 minutes at 70 °C in thermocycler (ABI).
  • CDNA was synthesized.
  • composition of the real-time PCR reactions consisted of 25 mM TAPS (pH 9.3 at 25 ° C), 50 mM KCl, 2 mM MgCl 2 , 1 mM 2-mercaptoethanol, 200 ⁇ M each dNTP, 1 unit Taq polymerase (TAKARA) and Forward 10pmole was added to the primer and reverse primer respectively, and 10pmole was also added to the probe. 2ul of the synthesized cDNA was added to a final volume of 20ul. The base sequences of each primer and probe are shown in the table.
  • PCR reaction was performed once using ABI 7500Fast (Applied Biosystem) for 5 minutes at 94 ° C denaturation temperature, 30 seconds at denaturation temperature 95 ° C, 10 cycles at 60 ° C annealing temperature, and then 30 seconds at 95 ° C. 40 cycles at 55 ° C. were repeated 40 times.
  • fluorescence was measured after each annealing process, and the fluorescence value increased with each cycle was measured.
  • the Ct value represents the number of cycles in which amplification began to increase significantly during the PCR process.
  • ⁇ Ct means the value of the vertical axis (mRAN expression ratio) in FIGS.
  • ⁇ Ct value of SKBR3 Ct value of HER2 in SKRB3-Ct value of reference gene (GAPDH) in SKBR3
  • ⁇ Ct value of THP-1 Ct value of HER2 at THP-1-Ct value of reference (GAPDH) gene at THP-1
  • ⁇ Ct value in breast cancer tissue Ct value of HER2 in breast cancer tissue-Ct value of reference (GAPDH) gene in tissue
  • ⁇ Ct value of THP-1 Ct value of HER2 at THP-1-Ct value of reference (GAPDH) gene at THP-1
  • R (expression) ⁇ Ct value in tissue of breast cancer patient- ⁇ Ct value in THP-1
  • the Ct value of the reference gene used in this experiment represents the Ct value for GAPDH, and the reference gene may include other house keeping genes in addition to the GAPDH used in this experiment.
  • SKBR3 As a positive control, it is possible to confirm whether HER2 expression is actually overexpressed.
  • Blood is drawn from the veins of cancer patients and healthy individuals using a tube containing EDTA anticoagulant. To prevent contamination from epithelial cells, discard the first 5 ml and use 10 ml later for this test.
  • the first experimental procedure, erythrocyte lysis begins within 4 hours of blood collection, and NH 4 Cl 154 mM, KHCO 3 9 mM, and EDTA 0.1 mM are used to dissolve erythrocytes from the blood. Add 5 times the volume with erythrocyte lysis solution, and after vortex, stand at room temperature for 10 minutes, centrifuge at 600 °C for 4 minutes for 10 minutes, and discard the supernatant carefully.
  • RBC lysis buffer 10 ml was added and allowed to stand on ice for 5 minutes, followed by centrifugation at 4 ° C. 3000rpm for 2 minutes. Discard supernatant carefully, add 1 ml PBS and resuspend the pellet. Treat RNase A (100 ug / ml) for 5 minutes to remove free nucleic acid.
  • composition of the real-time PCR reactions consisted of 25 mM TAPS (pH 9.3 at 25 ° C), 50 mM KCl, 2 mM MgCl 2 , 1 mM 2-mercaptoethanol, 200 ⁇ M each dNTP, 1 unit Taq polymerase (TAKARA) and Forward Put 10pmole for each primer and reverse primer, add 10pmole for each probe, and add 2ul of synthesized cDNA to a final volume of 20ul.
  • TAPS pH 9.3 at 25 ° C
  • 50 mM KCl 2 mM MgCl 2
  • 1 mM 2-mercaptoethanol 200 ⁇ M each dNTP
  • TAKARA unit Taq polymerase
  • Forward Put 10pmole for each primer and reverse primer add 10pmole for each probe, and add 2ul of synthesized cDNA to a final volume of 20ul.
  • the base sequence of each primer and probe is as follows.
  • Table 1 SEQ ID NO: 1 HER605-F AACCTGGAACTCACCTACCTGCCCAC SEQ ID NO: 2 HER689-R CGATGAGCACGTAGCCCTGCAC SEQ ID NO: 3 HER612-F AACTCACCTACCTGCCCACCAAT SEQ ID NO: 4 HER633-R CACGTAGCCCTGCACCTCCT SEQ ID NO: 5 HER637-P CAG CCT GTC CTT CCT GCA GGA TAT C FAM-BHQ1 SEQ ID NO: 6 HER2-F1 AAG CAT ACG TGA TGG CTG GTG T SEQ ID NO: 7 HER2-R1 TCT AAG AGG CAG CCA TAG GGC ATA SEQ ID NO: 8 HER2-P1 ATA TGT CTC CCG CCT TCT GGG CAT CT FAM-BHQ1 SEQ ID NO: 9 HER2-P2 CAT CCA CGG TGC AGC TGG TGA CAC A FAM-BHQ1 SEQ
  • Table 1 shows the nucleotide sequence of the primer and probe
  • the PCR reaction was performed once using ABI 7500Fast (Applied Biosystem) for 5 minutes at 94 ° C denaturation temperature, 40 cycles of 30 seconds at 95 ° C denaturation temperature and 20 seconds at 55 ° C annealing temperature.
  • the fluorescence was measured after each annealing process, and the fluorescence value increased with each cycle was measured.
  • Expression sensitivity of HER2 was confirmed using SK-BR-3, a HER2-positive breast cancer cell line. As a result, as shown in FIGS. 1 and 2, the sensitivity using RT-qPCR of HER2 was able to confirm the sensitivity of detecting up to one SK-BR-3 cell.
  • the expression levels of HER2 in each cell line were compared using SK-BR3, MCF7, and MDA-MB-231 cell lines.
  • HER2 expression of the HER2-negative cell line MDA-MB-231 cell line was set to 1
  • the amount of HER2 expression of MCF7 was about 5.4
  • the amount of HER2 expression of SK-BR-3 was about 56.9.
  • RNA quality of the sample is very important in the experiment using the FFPE sample. Samples of high quality RNA may yield accurate results, while low RNA quality may result in false positives or false negatives. Therefore, in the present invention, the degree of RNA quality is presented based on the expression level of GAPDH. As shown in FIGS. 5 to 7, when the expression level of GAPDH was classified based on the Ct value of RT-qPCR, the lower the Ct value of GAPDH, the more accurate the results were obtained.
  • the ROC curve (receiver operating characteristic) is a graph showing the performance of a binary classifier.
  • FPR false positive rate
  • IHC 0/1 + was negative and IHC 2 + / FISH positive samples and IHC 3+ samples were analyzed positively, and the results were calculated.
  • IHC 2 + / FISH negative samples were still clinically controversial and were excluded from the exclusion results.
  • N Engl J Med. Since 2008 Mar 27; 358 (13): 1409-11. Has demonstrated the effectiveness of Herceptin, a HER2-targeted drug, in IHC 2 + / FISH-negative patients, these patients should be defined as HER2-positive or negative.
  • the sensitivity and specificity of the present invention except for the corresponding part were confirmed to be 93.0% and 91.8%, respectively.
  • hormonal receptors In addition to the size of the cancer, the presence of lymph node metastasis, and the histological differentiation of the cancer, which are known as prognostic factors of breast cancer, positive hormonal receptors (ER; estrogen receptor, PR; progesterone receptor) play an important role in prognostic and treatment decisions.
  • Post-operative anti-hormonal therapy such as tamoxifen in patients with hormonal receptor-positive therapy is an important adjuvant therapy to improve survival, but many of the treated patients relapse, indicating resistance to anti-hormonal therapy, and the loss of hormonal receptor-positive mechanisms is important. It is known to be one of them and suggests changes in hormone receptors following anti-hormonal therapy.
  • Figure 10 confirmed the sensitivity of the ER (estrogen receptor) using one-tube nested PCR conditions with MCF7 cell line was detected in 10 2 cells.
  • 11 shows the sensitivity of progesterone receptor (PR) using MCF7 cell line using one-tube nested PCR conditions, but was detected in 10 2 cells, but the Ct value of the result was high.
  • Figure 12 shows the sensitivity of the hormone receptor combined with the ER-PR and the detection of 10 1 cells was confirmed that the sensitivity is higher than when the individual test proceeds like 10 or 11.
  • the present invention mixes SK-BR-3, a breast cancer cell line that overexpresses HER2, to blood of normal humans without breast cancer, and then extracts RNA from the blood through RNA extraction. I checked the diagnosis.
  • HER2 In order to confirm whether the expression of HER2 is actually expressed by cancer cells in the blood, the expression of other cancer cell related markers was checked. Markers used were epithelial antigen markers EpCAM (Fig. 17) and Cytokeratin 19 (Fig. 18), intracellular cancer-related markers hTERT (Fig. 19) and Ki67 (Fig. 20) to determine the presence of cancer cells in the blood. . EpCAM and CK19 were confirmed for sensitivity using SK-BR-3, and hTERT was confirmed using MDA-MB-231. Finally, Ki67 confirmed the sensitivity using MCF7.
  • EpCAM and CK19 were confirmed for sensitivity using SK-BR-3
  • hTERT was confirmed using MDA-MB-231.
  • Ki67 confirmed the sensitivity using MCF7.
  • Vimentin is an intermediate filament protein normally associated with mesenchymal-derived cells such as fibroblasts or hematopoietic cells, and is absent in most normal epithelial cells. It seems to be. The presence of vimentin indicates the properties of epithelial cells that can survive independently. Therefore, we determined that vimentin expression and cytokeratins expression could be used as important markers for determining the aggression and metastatic ability of breast cancer. We confirmed the sensitivity using MDA-MB-231 to confirm the expression of markers. ( Figure 21). Cyclin D1 is an important cell cycle regulator protein factor in the development and progression of cancer. It is correlated with the frequency of Cyclin D1 expression and the clinical pathologic prognostic factors of tumors.
  • Cyclin D1 overexpression is associated with positive expression of estrogen receptors. Therefore, the sensitivity was confirmed by using SK-BR3 to confirm the expression of the marker ( Figure 22).
  • PTEN Phosphatase and tensin homolog deleted on chromosome ten
  • MMAC-1 mutated in multiple advanced cancers
  • TEP-1 TGF- ⁇ regulated and epithelial cell enriched phosphatase
  • PI3-kinase phosphatidylinositol 3-kinase
  • Akt phosphatidylinositol 3-kinase
  • FAK focal adhesion kinase
  • Neuroplastin also known as NPTN, GP55, GP65, SDR1 (stromal cell-derived receptor), np55 or SDFR1
  • NPTN neurotrophic factor
  • GP55 GP55
  • GP65 GP65
  • SDR1 stromal cell-derived receptor
  • np55 or SDFR1 is a type1 transmembrane protein in the Ig superfamily that interacts in cell-cell interactions or cell substrates.
  • Overexpression of neuroplastin in breast cancer increased cancer growth and angiogenesis and played an important role in cancer metastasis.
  • EpCAM was able to detect sensitivity up to 1 cell in blood
  • CK19, hTERT, Ki67, Vimentin and Cyclin D1 showed sensitivity up to 10 cells in blood
  • PTEN and NPTN The sensitivity of 10 2 cells in the blood was confirmed.
  • EpCAM and CK19 used Ct values to compare normal subjects to breast cancer patients, and hTERT and Ki67 compared blood group relative expression rates to normal subjects and patient groups.
  • Cyclin D1 amplification of the Cyclin D1 gene has been reported in 15-20% of breast carcinomas. In this study, 7/27 (25.9%) was found to be highly expressed in stage 0 breast cancer patients. In the case of stage 0 breast cancer patients, it was expressed in 18/27 (66.7%), but the remaining 9/27 (33.3%) were not expressed.
  • Adhesion molecules play an important role in cancer cell invasion and metastasis, and thus, there is a great interest in cell adhesion factors in predicting cancer progression.
  • Stage-by-step analysis of breast cancer using cancer markers in blood was performed. 35 to 36, it was confirmed that the epithelial antigen is not distinguished by stages of breast cancer. However, it was confirmed that the high expression pattern in Stage 0. This may be associated with early detection of breast cancer patients.
  • intracellular cancer-related markers in Figures 37 to 39 it was confirmed that the expression pattern is different for each stage of breast cancer patients. Both hTERT and Ki67, including HER2, were found to increase the expression of cancer markers in the blood as the stage progressed. In particular, it was confirmed that the proportion of patients with overexpression of 90 to 100 times increased as the stage of patients became worse. This suggests that intracellular cancer-related markers may be related to the stage of the patient, and thus the malignancy of the breast cancer of the patient may be confirmed by rapid diagnosis using blood.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 방법 및 그 역전사 정량적 중합효소연쇄반응 키트에 관한 발명이다.

Description

조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소연쇄반응 키트
본 발명은 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 방법 및 그 역전사 정량적 중합효소연쇄반응 키트에 관한 발명이다.
Human epidermal growth factor receptor 2 (HER2)는 ErbB-like oncogene family로 HER2 검사는 유방암 치료에 있어서 매우 중요하다. 특히 HER2의 과 발현은 유방암 환자의 20~30% 발견되며 이러한 환자들은 예후가 좋지 못하고, 더 극심한 유방암 양상을 나타내게 되며 그렇지 못한 환자들에 비하여 5년 생존률이 감소한다. 이러한 HER2 과발현 환자의 치료를 위해서 Herceptin (Roche)을 사용하고 있다. Herceptin은 humanized monoclonal antibody로써 HER2 receptor의 extracellular domain을 직접적으로 타깃하고 있으며, 현재 전이성 유방암환자의 치료와 neo-adjuvant 환자의 치료에 있어서 화학적 요법으로 사용되고 있다.
암환자의 진단에 있어서 암의 병기, 예후 또는 치료제 선별에 있어서 가장 Gold standard로 사용되는 것은 형광동소보합법 (FISH)와 면역조직화학염색법 (IHC)이 사용되고 있다. 특히 HER2의 과발현 진단에 있어서 IHC법은 암세포 표면에 HER2 단백질의 과발현 유무를 나타내는 방법으로 사용되고, FISH 법은 chromosome상의 HER2 유전자의 과 발현 유무를 알아보는 방법으로 사용되고 있다. 특히 IHC법은 일차적인 선별 검사로 가장 널리 사용되고 있는 방법이나, 각 검사 기관별로 차이가 있고, 기술적인 정확성이나 결과의 재연성에서 논란이 대상이 되고 있다. 또한 FISH법은 IHC법에 비해 결과의 일치율이 좋고, 민감도 및 특이도에서 IHC 법보다 더 좋다고 알려져 있다. 그러나 검사과정이 매우 복잡하고 형광을 이용한 검사법이기 때문에 그 결과의 영구보존이 불가능하다고 알려져 있다. 또한 형광 probe의 값이 매우 비싸기 때문에 규모가 작은 병원등에서는 수행이 불가능하다고 알려져 있다.
관련 선행특허로 대한민국특허공개번호 제1020090079845호는 '유방암 모니터링，진단 및 스크리닝용 단백질 마커 및 이를 이용한 유방암 모니터링，진단 및 스크리닝 방법'에 관한 것과, 대한민국특허공개번호 제1020090064378호는 '유방암 관련 유전자 및 폴리펩티드'에 관한것이 있다.
본 발명은 상기의 문제점을 해결하고 상기의 필요성에 의하여 안출된 것으로서 본 발명의 목적은 역전사 정량적 중합반응을 이용한 유방암의 진단을 위한 정보제공방법을 제공하는 것이다.
본 발명의 다른 목적은 유방암진단용 키트를 제공하는 것이다.
상기의 목적을 달성하기 위하여 본 발명은 a) 암 의심환자의 조직 또는 혈액에서 얻은 세포로부터 전장 RNA를 분리하는 단계;b) 상기 분리된 전장 RNA로부터 cDNA를 합성하는 단계;c) 상기 합성된 cDNA를 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 프라이머쌍 및 프로브, 에스트로겐 수용체(estrogen receptor)를 증폭할 수 있는 프라이머쌍 및 프로브, 프로게스테론 수용체(progesterone receptor)를 증폭할 수 있는 프라이머쌍 및 프로브,사이토케라틴 19를 증폭할 수 있는 프라이머쌍 및 프로브, 상피세포부착분자(EpCAM)를 증폭할 수 있는 프라이머쌍 및 프로브, 인간 텔로머라제 역전사효소(hTERT)를 증폭할 수 있는 프라이머쌍 및 프로브,Ki67를 증폭할 수 있는 프라이머쌍 및 프로브, 비멘틴(Vimentin)을 증폭할 수 있는 프라이머쌍 및 프로브, 사이클린(Cyclin) D1을 증폭할 수 있는 프라이머쌍 및 프로브,E-카데린(cad)을 증폭할 수 있는 프라이머쌍 및 프로브, 스네일(Snail)을 증폭할 수 있는 프라이머쌍 및 프로브,포스파테이즈 및 텐신 호모로그(Phosphatase and tensin homolog;PTEN)를 증폭할 수 있는 프라이머쌍 및 프로브,뉴로프라스틴(Neuroplastin ;NPTN)을 증폭할 수 있는 프라이머쌍 및 프로브, 및 글리세르알데히드 -3-인산 탈수소효소(GAPDH)를 증폭할 수 있는 프라이머쌍 및 프로브 조성물을 이용하여 실시간-PCR을 수행하는 단계; 및 d) 상기 증폭된 양을 정상인에 대해 발현된 양과 비교하는 단계;를 포함하는 유방암의 진단을 위한 정보제공방법을 제공한다.
일반적으로 사용되는 전장 RNA(Total RNA)를 분리하는 방법 및 이로부터 cDNA를 합성하는 방법은 공지된 방법을 통해 수행될 수 있으며, 이 과정에 대한 자세한 설명은 Joseph Sambrook 등, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); 및 Noonan, K.F. 등에 개시되어 있어 본 발명의 참조로서 삽입될 수 있다.
본 발명의 프라이머는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비제한적인 예로는 메틸화, "캡화", 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다. 핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예: 뉴클레아제, 독소, 항체, 시그날 펩타이드, 폴리-L-리신 등), 삽입제(예: 아크리딘, 프소랄렌 등), 킬레이트화제(예: 금속, 방사성 금속,철, 산화성 금속 등), 및 알킬화제를 함유할 수 있다. 본 발명의 핵산 서열은 또한 검출 가능한 시그널을 직접 또는 간접적으로 제공할 수 있는 표지를 이용하여 변형시킬 수 있다. 표지의 예로는 방사성 동위원소, 형광성 분자, 바이오틴 등이 있다.
본 발명의 방법에 있어서, 상기 증폭된 표적 서열(HER 2, 및 GAPDH 유전자 등)은 검출가능한 표지 물질로 표지될 수 있다. 일 구현예에서, 상기 표지 물질은 형광, 인광, 화학발광단 또는 방사성을 발하는 물질일 수 있으나,이에 제한되지 않는다. 바람직하게는, 상기 표지 물질은 루오리신(fluorescein), 피코에리트린(phycoerythrin), 로다민, 리사민 (lissamine) Cy-5 또는 Cy-3일 수 있다. 표적 서열의 증폭시 프라이머의 5'-말단 및/또는 3' 말단에 Cy-5 또는 Cy-3를 표지하여 RT-PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지될 수 있다.
또한, 방사성 물질을 이용한 표지는 RT-PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하면 증폭 산물이 합성되면서 방사성이 증폭 산물에 혼입되어 증폭 산물이 방사성으로 표지될 수 있다. 표적 서열을 증폭하기 위해 이용된 하나 이상의 올리고뉴클레오티드 프라이머 세트를 이용할 수 있다.
표지는 당업계에서 통상적으로 실시되는 다양한 방법, 예컨대, 닉 트랜스레이션 (nick translation) 방법, 무작위 프라이밍 방법 (Multiprime DNA labelling systems booklet, "Amersham"(1989)) 및 카이네이션 방법 (Maxam & Gilbert, Methods in Enzymology, 65:499(1986))을 통해 실시될 수 있다. 표지는 형광, 방사능, 발색 측정,중량 측정, X-선 회절 또는 흡수, 자기, 효소적 활성, 매스 분석, 결합 친화도, 혼성화 고주파, 나노크리스탈에 의하여 검출할 수 있는 시그널을 제공한다.
본 발명의 한 측면에 따르면, 본 발명에서는 RT-PCR을 통해 mRNA 수준에서 발현수준을 측정하게 된다. 이를 위하여 상기 HER 2, 및 GAPDH 유전자 등에 특이적으로 결합하는 신규한 프라이머 쌍과 형광이 표지된 프로브가 요구되며, 본 발명에서 특정한 염기서열로 특정된 해당 프라이머 및 프로브를 사용할 수 있으나 이에 제한되는 것은 아니며, 이들 유전자에 특이적으로 결합하여 검출가능한 시그널을 제공하여 RT-PCR을 수행할 수 있는 것이면, 제한 없이 사용될 수 있다. 상기에서 FAM과 Quen(Quencher)는 형광염료를 의미한다.
본 발명에 적용되는 RT-PCR 방법은 당업계에서 통상적으로 사용되는 공지의 과정을 통해 수행될 수 있다.
mRNA 발현수준을 측정하는 단계는 통상의 mRNA 발현수준을 측정할 수 있는 방법이면 제한 없이 사용될 수 있으며, 사용한 프로브 표지의 종류에 따라 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있으나, 이에 제한되지 않는다. 증폭 산물을 검출하는 방법 중의 하나로서, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 real-time RT-PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 RT-PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성 측정기구, 예를들면, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다.
본 발명의 바람직한 일구현예에 따르면, 상기 RT-PCR을 통해 증폭된 PCR 산물에 형광이 표지된 프로브가 붙어 특정 파장의 형광을 내게 되고, 증폭과 동시에 PCR 장치의 형광 측정기에서 본 발명의 유전자들의 mRNA 발현수준을 실시간으로 측정하고, 측정된 값이 계산되어 PC를 통해 시각화 되게 되어 검사자는 쉽게 그 발현 정도를 확인할 수 있다.
본 발명의 다른 측면에 따르면 상기 진단 키트는 역전사 중합효소반응을 수행하기 위해 필요한 필수 요소를 포함하는 것을 특징으로 하는 유방암 진단용 키트일 수 있다. 역전사 중합효소반응 키트는 상기 본 발명의 유전자에 대한 특이적인 각각의 프라이머 쌍을 포함할 수 있다. 프라이머는 각 마커 유전자의 핵산서열에 특이적인 서열을 가지는 뉴클레오타이드로서, 약 7 bp 내지 50 bp의 길이, 보다 바람직하게는 약 10 bp 내지 30 bp 의 길이일 수 있다.
그 외 역전사 중합효소반응 키트는 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드(dNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNAse, RNAse 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다.
본 발명에서 용어 "암 진단을 위한 정보제공방법"은 진단을 위한 예비적 단계로서 암의 진단을 위하여 필요한 객관적인 기초정보를 제공하는 것이며 의사의 임상학적 판단 또는 소견은 제외된다.
용어 "프라이머"는 짧은 자유 3말단 수산화기를 가지는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 중합효소 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성이 개시할 수 있다. 본 발명의 프라이머는, 각 마커 유전자 특이적인 프라이머로 7개 내지 50개의 뉴클레오타이드 서열을 가진 센스 및 안티센스 핵산이다. 프라이머는 DNA 합성의 개시점으로 작용하는 프라이머의 기본 성질을 변화시키지 않는 추가의 특징을 혼입할 수 있다.
용어 "프로브"는 단일쇄 핵산 분자이며, 타깃 핵산 서열에 상보적인 서열을 포함한다.
용어 "실시간 역전사 중합효소 반응(realtime RT-PCR)"이라 함은 역전사효소를 이용하여 RNA를 상보적인 DNA(cDNA)로 역전사 시킨 후에 만들어진 cDNA를 주형(template) 으로하여 타겟 프라이머와 표지를 포함하는 타겟 프로브를 이용해 타겟을 증폭함과 동시에 증폭된 타겟에 타겟 프로프의 표지에서 발생하는 신호를 정량적으로 검출해 내는 분자생물학적 중합방법이다.
본 발명의 다른 구현예에 있어서, 상기 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 프라이머쌍은 서열번호 1 내지 2, 3 내지 4, 및 6 내지 7에 기재되고, 프로브는 서열번호 5, 8 및 9에 기재되고, 상기 에스트로겐 수용체(estrogen receptor)를 증폭할 수 있는 프라이머쌍은 서열번호 10 내지 11, 및 13 내지 14에 기재되고, 프로브는 서열번호 12 및 15에 기재되며, 상기 프로게스테론 수용체(progesterone receptor)를 증폭할 수 있는 프라이머쌍은 서열번호 16 내지 17, 및 19 내지 20에 기재되고, 프로브는 서열번호 18 및 21에 기재되고, 상기 글리세르알데히드 -3-인산 탈수소효소(GAPDH)를 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 22 내지 23, 및 24에 기재되고, 상기 상피세포부착분자(EpCAM)를 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 25 내지 26, 및 27에 기재되고, 상기 사이토케라틴 19를 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 28 내지 29, 및 30에 기재되고, 상기 인간 텔로머라제 역전사효소(hTERT)를 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 31 내지 32, 및 33에 기재되고, 상기 Ki67를 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 34 내지 35, 및 36에 기재되고, 상기 비멘틴(Vimentin)을 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 37 내지 38, 및 39에 기재되고,상기 사이클린(Cyclin) D1을 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 40 내지 41, 및 42에 기재되고, 상기 E-카데린(cad)을 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 43 내지 44, 및 45에 기재되고, 상기 스네일(Snail)을 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 46 내지 47, 및 48에 기재되고, 상기 포스파테이즈 및 텐신 호모로그(Phosphatase and tensin homolog;PTEN)를 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 49 내지 50, 및 51에 기재되고, 상기 뉴로프라스틴(Neuroplastin ;NPTN)을 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 52 내지 53, 및 54에 기재된 프라이머쌍 및 프로브인 것이 바람직하나 이에 한정되지 아니한다.
또 본 발명은 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 서열번호 1 내지 2, 3 내지 4, 및 6 내지 7에 기재된 프라이머쌍, 및 서열번호 5, 8 및 9에 기재된 프로브, 에스트로겐 수용체(estrogen receptor)를 증폭할 수 있는 서열번호 10 내지 11, 및 13 내지 14에 기재된 프라이머쌍 및 서열번호 12 및 15에 기재된 프로브, 프로게스테론 수용체(progesterone receptor)를 증폭할 수 있는 서열번호 16 내지 17, 및 19 내지 20에 기재된 프라이머쌍 및 서열번호 18 및 21에 기재된 프로브, 글리세르알데히드 -3-인산 탈수소효소(GAPDH)를 증폭할 수 있는 각각 서열번호 22 내지 23, 및 24에 기재된 프라이머쌍 및 프로브, 상피세포부착분자(EpCAM)를 증폭할 수 있는 각각 서열번호 25 내지 26, 및 27에 기재된 프라이머쌍 및 프로브, 사이토케라틴 19를 증폭할 수 있는 각각 서열번호 28 내지 29, 및 30에 기재된 프라이머쌍 및 프로브, 인간 텔로머라제 역전사효소(hTERT)를 증폭할 수 있는 각각 서열번호 31 내지 32, 및 33에 기재된 프라이머쌍 및 프로브, Ki67를 증폭할 수 있는 각각 서열번호 34 내지 35, 및 36에 기재된 프라이머쌍 및 프로브, 비멘틴(Vimentin)을 증폭할 수 있는 각각 서열번호 37 내지 38, 및 39에 기재된 프라이머쌍 및 프로브, 사이클린(Cyclin) D1을 증폭할 수 있는 각각 서열번호 40 내지 41, 및 42에 기재된 프라이머쌍 및 프로브, E-카데린(cad)을 증폭할 수 있는 각각 서열번호 43 내지 44, 및 45에 기재된 프라이머쌍 및 프로브, 스네일(Snail)을 증폭할 수 있는 각각 서열번호 46 내지 47, 및 48에 기재된 프라이머쌍 및 프로브, 포스파테이즈 및 텐신 호모로그(Phosphatase and tensin homolog;PTEN)를 증폭할 수 있는 각각 서열번호 49 내지 50, 및 51에 기재된 프라이머쌍 및 프로브, 뉴로프라스틴(Neuroplastin ;NPTN)을 증폭할 수 있는 각각 서열번호 52 내지 53, 및 54에 기재된 프라이머쌍 및 프로브로 이루어진 유방암의 진단을 위한 프라이머쌍 및 프로브 조성물을 제공한다.
본 발명의 일 구현예에 있어서, 상기 프로브의 5'말단은 형광물질로 표지된 것이 바람직하나 이에 한정되지 아니한다.
또한 본 발명은 상기 본 발명의 프라이머 쌍 및 프로브 조성물를 유효성분으로 포함하는 유방암 진단용 조성물을 제공한다.
또 본 발명은 상기 본 발명의 조성물을 포함하는 유방암 진단용 키트를 제공한다.
또한 본 발명은 상기 본 발명의 조성물을 포함하는 유방암 조기 또는 병기별 진단용 키트를 제공한다.
이하 본 발명을 설명한다.
이러한 부분을 대체하기 위하여 간편하고 정량적인 결과를 도출할 수 있는 RT-qPCR법을 기초로 하여 reference gene인 GAPDH를 이용한 HER2 유전자를 증폭한 후 나타난 발현양을 비교 정량하여 발현율을 기존의 방법인 IHC와 FISH 결과와 비교하여 보았다. 뿐만 아니라 효과적인 치료를 위하여 조직 검체 뿐만 아니라 혈액 내에서 발현하는 HER2와 혈액 내 암 관련 마커의 발현 양상을 통하여 더 효과적인 유방암 치료 및 진단에 도움을 주고자 본 발명을 완성하였다.
본 발명을 통하여 알 수 있는 바와 같이, 본 발명은 조직 검체 뿐만 아니라 혈액 내에서 발현하는 HER2와 혈액 내 암 관련 마커의 발현 양상을 통하여 더 효과적인 유방암 치료 및 진단에 도움을 줄 수 있다.
도 1은 SK-BR-3 세포주를 이용한 RT-qPCR의 HER2 민감도 확인이고, 도 2는 SK-BR-3 세포주를 이용하여 one-tube nested RT-qPCR의 개선된 HER2 민감도 확인;
도 3은 유방암 세포주를 이용한 HER2 mRNA의 발현양상 비교;
도 4는 HER2 RT-qPCR과 HER2 IHC간의 상관 분석 결과;
도 5 내지 7은 임상적 Cut-off 결정을 위한 ROC curve 분석법;
도 8은 ROC curve 분석법을 이용한 임상적 Cut-off의 설정;
도 9는 RT-qPCR을 이용한 임상 검체의 결과;
도 10 내지 12는 RT-qPCR을 이용한 호르몬 수용체의 민감도 변화;
도 13 및 14는 각각 RT-qPCR을 이용한 임상 검체에서 ER 발현양 비교와 ER-PR mix 발현양 비교;
도 15는 정상인 혈액에 SK-BR-3를 섞어준 후 HER2 RT-qPCR의 민감도 확인;
도 16은 정상인 그룹과 유방암 환자 그룹의 혈액 내 HER2 발현 비교;
도 17 내지 24는 혈액 내에서 암관련 마커의 발현 양상 비교;
도 25 내지 28은 정상인과 유방암 환자의 혈액 내 암관련 마커의 발현 여부 비교;
도 29는 0기 유방암환자를 대상으로 CTC marker별 발현양상 비교;
도 30은 CTC marker별(Snail, E-cadherin, Cyclin D1, PTEN, NPTN) 발현양의 비교;
도 31은 RT-qPCR을 이용한 혈액 내 암관련 마커와 혈액 내 HER2 발현양상의 비교;
도 32는 혈액 내 HER2 발현 및 Ki67과 hTER의 발현양상의 상관 관계 분석;
도 33은 Histological grade와 hTERT와 Ki67의 상관 관계 분석;
도 34는 조직학적 HER2의 발현과 혈액 내 HER2의 발현 양상의 비교;
도 35 내지 36은 유방암 환자의 병기별 상피성 항원의 발현 양상 확인;및
도 37 내지 39는 유방암 병기별 세포 내 암 관련 마커의 발현양상 확인
이하, 본 발명의 실시예에 대하여 첨부된 도면을 참조하면서 상세히 설명하기로 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1.치료제 선별 검사를 위한 조직 검사법
1) 재료
2010년부터 2011년까지 신촌 세브란스병원에서 199명의 환자의 FFPE (Formalin Fixed Paraffin Embbeded) 조직을 이용하였다. 환자의 조직학적 HER2의 발현여부는 면역조직화학 염색법 (IHC)과 형광동소보합법 (FISH)을 수행하여 확인하였다. 또한 HER2의 발현 여부를 확인하기 위하여 유방암 Cell line인 SK-BR3, MCF7, MDA-MB 231을 사용하여 HER2의 발현 여부를 확인하였다.
2) 면역조직화학염색법 (Immunohistochemistry ; IHC)
파라핀 블록을 4 ㎛ 두께로 박절하여 슬라이드에 부착시키고 충분히 건조시킨 후 BenchMark ST (Ventana medical system, USA) 자동면역염색기기를 이용하여 면역조직화학염색을 시행하였다. 일차항체는 polyclonal rabbit anti-human c-erbB-2 oncoprotein (A0485, DakoCytomation, Glostrup, Denmark)을 1:1,000으로 희석하여 이용하였다. 이러한 방법으로 슬라이드를 염색한 후 암세포의 세포막에 HER2 단백질이 염색되는 정도에 따라 4가지 등급, 즉 0, 1+, 2+, 3+으로 나누어 판정하였다. 그 중에서 0, 1+ 일 경우 HER2 음성으로 진단하고, 3+ 일 경우 양성으로 진단하였으며, 2+일 경우 환자의 임상정보에 따라 양성 혹은 FISH를 수행하여 진단을 하였다.
3) 형광동소보합법 (Fluorescence in situ Hybridization ; FISH )
HER2 IHC법에서 2+가 나온 환자를 대상으로 하여, 파라핀으로 고정되어 있는 조직 블록을 microtome을 이용하여 4 ㎛ 두께로 박절하여 슬라이드에 부착시킨 후, 탈파라핀화 및 함수 과정을 거쳐 상용화된 HER2 DNA probe kit (Vysis Inc, Downers Grove, IL, USA)를 이용하여 제조사의 지침에 따라 실험을 진행하였다. HER2 발현 여부는 유전자 발현 정도에 따라서 Amplification Index가 2.2 이상일 경우 양성으로 판독하였다.
4) 분리된 조직에서 Total RNA 분리
FFPE 조직을 10 ㎛의 두께로 박절한 2장의 조각을 이용하여, 탈파라핀화 과정을 거친 후 자동핵산 추출 장비인 MagNApure LC RNA Isolation Kit III (Roche) 를 이용하여 RNA를 추출하였다.
Cell line의 경우 각각의 Cell line의 세포 수를 1 x 106으로 맞춘 후 Trizol을 이용하여 제조 업체의 프로토콜에 따라 Total RNA를 분리 하였다. 분리한 Total RNA는 NanoQuant system (TECAN)을 이용하여 정량 하였다.
5) 분리된 Total RNA로부터 cDNA 제작 및 Real-time PCR 수행
ㄱ. cDNA 합성
분리된 total RNA 0.5~3ug, random primer (Invitrogen) 0.25 ug, dNTP(Intron) 250 uM, Tris-HCl(pH 8.3) 50 mM, KCl 75 mM, MgCl2 3 mM, DTT 8 mM 와 MMLV 역전사 중합효소 200 units (Invitrogen)을 첨가하고 최종부피를 30 ul가 되도록 DEPC treated DW를 넣고 잘 섞은 후 합성 반응액을 thermocycler (ABI)에서 25℃에서 10 분, 37℃에서 50 분, 70℃에서 15 분간 반응시켜 cDNA를 합성하였다.
ㄴ. RT-qPCR 수행
Real-time PCR의 반응물의 조성은 25 mM TAPS (pH 9.3 at 25°C), 50 mM KCl, 2 mM MgCl2, 1 mM 2-mercaptoethanol, 200 μM each dNTP, 1 unit Taq polymerase (TAKARA)와 Forward primer와 Reverse primer를 각각 10pmole을 넣어주고, probe 또한 10pmole을 넣어 주고, 합성된 cDNA를 2ul를 넣고 최종 부피를 20ul가 되게 수행한다. 각각의 프라이머와 프로브의 염기서열은 표와 같다.
PCR 반응은 ABI 7500Fast (Applied Biosystem) 이용하여 변성 온도 94℃에서 5분 동안 1회 수행하고, 변성 온도 95℃에서 30초, 어닐링 온도 60℃에서 10사이클을 먼저 수행한 후 다시 95℃에서 30초 , 55℃에서 40초인 사이클을 40회 반복하여 수행하였다. 또한 각각의 어닐링 과정 후 형광을 측정하는 과정을 추가하여, 각 사이클 별로 증가되는 형광 값을 측정하였다.
6) 결과의 분석
각 실험의 결과는 7500 software v2.0.4 (Applied Biosystem)을 이용하여 분석하였다. 유방암 세포인 SK-BR3을 105 부터 1세포 까지 단계적으로 희석하여 상대적 정량 곡선을 그려서 Ct value를 이용하여 발현양을 비교 정량하여 발현율을 살펴 보았다. 이때 GAPDH의 발현양을 기준으로 하여 각각의 HER2의 발현양을 비교하였고, HER2 음성 유방암 세포 주인 MDA-MB-231의 HER2 발현양을 1로 기준을 정한 후 각 검체 및 세포주의 HER2의 발현양을 제시하였다.
7)Software 분석을 통한 증폭여부 확인 및 증폭된 산물의 정량
qRT-PCR의 특정유전자 발현량을 정량하는 방법 중 하나인 Comparative Ct Method를 이용하여 하기 관계식에 의거하여 측정하였고 이 공식은 ABI 7500 software-Bio-Rad CFX Manager Software에 내재되어 있어 자동으로 계산되어 나온다.
[관계식 1]
ΔΔCt= ΔCt(sample) - ΔCt(reference gene)
여기에서 Ct값이란 PCR과정 중 증폭이 뚜렷하게 증가되기 시작한 Cycle의 수치를 나타낸다.
ΔΔCt는 도 5내지 7에서 세로축의 수치(mRAN expression ratio)를 의미한다.
[관계식 2]
양성대조군에서 HER2의 발현량 분석 관계식
SKBR3의 ΔCt 값= SKRB3에서 HER2의 Ct 값 - SKBR3에서 reference gene (GAPDH)의 Ct 값
THP-1의 ΔCt 값 = THP-1에서 HER2의 Ct 값 - THP-1에서 reference (GAPDH) gene의 Ct 값
R (발현량) = SKBR3의 ΔCt값 - THP-1의 ΔCt값
[관계식 3]
유방암 환자 조직 샘플에 대한 HER2의 발현량 분석 관계식
유방암 환자 조직에서의 ΔCt 값 = 유방암 환자 조직에서 HER2의 Ct 값 - 조직에서 reference(GAPDH) gene 의 Ct 값
THP-1의 ΔCt 값 = THP-1에서 HER2의 Ct 값 - THP-1에서 reference (GAPDH) gene의 Ct 값
R (발현량) = 유방암 환자 조직에서 ΔCt값 - THP-1에서의 ΔCt값
본 실험에서 사용된 reference gene의 Ct 값은 GAPDH에 대한 Ct값을 나타내며, reference gene이란 본 실험에 사용된 GAPDH이외에도 다른 house keeping gene이 포함될 수 있다.
SKBR3 : positive control 로써 실제로 HER2의 발현이 과발현되었는지를 확인할 수 있다.
실시예 2. 혈액 내에서 암발현 마커의 분석
1) 검체
2011년부터 2012년까지 연세대학교 세브란스 병원에서 제공받은 유방암 환자 188명의 혈액 및 유방암이 없는 정상인 기증자 50명의 혈액을 사용함.
2) 환자의 혈액에서 세포의 분리
암 환자 및 정상인의 정맥에서 혈액을 EDTA 항응고제가 들어있는 튜브를 사용하여 2 tube를 채취한다. 상피세포로부터의 오염을 방지하기 위하여 처음 채취한 5 ml은 버리고 나중에 채취한 10 ml을 본 검사에 이용한다. 환자 혈액으로부터 mRNA 손상을 방지하기 위하여 혈액 채취 후 4 시간 이내에 첫 실험 과정인 적혈구 용해 과정을 시작하며, 혈액으로부터 적혈구를 용해하기 위해 NH4Cl 154 mM, KHCO3 9 mM, EDTA 0.1 mM이 포함된 적혈구 용해 용액으로 5배 부피를 넣어 주고 vortex 후 상온에서 10분간 정치 후 10분간 4℃ 600g 에서 원심분리를 수행하고 상등액은 조심스럽게 버린다. 여분의 적혈구를 제거하기 위해 10 ml의 RBC lysis buffer를 넣고 5분간 ice에서 정치시킨 후 2분간 4℃ 3000rpm 에서 원심분리를 재차 수행 하고 상등액을 조심스럽게 버리고 1 ml PBS넣고 pellet을 재 부유시킨 후 혈중에 있는 자유 핵산을 제거해 주기 위하여 RNase A (100 ug/ml)를 5분 간 처리 해 준다.
3) 분리된 세포로부터 Total RNA 분리
재 부유시킨 pellet 다시 2분간 4℃ 3000 rpm 에서 원심분리를 하고 상등액은 pipetting 으로 버린 후 Trizol reagent (Invitorogen) 1ml을 넣고 제조 업체의 프로토콜에 따라 Total RNA를 분리하였다.
4) 분리된 Total RNA로부터 cDNA 제작 및 Real-time PCR 수행
ㄱ. cDNA 합성
분리된 total RNA 2 ug, Random Hexamer (Invitrogen) 0.25 ug, dNTP(Cosmo gene tech) 250 uM, Tris-HCl(pH 8.3) 50 mM, KCl 75 mM, MgCl2 3 mM, DTT 8 mM 와 MMLV 역전사 중합효소 200 units (Invitrogen)을 첨가하고 최종부피를 20 ul가 되도록 DEPC treated DW를 넣고 잘 섞은 후 합성 반응액을 thermocycler (ABI)에서 25℃에서 10 분, 37℃에서 50 분, 70℃에서 15 분간 반응시켜 cDNA를 합성한다.
ㄴ. Real-time PCR 수행
Real-time PCR의 반응물의 조성은 25 mM TAPS (pH 9.3 at 25°C), 50 mM KCl, 2 mM MgCl2, 1 mM 2-mercaptoethanol, 200 μM each dNTP, 1 unit Taq polymerase (TAKARA)와 Forward primer와 Reverse primer를 각각 10pmole을 넣어주고, probe 또한 각 10pmole을 넣어 주고, 합성된 cDNA를 2ul를 넣고 최종 부피를 20ul가 되게 수행한다. 각각의 프라이머와 프로브의 염기서열은 다음과 같다.
표 1
서열번호1 HER605-F AACCTGGAACTCACCTACCTGCCCAC
서열번호2 HER689-R CGATGAGCACGTAGCCCTGCAC
서열번호3 HER612-F AACTCACCTACCTGCCCACCAAT
서열번호4 HER633-R CACGTAGCCCTGCACCTCCT
서열번호5 HER637-P CAG CCT GTC CTT CCT GCA GGA TAT C FAM-BHQ1
서열번호6 HER2-F1 AAG CAT ACG TGA TGG CTG GTG T
서열번호7 HER2-R1 TCT AAG AGG CAG CCA TAG GGC ATA
서열번호8 HER2-P1 ATA TGT CTC CCG CCT TCT GGG CAT CT FAM-BHQ1
서열번호9 HER2-P2 CAT CCA CGG TGC AGC TGG TGA CAC A FAM-BHQ1
서열번호10 ER(6118)-F1 TCAAATGCCAAATTGTGTTTGATGGA
서열번호11 ER(6201)-R2 GCTGCGACAAAACCGAGTCACATCA
서열번호12 ER(6145)-P TAATATGCCCTTTTGCCGATGCATACT FAM-BHQ1
서열번호13 ER(6122)-F ATGCCAAATTGTGTTTGATGGAT
서열번호14 ER(6197)-R CGACAAAACCGAGTCACATCAGTAAT
서열번호15 P at gcccttttgc cgatgca FAM-BHQ1
서열번호16 PR(1925)-F AGTCAGAGTTGTGAGAGCACTGGA
서열번호17 PR(2006)-R CTGGCTTAGGGCTTGGCTTTCATT
서열번호18 PR(1950)-P TGCTGTTGCTCTCCCACAGCCAGT FAM-BHQ1
서열번호19 PR(1932)-F GTTGTGAGAGCACTGGATGCTGTT
서열번호20 PR(2010)-R AATCTCTGGCTTAGGGCTTGGCTT
서열번호21 PR(1964)-P ACAGCCAGTGGGCGTTCCAAATGA FAM-BHQ1
서열번호22 GAPDH-F cca tct tcc agg agc gag atc c
서열번호23 GAPDH-R atg gtg gtg aag acg cca gtg
서열번호24 GAPDH-P tcc acg acg tac tca gcg cca gca Cy5-BHQ2
서열번호25 EPCAM(158)-F GCCAGTGTACTTCAGTTGGTGCAC
서열번호26 240-R CATTTCTGCCTTCATCACCAAACA
서열번호27 186-P TACTGTCATTTGCTCAAAGCTGGCTGCCA FAM-BHQ1
서열번호28 CK19-F GATGAGCAGGTCCGAGGTTA
서열번호29 CK19-R TCTTCCAAGGCAGCTTTCAT
서열번호30 CK19-P CTGCGGCGCACCCTTCAGGGTCT FAM-BHQ1
서열번호31 hTERT-F TGACGTCCAGACTCCGCTTCAT
서열번호32 hTERT-R ACGTTCTGGCTCCCACGACGTA
서열번호33 hTERT-P GCTGCGGCCGATTGTGAACATGGA FAM-BHQ1
서열번호34 Ki67-F TAATGAGAGTGAGGGAATACCTTTG
서열번호35 Ki67-R AGGCAAGTTTTCATCAAATAGTTCA
서열번호36 Ki67-P GGCGTGTGTCCTTTGGTGGGCA FAM-BHQ1
서열번호37 Vimentin-F ATGTTGACAATGCGTCTCTGGCA
서열번호38 Vimentin-R ATT TCCTCTTCGTGGAGTTTCTTCAAA
서열번호39 Vimentin-P TGACCTTGAACGCAAAGTGGAATCTTTGC FAM-BHQ1
서열번호40 CyclinD1-F TGAACAAGCTCAAGTGGAACCTGG
서열번호41 CyclinD1-R CTGTTTGTTCTCCTCCGCCTCTGG
서열번호42 CyclinD1-P CCCGCACGATTTCATTGAACACTTCC FAM-BHQ1
서열번호43 E-cad422F GGGCACAGATGGTGTGATTACAGTC
서열번호44 E-cad500R CCCAGGCGTAGACCAAGAAATG
서열번호45 E-cad452P GGCCTCTACGGTTTCATAACCCACAGATC FAM-BHQ1
서열번호46 Snail6501-F TGTGACAAGGAATATGTGAGCCTGG
서열번호47 Snail6582-R CGCAGATCTTGCAAACACAAGG
서열번호48 Snail6530-P CCTGAAGATGCATATTCGGACCCACACATT FAM-BHQ1
서열번호49 PTEN1828F GTCTGAGTCGCCTGTCACCATTT
서열번호50 PTEN1908R CGCCGTGTTGGAGGCAGTAG
서열번호51 PTEN1858P TGGGAACGCCGGAGAGTTGGTCTCT FAM-BHQ1
서열번호52 NPTN651F ACCAGTGAAGAGGTCATTATTCGAGACA
서열번호53 NPTN739R TATGTAAGGGTGTGAGAGCTGGAGGT
서열번호54 NPTN681P CCTGTTCTCCCTGTCACCCTGCAGTGTAAC FAM-BHQ1
표 1은 프라이머와 프로브의 염기서열
PCR 반응은 ABI 7500Fast (Applied Biosystem) 이용하여 변성 온도 94℃에서 5분 동안 1회 수행하고, 변성 온도 95℃에서 30초, 어닐링 온도 55℃에서 20초인 사이클을 40회 반복하여 수행하였다. 또한 각각의 어닐링 과정 후 형광을 측정하는 과정을 추가 하여, 각 사이클 별로 증가되는 형광 값을 측정하였다.
5) 결과의 분석
각 실험의 결과는 7500 software v2.0.4 (Applied Biosystem)을 이용하여 분석 하였다. 세포표면항원인 EpCAM과 CK19의 경우 RT-qPCR의 Ct 값을 기준으로 양성과 음성을 구분하였다. 두 마커 모두 Ct 값이 38 이하인 경우 양성으로 판독하였고, Ct값이 38 이상인 경우는 음성으로 판독하였다. 각 마커의 경우 정상인의 혈액에서 발현되는 HER2, hTERT와 Ki67의 발현 양을 기준으로 하여 환자군의 발현양을 비교 정량하여 발현율을 살펴 보았다. 이때 GAPDH의 발현양을 기준으로 하여 각각의 마커의 발현양을 비교하였다.
상기 실시예의 결과는 다음과 같다.
1. 치료제 선별을 위한 조직 검사의 RT-qPCR의 이용
1) RT-qPCR을 이용한 각 Cell line 별 HER2 발현양 비교
HER2 양성 유방암 세포주인 SK-BR-3를 이용하여 HER2의 발현 민감도를 확인하였다. 그 결과 도 1 및 2에서 볼 수 있듯이 HER2의 RT-qPCR을 이용한 민감도는 SK-BR-3 세포를 한 개 까지 검출할 수 있는 민감도를 확인할 수 있었다.
민감도를 더 높게 하기 위하여 HER2의 one-tube nested PCR조건을 이용하여 기존 방법과 비교해 본 결과 SK-BR-3 세포를 한 개까지 검출할 수 있었으나 각각에서 나온 Ct값의 104정도 높게 나타남을 확인할 수 있었다. 따라서 본 발명에서는 one-tube nested PCR조건을 이용하여 임상테스트를 진행하였다.
또한 유방암 세포 cell line인 SK-BR3, MCF7, MDA-MB-231 세포주를 이용하여 각 세포주의 HER2의 발현양을 비교하였다. HER2 음성 세포 주인 MDA-MB-231 세포주의 HER2 발현을 1로 정했을 때, MCF7의 HER2 발현양은 약 5.4로 나타났고, SK-BR-3의 HER2 발현양은 약 56.9를 나타내는 것을 확인할 수 있었다.
2) 임상적 Cut-off의 설정
신촌 세브란스 병원에서 제공 받은 유방암 환자의 199명의 FFPE 검체를 이용하여 HER2 RT-qPCR을 수행한 후 그 결과를 유방암 환자의 IHC Score와 FISH 결과와 비교해 보았다. IHC 0 인 경우 0으로 IHC 1+인 경우 25로 IHC 2+이면서 FISH음성일 경우 50으로 IHC 2+면서 FISH 양성일 경우는 75로 IHC 3+ 인 경우는 100으로 각각 Score를 지정한 후 그 결과를 HER2 RT-qPCR의 결과와 상관 분석을 시행하였다.
도 3에서 Pearson r 값이 0.5418 R squre 는 0.2936 p value는 < 0.0001 로 나타나서 RT-qPCR과 IHC 결과 사이에는 상관 관계가 있다는 것을 알 수 있었다.
또한 FFPE 검체를 이용한 실험에서는 검체의 RNA quality가 매우 중요하다. RNA의 quality가 높은 검체는 정확한 결과를 나타낼 수 있는 반면에 RNA quality가 낮다면 위양성 혹은 위음성의 결과를 나타낼 수 있다. 따라서 본 발명에서는 RNA quality의 정도를 GAPDH의 발현양을 기준으로 제시하였다. 도 5 내지 7에서 볼 수 있듯이 GAPDH의 발현 정도를 RT-qPCR의 Ct 값을 기준으로 하여 분류해 보았을 때 GAPDH의 Ct 값이 낮은 값을 가질수록 더 정확한 결과를 나타내는 것을 확인할 수 있었다.
이때 ROC curve(receiver operating characteristic)는 어떤 검사의 판단결과(binary classifier)의 performance를 보여주는 그래프로,
TPR(true positive rate) or sensitivity, 을 y 축으로
FPR(false positive rate) or 1-specificity 을 x 축으로 가진다.
즉, TRP = y축 = sensitivity = (TP / (TP + FN)
FPR = x 축 = 1-specificity = 1 - [ TN / (TN + FP)] 로 계산된다.
도 5내지 7을 보면 모든 검체를 GAPDH의 Ct 값 30이하의 검체를 분석한 경우(도 7)가 GAPDH의 Ct 값을 33이하의 검체만 분석한 경우(도 6)와 GAPDH의 결과에 관계없이 모든 검체를 분석한 경우(도 5) 보다 더 높은 특이도와 민감도 분석이 가능 한 것을 알 수 있었다. 이 결과를 바탕으로 하여 본 발명에서는 GAPDH Ct 값이 30이하인 검체만을 가지고 임상적 Cut-off 분석을 수행하였고 그 결과는 도 5에 잘 나타나 있다.
도 8에 의하면 GAPDH Ct 값을 30이하로 하였을 때 그 민감도와 특이도가 가장 높은 것을 알 수 있었고 (민감도 93.02, 특이도 91.84) 그 때의 Cut-off는 105.5인 것을 알 수 있었다. 이렇게 지정한 Cut-off를 이용한 임상 검체를 분석한 결과는 도 9에서 볼 수 있다.
도 9에서 볼 수 있듯이 IHC 0/1+는 음성으로 IHC 2+/FISH 양성 검체와 IHC 3+ 검체는 양성으로 분석하여 결과를 산출하였다. IHC 2+/FISH 음성 검체는 아직까지 임상적으로 논란이 많은 부분이라 제외 결과 산출에선 제외하였다. N Engl J Med.　2008 Mar 27;358(13):1409-11.에 의하면 IHC 2+/FISH 음성 환자에 HER2 표적 치료제인 Herceptin을 투여 했을 때 그 효과가 있다는 것이 증명되었기 때문에 해당 환자들을 HER2 양성 혹은 음성으로 규정할 수 없었다. 따라서 해당 부분을 제외한 본 발명의 민감도 및 특이도는 각각 93.0%와 91.8%로 확인할 수 있었다.
3) 호르몬 수용체 검사를 위한 RT-qPCR법
유방암의 예후 예측인자로 알려진 암의 크기 및 림프절 전이 유무, 암의 조직학적 분화도 외에도 호르몬 수용체(ER; estrogen receptor, PR; progesterone receptor) 양성 유무가 예후 및 치료의 결정에 매우 중요한 역할을 담당하고 있다. 호르몬 수용체 양성의 환자에게서 수술 후 타목시펜 등의 항호르몬 치료는 생존율을 높이는 중요한 보조요법이지만 치료받은 환자의 상당수는 재발하는데 이는 항호르몬치료에 대한 내성을 의미하며 호르몬 수용체 양성의 소실이 중요한 내성 발현 기전중의 하나로 알려져 있고 이는 항호르몬치료에 따른 호르몬 수용체 변화를 시사한다. 유방암 치료 과정에서 수술 후 원발성 유방암은 물론 재발성 유방암에 대해서도 호르몬 수용체 발현에 대한 면역조직화학염색 검사는 기본적으로 시행되고있는 실정이다. 호르몬 수용체의 존재는 양호한 예후 인자로 알려져 있으며, 삼중복 음성 유방암은 불량한 예후를 가진다고 알려져 있다. 호르몬 수용체의 양성에서 음성으로의 변화 및 삼중복 음성이 높게 나오게 되는 변화는 원발암에 비해 재발암에서 적절한 항호르몬 치료와 Herceptin과 같은 표적치료를 받을 기회가 없어지게 되며, 불량한 예후와 관련이 있게 된다. 따라서 호르몬 수용체를 RT-qPCR을 통하여 민감도를 확인하였다.
도 10은 MCF7 cell line을 가지고 one-tube nested PCR조건을 이용하여 ER(estrogen receptor)의 민감도를 확인하였으며 102 세포에서 검출되었다. 도 11은 MCF7 cell line을 가지고 one-tube nested PCR조건을 이용하여 PR(progesterone receptor)의 민감도를 확인하였으며 102 세포에서 검출되었으나 결과값에 나온 Ct값이 높게 나타났다. 도 12는 ER-PR을 모두 합한 호르몬 수용체의 민감도이며 101 세포에서 검출되어 10이나 11처럼 개별 테스트 진행한 경우보다 민감도가 높게 나타남을 확인 할 수 있었다.
또한 임상조직샘플을 이용하여 비교한 결과 ER만 진행한 경우에서는 ER IHC 양상이 10%이상인 경우가 59검체(71.1%)로 나왔으나(도 13), ER-PR mix한 호르몬 수용체 검사에서는 63검체(75.9%)로 4검체(4.8%)가 양성으로 확인됨을 알 수 있었다(도 14).
2. 혈액 내에서 HER2 발현 및 암발현 마커의 분석
1) 민감도 및 특이도 비교
혈액 내에서 HER2의 발현을 검출할 수 있는지 여부를 파악하기 위하여 본 발명에서는 유방암이 없는 정상인의 혈액에 HER2를 과발현하는 유방암세포주인 SK-BR-3를 섞어 준 후 RNA 추출을 통하여 혈액 내 암세포의 진단 여부를 확인해 보았다.
도 15에서 볼 수 있듯이 혈액과 섞어 준 SK-BR-3의 세포가 1개 일 때까지 HER2의 민감도가 높다는 것을 알 수 있었다.
또한 혈액 내에서 HER2의 발현 여부를 확인하기 위하여 정상인 50명과 신촌 세브란스 병원으로부터 제공 받은 유방암 환자 188명의 혈액을 이용하여 HER2의 발현 여부를 확인해 보았다. 그 결과 정상인에서는 그 발현이 모두 0~1.5 정도로 낮게 나타났고, 유방암 환자에서는 0 ~ 355까지 다양한 발현이 나타나는 것을 확인할 수 있었다. 그 중에서 혈액 내 HER2의 발현이 10이상인 환자들을 양성으로 하여 그 이상의 HER2 발현을 양성 10이하의 발현을 음성으로 구분하였다.
도 16에서 볼 수 있듯이 정상인에서는 HER2의 과발현이 나타나지 않은 반면에 188명의 유방암 환자 중 39명 (20.7%)에서는 HER2의 과발현이 나타나는 것을 확인 할 수 있었다.
2) 기타 혈액 내 암 마커의 발현양 비교
HER2의 발현이 실제 혈액 내에서 암세포에 의해서 발현되는지 여부를 확인하기 위하여 다른 암세포 관련 마커의 발현 여부를 확인해 보았다. 사용된 마커는 상피성 항원 마커인 EpCAM(도17)과 Cytokeratin 19(도 18), 세포 내 암관련 마커인 hTERT(도 19)와 Ki67(도 20)을 이용하여 혈액 내 암세포의 유무를 확인 하였다. EpCAM과 CK19는 SK-BR-3를 이용하여 민감도를 확인하였고, hTERT는 MDA-MB-231을 이용하여 확인하였다. 마지막으로 Ki67은 MCF7을 이용하여 민감도를 확인하였다.
Vimentin은 정상적으로는 섬유모세포나 hematopoietic cells와 같은 간엽기원의 세포들과 관련되어 있는 intermediate filament protein으로서 대부분의 정상적인 상피세포들에는 존재하고 있지 않고 세포질 내 vimentin 발현은 광범하게 분포되어 자주 분명한 perinuclear & subplasmalemmal accentuation을 보인다고 하였다. vimentin의 존재는 독립적으로 생존할 수 있는 상피세포들의 성질을 나타낸다. 따라서 vimentin발현과 cytokeratins의 발현여부를 판단하는 것이 유방암의 공격성과 전이능을 판단할 수 있는 중요한 마커로서 활용될 수 있다고 보고 마커의 발현여부를 확인하고자 MDA-MB-231을 이용하여 민감도를 확인하였다(도 21). Cyclin D1은 암의 발달과 진행에 있어서 중요한 세포 주기 조절 단백질 인자로서 Cyclin D1 발현빈도와 종양의 임상 병리학적 예후 인자와 상관관계에 있으며, Cyclin D1의 과발현은 에스트로겐 수용체의 양성 발현과 관련이 있다. 따라서 마커의 발현여부를 확인하고자 SK-BR3를 이용하여 민감도를 확인하였다(그림 22). PTEN (Phosphatase and tensin homolog deleted on chromosome ten)은 MMAC-1(mutated in multiple advanced cancers) 혹은 TEP-1(TGF-β regulated and epithelial cell enriched phosphatase)라고 불리워지는 종양 억제 유전자로서,암세포의 성장을 억제할 뿐만 아니라 배아(embryo)의 성숙과 세포의 이동, 세포 자멸사(apoptosis)에 중요한 역할을 하는 것으로 알려져 있으며, 상피세포 성장 인자 수용체의 신호전달 경로를 조절하는 지질 인산 분해효소로 작용을 한다. 즉, 세포의 성장 및 생존에 관련된 phosphatidylinositol 3-kinase(PI3-kinase)/Akt 경로를 조절하는 역할을 함으로써 세포 분화 주기의 진행을 억제하여 G1 정지를 유발함으로써 세포의 성장을 억제하는 작용이 있다. 또한 PTEN은 focal adhesion kinase(FAK)을 탈인산화 시켜 세포의 이동과 분포, 그리고 국소적인 유착 형성을 초래한다. PTEN의 소실이 종양 진행과 전이와 상관 관계가 있다는 보고가 있기 때문에 마커의 발현여부를 확인하고자 하였다(도 23). Neuroplastin는 인간 NPTN 유전자에 의해 암호화하는 단백질이다. NPTN, GP55, GP65, SDR1 (stromal cell-derived receptor), np55 or SDFR1로 알려진 Neuroplastin은 Ig superfamily 속하는 type1 transmembrane 단백질로 세포-세포 상호 작용 또는 세포 기질에서 상호 작용한다. 유방암에서 neuroplastin의 과발현은 암의성장과 혈관신생을 증가시켜 암전이에 중요한 역할을 하여 해당마커를 사용하여 발현여부를 확인하고자 하였다(도 24).
상기에서 알 수 있듯이 EpCAM은 혈액 내 1개의 세포까지 민감도를 확인 할 수 있었고, CK19와 hTERT, Ki67, Vimentin그리고 Cyclin D1은 혈액 내 10개의 세포까지 확인 할 수 있는 민감도를 나타냈으며 PTEN과 NPTN의 경우는 혈액내 102개 세포에서의 민감도를 확인 할 수 있었다.
또한 도 25에서 볼 수 있듯이 EpCAM과 CK19는 그 발현을 Ct 값을 이용하여 정상인과 유방암환자를 비교하였고, hTERT와 Ki67은 혈액 내 상대적인 발현 비율을 정상인과 환자 군을 비교해 보았다.
도 26 내지 28에서 볼 수 있듯이 EpCAM과 CK19에서는 정상인은 EpCAM에서 한 명을 제외하고 모두 Ct값 39 이상의 낮은 값을 나타낸 반면 유방암 환자 군에서는 Ct 값 38 이하의 높은 값을 갖는 환자들이 존재하는 것을 확인할 수 있었다. EpCAM에서는 45.2%의 양성률을 나타내는 것을 확인할 수 있었고, CK19에서는 50.5%의 양성률을 확인 할 수 있었다. 또한 hTERT와 Ki67의 발현양을 확인한 결과 정상인에서는 hTERT와 Ki67 모두 상대적 발현양이 10이상을 나타낸 사람이 없는 반면에 유방암 환자 군에서는 10이상의 높은 발현율을 나타내는 환자가 hTERT 20.7% Ki67은 13.8%의 환자가 10이상의 높은 발현을 나타내는 것을 확인할 수 있었다.
Cyclin D1은 유방암종의 15-20%에서 Cyclin D1 유전자의 증폭이 보고되고 있는데 본 실험에서도 0기의 유방암환자를 대상으로 발현여부를 확인해 본 결과 7/27(25.9%)가 높게 발현되었으며, PTEN의 경우 0기의 유방암환자를 대상으로 발현여부를 확인해 본 결과 18/27(66.7%)에서 발현이 되었으나 나머지 9/27(33.3%)는 발현되지 않아서 9명의 환자는 PTEN의 소실이 종양 진행과 전이와 상관 관계가 있다는 보고가 있기 때문에 추적검사가 필요해 보인다(도 29). 암세포의 침윤과 전이에 세포부착인자(adhesion molecule)가 중요한 역할을 하기 때문에 암의 진행과정 예측에 있어 세포부착인자에 대한 관심이 높다.
본 발명에서는 0기 유방암환자를 대상으로 cadherin과 Snail의 발현여부를 확인해 보았다. 그 결과 Snail에서 18/27(66.7%)에서 양성발현을 보였으나 E-cadherin의 경우 단 1/27(3.7%)에서만 양성반응을 보였다. Snail은 암종 형성과정의 비교적 초기 단계에서 관여한다는 보고에 비슷한 결과를 보였으며 초기의 진단마커로 유용함을 보여줬으며, E-cadherin은 Snail과 역상관 관계의 발현 양상을 보이고 있었다(도 30).
3) 혈액 내 HER2 발현과 유방암 관련 마커의 발현 양상 비교
혈액 내에서 HER2를 발현한 환자의 검체와 본 발명에서 이용한 암 관련 마커 들의 발현양상이 어떠한 관계가 있는지 확인해 보았다.
도 31에서 볼 수 있듯이 혈액 내 HER2를 발현한 환자는 2명의 환자를 제외하고는 모두 상피성 항원 또는 세포내 암관련 마커와 동시에 발현하는 것을 확인할 수 있었다. 이는 혈액 내 HER2의 발현이 실제로 HER2를 과 발현하는 암세포의 존재에 의해서 높은 발현을 나타내는 것임을 확인할 수 있었다.
특히 혈액 내 HER2의 발현은 혈액 내 Ki67과 hTERT의 발현과 작은 연관성이 있는 것을 확인 할 수 있었다 (도 32). 이로 인하여 HER2의 과 발현이 암세포의 악성도와 연관이 있음을 알 수 있었고, 이는 또한 암세포의 Histological grade가 점점 악화 될수록 Ki67과 hTERT발현이 어느 정도 연관성이 있음을 도 33에서 확인할 수 있었다.
4) 혈액 내 HER2의 발현과 조직학적 검사 HER2 결과의 비교
혈액 내에서 발현하는 HER2와 조직학적 검사 방법을 이용한 HER2의 발현양상이 어떠한 관계에 있는지 RT-qPCR을 이용하여 비교해 보았다.
도 34에서 볼 수 있듯이 혈액 내 HER2의 발현은 조직학적 HER2 검사 법과 많은 차이를 보이는 것을 알 수 있었다. 도면의 아래 표에서 붉은 사각형으로 표시한 부분은 조직학적 검사 결과에서 HER2 음성을 나타낸 환자지만 혈액 내 HER2발현이 높게 나타난 환자임을 알 수 있다. 그 비율은 HER2 음성환자의 19.6%의 비율로 전체의 1/5을 차지할 정도로 그 비율이 높음을 알 수 있다. 이러한 환자들은 암세포의 악성도와 관련이 있다는 것을 알 수 있었고, 따라서 혈액 내 HER2의 발현이 높게 나타난 환자들에게 HER2의 Target 치료제인 Herceptin을 투여하여 치료를 가능하게 할 수 있을 것이라고 볼 수 있다.
5) 혈액 내 암 마커의 유방암 병기별 분석
혈액 내 암 마커를 이용한 유방암 병기별 분석을 수행하였다. 도 35 내지 36에서 상피성 항원의 경우 유방암의 병기 별로 큰 구별이 되지 않는 것을 확인할 수 있었다. 그러나 Stage 0에서 높은 발현 양상을 나타내는 것을 확인할 수 있었다. 이는 유방암 환자의 조기 발견과 연관할 수 있을 것이라고 생각된다.
도 37 내지 39에서 세포내 암 관련 마커의 경우는 유방암 환자의 병기별로 발현 양상이 차이가 나는 것을 확인할 수 있었다. HER2를 포함하여 hTERT와 Ki67 모두 병기가 진행될수록 혈액 내 암마커의 발현이 높아지는 것을 확인할 수 있었다. 특히 90 ~ 100 배 이상의 과 발현 환자의 비율이 환자의 병기가 나빠질수록 높아지는 것을 확인 할 수 있었다. 이로써 세포 내 암 관련 마커는 환자의 병기와 연관이 있다는 것을 알 수 있어서 혈액을 이용한 신속한 진단으로 환자의 유방암의 악성도를 확인 할 수 있을 것이라고 생각된다.

Claims (8)

  1. a) 암 의심환자의 조직 또는 혈액에서 얻은 세포로부터 전장 RNA를 분리하는 단계;
    b) 상기 분리된 전장 RNA로부터 cDNA를 합성하는 단계;
    c) 상기 합성된 cDNA를 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 프라이머쌍 및 프로브, 에스트로겐 수용체(estrogen receptor)를 증폭할 수 있는 프라이머쌍 및 프로브, 프로게스테론 수용체(progesterone receptor)를 증폭할 수 있는 프라이머쌍 및 프로브,사이토케라틴 19를 증폭할 수 있는 프라이머쌍 및 프로브, 상피세포부착분자(EpCAM)를 증폭할 수 있는 프라이머쌍 및 프로브, 인간 텔로머라제 역전사효소(hTERT)를 증폭할 수 있는 프라이머쌍 및 프로브,Ki67를 증폭할 수 있는 프라이머쌍 및 프로브, 비멘틴(Vimentin)을 증폭할 수 있는 프라이머쌍 및 프로브, 사이클린(Cyclin) D1을 증폭할 수 있는 프라이머쌍 및 프로브,E-카데린(cad)을 증폭할 수 있는 프라이머쌍 및 프로브, 스네일(Snail)을 증폭할 수 있는 프라이머쌍 및 프로브,포스파테이즈 및 텐신 호모로그(Phosphatase and tensin homolog;PTEN)를 증폭할 수 있는 프라이머쌍 및 프로브,뉴로프라스틴(Neuroplastin ;NPTN)을 증폭할 수 있는 프라이머쌍 및 프로브,
    및 글리세르알데히드 -3-인산 탈수소효소(GAPDH)를 증폭할 수 있는 프라이머쌍 및 프로브 조성물을 이용하여 실시간-PCR을 수행하는 단계; 및
    d) 상기 증폭된 양을 정상인에 대해 발현된 양과 비교하는 단계;를 포함하는 유방암의 진단을 위한 정보제공방법.
  2. 제 1항에 있어서, 상기 증폭된 양을 정상인에 대해 증폭된 양과 비교하는 단계는 표준 또는 컷오프 값에 의하여 수행되는 것을 특징으로 하는 유방암의 진단을 위한 정보제공방법.
  3. 제 1항에 있어서, 상기 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 프라이머쌍은 서열번호 1 내지 2, 3 내지 4, 및 6 내지 7에 기재되고, 프로브는 서열번호 5, 8 및 9에 기재되고, 상기 에스트로겐 수용체(estrogen receptor)를 증폭할 수 있는 프라이머쌍은 서열번호 10 내지 11, 및 13 내지 14에 기재되고, 프로브는 서열번호 12 및 15에 기재되며, 상기 프로게스테론 수용체(progesterone receptor)를 증폭할 수 있는 프라이머쌍은 서열번호 16 내지 17, 및 19 내지 20에 기재되고, 프로브는 서열번호 18 및 21에 기재되고, 상기 글리세르알데히드 -3-인산 탈수소효소(GAPDH)를 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 22 내지 23, 및 24에 기재되고, 상기 상피세포부착분자(EpCAM)를 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 25 내지 26, 및 27에 기재되고, 상기 사이토케라틴 19를 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 28 내지 29, 및 30에 기재되고, 상기 인간 텔로머라제 역전사효소(hTERT)를 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 31 내지 32, 및 33에 기재되고, 상기 Ki67를 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 34 내지 35, 및 36에 기재되고, 상기 비멘틴(Vimentin)을 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 37 내지 38, 및 39에 기재되고,
    상기 사이클린(Cyclin) D1을 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 40 내지 41, 및 42에 기재되고, 상기 E-카데린(cad)을 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 43 내지 44, 및 45에 기재되고, 상기 스네일(Snail)을 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 46 내지 47, 및 48에 기재되고, 상기 포스파테이즈 및 텐신 호모로그(Phosphatase and tensin homolog;PTEN)를 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 49 내지 50, 및 51에 기재되고, 상기 뉴로프라스틴(Neuroplastin ;NPTN)을 증폭할 수 있는 프라이머쌍 및 프로브는 각각 서열번호 52 내지 53, 및 54에 기재된 프라이머쌍 및 프로브인 것을 특징으로 하는 유방암의 진단을 위한 정보제공방법.
  4. 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 서열번호 1 내지 2, 3 내지 4, 및 6 내지 7에 기재된 프라이머쌍, 및 서열번호 5, 8 및 9에 기재된 프로브, 에스트로겐 수용체(estrogen receptor)를 증폭할 수 있는 서열번호 10 내지 11, 및 13 내지 14에 기재된 프라이머쌍 및 서열번호 12 및 15에 기재된 프로브, 프로게스테론 수용체(progesterone receptor)를 증폭할 수 있는 서열번호 16 내지 17, 및 19 내지 20에 기재된 프라이머쌍 및 서열번호 18 및 21에 기재된 프로브, 글리세르알데히드 -3-인산 탈수소효소(GAPDH)를 증폭할 수 있는 각각 서열번호 22 내지 23, 및 24에 기재된 프라이머쌍 및 프로브, 상피세포부착분자(EpCAM)를 증폭할 수 있는 각각 서열번호 25 내지 26, 및 27에 기재된 프라이머쌍 및 프로브, 사이토케라틴 19를 증폭할 수 있는 각각 서열번호 28 내지 29, 및 30에 기재된 프라이머쌍 및 프로브, 인간 텔로머라제 역전사효소(hTERT)를 증폭할 수 있는 각각 서열번호 31 내지 32, 및 33에 기재된 프라이머쌍 및 프로브, Ki67를 증폭할 수 있는 각각 서열번호 34 내지 35, 및 36에 기재된 프라이머쌍 및 프로브, 비멘틴(Vimentin)을 증폭할 수 있는 각각 서열번호 37 내지 38, 및 39에 기재된 프라이머쌍 및 프로브, 사이클린(Cyclin) D1을 증폭할 수 있는 각각 서열번호 40 내지 41, 및 42에 기재된 프라이머쌍 및 프로브, E-카데린(cad)을 증폭할 수 있는 각각 서열번호 43 내지 44, 및 45에 기재된 프라이머쌍 및 프로브, 스네일(Snail)을 증폭할 수 있는 각각 서열번호 46 내지 47, 및 48에 기재된 프라이머쌍 및 프로브, 포스파테이즈 및 텐신 호모로그(Phosphatase and tensin homolog;PTEN)를 증폭할 수 있는 각각 서열번호 49 내지 50, 및 51에 기재된 프라이머쌍 및 프로브, 뉴로프라스틴(Neuroplastin ;NPTN)을 증폭할 수 있는 각각 서열번호 52 내지 53, 및 54에 기재된 프라이머쌍 및 프로브로 이루어진 유방암의 진단을 위한 프라이머쌍 및 프로브 조성물.
  5. 제 4항에 있어서, 상기 프로브의 5'말단은 형광물질로 표지된 것을 특징으로 하는 유방암의 진단을 위한 프라이머쌍 및 프로브 조성물.
  6. 제 4항의 프라이머 쌍 및 프로브 조성물을 유효성분으로 포함하는 유방암 진단용 조성물.
  7. 제4항의 조성물을 포함하는 유방암 진단용 키트.
  8. 제4항의 조성물을 포함하는 유방암 조기 또는 병기별 진단용 키트.
PCT/KR2013/011978 2013-12-20 2013-12-20 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소연쇄반응 키트 WO2015093670A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
PCT/KR2013/011978 WO2015093670A1 (ko) 2013-12-20 2013-12-20 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소연쇄반응 키트
CA2934618A CA2934618A1 (en) 2013-12-20 2013-12-20 Quantitative reverse transcription polymerase chain reaction kit using tissue and blood for early diagnosis and screening test for therapeutic agent of breast cancer
US15/104,592 US20160348181A1 (en) 2013-12-20 2013-12-20 Quantitative reverse transcription polymerase chain reaction kit using tissue and blood for early diagnosis and screening test for therapeutic agent of breast cancer

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2013/011978 WO2015093670A1 (ko) 2013-12-20 2013-12-20 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소연쇄반응 키트

Publications (1)

Publication Number Publication Date
WO2015093670A1 true WO2015093670A1 (ko) 2015-06-25

Family

ID=53403001

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/011978 WO2015093670A1 (ko) 2013-12-20 2013-12-20 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소연쇄반응 키트

Country Status (2)

Country Link
CA (1) CA2934618A1 (ko)
WO (1) WO2015093670A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011107819A1 (en) * 2010-03-01 2011-09-09 Adelbio Methods for predicting outcome of breast cancer, and/or risk of relapse, response or survival of a patient suffering therefrom
US20120009582A1 (en) * 2010-07-07 2012-01-12 The Regents Of The University Of Michigan Diagnosis and treatment of breast cancer

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011107819A1 (en) * 2010-03-01 2011-09-09 Adelbio Methods for predicting outcome of breast cancer, and/or risk of relapse, response or survival of a patient suffering therefrom
US20120009582A1 (en) * 2010-07-07 2012-01-12 The Regents Of The University Of Michigan Diagnosis and treatment of breast cancer

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BIECHE ET AL.: "Prognostic value of CCND1 gene status in sporadic breast tumours, as determined by real-time quantitative PCR assays", BRITISH JOURNAL OF CANCER, vol. 86, no. 4, 2002, pages 580 - 586 *
MITAS ET AL.: "Quantitative real time RT PCR detection of breast cancer micrometastasis using a multigene marker panel", INTERNATIONAL JOURNAL OF CANCER, vol. 93, no. 2, 2001, pages 162 - 171 *
POWELL ET AL.: "Single cell profiling of circulating tumor cells: transcriptional heterogeneity and diversity from breast cancer cell lines", PLOS ONE, vol. 7, no. ISSUE, 2012, pages 1 - 11 *
SLEIJFER ET AL.: "Circulating tumour cell detection on its way to routine diagnostic implementation?", EUROPEAN JOURNAL OF CANCER, vol. 43, no. 18, 2007, pages 2645 - 2650 *

Also Published As

Publication number Publication date
CA2934618A1 (en) 2015-06-25

Similar Documents

Publication Publication Date Title
AU2002326899B2 (en) Chromogenic in situ hybridization methods, kits, and compositions
Houghton et al. Transcriptional complementarity in breast cancer: application to detection of circulating tumor cells
EP2890815A2 (en) Methods for diagnosis and treatment of cancer
WO2011122857A9 (ko) 유방암 예후 예측을 위한 조성물 및 이를 포함하는 키트
WO2017222221A1 (ko) 포타슘 채널 단백질을 이용한 암 진단용 조성물
WO2021086014A1 (ko) 폐암 환자의 면역치료 반응성 예측용 cxcl13 마커 및 이의 용도
WO2012161385A1 (ko) 실시간 중합반응을 이용한 암의 진단을 위한 정보제공방법 및 이를 위한 암 진단용 키트
KR20210156259A (ko) Acly를 포함하는 내성 암 진단용 바이오마커 조성물 및 이의 용도
EP1959022A1 (en) Detection of uterine leiomyosarcoma using lmp2
WO2011081421A2 (en) Complement c9 as markers for the diagnosis of cancer
WO2012115493A9 (ko) 암에 대한 바이오마커 및 이를 이용한 암 진단
KR20120060442A (ko) 위암 진단용 마커로서 ｔｆｆ2의 용도
WO2015093670A1 (ko) 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소연쇄반응 키트
KR20110082669A (ko) 대장암의 조기 진단을 위한 메틸화 바이오마커 및 이의 용도
WO2003097872A2 (en) G - protein coupled receptor marker molecules associated with colorectal lesions
WO2015129942A1 (ko) 개선된 유방암에 대한 정보제공 방법 및 그 진단용 키트
WO2009131366A2 (ko) 위암 또는 대장암 진단 마커 및 치료제로서의 ｃdca5
WO2013077479A1 (ko) 실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트
WO2010123124A1 (ja) 固形がんの再発および予後因子、およびその臨床利用
WO2015046638A1 (ko) 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소 연쇄반응 키트
KR101528331B1 (ko) 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소연쇄반응 키트
WO2022092702A1 (ko) 인간 유방암 및 동물 유선암의 진단 및 악성도 평가를 위한 바이오마커로서 smp30의 용도
KR101925715B1 (ko) 간암 예후측정 또는 진단용 마커로서의 ard1의 용도
KR102416607B1 (ko) 방사선 저항성 지표 단백질 및 이의 검출방법
WO2024151138A1 (ko) 엑소좀을 이용한 편평상피세포 폐암 진단 또는 예후 예측용 바이오마커 및 이의 용도

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 15104592

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2934618

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13899353

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 13899353

Country of ref document: EP

Kind code of ref document: A1