WO2012115493A9 - 암에 대한 바이오마커 및 이를 이용한 암 진단 - Google Patents

암에 대한 바이오마커 및 이를 이용한 암 진단 Download PDF

Info

Publication number
WO2012115493A9
WO2012115493A9 PCT/KR2012/001471 KR2012001471W WO2012115493A9 WO 2012115493 A9 WO2012115493 A9 WO 2012115493A9 KR 2012001471 W KR2012001471 W KR 2012001471W WO 2012115493 A9 WO2012115493 A9 WO 2012115493A9
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
mest
present
kit
expression
Prior art date
Application number
PCT/KR2012/001471
Other languages
English (en)
French (fr)
Other versions
WO2012115493A3 (ko
WO2012115493A2 (ko
Inventor
강성균
이현숙
이정현
김상진
권개경
임형순
김윤재
황영옥
진욱
조용균
Original Assignee
한국해양연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국해양연구원 filed Critical 한국해양연구원
Priority to US14/001,655 priority Critical patent/US20170240971A1/en
Publication of WO2012115493A2 publication Critical patent/WO2012115493A2/ko
Publication of WO2012115493A3 publication Critical patent/WO2012115493A3/ko
Publication of WO2012115493A9 publication Critical patent/WO2012115493A9/ko
Priority to US16/558,455 priority patent/US20190382853A1/en
Priority to US18/078,391 priority patent/US20230111706A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5302—Apparatus specially adapted for immunological test procedures
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57415—Specifically defined cancers of breast
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57438—Specifically defined cancers of liver, pancreas or kidney
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5748—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving oncogenic proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to biomarkers for cancer and cancer diagnosis using the same.
  • Malignant tumors are the second leading cause of death after heart disease in the United States (Boring et al., CA Cancer J. Clin . 43: 7 (1993)). Cancer is transmitted through the blood or lymphatic system by a process called an increase in the number of abnormal or neoplastic cells (proliferating to form tumor masses) derived from normal tissue, invading and translocating these neoplastic tumor cells into adjacent tissues. Eventually it is characterized by the development of malignant cells that spread to local lymph nodes and distal. Cancerous cells also grow under conditions that normal cells cannot grow. Cancer itself manifests itself in a wide variety of forms, characterized by different degrees of invasiveness and aggressiveness.
  • Polypeptides, or else membrane bound polypeptides have been sought. Often, such membrane bound polypeptides are expressed more abundantly on the surface of cancer cells than on the surface of non-cancerous cells.
  • Antigen polypeptides on these tumor-associated cell surfaces could be identified and specifically targeted and destroyed by cancer-based therapies. In this regard, it is noted that antibody-based therapies have proven very effective in the treatment of certain cancers.
  • Herceptin HERCEPTIN®
  • Rituxan Genetech, Inc., South San Francisco, CA
  • Herceptin® is a recombinant DNA-derived humanized monoclonal antibody that selectively binds to the extracellular domain of human epidermal growth factor receptor 2 (HER2) proto-oncogene .
  • HER2 human epidermal growth factor receptor 2
  • Overexpression of HER2 protein is observed in 25-30% of primary breast cancers.
  • Rituxan® is a genetically engineered chimeric murine / human monoclonal antibody presented against CD20 antigen found on the surface of normal B lymphocytes and malignant B lymphocytes. Both of these antibodies are produced by recombinant methods in Chinese hamster ovary (CHO) cells.
  • US Pat. No. 5,942,385 discloses a method for diagnosing metastatic cancer using VEGF (vascular endothelial growth factor) as a marker.
  • VEGF vascular endothelial growth factor
  • US Patent No. 6,171,796 discloses a method for diagnosing metastatic prostate cancer using transglutaminase or the like.
  • US Pat. No. 6,190,857 discloses a method for diagnosing prostate cancer using interleukin 8 or interleukin 10 as a biomarker.
  • the present inventors have made diligent efforts to discover novel biomarkers that can rapidly and accurately molecularly diagnose cancer. As a result, the present invention was completed by identifying that the discovered biomarker is a marker that can diagnose cancer and determine prognosis.
  • Another object of the present invention is to provide a method for detecting cancer markers in order to provide information necessary for diagnosis or prognosis of cancer.
  • the present invention provides an antibody or aptamer that specifically binds to a MEST protein, a cancer diagnosis comprising a nucleotide sequence encoding a MEST protein, a sequence complementary to the nucleotide sequence, or a fragment of the nucleotide.
  • kits for prognostic analysis are provided.
  • the present invention provides a method for detecting cancer through a method of detecting the expression of the nucleotide sequence of MEST in a biological sample of human in order to provide information necessary for cancer diagnosis or prognosis.
  • the present inventors have made diligent efforts to discover novel molecular markers capable of molecular diagnosis of cancer quickly and accurately.
  • the molecular markers described were found to be able to diagnose cancer early and determine the prognosis. It was.
  • the markers of the present invention are markers with greatly improved accuracy and reliability as markers for cancer.
  • the MEST gene is present on human chromosome 7, mRNA sequences for isoforms ⁇ and ⁇ are known in NM_002402.2, NM_177524.1 and 3.NM_177525.1, respectively, and the protein sequences are NP_002393.2 and NP_803490. 1 and NP_803491.1, respectively.
  • biological sample refers to any sample obtained from a human body or a mammal, such as, but not limited to, a cell, tissue, urine, saliva, blood, plasma or serum sample.
  • the present invention is a cancer marker capable of diagnosing cancer from a sample of cells or tissues.
  • the molecular marker of the present invention may be an indicator for the development and development of cancer, and may be used for the diagnosis of the development and development of cancer.
  • the molecular marker of the present invention is breast cancer (breast cancer), liver cancer (liver cancer), bladder cancer (bradder cancer), brain cancer (brain cancer), cervical cancer, colorectal cancer (colorectal) cancer, esophageal cancer, gallbladder cancer, head and neck cancer, kidney cancer, lung cancer (small and / or non-small cell) (lung cancer (small and / or non) small cells), melanoma, ovarian cancer, ovary (germ cell cancer), prostate cancer, pancreatic cancer, penile cancer, Skin cancer, soft-tissue sarcoma, squamous cell carcinomas, stomach cancer, testicular cancer, thyroid cancer and uterine cancer Used to predict or diagnose one or more cancers selected from the group, more preferably breast cancer, It is used to predict or diagnose liver cancer or both very accurately.
  • the present invention is characterized by being able to diagnose metastatic cancer very accurately.
  • the marker of the invention is a marker for diagnosing metastatic cancer.
  • diagnosis refers to determining the susceptibility of an object to a particular disease or condition, determining whether an object currently has a particular disease or condition, a particular disease or condition Determining the prognosis (eg, identifying a metastatic or metastatic cancer state, determining the stage of the cancer, or determining the responsiveness of the cancer to treatment), or therametrics (eg, treatment) Monitoring the state of the object to provide information about its efficacy.
  • prognosis eg, identifying a metastatic or metastatic cancer state, determining the stage of the cancer, or determining the responsiveness of the cancer to treatment
  • therametrics eg, treatment
  • prognosis in the context of the present invention includes the prediction in terms of the process of disease progression, in particular, the degree of disease remission, disease regeneration, tumor recurrence, metastasis and death.
  • the prognosis in the present invention means the possibility that the disease of a cancer patient will be cured.
  • the present invention can be carried out by immunoassay (ie, antigen-antibody reaction).
  • immunoassay ie, antigen-antibody reaction
  • the antibody or aptamer specifically binds to the cancer marker of the present invention described above.
  • the antibody used in the present invention is a polyclonal or monoclonal antibody, preferably a monoclonal antibody.
  • Antibodies may be commonly used in the art, such as fusion methods (Kohler and Milstein, European Journal of Immunology, 6: 511-519 (1976)), recombinant DNA methods (US Pat. No. 4,816,56) Or phage antibody library methods (Clackson et al, Nature , 352: 624-628 (1991) and Marks et al, J. Mol. Biol. , 222: 58, 1-597 (1991)).
  • fusion methods Kelman and Milstein, European Journal of Immunology, 6: 511-519 (1976)
  • recombinant DNA methods US Pat. No. 4,816,56
  • phage antibody library methods Click-binds et al, Nature , 352: 624-628 (1991) and Marks et al, J. Mol. Biol. , 222: 58, 1-597 (1991
  • the present invention can be used to diagnose cancer by performing according to conventional immunoassay methods.
  • the immunoassay format may include radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, immunohistochemical staining, enzyme-linked immunosorbant assay (ELISA), capture-ELISA, inhibition or hardwood analysis, sandwich analysis, flow cytometry, immunoassay. Including but not limited to fluorescent staining and immunoaffinity purification.
  • the immunoassay or method of immunostaining is described in Enzyme Immunoassay, E. T.
  • an antibody labeled with a radioisotope detects a marker molecule of the invention. It can be used to.
  • certain embodiments of the present invention comprise the steps of: (i) coating an unknown cell sample lysate to be analyzed on the surface of a solid substrate; (ii) reacting said cell lysate with an antibody against a marker as a primary antibody; (iii) reacting the resultant of step (ii) with the secondary antibody to which the enzyme is bound; And (iv) measuring the activity of the enzyme.
  • Suitable as the solid substrate are hydrocarbon polymers (eg polystyrene and polypropylene), glass, metal or gel, most preferably microtiter plates.
  • Enzymes bound to the secondary antibody include, but are not limited to, enzymes catalyzing color reaction, fluorescence, luminescence or infrared reaction, for example, alkaline phosphatase, ⁇ -galactosidase, hose Radish peroxidase, luciferase and cytochrome P450.
  • alkaline phosphatase When alkaline phosphatase is used as an enzyme binding to the secondary antibody, bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol-AS-B1-phosphate (naphthol-AS) Chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis) when colorimetric substrates such as -B1-phosphate) and enhanced chemifluorescence (ECF) are used, and horse radish peroxidase is used -N-methylacridinium nitrate), resorupin benzyl ether, luminol, Amflex red reagent (10-acetyl-3,7-dihydroxyphenoxazine), p-phenylenediamine-HCl and pyrocatechol (HYR), TMB (tetramethylbenzidine), AB
  • certain embodiments of the invention comprise (i) coating an antibody against a marker of the invention as a capturing antibody on the surface of a solid substrate; (ii) reacting the capture antibody with the sample; (iii) reacting the product of step (ii) with a detecting antibody that has a label that generates a signal and that specifically reacts with the MEST protein; And (iv) measuring the signal resulting from the label.
  • the detection antibody carries a label which generates a detectable signal.
  • the label may include chemicals (eg biotin), enzymes (alkaline phosphatase, ⁇ -galactosidase, horse radish peroxidase and cytochrome P450), radioactive substances (eg C14, I125, P32 and S35) , Fluorescent materials (eg, fluorescein), luminescent materials, chemiluminescent, and fluorescence resonance energy transfer (FRET).
  • chemicals eg biotin
  • enzymes alkaline phosphatase, ⁇ -galactosidase, horse radish peroxidase and cytochrome P450
  • radioactive substances eg C14, I125, P32 and S35
  • Fluorescent materials eg, fluorescein
  • luminescent materials eg, chemiluminescent
  • FRET fluorescence resonance energy transfer
  • Measurement of the final enzyme activity or signal in the ELISA method and the capture-ELISA method can be carried out according to various methods known in the art. Detection of these signals allows for qualitative or quantitative analysis of the markers of the invention. If biotin is used as a label, the signal can be easily detected with streptavidin and luciferin if luciferase is used.
  • an aptamer that specifically binds to the marker of the present invention may be used instead of the antibody.
  • Aptamers are oligonucleic acid or peptide molecules, the general contents of which are described in Bock LC et al., Nature 355 (6360): 5646 (1992); Hoppe-Seyler F, Butz K "Peptide aptamers: powerful new tools for molecular medicine”. J Mol Med. 78 (8): 42630 (2000); Cohen BA, Colas P, Brent R. "An artificial cell-cycle inhibitor isolated from a combinatorial library”. Proc Natl Acad Sci USA . 95 (24): 142727 (1998).
  • Cancer can be diagnosed by analyzing the final signal intensity by the above-described immunoassay process. That is, if the protein of the marker of the present invention is expressed high in a biological sample and the signal is stronger than that of the normal biological sample (eg, normal gastric tissue, blood, plasma or serum), the cancer is diagnosed.
  • the normal biological sample eg, normal gastric tissue, blood, plasma or serum
  • the kit of the present invention may further include other components in addition to the above components.
  • the kit of the present invention may optionally contain reagents necessary for PCR amplification, such as buffers, DNA polymerases (eg, Thermus aquaticus (Taq), Thermus thermophilus). (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis or thermally stable DNA polymerase obtained from Pyrococcus furiosus (Pfu)), DNA polymerase cofactors and dNTPs.
  • Kits of the invention can be prepared in a number of separate packaging or compartments containing the reagent components described above.
  • the kit of the invention may be a microarray.
  • the kit of the present invention is a gene amplification kit.
  • the probe is immobilized on the solid surface of the microarray.
  • the kit of the present invention is a gene amplification kit, it includes a primer.
  • the probe or primer used in the diagnostic kit of the present invention has a sequence complementary to the MEST nucleotide sequence.
  • the term “complementary” means having complementarity enough to selectively hybridize to the above-described nucleotide sequence under certain specific hybridization or annealing conditions.
  • the term “complementary” has a different meaning from the term perfectly complementary, and the primers or probes of the present invention may be capable of selectively hybridizing to the above-described nucleotide sequence so long as one or more mismatches ( mismatch) may have a nucleotide sequence.
  • primer refers to a single that can serve as an initiation point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerases) at suitable temperatures. -Refers to stranded oligonucleotides. Suitable lengths of primers are typically 15-30 nucleotides, although varying with various factors, such as temperature and the use of the primer. Short primer molecules generally require lower temperatures to form hybrid complexes that are sufficiently stable with the template.
  • the sequence of the primer does not need to have a sequence that is completely complementary to some sequences of the template, and it is sufficient to have sufficient complementarity within a range capable of hybridizing with the template to perform the primer-specific function. Therefore, the primer in the present invention does not need to have a sequence that is perfectly complementary to the above-described nucleotide sequence as a template, and it is sufficient to have sufficient complementarity within a range capable of hybridizing to the gene sequence and acting as a primer.
  • the design of such primers can be easily carried out by those skilled in the art with reference to the above-described nucleotide sequence, for example, by using a program for primer design (eg, PRIMER 3 program).
  • probe refers to a linear oligomer of natural or modified monomers or linkages, includes deoxyribonucleotides and ribonucleotides, and can specifically hybridize to a target nucleotide sequence, naturally Present or artificially synthesized. Probes of the invention are preferably single chain and oligodioxyribonucleotides.
  • nucleotide sequence of the marker of the present invention which should be referred to when constructing the primer or probe, can be confirmed in GenBank using the accession number of the above-described MEST, and the primer or probe can be designed with reference to this sequence.
  • the probe is used as a hybridizable array element and is immobilized on a substrate.
  • Preferred gases include suitable rigid or semi-rigid supports such as membranes, filters, chips, slides, wafers, fibers, magnetic beads or nonmagnetic beads, gels, tubing, plates, polymers, microparticles and capillaries.
  • Said hybridization array element is arranged and immobilized on said gas. This immobilization is carried out by chemical bonding methods or by covalent binding methods such as UV.
  • the hybridization array element can be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and can also be bonded by UV at the polylysine coating surface.
  • the hybridization array element may be coupled to the gas through a linker (eg, ethylene glycol oligomer and diamine).
  • sample DNA applied to the microarray of the present invention can be labeled and hybridized with array elements on the microarray.
  • Hybridization conditions can vary. Detection and analysis of the degree of hybridization can be carried out in various ways depending on the labeling substance.
  • the cancer diagnostic kit of the present invention can be carried out based on hybridization.
  • a probe having a sequence complementary to the nucleotide sequence of the marker of the present invention described above is used.
  • Cancer can be determined by hybridization-based analysis using a probe hybridized to the nucleotide sequence of the marker of the present invention described above.
  • the label of the probe can provide a signal that allows detection of hybridization, which can be linked to oligonucleotides.
  • Suitable labels include fluorophores (eg, fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia), chromophores, chemilumines, magnetic particles, radioisotopes Elements (P32 and S35), mass labels, electron dense particles, enzymes (alkaline phosphatase or horseradish peroxidase), cofactors, substrates for enzymes, heavy metals (eg gold) and antibodies, streptavidin, biotin And hapten with specific binding partners such as digoxigenin and chelating groups.
  • fluorophores eg, fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia)
  • chromophores eg, chromophores
  • Labeling is carried out in a variety of ways conventionally practiced in the art, such as nick translation methods, random priming methods (Multiprime DNA labeling systems booklet, "Amersham” (1989)) and chination methods (Maxam & Gilbert, Methods). in Enzymology , 65: 499 (1986)). Labels provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetric, X-ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, hybridization high frequency, nanocrystals.
  • the nucleic acid sample to be analyzed may be prepared using mRNA obtained from various biological samples, and preferably, may be prepared using mRNA obtained from stomach tissue cells.
  • the hybridization reaction-based assay may be performed by labeling the cDNA to be analyzed instead of the probe.
  • suitable hybridization conditions can be determined in a series of procedures by an optimization procedure. This procedure is carried out by a person skilled in the art in order to establish a protocol for use in the laboratory. For example, conditions such as temperature, concentration of components, hybridization and wash times, buffer components and their pH and ionic strength depend on various factors such as probe length and GC amount and target nucleotide sequence. Detailed conditions for hybridization are described by Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And MLM Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. NY (1999).
  • the higher stringency conditions were hybridized to 65 ° C. in 0.5 M NaHPO 4 , 7% sodium dodecyl sulfate (SDS), 1 mM EDTA, and at 0.1 ⁇ standard saline citrate / 0.1% SDS. It means to wash at 68 °C conditions.
  • high stringency conditions mean washing at 48 ° C. in 6 ⁇ SSC / 0.05% sodium pyrophosphate.
  • Low stringency means washing at 42 ° C. conditions, for example, at 0.2 ⁇ SSC / 0.1% SDS.
  • the hybridization signal coming out of the hybridization reaction is detected.
  • the hybridization signal can be performed by various methods, for example, depending on the type of label bound to the probe. For example, if the probe is labeled by an enzyme, the substrate of the enzyme can be reacted with the hybridization product to confirm hybridization.
  • Combinations of enzymes / substrates that can be used include peroxidase (eg horseradish peroxidase) and chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium Nitrate), resoruppin benzyl ether, luminol, amplex red reagent (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS , 2'-Azine-di [3-ethyl benzthiazoline sulfonate]), o-phenylenediamine (OPD) and naphthol / pyronine; Alkaline phosphatase with bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT
  • the method for detecting the cancer marker of the present invention is carried out on the basis of hybridization, specifically (i) hybridizing a probe having a sequence complementary to the nucleotide sequence of the marker of the present invention to a nucleic acid sample; (ii) detecting whether the hybridization reaction occurs.
  • the hybridization signal By analyzing the strength of the hybridization signal by the hybridization process, it is possible to determine whether cancer. In other words, if the hybridization signal to the nucleotide sequence of the marker of the present invention in the sample is stronger than the normal sample (eg, normal gastric tissue cells), the cancer is diagnosed.
  • the human cancer diagnostic kit of the present invention may be a gene amplification kit.
  • amplification refers to a reaction that amplifies a nucleic acid molecule.
  • Various amplification reactions have been reported in the art, which include polymerase chain reaction (PCR) (US Pat. Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcriptase-polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al.
  • PCR polymerase chain reaction
  • RT-PCR reverse transcriptase-polymerase chain reaction
  • PCR is the best known nucleic acid amplification method, and many modifications and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR, and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR.
  • real-time PCR differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction (inverse polymerase) chain reaction (IPCR), vectorette PCR and thermal asymmetric interlaced PCR (TAIL-PCR) have been developed for specific applications.
  • DD-PCR differential display PCR
  • RACE rapid amplification of cDNA ends
  • IPCR inverse polymerase chain reaction
  • TAIL-PCR thermal asymmetric interlaced PCR
  • a gene amplification reaction is performed to examine the expression level of the nucleotide sequence of the marker of the present invention. Since the present invention analyzes the expression level of the nucleotide sequence of the marker of the present invention, the mRNA amount of the nucleotide sequence of the marker of the present invention is examined in a sample (eg, gastric tissue, blood, plasma, serum or urine) of the analyte. The degree of expression of the nucleotide sequence of the marker of the present invention is determined.
  • the present invention performs a gene amplification reaction using primers that bind to mRNA or cDNA as a template of mRNA in a sample.
  • RNA total RNA is isolated from the sample. Isolation of total RNA can be carried out according to conventional methods known in the art. See Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001); Tesniere. , C. et al., Plant Mol. Biol. Rep. , 9: 242 (1991); Ausubel, FM et al., Current Protocols in Molecular Biology , John Willey & Sons (1987); and Chomczynski, P. et al , Anal.Biochem. 162: 156 (1987)).
  • TRIzol can be used to easily isolate total RNA in cells.
  • cDNA is synthesized from the isolated mRNA and amplified. Since the total RNA of the present invention is isolated from human samples, it has a poly-A tail at the end of the mRNA, and cDNA can be easily synthesized using oligo dT primer and reverse transcriptase using this sequence characteristic ( PNAS USA, 85: 8998 (1988); Libert F, et al., Science , 244: 569 (1989); and Sambrook, J. et al., Molecular Cloning.A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001). Then, the synthesized cDNA is amplified by a gene amplification reaction.
  • Primers used in the present invention are hybridized or annealed to one site of the template to form a double chain structure.
  • Conditions for nucleic acid hybridization suitable for forming such a double-chain structure include Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization , A Practical Approach, IRL Press, Washington, DC (1985).
  • Various DNA polymerases can be used for amplification of the present invention and include “Clenow” fragments of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase.
  • the polymerase is a thermostable DNA polymerase obtained from various bacterial species, which include Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu). Include.
  • the amplification reaction When carrying out the polymerization reaction, it is preferable to provide an excess amount of components necessary for the reaction to the reaction vessel.
  • components required for the amplification reaction means an amount such that the amplification reaction is not substantially limited to the concentration of the components. It is desired to provide cofactors such as Mg 2+ , dATP, dCTP, dGTP and dTTP to the reaction mixture such that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, the buffer ensures that all enzymes are close to optimal reaction conditions. Thus, the amplification process of the present invention can be carried out in a single reactant without changing conditions such as addition of reactants.
  • Annealing in the present invention is carried out under stringent conditions allowing specific binding between the target nucleotide sequence and the primer.
  • Stringent conditions for annealing are sequence-dependent and vary depending on the surrounding environmental variables.
  • the cDNA of the nucleotide sequence of the marker of the present invention thus amplified is analyzed by a suitable method to investigate the expression level of the nucleotide sequence of the marker of the present invention.
  • the degree of expression of the nucleotide sequence of the marker of the present invention is examined by gel electrophoresis of the amplification reaction product described above, and by observing and analyzing the resulting band.
  • cancer is diagnosed when the expression of the nucleotide sequence of the marker of the present invention in a biological sample is higher than that of a normal sample (eg, normal cells, blood, plasma or serum).
  • the cancer marker detection method of the present invention is carried out based on an amplification reaction using cDNA, specifically (i) performing an amplification reaction using a primer annealed to the nucleotide sequence of the marker of the present invention; And (ii) analyzing the product of the amplification reaction to determine the expression level of the nucleotide sequence of the marker of the present invention.
  • Markers of the invention are biomolecules that are highly expressed in cancer. High expression of such markers can be measured at the mRNA or protein level.
  • the term "high expression” as used herein refers to a case where the expression level of the nucleotide sequence of interest in the sample to be investigated is high compared to the normal sample.
  • expression assay methods commonly used in the art, such as RT-PCR methods or ELISA methods (Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)
  • expression analysis it means a case where the expression is analyzed to be many.
  • the marker of the present invention is expressed 2-10 times higher than normal cells, it is determined as "high expression" in the present invention and cancer.
  • the present invention provides a kit for cancer diagnosis or prognosis analysis.
  • MEST in the present invention is a marker with greatly improved accuracy and reliability as a marker for cancer.
  • this marker is excellent in accuracy and reliability as a marker for breast cancer and liver cancer.
  • MEST in the present invention shows very good accuracy and reliability in markers for metastatic cancer.
  • the present invention can determine the early diagnosis and prognosis of cancer very specifically from biological samples (e.g., cells or tissues) using MESTs whose expression is specifically increased only in cells and tissues of cancer patients. have.
  • biological samples e.g., cells or tissues
  • HMLE refers to human normal mammary epithelial cells, Hs578T (human breast adenocarcinoma cell), MDA-MB-231 (human breast adenocarcinoma cell), MDA-MB-468 (human breast adenocarcinoma cell), Human breast ductal carcinoma cells (BT-474), human breast adenocarcinoma cells (SKBR3), and human breast ductal carcinoma cells (ZR75-1) represent breast cancer cell lines.
  • Figure 2 is the result of confirming the MEST overexpressed from human breast cancer (carcinoma) tissue using quantitative RT-PCR in the present invention.
  • Figure 4a-4d shows the epithelial markers and mesenchymal markers RT-PCR using HMLE cells and HMLE-MEST expressing cells to investigate whether the expression of MEST induces EMT (Epithelial-Mesenchmal transition) phenomenon in the present invention
  • EMT Epithelial-Mesenchmal transition
  • Figure 5 is the result of confirming the presence position in the cells of MEST in the present invention by immunofluorescence staining method.
  • Figure 6 shows the results confirmed by immunofluorescence staining for epithelial markers and mesenchymal marker proteins expressed in HMLE cells and HMLE-MEST expressing cells in the present invention.
  • Figure 7a-7b shows the expression pattern of MEST protein and expression of MEST and proliferation of MEST protein using 4T1 cell line, a mouse breast cancer cell line with high expression of MEST gene, to investigate the functional role of MEST gene in breast tumor growth in the present invention. This is the result of checking the relevance.
  • Chang liver cell refers to human normal mammary epithelial cells
  • SNU-354, SNU-182, SNU-387, SNU-368, SNU-449, and SNU-761 cells refer to cell lines derived from liver cancer patients.
  • human hepatocellular carcinoma cell refers to human hepatocellular carcinoma cell.
  • FIG. 9 is a graph showing the results of confirming the expression of MEST from human normal hepatocytes and invasive liver cancer cell lines using quantitative real time (PCR).
  • % used to indicate the concentration of a particular substance is solid / solid (weight / weight)%, solid / liquid (weight / volume)%, and Liquid / liquid is (volume / volume)%.
  • the mouse 4T1 cell line was cultured with 10% heat-fluorinated fetal bovine serum in DMEM (Gibco, Grand Island, NY) containing high concentrations of sugar, and DMEM / F12 for immortalized human mammary epithelial cells (HMLE).
  • 10% heat-fluorinated fetal bovine serum was added to DMEM / F12 containing insulin (10 ⁇ g / ml), human epidermal growth factor (10 ng / ml), hydrocortisone (0.5 ⁇ g / ml)
  • the medium was incubated at 37 ° C. and 5% CO 2 conditions.
  • anti-rabbit HRP-link IgG 7074
  • anti-rabbit HRP-link IgG 7076
  • anti-mouse IgG were purchased from Cell Signaling Techonology
  • anti-E-cadherin (61181)
  • Anti-N-cadherin 610920
  • anti-CD24 555428)
  • anti-Cd44 5554708
  • anti-fibronectin fibronectin, 610077
  • anti- ⁇ -catenin 13-9700
  • Anti- ⁇ -catenin 13-8400
  • anti-Twist1 sc-6269
  • anti-V5 RV125
  • Mito Tracker M7512
  • goat serum 50062Z
  • ProLong Gold antifade reagent with DAPI P36935)
  • ViraPower Lentiviral packing mix K4975-00
  • Chang's normal and human liver cancer cell lines, SNU182, SNU354, SNU368, SNU387, SNU449 and SNU761 cell lines, were supplemented with 10% heat-inactivated fetal bovine serum in DMEM (Gibco, Grand Island, NY) containing high glucose The medium was incubated at 37 ° C. and 5% CO 2 conditions.
  • mouse breast cancer cell lines (NMuMG, 67NR and 4T1 cell lines), human breast cancer cell lines (Hs578T, MDA-MB-231, MDA-MB-468, BT-474, SKBR3 and ZR75-1), human liver normal cell lines (Chang liver cells), SNU-182, SNU-387 and SNU-449 cell lines were purchased from the American Type Culture Collection (ATCC), and SNU-354, SNU-368 and SNU-761 cell lines were purchased from the Korea Cell Line Bank.
  • ATCC American Type Culture Collection
  • SNU-354, SNU-368 and SNU-761 cell lines were purchased from the Korea Cell Line Bank.
  • RNA isolated from patient-derived normal and breast cancer tissues was supplied from Gangnam Severance Hospital, and tissues were purchased from Imgenex.
  • RNAi oligonucleotides synthesized sense and antisense of 5 ⁇ l (100 mM) oligonucleotide (5'-CTAGACC CCACATCAGTACTCCATATTT CTCGAG AAATATGGAGTACTGATGTGG TTTTTGGAAAC -3 ') and (5'-CTAGACC GCCCTTGATTTCTTAGGCTTT TTCAAGAGA AAAGCCTAAGAAATCAAGGGC TTTTTGGAAAC -3')
  • annealing was performed at 95 ° C. for 2 minutes, followed by cooling at 72 ° C., and then slowly cooled to room temperature.
  • mice using buffer 25 mM Hepes, pH 7.5), 150 mM NaCl, 1% Triton X-100, 10% Glycerol, 5 mM EDTA, Protease Inhibitor Mixture (Complete, Roche, Gipf-Oberfrick, Switzerland)
  • Breast cancer cell line NMuMG, 67NR, 4T1 cell
  • MEST overexpressing cell line HMLE, HMLE-MEST
  • MEST knockdown (4T1-siMEST) Chang liver cell
  • SNU-182 SNU-387, SNU-449 Total protein was extracted from SNU-354, SNU-368 and SNU-761 cell lines.
  • Each extracted protein was isolated using an SDS / PAGE gel, transferred using a poly (vinylidene difluoride) membrane and then attached to a primary antibody using polyclonal or monoclonal antisera (anti-MEST ( HPA005623): Sigma-Aldrich). Secondary antibodies were then attached using horseradish peroxidase (HRP) -conjugated anti-rabbit and anti-mouse IgG. According to the manufacturer's instructions (Pierce) chemiluminescence was confirmed.
  • HRP horseradish peroxidase
  • DMEM Dulbecco's modified Eagle's madium
  • forward primer TGCCCAGAAAATGAAAAAGG
  • reverse primer GTGTATGTGGCAATGCGTTC
  • forward primer ACAGTGGCCACCTACAAAGG
  • reverse primer CCGAGATGGGGTTGATAATG
  • forward primer GAGAACTTTGCCGTTGAAGC
  • reverse primer GCTTCCTGTAGGTGGCAATC were used.
  • Snail used a forward primer: CCTCCCTGTCAGATGAGGAC, a reverse primer: CCAGGCTGAGGTATTCCTTG for Snail, and a forward primer: GGGGAGAAGCCTTTTTCTTG, a reverse primer: TCCTCATGTTTGTGCAGGAG for Twist-1, and a forward primer: CGACGAGCTGGACTCCAAG, reverse primer: CCTCCATCCTCCAGACCGA was used, and for Twist-2, forward primer: CAGAGCGACGAGATGGACAA, reverse primer: CACACGGAGAAGGCGTAGC.
  • cDNA was used for PCR using SYBR-Green Master PCR Mix and Taqman Master PCR Mix (Applied Biosystems). PCR and data collection were performed using the 7900HT Fast Real-Time PCR System (Applied Biosystems). All quantifications were leveled with endogenous control 18S.
  • Ct-Cc Relative amounts of each target gene are expressed as 2 (Ct-Cc) (Ct and Cc show mean titer cycle differences after leveling to 18S) and MEST (Hs00853380_g1) and 18S (Hs03003631_g1) probes for quantitative Taqman RT-PCR was purchased from Applied Biosystems.
  • HMLE and HMLE-MEST cells 2.5 x 10 4 HMLE and HMLE-MEST cells were seeded on 4-well Lab-TekII chamber slides, and after 24 hours the cells were washed twice with phosphate-buffered saline (PBS). Then, the mixture was immobilized for 30 minutes by adding 2% paraformaldehyde and 0.1% Triton X 100 to PBS, and then washed three times with PBS, followed by addition of blocking solution (10% goat serum in PBS), followed by incubation. It was.
  • PBS phosphate-buffered saline
  • the cells were incubated with the primary antibody for 2 hours, washed three times with PBS with 0.1% Tween-20, and incubated with the secondary antibody and DAPI for 2 hours, followed by a slowfade light antifade kit (Slowfade Light Antifade). Kit, Invitrogen) was mounted. All samples were taken using an immunofluorescence microscope under the same conditions.
  • tissue microarray slide After deparaffinization and rehydration of the tissue microarray slide (IMX-364), heat-induced epitope retrieval was performed using 0.01 mol / L citric acid buffer (pH 6.0). Intrinsic peroxidase activity was treated for 10 minutes with 3% hydrogen peroxide. Non-specific binding was done using 5% goat serum for 1 hour, and slides were incubated with Mest antibody for 12 hours at 4 ° C. and images were taken using LSAB2 system (DakoCytomation).
  • the MEST gene is a newly identified imprinted gene that forms two isoforms, and the two isoforms are reported to be produced by spliced variant isoform mRNA.
  • Isoform 1 long isoform
  • isoform 2 short isoform
  • isoform 2 is found to have no 9 residues at the N-terminus. have.
  • isoform 2 is reported to be expressed in some non-placental organs, the association with cancer is not reported yet.
  • E-cadherin mRNA An important mechanism for the loss of E-cadherin mRNA is due to direct transcription inhibition by the transcription factors E12, E47, SIP1, slug, Goosecoid, and twist.
  • these transcription factors were overexpressed in various human tumors, and have been shown to be closely associated with tumor invasion or metastasis. Therefore, the expression of transition factors involved in inducing EMT due to the expression of MEST was confirmed using quantitative RT-PCR. As a result, the expression of sanil showed no significant difference in HMLE cells and HMLE-MEST cells.
  • Slug was investigated to increase by about 1.8 times by MEST, it was confirmed that the increase in the case of Twist-1 and Twist-2 (Fig. 6).
  • MEST was estimated to have mitochondrial targeting peptide and mitochondrial protein when using TargetP, iPsort and MitoProt program, and therefore, the intracellular location of MEST was confirmed.
  • Mest staining using Mito-Tracker was not found in the mitochondria and was found not in the nucleus. Therefore, MEST seems to be located in the cytoplasm (Fig. 7).
  • siRNAs were designed for the coding region of the mouse MEST gene, and for the control, siRNAs were designed for the luciferase DNA that did not match the known mouse genes.
  • AKT is a serine / threonine kinase and belongs to the cAMP-dependent protein-kinase A / protein kinase G / protein kinase C super-family. Activation of AKT is induced during the introduction of signals by growth factors or insulin, and has been reported to be involved in many intracellular processes such as cell growth and survival, glucose metabolism and transcriptional regulation.
  • the expression of the MEST gene was confirmed using human liver cancer cell lines. As a result, it was confirmed that the expression of MEST is overexpressed compared to normal Chang liver cells used as a control in liver cancer cell line (Fig. 10).
  • MEST gene expression was overexpressed in mouse and human breast cancer cell lines compared to human normal mammary epithelial cells (HMLE) in breast cancer cell lines, and it was also confirmed that this expression of MEST was stronger in high metastatic breast cancer cell lines. .
  • HMLE human normal mammary epithelial cells

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Analytical Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Pathology (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Oncology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Hospice & Palliative Care (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

본 발명은 암 진단 또는 예후 분석용 키트에 관한 것이다. 본 발명에서의 MEST는 암에 대한 마커로서의 정확성 및 신뢰도가 크게 개선된 마커이다. 특히, 본 마커는 유방암과 간암에 대한 마커로서의 정확성 및 신뢰도가 우수하다. 본 발명에서의 MEST는 전이암에 대한 마커에 있어서 매우 우수한 정확성과 신뢰도를 나타낸다. 또한, 본 발명은 암 환자의 세포 및 조직에서만 특이적으로 발현이 증가되는 MEST을 이용하여 생물학적 시료(예컨대, 혈액이나 혈청)로부터 매우 특이적으로 암의 조기 진단 및 예후를 판정할 수 있다.

Description

암에 대한 바이오마커 및 이를 이용한 암 진단
본 발명은 암에 대한 바이오마커 및 이를 이용한 암 진단에 관한 것이다.
암 진단의 연구는 암의 치료 연구와 함께 분자생물학 및 의학계의 초미의 관심사이다. 그러나, 수 많은 암 진단에 관한 연구가 있었음에도 불구하고, 현재까지 외과적 수술 없이 확실성을 갖고 암을 진단할 수 있는 방법은 개발되어 있지 않은 상태이다. 암 진단 연구는 분자생물학의 발전에 의해, 특히 유전적 결함 및 바이오 마커에 초점이 맞추어져 이루어졌다 (Dong et al., Science, 268:884(1995)). 예를 들어, 라스 (ras) 발암 유전자의 변형 (transformation), HER-2/neu의 증폭, p53의 결손 및 변이, DCC의 결손 및 BRCA1의 변이 등에 관한 암 진단 연구가 있어 왔다.
악성 종양 (암)은 미국에서 심장 질환에 이어 두 번째로 높은 사망 원인이다 (문헌 [Boring et al., CA Cancer J. Clin. 43:7 (1993)]). 암은 정상 조직으로부터 유래된 비정상적인 세포 또는 신생물 세포 (증식하여 종양 덩어리를 형성함) 수의 증가, 이들 신생물성 종양 세포의 인접 조직으로의 침입 및 전이라고 일컬어지는 과정에 의해 혈액 또는 림프계를 통해 결국 국부 림프절 및 원위부로 확산되는 악성 세포의 발생을 특징으로 한다. 암성 상태의 세포는 정상 세포라면 성장하지 못하는 조건에서도 성장한다. 암 자체는 상이한 정도의 침입성 및 공격성을 특징으로 하는 매우 다양한 형태로 나타난다.
암의 진단 및 치료에 효과적인 세포 표적을 발견하기 위한 시도에서, 연구자들은 1종 이상의 정상적인 비-암성 세포(들)에 비해 1종 이상의 특정 유형(들)의 암세포 표면에서 특이적으로 발현되는 막횡단 폴리펩티드, 또 다르게는 막결합 폴리펩티드를 확인하고자 하였다. 흔히, 이러한 막결합 폴리펩티드는 비-암성 세포의 표면에 비해 암세포의 표면에서 더 풍부하게 발현된다. 이러한 종양-관련 세포 표면 상의 항원 폴리펩티드를 확인하여 항체-기재 요법을 통해 암세포를 특이적으로 표적화하여 파괴할 수 있었다. 이와 관련하여, 항체-기재 요법은 특정 암의 치료에 매우 효과적인 것으로 입증되었음을 유의한다. 예를 들면, 헤르셉틴 (HERCEPTIN; 등록상표) 및 리툭산 (RITUXAN; 등록상표) (제넨테크, 인크. (Genentech, Inc.; 미국 캘리포니아주 사우쓰 샌프란시스코소재) 제품)은 각각 유방암 및 비-호지킨 림프종을 치료하는데 성공적으로 사용되어 온 항체이다. 보다 구체적으로, 헤르셉틴 (등록상표)은 인간 상피 성장 인자 수용체 2 (HER2) 원종양유전자 (proto-oncogene)의 세포외 도메인에 선택적으로 결합하는, 재조합 DNA-유래의 인간화된 모노클로날 항체이다. HER2 단백질의 과다발현은 원발성 유방암의 25 내지 30％에서 관찰된다. 리툭산 (등록상표)은 정상 B 림프구 및 악성 B 림프구의 표면에서 발견되는 CD20 항원에 대해 제시되는, 유전자 조작된 키메라 쥐과동물/인간 모노클로날 항체이다. 이들 두 항체는 모두 차이니즈 햄스터 난소 (CHO) 세포에서 재조합 방법에 의해 제조된다.
한편, 유전적 결함은 암 환자를 완전하게 진단할 수 없었고, 정상인에서도 포지티브한 결과를 보이는 경우가 많았으며, 대부분은 의심되는 조직의 직접적인 샘플링을 요구하는 문제점이 있다.
암의 진단과 관련된 특허로서, 미합중국 특허 제 5,942,385호는 VEGF (vascular endothelial growth factor)를 마커로 이용하는 전이성 암의 진단방법을 개시하고 있다. 미합중국 특허 제 6,171,796호는 트랜스글루타미나아제 등을 이용한 전이성 전립선 암의 진단방법을 개시하고 있다. 미합중국 특허 제 6,190,857호는 인터루킨 8 또는 인터루킨 10을 바이오마커로 이용하는 전립선 암의 진단방법을 개시하고 있다.
따라서, 암을 신속하고 정확하게 분자 진단할 수 있는 신규한 바이오마커의 개발의 필요성이 대두되고 있다.
본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 발명자들은 암을 신속하고 정확하게 분자 진단할 수 있는 신규한 바이오마커를 발굴하고자 예의 연구 노력하였다. 그 결과, 발굴된 바이오마커가 암을 진단할 수 있고 예후를 판정할 수 있는 마커임을 규명함으로써 본 발명을 완성하게 되었다.
따라서, 본 발명의 목적은 암의 진단 또는 예후 분석용 키트를 제공하는 데 있다.
본 발명의 다른 목적은 암의 진단 또는 예후에 필요한 정보를 제공하기 위하여 암 마커를 검출하는 방법을 제공하는 데 있다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
본 발명의 일 양태에 따르면, 본 발명은 MEST 단백질에 특이적으로 결합하는 항체 또는 앱타머, MEST 단백질을 코딩하는 뉴클레오타이드 서열, 상기 뉴클레오타이드 서열에 상보적인 서열 또는 상기 뉴클레오타이드의 단편을 포함하는 암 진단 또는 예후 분석용 키트를 제공한다.
본 발명의 다른 양태에 따르면, 본 발명은 암 진단 또는 예후에 필요한 정보를 제공하기 위하여 인간의 생물학적 시료에 있는 MEST의 뉴클레오타이드 서열의 발현을 검출하는 방법을 통해 암을 검출하는 방법을 제공한다.
본 발명자들은 암을 신속하고 정확하게 분자 진단할 수 있는 신규한 분자 마커를 발굴하고자 예의 연구 노력하였으며, 그 결과, 기술한 분자 마커가 암을 조기 진단할 수 있고, 예후를 판정할 수 있는 마커임을 규명하였다. 특히, 본 발명의 마커는 암에 대한 마커로서의 정확성과 신뢰도가 크게 개선된 마커이다.
MEST 유전자는 인간 7번 염색체상에 존재하며, 이소폼 α와 β에 대한 mRNA 서열은 NM_002402.2, NM_177524.1 및 3.NM_177525.1에 각각 공지되어 있으며, 단백질 서열은 NP_002393.2, NP_803490.1 및 NP_803491.1에 각각 공지되어 있다.
본 발명에서 용어“생물학적 시료”는 인체 나 포유동물로부터 얻어지는 모든 시료, 예컨대, 세포, 조직, 오줌, 타액, 혈액, 혈장 또는 혈청 시료를 의미하며, 이에 제한되지 않는다.
본 발명의 바람직한 구현예에 따르면, 본 발명은 세포 또는 조직의 시료부터 암을 진단할 수 있는 암 마커이다.
본 발명의 분자 마커는 암의 발생 및 발전에 대한 지표가 될 수 있으며, 암의 발생 및 발전의 진단에 이용될 수 있다.
본 발명의 바람직한 구현 예에 따르면, 본 발명의 분자마커는 유방암(breast cancer), 간암(liver cancer), 방광암(bladder cancer), 뇌암(brain cancer), 자궁경부암(cervical cancer), 대장암(colorectal cancer), 식도암(esophageal cancer), 담낭암(gallbladder cancer), 두경부암(head and neck cancer), 신장암(kidney cancer), 폐암(소세포 및/또는 비-소세포)(lung cancer (small and/or non-small cell)), 흑색종(melanoma), 암(ovarian cancer), 생식세포암(ovary (germ cell) cancer), 전립선암(prostate cancer), 췌장암(pancreatic cancer), 음경암(penile cancer), 피부암(skin cancer), 연조직 육종(soft-tissue sarcoma), 편평상피세포암(squamous cell carcinomas), 위암(stomach cancer), 고환암(testicular cancer), 갑상선암(thyroid cancer) 및 자궁암(uterine cancer)으로 이루어진 군으로부터 선택된 하나 이상의 암을 예측 또는 진단하는데 이용되며, 보다 바람직하게는 유방암, 간암 또는 이의 모두를 매우 정확하게 예측 또는 진단하는데 이용된다.
또한, 본 발명은 전이성 암을 매우 정확하게 진단할 수 있는 특징을 가진다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 마커는 전이성 암을 진단하는 마커이다.
본 발명의 명세서에서 용어 “진단”은 특정 질병 또는 질환에 대한 한 객체의 감수성(susceptibility)을 판정하는 것, 한 객체가 특정 질병 또는 질환을 현재 가지고 있는 지 여부를 판정하는 것, 특정 질병 또는 질환에 걸린 한 객체의 예후(prognosis)(예컨대, 전-전이성 또는 전이성 암 상태의 동정, 암의 단계 결정 또는 치료에 대한 암의 반응성 결정)를 판정하는 것, 또는 테라메트릭스(therametrics)(예컨대, 치료 효능에 대한 정보를 제공하기 위하여 객체의 상태를 모니터링 하는 것)을 포함한다.
본 발명의 명세서에서 용어 "예후"는 질병의 진행 가능성 과정, 특히, 질병의 차도, 질병의 재생, 종양 재발, 전이 및 죽음 가능성 측면에서의 예측을 포함한다. 바람직하게는, 본 발명에서의 예후는 암 환자의 질병이 완치될 가능성을 의미한다.
본 발명의 바람직한 구현 예에 따르면, 본 발명은 면역분석(immunoassay) 방식, 즉 항원-항체 반응 방식으로 실시될 수 있다. 이 경우, 상술한 본 발명의 암 마커에 특이적으로 결합하는 항체 또는 앱타머를 이용하여 실시된다.
본 발명에서 이용되는 항체는 폴리클로날 또는 모노클로날 항체이며, 바람직하게는 모노클로날 항체이다. 항체는 당업계에서 통상적으로 실시되는 방법들, 예를 들어, 융합 방법(Kohler and Milstein, European Journal of Immunology, 6:511-519(1976)), 재조합 DNA 방법(미국 특허 제4,816,56호) 또는 파아지 항체 라이브러리 방법(Clackson et al, Nature, 352:624-628(1991) 및 Marks et al, J. Mol. Biol., 222:58, 1-597(1991))에 의해 제조될 수 있다. 항체 제조에 대한 일반적인 과정은 Harlow, E. and Lane, D., Using Antibodies: A Laboratory Manual, Cold Spring Harbor Press, New York, 1999; Zola, H., Monoclonal Antibodies: A Manual of Techniques, CRC Press, Inc., Boca Raton, Florida, 1984; 및 Coligan , CURRENT PROTOCOLS IN IMMUNOLOGY, Wiley/Greene, NY, 1991에 상세하게 기재되어 있으며, 상기 문헌들은 본 명세서에 참조로서 삽입된다. 예를 들어, 단일클론 항체를 생산하는 하이브리도마 세포의 제조는 불사멸화 세포주를 항체-생산 림프구와 융합시켜 이루어지며, 이 과정에 필요한 기술은 당업자에게 잘 알려져 있으며 용이하게 실시할 수 있다. 폴리클로날 항체는 단백질 항원을 적합한 동물에게 주사하고, 이 동물로부터 항혈청을 수집한 다음, 공지의 친화성(affinity) 기술을 이용하여 항혈청으로부터 항체를 분리하여 얻을 수 있다.
본 발명의 방법을 항체 또는 앱타머를 이용하여 실시하는 경우, 본 발명은 통상적인 면역분석 방법에 따라 실시하여 암을 진단하는 데 이용될 수 있다.
이러한 면역분석은 종래에 개발된 다양한 정량적 또는 정성적 면역분석 프로토콜에 따라 실시될 수 있다. 상기 면역분석 포맷은 방사능면역분석, 방사능면역침전, 면역침전, 면역조직화학염색, ELISA (enzyme-linked immunosorbant assay), 캡처-ELISA, 억제 또는 경재 분석, 샌드위치 분석, 유세포 분석(flow cytometry), 면역형광염색 및 면역친화성 정제를 포함하지만, 이에 한정되는 것은 아니다. 상기 면역분석 또는 면역염색의 방법은 Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay(ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J.M. ed., Humana Press, NJ, 1984; 및 Ed Harlow and David Lane, Using Antibodies:A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999에 기재되어 있으며, 상기 문헌은 본 명세서에 참조로서 삽입된다.
예를 들어, 본 발명의 방법이 방사능면역분석 방법에 따라 실시되는 경우, 방사능동위원소(예컨대, C14, I125, P32 및 S35)로 레이블링된 항체가 본 발명의 마커 분자를 검출하는 데 이용될 수 있다.
본 발명의 방법이 ELISA 방식으로 실시되는 경우, 본 발명의 특정 실시 예는 (i) 분석하고자 하는 미지의 세포 시료 분해물을 고체 기질의 표면에 코팅하는 단계; (ii) 일차항체로서의 마커에 대한 항체와 상기 세포 분해물을 반응시키는 단계; (iii) 상기 단계 (ii)의 결과물을 효소가 결합된 이차항체와 반응시키는 단계; 및 (iv) 상기 효소의 활성을 측정하는 단계를 포함한다.
상기 고체 기질로 적합한 것은 탄화수소 폴리머(예컨대, 폴리스틸렌 및 폴리프로필렌), 유리, 금속 또는 젤이며, 가장 바람직하게는 마이크로타이터 플레이트이다.
상기 이차항체에 결합된 효소는 발색반응, 형광반응, 발광반응 또는 적외선 반응을 촉매하는 효소를 포함하나, 이에 한정되지 않으며, 예를 들어, 알칼린 포스파타아제, β-갈락토시다아제, 호스 래디쉬 퍼옥시다아제, 루시퍼라아제 및 사이토크롬 P450을 포함한다. 상기 이차항체에 결합하는 효소로서 알칼린 포스파타아제가 이용되는 경우에는, 기질로서 브로모클로로인돌일 포스페이트 (BCIP), 니트로 블루 테트라졸리움 (NBT), 나프톨-AS-B1-포스페이트 (naphthol-AS-B1-phosphate) 및 ECF (enhanced chemifluorescence)와 같은 발색반응 기질이 이용되고, 호스 래디쉬 퍼옥시다아제가 이용되는 경우에는 클로로나프톨, 아미노에틸카바졸, 디아미노벤지딘, D-루시페린, 루시게닌 (비스-N-메틸아크리디늄 니트레이트), 레소루핀 벤질 에테르, 루미놀, 암플렉스 레드 시약(10-아세틸-3,7-디하이드록시페녹사진), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2,2‘-Azine-di[3-ethylbenzthiazoline sulfonate]), o-페닐렌디아민 (OPD) 및 나프톨/파이로닌, 글루코스 옥시다아제와 t-NBT (nitroblue tetrazolium) 및 m-PMS (phenzaine methosulfate)과 같은 기질이 이용될 수 있다.
본 발명의 방법이 캡처-ELISA 방식으로 실시되는 경우, 본 발명의 특정 실시 예는 (i) 포획항체(capturing antibody)로서 본 발명의 마커에 대한 항체를 고체 기질의 표면에 코팅하는 단계; (ii) 포획항체와 시료를 반응시키는 단계; (iii) 상기 단계 (ii)의 결과물을 시그널을 발생시키는 레이블이 결합되어 있고, MEST 단백질에 특이적으로 반응하는 검출항체(detecting antibody)와 반응시키는 단계; 및 (iv) 상기 레이블로부터 발생하는 시그널을 측정하는 단계를 포함한다.
상기 검출 항체는 검출 가능한 시그널을 발생시키는 레이블을 가지고 있다. 상기 레이블은 화학물질 (예컨대, 바이오틴), 효소 (알칼린 포스파타아제, β-갈락토시다아제, 호스 래디쉬 퍼옥시다아제 및 사이토크롬 P450), 방사능물질(예컨대, C14, I125, P32 및 S35), 형광물질 (예컨대, 플루오레신), 발광물질, 화학발광물질 (chemiluminescent) 및 FRET (fluorescence resonance energy transfer)을 포함하나, 이에 한정되는 것은 아니다. 다양한 레이블 및 레이블링 방법은 Ed. Harlow and David Lane, Using Antibodies:A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999에 기재되어 있다.
상기 ELISA 방법 및 캡처-ELISA 방법에서 최종적인 효소의 활성 측정 또는 시그널의 측정은 당업계에 공지된 다양한 방법에 따라 실시될 수 있다. 이러한 시그널이 검출은 본 발명의 마커의 정성적 또는 정량적 분석을 가능하게 한다. 만일, 레이블로서 바이오틴이 이용된 경우에는 스트렙타비딘으로, 루시퍼라아제가 이용된 경우에는 루시페린으로 시그널을 용이하게 검출할 수 있다.
본 발명의 다른 변형 예에 따르면, 항체 대신에 본 발명의 마커에 특이적으로 결합하는 앱타머를 이용할 수 있다. 앱타머는 올리고핵산 또는 펩타이드 분자이며, 앱타머의 일반적인 내용은 Bock LC et al., Nature 355 (6360):5646 (1992); Hoppe-Seyler F, Butz K "Peptide aptamers: powerful new tools for molecular medicine". J Mol Med. 78(8):42630(2000); Cohen BA, Colas P, Brent R . "An artificial cell-cycle inhibitor isolated from a combinatorial library". Proc Natl Acad Sci USA. 95(24):142727 (1998) 에 상세하게 개시되어 있다.
상술한 면역분석 과정에 의한 최종적인 시그널의 세기를 분석함으로써, 암을 진단할 수 있다. 즉, 생물학적 시료에서 본 발명의 마커의 단백질이 고발현 되어 시그널이 정상 생물학적 시료(예컨대, 정상 위조직, 혈액, 혈장 또는 혈청) 보다 강하게 나오는 경우에는 암으로 진단된다.
본 발명의 키트는 상기한 성분 이외에도, 다른 성분들을 추가적으로 포함할 수 있다. 예를 들어, 본 발명의 키트가 PCR 증폭 과정에 적용되는 경우에는, 본 발명의 키트는 선택적으로, PCR 증폭에 필요한 시약, 예컨대, 완충액, DNA 중합효소 (예컨대, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis 또는 Pyrococcus furiosus (Pfu)로부터 수득한 열 안정성 DNA 중합효소), DNA 중합 효소 조인자 및 dNTPs를 포함할 수 있다. 본 발명의 키트는 상기한 시약 성분을 포함하는 다수의 별도 패키징 또는 컴파트먼트로 제작될 수 있다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 키트는 마이크로어레이일 수 있다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 키트는 유전자 증폭 키트이다.
본 발명의 키트가 마이크로어레이인 경우에는, 마이크로어레이의 고상표면에 프로브가 고정화 되어 있다. 본 발명의 키트가 유전자 증폭 키트인 경우에는 프라이머를 포함한다.
본 발명의 진단용 키트에서 이용되는 프로브 또는 프라이머는 MEST 뉴클레오티드 서열에 대하여 상보적인 서열을 갖는다. 본 명세서에서 용어“상보적(complementary)”은 어떤 특정한 혼성화(hybridization) 또는 어닐링 조건 하에서 상술한 뉴클레오티드 서열에 선택적으로 혼성화할 수 있을 정도의 상보성을 갖는 것을 의미한다. 따라서 용어 “상보적”은 용어 완전 상보적 (perfectly complementary)과는 다른 의미를 가지며, 본 발명의 프라이머 또는 프로브는 상술한 뉴클레오티드 서열에 선택적으로 혼성화할 수 있을 정도이면, 하나 또는 그 이상의 미스매치(mismatch) 염기서열을 가질 수 있다.
본 명세서에서 사용되는 용어 “프라이머”는 적합한 온도에서 적합한 완충액 내에서 적합한 조건 (즉, 4종의 다른 뉴클레오사이드 트리포스페이트 및 중합반응 효소) 하에서 주형-지시 DNA 합성의 개시점으로 작용할 수 있는 단일-가닥 올리고뉴클레오타이드를 의미한다. 프라이머의 적합한 길이는 다양한 요소, 예컨대, 온도와 프라이머의 용도에 따라 변화가 있지만 전형적으로 15-30 뉴클레오타이드이다. 짧은 프라이머 분자는 주형과 충분히 안정된 혼성 복합체를 형성하기 위하여 일반적으로 보다 낮은 온도를 요구한다.
프라이머의 서열은 주형의 일부 서열과 완전하게 상보적인 서열을 가질 필요는 없으며, 주형과 혼성화 되어 프라이머 고유의 작용을 할 수 있는 범위 내에서의 충분한 상보성을 가지면 충분하다. 따라서 본 발명에서의 프라이머는 주형인 상술한 뉴클레오티드 서열에 완벽하게 상보적인 서열을 가질 필요는 없으며, 이 유전자 서열에 혼성화되어 프라이머 작용을 할 수 있는 범위 내에서 충분한 상보성을 가지면 충분하다. 이러한 프라이머의 디자인은 상술한 뉴클레오티드 서열을 참조하여 당업자에 의해 용이하게 실시할 수 있으며, 예컨대, 프라이머 디자인용 프로그램(예: PRIMER 3 프로그램)을 이용하여 할 수 있다.
본 명세서에서 사용된 용어 “프로브”는 자연의 또는 변형된 모노머 또는 연쇄 (linkages)의 선형 올리고머를 의미하며, 디옥시리보뉴클레오타이드 및 리보뉴클레오타이드를 포함하고 타깃 뉴클레오타이드 서열에 특이적으로 혼성화 할 수 있으며, 자연적으로 존재하거나 또는 인위적으로 합성된 것이다. 본 발명의 프로브는 바람직하게는 단일쇄이며, 올리고디옥시리보뉴클레오타이드이다.
프라이머 또는 프로브 제작 시 참조하여야 하는 본 발명 마커의 뉴클레오타이드 서열은 상술한 MEST의 접근번호를 이용하여 GenBank에서 확인할 수 있으며, 이 서열을 참조하여 프라이머 또는 프로브를 디자인할 수 있다.
본 발명의 마이크로어레이에 있어서, 상기한 프로브는 혼성화 어레이 요소(hybridizable array element)로서 이용되며, 기체 (substrate) 상에 고정화된다. 바람직한 기체는 적합한 견고성 또는 반-견고성 지지체로서, 예컨대, 막, 필터, 칩, 슬라이드, 웨이퍼, 파이버, 자기성 비드 또는 비자기성 비드, 겔, 튜빙, 플레이트, 고분자, 미소입자 및 모세관을 포함한다. 상기한 혼성화 어레이 요소는 상기의 기체 상에 배열되고 고정화 된다. 이와 같은 고정화는 화학적 결합 방법 또는 UV와 같은 공유 결합적 방법에 의해 실시된다. 예를 들어, 상기 혼성화 어레이 요소는 에폭시 화합물 또는 알데히드기를 포함하도록 변형된 글래스 표면에 결합될 수 있고, 또한 폴리라이신 코팅 표면에서 UV에 의해 결합될 수 있다. 또한, 상기 혼성화 어레이 요소는 링커(예: 에틸렌 글리콜 올리고머 및 디아민)를 통해 기체에 결합될 수 있다.
한편, 본 발명의 마이크로어레이에 적용되는 시료 DNA는 표지(labeling)될 수 있고, 마이크로어레이상의 어레이 요소와 혼성화된다. 혼성화 조건은 다양하게 할 수 있다. 혼성화 정도의 검출 및 분석은 표지 물질에 따라 다양하게 실시될 수 있다.
본 발명의 암 진단용 키트는 혼성화에 기초하여 실시할 수 있다. 이 경우, 상술한 본 발명의 마커의 뉴클레오티드 서열에 대하여 상보적인 서열을 가지는 프로브가 이용된다.
상술한 본 발명의 마커의 뉴클레오티드 서열에 혼성화 되는 프로브를 이용하여 혼성화-기초 분석을 하여 암 여부를 판단할 수 있다.
프로브의 표지는 혼성화 여부를 검출케 하는 시그널을 제공할 수 있으며, 이는 올리고뉴클레오타이드에 연결될 수 있다. 적합한 표지는 형광단 (예컨대, 플루오리신 (fluorescein), 피코에리트린 (phycoerythrin), 로다민, 리사민 (lissamine), 그리고 Cy3와 Cy5 (Pharmacia)), 발색단, 화학발광단, 자기입자, 방사능동위원소(P32 및 S35), 매스 표지, 전자밀집입자, 효소(알칼린 포스파타아제 또는 호스래디쉬 퍼옥시다아제), 조인자, 효소에 대한 기질, 중금속(예컨대, 금) 그리고 항체, 스트렙타비딘, 바이오틴, 디곡시게닌과 킬레이팅기와 같은 특정 결합 파트너를 갖는 햅텐을 포함하나, 이에 한정되는 것은 아니다. 표지는 당업계에서 통상적으로 실시되는 다양한 방법, 예컨대, 닉 트랜스레이션 (nick translation) 방법, 무작위 프라이밍 방법 (Multiprime DNA labelling systems booklet, "Amersham"(1989)) 및 카이네이션 방법 (Maxam & Gilbert, Methods in Enzymology, 65:499(1986))을 통해 실시될 수 있다. 표지는 형광, 방사능, 발색 측정, 중량 측정, X-선 회절 또는 흡수, 자기, 효소적 활성, 매스 분석, 결합 친화도, 혼성화 고주파, 나노크리스탈에 의하여 검출할 수 있는 시그널을 제공한다.
분석 대상이 되는 핵산 시료는 다양한 생물학적 시료(biosamples)에서 얻은 mRNA를 이용하여 제조할 수 있으며, 바람직하게는 위(stomach) 조직세포에서 얻은 mRNA를 이용하여 제조할 수 있다. 프로브 대신에 분석 대상이 되는 cDNA를 표지하여 혼성화 반응-기초 분석을 실시할 수도 있다.
프로브를 이용하는 경우, 프로브를 cDNA 분자와 혼성화시킨다. 본 발명에서, 적합한 혼성화 조건은 최적화 절차에 의하여 일련의 과정으로 결정될 수 있다. 이런 절차는 연구실에서 사용을 위한 프로토콜을 수립하기 위하여 당업자에 의하여 일련의 과정으로 실시된다. 예를 들어, 온도, 성분의 농도, 혼성화 및 세척 시간, 완충액 성분 및 이들의 pH 및 이온세기 등의 조건은 프로브의 길이 및 GC 양 및 타깃 뉴클레오타이드 서열 등의 다양한 인자에 의존한다. 혼성화를 위한 상세한 조건은 Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001); 및 M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y.(1999)에서 확인할 수 있다. 예를 들어, 상기 엄격조건 중에서 고 엄격조건은 0.5 M NaHPO4, 7% SDS(sodium dodecyl sulfate), 1 mM EDTA에서 65℃ 조건으로 혼성화하고, 0.1 x SSC(standard saline citrate)/0.1% SDS에서 68℃ 조건으로 세척하는 것을 의미한다. 또는, 고 엄격조건은 6 x SSC/0.05% 소듐 파이로포스페이트에서 48℃ 조건으로 세척하는 것을 의미한다. 저 엄격조건은 예를 들어, 0.2 x SSC/0.1% SDS에서 42℃ 조건으로 세척하는 것을 의미한다.
혼성화 반응 이후에, 혼성화 반응을 통하여 나오는 혼성화 시그널을 검출한다. 혼성화 시그널은 예컨대, 프로브에 결합된 표지의 종류에 따라 다양한 방법으로 실시할 수 있다. 예를 들어, 프로브가 효소에 의해 표지된 경우, 이 효소의 기질을 혼성화 반응 결과물과 반응시켜 혼성화 여부를 확인할 수 있다. 이용될 수 있는 효소/기질의 조합은, 퍼옥시다아제 (예컨대, 호스래디쉬 퍼옥시다아제)와 클로로나프톨, 아미노에틸카바졸, 디아미노벤지딘, D-루시페린, 루시게닌 (비스-N-메틸아크리디늄 니트레이트), 레소루핀 벤질 에테르, 루미놀, 암플렉스 레드 시약 (10-아세틸-3,7-디하이드록시페녹사진), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2,2‘-Azine-di[3-ethyl benzthiazoline sulfonate]), o-페닐렌디아민(OPD) 및 나프톨/파이로닌; 알칼린 포스파타아제와 브로모클로로인돌일 포스페이트(BCIP), 니트로 블루 테트라졸리움(NBT), 나프톨-AS-B1-포스페이트 (naphthol-AS-B1-phosphate) 및 ECF 기질; 글루코스 옥시다아제와 t-NBT (nitroblue tetrazolium) 및 m-PMS (phenzaine methosulfate) 등이다. 프로브가 금 입자로 표지된 경우에는 실버 나이트레이트를 이용하여 실버 염색 방법으로 검출할 수 있다. 따라서 본 발명의 암 마커를 검출하는 방법을 혼성화에 기초하여 실시하는 경우에는, 구체적으로 (i) 본 발명의 마커의 뉴클레오티드 서열에 대하여 상보적인 서열을 가지는 프로브를 핵산 시료에 혼성화시키는 단계; (ii) 상기 혼성화 반응 발생 여부를 검출하는 단계를 포함한다. 혼성화 과정에 의한 혼성화 시그널의 세기를 분석함으로써, 암 여부를 판단할 수 있다. 즉, 시료에서 본 발명의 마커의 뉴클레오티드 서열에 대한 혼성화 시그널이 정상 시료(예컨대, 정상 위 조직세포)보다 강하게 나오는 경우에는 암으로 진단된다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 인간의 암 진단용 키트는 유전자 증폭 키트일 수 있다.
본 명세서에 기재된 용어“증폭”은 핵산 분자를 증폭하는 반응을 의미한다. 다양한 증폭 반응들이 당업계에 보고되어 있으며, 이는 중합효소 연쇄반응(PCR)(미국 특허 제4,683,195, 4,683,202, 및 4,800,159호), 역전사-중합효소 연쇄반응(RT-PCR)(Sambrook 등, Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001)), Miller, H. I.(WO 89/06700) 및 Davey, C. 등(EP 329,822)의 방법, 리가아제 연쇄 반응(ligase chain reaction; LCR)(17, 18), Gap-LCR(WO 90/01069), 복구 연쇄 반응(repair chain reaction; EP 439,182), 전사-매개 증폭(transcription-mediated amplification; TMA, WO 88/10315), 자가 유지 염기서열 복제(self sustained sequence replication, WO 90/06995), 타깃 폴리뉴클레오티드 염기서열의 선택적 증폭(selective amplification of target polynucleotide sequences, 미국 특허 제6,410,276호), 컨센서스 서열 프라이밍 중합효소 연쇄 반응(consensus sequence primed polymerase chain reaction(CP-PCR), 미국 특허 제4,437,975호), 임의적 프라이밍 중합효소 연쇄 반응(arbitrarily primed polymerase chain reaction(AP-PCR), 미국 특허 제5,413,909호 및 제5,861,245호), 핵산 염기서열 기반 증폭(nucleic acid sequence based amplification(NASBA), 미국 특허 제5,130,238호, 제5,409,818호, 제5,554,517호, 및 제6,063,603호), 가닥 치환 증폭(strand displacement amplification)(21, 22) 및 고리-중재 항온성 증폭(loop-mediated isothermal amplification; LAMP)(23)를 포함하나, 이에 한정되지는 않는다. 사용 가능한 다른 증폭 방법들은 미국특허 제5,242,794, 5,494,810, 4,988,617호 및 미국 특허 제09/854,317호에 기술되어 있다.
PCR은 가장 잘 알려진 핵산 증폭 방법으로, 그의 많은 변형과 응용들이 개발되어 있다. 예를 들어, PCR의 특이성 또는 민감성을 증진시키기 위해 전통적인 PCR 절차를 변형시켜 터치다운(touchdown) PCR, 핫 스타트(hot start) PCR, 네스티드(nested) PCR 및 부스터(booster) PCR이 개발되었다. 또한, 실시간(real-time) PCR, 분별 디스플레이 PCR(differential display PCR: DD-PCR), cDNA 말단의 신속 증폭(rapid amplification of cDNA ends: RACE), 멀티플렉스 PCR, 인버스 중합효소 연쇄반응(inverse polymerase chain reaction: IPCR), 벡토레트(vectorette) PCR 및 TAIL-PCR(thermal asymmetric interlaced PCR)이 특정한 응용을 위해 개발되었다. PCR에 대한 자세한 내용은 McPherson, M.J., 및 Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000)에 기재되어 있으며, 그의 교시사항은 본 명세서에 참조로 삽입된다.
본 발명의 진단용 키트를 프라이머로 이용하여 실시하는 경우에는, 유전자 증폭 반응을 실시하여 본 발명의 마커의 뉴클레오티드 서열의 발현 정도를 조사한다. 본 발명은 본 발명의 마커의 뉴클레오티드 서열의 발현 정도를 분석하는 것이기 때문에, 분석 대상의 시료(예컨대, 위 조직, 혈액, 혈장, 혈청 또는 소변)에서 본 발명의 마커의 뉴클레오티드 서열의 mRNA 양을 조사하여 본 발명의 마커의 뉴클레오티드 서열의 발현 정도를 결정한다.
따라서 본 발명은 원칙적으로 시료 내의 mRNA를 주형으로 하고 mRNA 또는 cDNA에 결합하는 프라이머를 이용하여 유전자 증폭 반응을 실시한다.
mRNA를 얻기 위하여, 시료에서 총 RNA를 분리한다. 총 RNA를 분리하는 것은 당업계에 공지된 통상의 방법에 따라 실시될 수 있다(참조: Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001); Tesniere, C. et al., Plant Mol. Biol. Rep., 9:242(1991); Ausubel, F.M. et al., Current Protocols in Molecular Biology, John Willey & Sons(1987); 및 Chomczynski, P. et al., Anal. Biochem. 162:156(1987)). 예컨대, TRIzol을 이용하여 용이하게 세포내의 총 RNA를 분리할 수 있다. 이어, 분리된 mRNA로부터 cDNA를 합성하고, 이 cDNA를 증폭한다. 본 발명의 총 RNA는 인간의 시료로부터 분리되는 것이기 때문에, mRNA의 말단에는 폴리-A 테일을 갖고 있으며, 이러한 서열 특성을 이용한 올리고 dT 프라이머 및 역전사 효소를 이용하여 cDNA을 용이하게 합성할 수 있다(참조: PNAS USA, 85:8998(1988); Libert F, et al., Science, 244:569(1989); 및 Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001)). 이어, 유전자 증폭 반응을 통하여 합성된 cDNA를 증폭한다.
본 발명에 이용되는 프라이머는 주형의 한 부위에 혼성화 또는 어닐링되어, 이중쇄 구조를 형성한다. 이러한 이중쇄 구조를 형성하는 데 적합한 핵산 혼성화의 조건은 Joseph Sambrook, 등, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001) 및 Haymes, B. D., 등, Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985)에 개시되어 있다.
다양한 DNA 중합효소가 본 발명의 증폭에 이용될 수 있으며, E. coli DNA 중합효소 I의 “클레나우” 단편, 열안정성 DNA 중합효소 및 박테리오파아지 T7 DNA 중합효소를 포함한다. 바람직하게는, 중합효소는 다양한 박테리아 종으로부터 얻을 수 있는 열안정성 DNA 중합효소이고, 이는 Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, 및 Pyrococcus furiosus (Pfu)를 포함한다.
중합 반응을 실시할 때, 반응 용기에 반응에 필요한 성분들을 과량으로 제공하는 것이 바람직하다. 증폭 반응에 필요한 성분들의 과량은, 증폭반응이 성분의 농도에 실질적으로 제한되지 않는 정도의 양을 의미한다. Mg2+와 같은 조인자, dATP, dCTP, dGTP 및 dTTP를 원하는 증폭 정도가 달성될 수 있을 정도로 반응 혼합물에 제공하는 것이 요구된다. 증폭 반응에 이용되는 모든 효소들은 동일한 반응 조건에서 활성 상태일 수 있다. 사실, 완충액은 모든 효소들이 최적의 반응 조건에 근접하도록 한다. 따라서 본 발명의 증폭 과정은 반응물의 첨가와 같은 조건의 변화 없이 단일 반응물에서 실시될 수 있다.
본 발명에 있어서 어닐링은 타깃 뉴클레오타이드 서열과 프라이머 사이에 특이적 결합을 가능하게 하는 엄격조건 하에서 실시된다. 어닐링을 위한 엄격조건은 서열-의존적이며 주위 환경적 변수에 따라 다양하다.
이렇게 증폭된 본 발명의 마커의 뉴클레오티드 서열의 cDNA를 적합한 방법으로 분석하여 본 발명의 마커의 뉴클레오티드 서열의 발현 정도를 조사한다. 예를 들어, 상술한 증폭 반응 결과물을 젤 전기영동을 하고, 그 결과 형성되는 밴드를 관찰 및 분석함으로써 본 발명의 마커의 뉴클레오티드 서열의 발현 정도를 조사한다. 이러한 증폭 반응을 통하여, 생물학적 시료에서 본 발명 마커의 뉴클레오티드 서열의 발현이 정상 시료(예컨대, 정상 세포, 혈액, 혈장 또는 혈청)보다 높게 나오는 경우에는 암으로 진단된다.
따라서 본 발명의 암 마커의 검출 방법을 cDNA를 이용하는 증폭반응에 기초하여 실시하는 경우에는, 구체적으로 (i) 본 발명의 마커의 뉴클레오티드 서열에 어닐링되는 프라이머를 이용하여 증폭 반응을 실시하는 단계; 및 (ii) 상기 증폭 반응의 산물을 분석하여 본 발명의 마커의 뉴클레오티드 서열의 발현정도를 결정하는 단계를 포함한다.
본 발명의 마커는 암에서 고발현 되는 생체 분자이다. 이러한 마커의 고발현은 mRNA 또는 단백질 수준에서 측정될 수 있다. 본 명세서에서 사용되는 용어 “고발현”은 조사 대상의 시료에서의 대상이 되는 뉴클레오티드 서열의 발현 정도가 정상 시료와 비교하여 높은 경우를 의미한다. 예컨대, 당업계에서 통상적으로 이용되는 발현 분석 방법, 예컨대 RT-PCR 방법 또는 ELISA 방법(참조: Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001))에 따라 발현 분석을 한 경우, 발현이 많은 것으로 분석되는 경우를 의미한다. 예를 들어, 상술한 분석 방법에 따라 분석한 결과, 본 발명의 마커가 정상세포와 비교하여 2-10 배 정도 고발현 되는 경우, 본 발명에서의 “고발현”으로 판정하고 암으로 판정한다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(i) 본 발명은 암 진단 또는 예후 분석용 키트를 제공한다.
(ii) 본 발명에서의 MEST는 암에 대한 마커로서의 정확성 및 신뢰도가 크게 개선된 마커이다. 특히, 본 마커는 유방암과 간암에 대한 마커로서의 정확성 및 신뢰도가 우수하다.
(iii) 본 발명에서의 MEST는 전이암에 대한 마커에 있어서 매우 우수한 정확성과 신뢰도를 나타낸다.
(iv) 또한, 본 발명은 암 환자의 세포 및 조직에서만 특이적으로 발현이 증가되는 MEST을 이용하여 생물학적 시료(예컨대, 세포나 조직)로부터 매우 특이적으로 암의 조기 진단 및 예후를 판정할 수 있다.
도 1은 본 발명에서 마우스 및 인간 유방암 세포주로부터 MEST의 발현을 RT-PCR과 이뮤노블롯팅을 이용하여 확인한 결과이다. HMLE는 인간 정상 유방 상피세포주(human normal mammary epithelial cell)를 의미하며, Hs578T (human breast adenocarcinoma cell), MDA-MB-231 (human breast adenocarcinoma cell), MDA-MB-468 (human breast adenocarcinoma cell), BT-474 (human breast ductal carcinoma cell), SKBR3 (human breast adenocarcinoma cell), ZR75-1 (human breast ductal carcinoma cell)들로서 유방암세포주를 의미한다.
도 2는 본 발명에서 인간 유방 암(carcinoma) 조직으로부터 과발현되는 MEST를 정량적 RT-PCR을 이용하여 확인한 결과이다.
도 3은 본 발명에서 정상 유방 세포와 IDC(infiltrating duct carcinoma)로부터 발현되는 MEST 단백질을 면역조직화학염색법으로 확인한 결과이다.
도 4a-4d는 본 발명에서 MEST의 발현으로 인해 EMT (Epithelial-Mesenchmal transition)현상을 유도하는지를 조사하기 위해 HMLE 세포 및 HMLE-MEST 발현 세포을 이용하여 상피세포마커 및 중배엽(mesenchymal) 마커를 RT-PCR과 정략적 RT-PCT을 이용하여 확인한 결과이다.
도 5는 본 발명에서 MEST의 세포에서의 존재 위치를 면역형광염색법으로 확인한 결과이다.
도 6은 본 발명에서 HMLE 세포 및 HMLE-MEST 발현 세포에서 발현하는 상피세포마커 및 중배엽(mesenchymal) 마커 단백질들에 대하여 면역형광염색법으로 확인한 결과이다.
도 7a-7b는 본 발명에서 유방 종양 성장에 있어서 MEST 유전자의 기능적 역할을 규명하기 위해 MEST 유전자의 발현이 높은 마우스 유방암세포주인 4T1 세포주를 이용하여 MEST 단백질의 발현양상 및 MEST의 발현과 세포주의 증식과 관련성을 확인한 결과이다.
도 8은 본 발명에서 인간 정상 간세포주 및 간암 세포주로부터 MEST의 발현을 RT-PCR을 이용하여 확인한 결과이다. Chang liver cell은 인간 정상 간 상피세포주 (human normal mammary epithelial cell)를 의미하며, SNU-354, SNU-182, SNU-387, SNU-368, SNU-449, SNU-761 cell은 간암 환자 유래 세포주 (human hepatocellular carcinoma cell)을 의미한다.
도 9는 본 발명에서 인간 정상 간세포주 및 침투성 간암 세포주들로부터 MEST의 발현을 정량적 RT(real time)-PCR을 이용하여 확인한 결과를 그래프로 나타낸 것이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
본 명세서 전체에 걸쳐, 특정 물질의 농도를 나타내기 위하여 사용되는 “%“는 별도의 언급이 없는 경우, 고체/고체는 (중량/중량) %, 고체/액체는 (중량/부피) %, 그리고 액체/액체는 (부피/부피) %이다.
실험 재료 및 방법
세포 배양, 항체 및 시약
마우스 4T1 세포주는 고농도 당을 포함하는 DMEM(Gibco, Grand Island, NY)에 10% 열-불화시킨 우태아혈청이 첨가된 배지를 이용하였으며, HMLE (immortalized human mammary epithelial cells)의 경우 DMEM/F12, 인슐린(10 ㎍/㎖), 인간 EGF(epidermal growth factor, 10 ng/㎖), 하이드로코르티손(hydrocortisone, 0.5 ㎍/㎖)이 포함된 DMEM/F12에 10% 열-불화시킨 우태아혈청이 첨가된 배지를 이용하여 37℃ 및 5% CO2 조건에서 배양하였다. 항체 및 시약의 경우, 안티-래빗 HRP-링크 IgG (7074) 및 안티-래빗 HRP-링크 IgG (7076), 안티-마우스 IgG는 Cell Signaling Techonology사에서 구입하였고, 안티-E-cadherin(61181), 안티-N-cadherin(610920), 안티-CD24(555428), 안티-Cd44(555478), 안티-피브로넥틴(fibronectin, 610077)은 BD sciences사에서 구입하였고, 안티-β-catenin(13-9700), 안티-α-catenin(13-8400)은 Zymed사에서 구입하였으며, 안티-Twist1 (sc-6269)은 santa cruz technology사에서 구입하였고, 안티-V5(R96125), Mito Tracker(M7512), 염소 혈청(50062Z), ProLong Gold antifade reagent with DAPI (P36935) 및 ViraPower Lentiviral packing mix (K4975-00)는 Invitrogen사에서 구입하였다. 또한, 안티-β-actin(A1978), 안티-MEST (HPA005623)는 Sigma-Aldrich사에서 구입하였다. pFG12 렌티바이러스 벡터는 ADDGEGE사에서 구입하였다.
Chang 정상 간세포주 및 인간 간암 세포주인 SNU182, SNU354, SNU368, SNU387, SNU449 및 SNU761 세포주는 고농도 포도당을 포함하는 DMEM(Gibco, Grand Island, NY)에 10% 열-불화성화 시킨 우태아혈청이 첨가된 배지를 이용하여 37℃ 및 5% CO2 조건에서 배양하였다. 293T 세포, 마우스 유방암 세포주(NMuMG, 67NR 및 4T1 세포주), 인간 유방암 세포주(Hs578T, MDA-MB-231, MDA-MB-468, BT-474, SKBR3 및 ZR75-1), 인간 간 정상세포주(Chang liver cell), SNU-182, SNU-387 및 SNU-449 세포주는 ATCC (American Type Culture Collection)에서 구입하였으며, SNU-354, SNU-368 및 SNU-761 세포주은 한국세포주은행에서 구입하였다.
Human Tumor Samples.
환자 유래 정상 및 유방암 환자 조직에서 분리한 RNA는 강남 세브란스 병원으로부터 공급받았으며, 조직은 Imgenex 사로부터 구입하였다.
MEST siRNA 플라스미드
마우스 MEST에 대한 각각 두개씩의 siRNA-코딩 올리고는 마우스 지놈을 이용한 블라스트 서치를 이용하여 5’-GCCCTTGATTTCTTAGGCTTT-3’ 및 5’-CCACATCAGTACTCCATATTT-3’를 타겟으로 하는 MEST siRNA 올리고를 디자인하고 확인하였다. 헤어핀-타입 단일 RNAi 벡터를 만들기 위해 5 ㎕(100 mM)의 합성된 센스 및 안티센스 올리고뉴클레오타이드(5’-CTAGACCCCACATCAGTACTCCATATTTCTCGAG AAATATGGAGTACTGATGTGGTTTTTGGAAAC-3’) 및 (5’-CTAGACCGCCCTTGATTTCTTAGGCTTT TTCAAGAGAAAAGCCTAAGAAATCAAGGGCTTTTTGGAAAC-3’)를 1 ㎕의 1 M NaCl와 잘 혼합한 후, 95°C, 2분 동안 어닐링(annealing)을 시킨 후 72°C에서 쿨링(cooling) 시키고, 그 다음 다시 상온에 방치하여 천천히 식혔다. 마우스 MEST-siRNA 인서트를 pFG12 렌티-바이러스 벡터(Inhibiting HIV-1 infection in human T cells by lentiviral-mediated delivery of small interfering RNA against CCR5. Qin XF et al. (Proc Natl Acad Sci U S A. 2003 Jan 7. 100(1):183-8. Pubmed)).의 XbaI/XhoI 영역에 서브클로닝시켰다. 대조군 siRNA는 마우스 cDNA를 코딩하지 않는 것으로 알려진 시퀀스를 이용하여 제조하였다.
역전사-PCR 반응
모든 RNA는 Quizol 시약(Qiagen, Inc., Valencia, CA)를 이용하여 추출하였다. 역전사는 원 스탑 RT-PCR 키트(Qiagen, Inc., Valencia, CA)를 이용하여 실험하였다. 각각의 PCR 프로덕트는 1% 아가로오즈 젤을 이용하여 확인하였다. MEST RT-PCR을 위해 forward primer (5’-TCAGTGACAAACCGAGACCA-3’) 와 reverse primer 5’-CATCAGTCGTGTGAGGATGG-3’)를 프라이머로 이용하였다.
이뮤노블롯팅(Immunoblotting)
버퍼(25 mM Hepes (pH 7.5), 150 mM NaCl, 1% 트리톤 X-100, 10% 글리세롤, 5 mM EDTA, 프로테아제 인히비터 믹스쳐(Complete, Roche, Gipf-Oberfrick, Switzerland))를 이용하여 마우스 유방암 세포주(NMuMG, 67NR, 4T1 cell), MEST 과발현 세포주 (HMLE, HMLE-MEST), MEST 녹다운(4T1-siMEST), 간 정상 세포주(Chang liver cell), SNU-182, SNU-387, SNU-449, SNU-354, SNU-368 및 SNU-761 세포주에서 전체 단백질을 추출하였다. 추출된 각각의 단백질은 SDS/PAGE 젤을 이용하여 분리하였고, 폴리(vinylidene difluoride) 멤브레인을 이용하여 이동시킨 후 폴리클로날 또는 모노클로날 안티세라를 이용하여 1차 항체를 붙였다 (안티-MEST (HPA005623): Sigma-Aldrich). 그 다음, HRP(horseradish peroxidase)-콘쥬게이티드 안티-래빗 및 안티-마우스 IgG를 이용하여 2차 항체를 붙였다. 제조자의 지침에 따라(Pierce) 발광(chemiluminescence)을 확인하였다.
바이러스 생산물 및 타겟 세포의 감염
293T 세포에 트렌스퍼 벡터 플라스미드 pFG12-siLuc(empty) 또는 pFG12-마우스 siMEST 플라스미드를 ViraPower Lentiviral packing mix와 같이 혼합하여 칼슘 포스페이트 방법을 이용하여 트랜스팩션 시켰다. 상층액을 트랜스펙션 시킨 후 72시간 후에 0.45-㎛ 필터를 이용하여 회수하였다. 그 다음, SW28 로터를 이용하여 100,000 x g에서 원심분리 한 후 100 ㎕ 0.1% BSA(PBS) 버퍼에 현탁시켰다. 렌티바이러스 스톡은 사용 전까지 -80°C 저장고에 보관하였다. 세포 감염을 위해 마우스 유방암세포주인 4T1 세포주을 6-웰 플레이트(1 x 105 세포/웰)에 접종한 후 12시간 배양하였고 렌티바이러스는 폴리브렌(polybrene, 8 ㎍/㎖)이 포함된 2 ㎖ DMEM(Dulbecco's modified Eagle's madium)에 첨가한 후 30분 동안 1,500 rpm으로 원심분리 하였다. 감염시킨 후 24시간 후에, 폴리브렌-DMEM를 새로운 DMEM 배지로 교환한 후, 다른 어세이를 위하여 배양하였다.
정량적 RT-PCR
E-cadherin의 경우 정방향 프라이머: TGCCCAGAAAATGAAAAAGG, 역방향 프라이머: GTGTATGTGGCAATGCGTTC를 이용하였고, N-cadherin의 경우 정방향 프라이머: ACAGTGGCCACCTACAAAGG, 역방향 프라이머: CCGAGATGGGGTTGATAATG를 이용하였으며, 피브로넥틴의 경우 정방향 프라이머: CAGTGGGAGACCTCGAGAAG, 역방향 프라이머: TCCCTCGGAACATCAGAAAC를 이용하였고, 비벤틴의 경우 정방향 프라이머: GAGAACTTTGCCGTTGAAGC, 역방향 프라이머: GCTTCCTGTAGGTGGCAATC를 이용하였다. 또한, EMT 유발 전사 인자의 활성을 보기 위해 Snail의 경우 정방향 프라이머: CCTCCCTGTCAGATGAGGAC, 역방향 프라이머: CCAGGCTGAGGTATTCCTTG를 이용하였고 Slug의 경우 정방향 프라이머: GGGGAGAAGCCTTTTTCTTG, 역방향 프라이머: TCCTCATGTTTGTGCAGGAG를 이용하였고, Twist-1의 경우 정방향 프라이머: CGACGAGCTGGACTCCAAG, 역방향 프라이머: CCTCCATCCTCCAGACCGA를 이용하였으며, Twist-2의 경우 정방향 프라이머: CAGAGCGACGAGATGGACAA, 역방향 프라이머: CACACGGAGAAGGCGTAGC를 이용하였다.
총 RNA는 RNeasy 미니 키트(Qiagen)를 이용하여 분리하였고, cDNA를 만들기 위해 헥사-뉴클레오타이드 믹스(hexa-nucleotide Mix, Roche)를 이용하여 만들었다. 결과적으로 cDNA는 SYBR-그린 마스터 PCR 믹스 및 Taqman 마스터 PCR 믹스(Applied Biosystems)를 이용하여 PCR에 이용하였다. PCR 및 데이터 수집은 7900HT 패스트 리얼-타임 PCR 시스템(Applied Biosystems)을 이용하였다. 모든 정량은 내재성(endogenous) 대조구 18S로 평준화 시켰다. 각 타겟 유전자의 상대적인 양은 2(Ct-Cc) (Ct와 Cc는 18S로 평준화시킨 후 평균 역가 사이클 차이를 나타냄)로 표시하였으며, 정량적 Taqman RT-PCR을 위한 MEST(Hs00853380_g1)와 18S (Hs03003631_g1) 프로브는 Applied Biosystems 사에서 구입하였다.
면역형광법(Immunofluorescence)
2.5 x 104개의 HMLE 및 HMLE-MEST세포를 4-웰 Lab-TekII 챔버 슬라이드에 씨딩(seeding) 한 후, 24시간 후에 세포를 PBS(phosphate-buffered saline)로 2회 세척하였다. 그 다음, PBS에 2% 파라포름알데히드 및 0.1% 트리톤 X 100을 첨가하여 30분 동안 고정화 시킨 후, 다시 PBS로 3회 세척 과정을 거쳐 블록킹 용액(10% goat serum in PBS)을 첨가한 후 인큐베이션하였다. 블록킹 후 2시간 동안 1차 항체와 함께 인큐베이션시킨 후 0.1% Tween-20이 첨가된 PBS로 3회 세척하였으며, 2차 항체 및 DAPI로 2시간 동안 배양시킨 후 슬로페이드 라이트 안티페이드 키트(Slowfade Light Antifade Kit, Invitrogen)를 이용하여 마운팅하였다. 모든 샘플은 동일한 조건으로 면역형광 현미경을 이용하여 이미지를 촬영하였다.
면역조직화학(Immunohistochemistry)
조직 마이크로어레이 슬라이드(IMX-364)를 탈파라핀화 및 재수화 시킨 후에 0.01 mol/ℓ 시트르산 버퍼(pH 6.0)를 이용하여 열-유도 에피토브 검색(heat-induced epitope retrieval)을 실시하였다. 내재성 퍼옥시다아제 활성은 3% 과산화수소를 이용하여 10분 동안 처리하였다. 비특이적인 결합은 1시간 동안 5% 염소 혈청을 이용하였으며, 슬라이드를 4°C에서 12시간 동안 Mest 항체를 이용하여 배양시킨 후 LSAB2 시스템(DakoCytomation)을 이용하여 이미지를 촬영하였다.
실험 결과
인간 유방암 세포주에서의 MEST 유전자의 발현
MEST 유전자는 새롭게 확인된 임프린티드 유전자(imprinted gene)로서 두개의 이소폼을 형성하며, 두 개의 이소폼들은 스플라이스드 변이체 이소폼 mRNA(spliced variant isoform mRNA)에 의해 만들어지는 것으로 보고되고 있다. 이소폼 1(long isoform)은 뇌, 골격근, 신장, 인간 장기, 부신, 혀, 심장, 피부 및 태반등에서 발현되며, 이소폼 2(short isoform)는 N-말단에서 9개의 잔기가 없는 것으로 조사되고 있다. 또한, 이소폼 2이 몇 가지 비-태반 기관등에서 발현되고 있는 것으로 보고 있지만 아직까지 암과의 연관성은 보고되고 있지 않은 실정이다.
따라서, MEST 유전자의 발현과 암과의 연관성을 확인하기 위해 인간 유방암세포주들을 이용하여 MEST 유전자의 발현을 확인하였다. 도 1에서 보는 바와 같이, MEST의 발현이 유방암 세포주에서 HMLE(human normal mammary epithelial cell)과 비교시 과발현되어 있는 것을 확인하였으며, 유방암 세포주들에서 그 발현이 더 강한 것을 확인하였다.
또한, MEST 유전자의 발현이 임상적 유방암 샘플에서 어떤 병리학적 표현형(phenotype)과 연관이 있는지를 확인하기 위해 17명의 환자로부터 얻은 침투성(invasive) 인간 유방암 조직으로부터 RNA를 분리하였다. 환자의 정상 조직 및 암조직에서의 MEST 유전자의 발현은 크게 차이가 나는 것을 확인하였다. 17명의 환자 암샘플 중 16명의 환자 암샘플에서 MEST 발현이 최저 2배 이상에서 최고 96배 이상으로 크게 증가하는 것으로 확인되었다. 즉, MEST의 발현을 조사한 환자 중 94% 이상의 환자에서 과발현되어 있는 것으로 조사되었다(도 2). 그러나, MEST 이소폼인 MESTb의 발현은 유방암 환자 샘플에서는 검출 되지 않았다.
이러한 결과들을 바탕으로 57개의 유방암 환자 조직을 MEST 항체를 이용하여 면역조직화학을 실시하였다.
정상 유방 샘플의 경우 MEST 항체에 의해 아주 약하게 염색된 반면 IDC(infiltrating duct carcinoma)의 경우 MEST 항체로 염색된 강도에 따라 분류한 결과 -/+ sample은 5개, ++ sample은 14개, +++ sample은 26개로 대부분의 유방암 환자 조직에서 MEST가 강하게 발현되는 것을 확인하였다(도 3).
MEST 발현과 CSC (cancer stem cell)과의 연관성 및 EMT (Epithelial-Mesenchmal transition) 유도
E-cadherin mRNA의 상실에 대한 중요한 기작은 전사 인자인 E12, E47, SIP1, slug, Goosecoid, twist등에 의한 직접적인 전사 억제에 기인한다. 또한, 이러한 전사 인자들은 다양한 인간 종양에서 과발현되어 있는 것으로 조사되었으며, 종양 침투 또는 전이등과 밀접한 연관성을 보여주고 있다. 따라서 MEST의 발현으로 인한 EMT 현상을 유도함에 있어 관여되는 전이 인자들의 발현을 정량적 RT-PCR을 이용하여 확인하였다. 그 결과, sanil의 발현은 HMLE 세포 및 HMLE-MEST 세포에서는 크게 발현 차이를 보이지 않았다. 하지만, Slug의 경우 MEST에 의해 1.8배 정도 증가하는 것으로 조사되었으며, Twist-1와 Twist-2의 경우 크게 증가하는 것을 확인하였다(도 6).
본 연구에서 MEST의 경우 TargetP, iPsort 및 MitoProt 프로그램을 이용하였을 때, 추정의 미토콘드리아 타겟팅 펩타이드를 가지고 있으며 미토콘드리아 단백질인 것으로 예상되었으며, 이에 따라서 MEST의 세포내 위치를 확인하였다. 그 결과, Mest의 경우 Mito-Tracker를 이용하여 염색한 결과 미토콘드리아에 위치하지 않았으며, 핵에도 위치하지 않는 것으로 확인되었다. 따라서 MEST의 경우 세포질에 위치하는 것으로 보인다(도 7).
다음으로 MEST의 발현으로 인해 EMT현상을 유도하는지를 조사하기 위하여, HMLE 세포 및 HMLE-MEST 세포을 이용하여 상피세포 마커 및 중배엽 마커를 면역염색하였다. 그 결과, MEST의 발현으로 인해 상피세포 마커인 E-cadherin, α- 및 β-catenin의 발현이 감소하는 것을 확인하였으며, 중배엽 마커인 피브로넥틴 및 N-cadherin의 발현이 증가하는 것을 확인하였다. 또한, 이러한 EMT현상을 유발하는 전사인자 Twist-1의 면역염색시 MEST의 발현으로 인해 더 강하게 염색되는 것을 확인하였다(도 8).
MEST 발현에 의한 종양 성장 및 종양세포 생존률
유방 종양 성장에 있어서 MEST 유전자의 기능적 역할을 규명하기 위하여, MEST 유전자의 발현이 높은 마우스 유방암세포주인 4T1 세포를 이용하여 MEST 발현을 녹다운(knockdown)을 시키는 siRNA기법을 이용하였다. 이를 위해 마우스 MEST 유전자의 코딩 영역에 대한 siRNA를 디자인하였으며, 대조구의 경우 알려져 있는 마우스 유전자와 매치가 되지 않는 루시퍼라아제 DNA에 대한 siRNA를 디자인하였다.
siRNA에 감염된 4T1 세포에서 MEST mRNA와 단백질의 발현을 조사한 결과, 대조구와 비교시 siRNA로 감염된 4T1 세포에서 MEST mRNA와 단백질의 발현이 크게 감소하는 것을 확인하였다(도 9). 그 다음, MEST 발현을 녹다운시켰을 때 세포 증식에 어떠한 영향을 미치는지는 조사하였다. si-MEST-발현 4T1 세포의 경우 4T1 세포 발현 대조구-siRNA의 성장와 비교시 현저히 감소하는 것을 확인하였다. AKT는 세린/트레오닌 키나아제로 cAMP-의존 프로테인-키나아제 A/프로테인 키나아제 G/프로테인 키나아제 C 슈퍼-패밀리에 속한다. AKT의 활성화는 성장 인자나 인슐린에 의한 시그날 도입과정에서 유도되는 것으로 세포 성장 및 생존과 글루코오스 대사 및 전사 조절과 같은 많은 세포내 과정에 관여하는 것으로 보고 되고 있다.
또한, PI3K에 의해 세린 308과 세린 473 위치에서 포스포릴레이션(phosphorylation)에 의해 활성화되는 것으로 조사되었으며, 이러한 활성화로 인해 세포 성장, 생존 및 아팝토시스(apoptosis)에 중요한 역할을 할 뿐 만 아니라 많은 다운스트림 프로-아팝토시스 프로테인 타겟의 연속적인 세포질 한정(localization)을 유도하는 것으로 보고되고 있다. MEST 과발현으로 인한 AKT의 활성화를 통하여 유방암 성장 및 생존을 유지시켜며, 아팝토시스에서 중요한 역할을 담당할 것으로 예상되어진다.
인간 간암 세포주에서의 MEST 유전자의 발현
MEST 유전자의 발현과 간암과의 연관성을 확인하기 위해, 인간 간암 세포주들을 이용하여 MEST 유전자의 발현을 확인하였다. 그 결과, MEST의 발현이 간암 세포주에서 대조구로 사용한 정상 Chang 간 세포와 비교시 과발현되는 것으로 확인되었다(도 10).
또한, MEST 유전자의 발현이 임상적 간 종양 샘플에서 어떤 병리학적 표현형과 연관이 있는지를 확인하기 위해 31명의 환자로부터 얻은 침투성 인간 간 종양 조직로부터 RNA를 분리하였다. 그 결과, 환자의 정상 조직 및 종양 조직에서 MEST 유전자의 발현이 크게 차이가 나는 것을 확인하였다(도 11). 뿐 만 아니라, 31명의 환자 종양 샘플중 20명의 환자 종양 샘플에서 MEST 발현이 최저 2배 이상에서 최고 44배 이상으로 크게 증가한 것을 확인하였다. 즉, MEST의 발현을 조사한 환자 중 65% 이상의 환자에서 과발현 되어 있는 것으로 조사되었다.
검토
본 실험을 통해 MEST 유전자의 발현과 암과의 연관성을 확인하였다. MEST의 발현이 유방암 세포주에서 HMLE(human normal mammary epithelial cell)과 비교시 마우스 및 인간 유방암 세포주에서 과발현되어 있는 것을 확인하였으며, 또한 이러한 MEST 발현은 고 전이성 유방암 세포주들에서 그 발현이 더 강한 것을 확인하였다.
또한, MEST 유전자의 발현이 임상적 유방 종양 샘플에서 어떤 병리학적 표현과 연관이 있는지를 확인한 결과, MEST의 발현을 조사한 환자 중 94% 이상의 환자에서 과발현 되어 있는 것을 확인하였으며, 이러한 결과는 환자 조직을 이용한 면역조직화학법를 통해서도 동일한 결과를 얻을 수 있었다.
그 다음, MEST의 발현으로 인해 EMT (Epithelial-Mesenchmal transition)현상을 유도하는지를 조사한 결과, 상피 세포 마커인 E-cadherin, α- 및 β-catenin의 발현이 감소하는 것을 확인하였으며 중배엽 마커인 피브로넥틴과 N-cadherin의 발현이 증가하는 것을 확인하였다. 또한, 이러한 EMT의 유도는 전사 인자인 Slug, Twist-1 및 Twist-2의 발현 증가에 기인하는 것을 확인하였다. 뿐 만 아니라, MEST 과발현으로 인해 세포 성장을 조절하는 결과로 보아 AKT의 활성화를 통해 유방암 성장 및 생존을 유지시킬 것으로 기대되며, 아팝토시스에서 중요한 역할을 담당할 것으로 예상되어진다.
본 연구를 통해 MEST 유전자의 발현과 간암과의 연관성을 확인하였다. MEST의 발현이 간암 세포주에서 대조구와 비교시 인간 간암 세포주에서 과발현되어 있는 것을 확인하였다. 또한, MEST 유전자의 발현이 임상 유방 종양 샘플에서 어떤 병리학적 표현형과 연관이 있는지를 확인한 결과, MEST의 발현을 조사한 환자 중 65% 이상의 환자에서 과발현 되어 있는 것을 확인함으로써 MEST의 발현이 간암유발 및 전이에 중요한 역할을 담당할 것으로 예상되어진다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (11)

  1. MEST(mesoderm specific transcript homolog) 단백질에 특이적으로 결합하는 항체 또는 앱타머, MEST 단백질을 코딩하는 뉴클레오타이드 서열, 상기 뉴클레오타이드 서열에 상보적인 서열 또는 상기 뉴클레오타이드의 단편을 포함하는 암 진단 또는 예후 분석용 키트.
  2. 제 1 항에 있어서, 상기 암은 유방암(breast cancer), 간암(liver cancer), 방광암(bladder cancer), 뇌암(brain cancer), 자궁경부암(cervical cancer), 대장암(colorectal cancer), 식도암(esophageal cancer), 담낭암(gallbladder cancer), 두경부암(head and neck cancer), 신장암(kidney cancer), 폐암(소세포 및/또는 비-소세포)(lung cancer (small and/or non-small cell)), 흑색종(melanoma), 암(ovarian cancer), 생식세포암(ovary (germ cell) cancer), 전립선암(prostate cancer), 췌장암(pancreatic cancer), 음경암(penile cancer), 피부암(skin cancer), 연조직 육종(soft-tissue sarcoma), 편평상피세포암(squamous cell carcinomas), 위암(stomach cancer), 고환암(testicular cancer), 갑상선암(thyroid cancer) 및 자궁암(uterine cancer)으로 이루어진 군으로부터 선택된 하나 이상의 암인 것을 특징으로 하는 키트.
  3. 제 1 항에 있어서, 상기 암은 전이성 암인 것을 특징으로 하는 키트.
  4. 제 1 항에 있어서, 상기 키트는 면역분석(immunoassay)용 키트인 것을 특징으로 하는 키트.
  5. 제 1 항에 있어서, 상기 키트는 마이크로어레이인 것을 특징으로 하는 키트.
  6. 암 진단 또는 예후 분석에 필요한 정보를 제공하기 위하여 인간의 생물학적 시료에 있는 MEST 단백질 또는 MEST 단백질을 코딩하는 뉴클레오타이드 서열의 발현을 검출하는 방법을 통해 암 진단 또는 예후 분석 마커를 검출하는 방법.
  7. 제 6 항에 있어서, 상기 암은 유방암(breast cancer), 간암(liver cancer), 방광암(bladder cancer), 뇌암(brain cancer), 자궁경부암(cervical cancer), 대장암(colorectal cancer), 식도암(esophageal cancer), 담낭암(gallbladder cancer), 두경부암(head and neck cancer), 신장암(kidney cancer), 폐암(소세포 및/또는 비-소세포)(lung cancer (small and/or non-small cell)), 흑색종(melanoma), 암(ovarian cancer), 생식세포암(ovary (germ cell) cancer), 전립선암(prostate cancer), 췌장암(pancreatic cancer), 음경암(penile cancer), 피부암(skin cancer), 연조직 육종(soft-tissue sarcoma), 편평상피세포암(squamous cell carcinomas), 위암(stomach cancer), 고환암(testicular cancer), 갑상선암(thyroid cancer) 및 자궁암(uterine cancer)으로 이루어진 군으로부터 선택된 하나 이상의 암인 것을 특징으로 하는 방법.
  8. 제 6 항에 있어서, 상기 암은 전이성 암인 것을 특징으로 하는 방법.
  9. 제 6 항에 있어서, 상기 방법은 항원-항체 반응 방식으로 실시되는 것을 특징으로 하는 방법.
  10. 제 6 항에 있어서, 상기 방법은 마이크로어레이 방식으로 실시되는 것을 특징으로 하는 방법.
  11. 제 6 항에 있어서, 상기 방법은 유전자 증폭 방식으로 실시되는 것을 특징으로 하는 방법.
PCT/KR2012/001471 2011-02-25 2012-02-27 암에 대한 바이오마커 및 이를 이용한 암 진단 WO2012115493A2 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US14/001,655 US20170240971A1 (en) 2011-02-25 2012-02-27 Biomarkers for cancer diagnosis and prognosis and method for using thereof
US16/558,455 US20190382853A1 (en) 2011-02-25 2019-09-03 Mest as biomarker for cancer diagnosis and prognosis and method for using thereof
US18/078,391 US20230111706A1 (en) 2011-02-25 2022-12-09 Mest as biomarker for cancer diagnosis and prognosis and method for using thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2011-0016983 2011-02-25
KR1020110016983A KR101270944B1 (ko) 2011-02-25 2011-02-25 암에 대한 바이오마커 및 이를 이용한 암 진단

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US14/001,655 A-371-Of-International US20170240971A1 (en) 2011-02-25 2012-02-27 Biomarkers for cancer diagnosis and prognosis and method for using thereof
US16/558,455 Continuation-In-Part US20190382853A1 (en) 2011-02-25 2019-09-03 Mest as biomarker for cancer diagnosis and prognosis and method for using thereof

Publications (3)

Publication Number Publication Date
WO2012115493A2 WO2012115493A2 (ko) 2012-08-30
WO2012115493A3 WO2012115493A3 (ko) 2012-12-20
WO2012115493A9 true WO2012115493A9 (ko) 2013-02-14

Family

ID=46721372

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2012/001471 WO2012115493A2 (ko) 2011-02-25 2012-02-27 암에 대한 바이오마커 및 이를 이용한 암 진단

Country Status (3)

Country Link
US (1) US20170240971A1 (ko)
KR (1) KR101270944B1 (ko)
WO (1) WO2012115493A2 (ko)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101588018B1 (ko) * 2012-12-04 2016-01-25 연세대학교 산학협력단 암에 대한 바이오마커 및 이를 이용한 암 진단 방법
EP3692369A1 (en) * 2017-10-02 2020-08-12 Universität zu Köln Tumor and metastasizing marker
CN108152496B (zh) * 2017-11-24 2020-10-27 暨南大学 Mest蛋白在制备肺癌辅助诊断和/或预后判断的试剂盒中的应用
CN107807243B (zh) * 2017-11-24 2020-08-07 暨南大学 一种食管癌的生物标志物及其应用

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2007306801A (ja) * 2004-07-08 2007-11-29 Japan Health Science Foundation 肥満関連疾患診断方法、Ｍｅｓｔ発現調節因子検査方法及びＭｅｓｔ発現調節因子のスクリーニング方法
US20100124747A1 (en) 2008-11-03 2010-05-20 University Of Southern California Compositions and methods for diagnosis or prognosis of testicular cancer

Also Published As

Publication number Publication date
WO2012115493A3 (ko) 2012-12-20
WO2012115493A2 (ko) 2012-08-30
US20170240971A1 (en) 2017-08-24
KR20120097647A (ko) 2012-09-05
KR101270944B1 (ko) 2013-06-11

Similar Documents

Publication Publication Date Title
Evans et al. C35 (C17orf37) is a novel tumor biomarker abundantly expressed in breast cancer
WO2012115493A9 (ko) 암에 대한 바이오마커 및 이를 이용한 암 진단
KR101863951B1 (ko) 난소암의 진단 및 치료를 위한 조성물, 키트 및 방법
KR101399409B1 (ko) 위암의 림프절 전이 진단 마커로서의 유전자의 용도
JP7150018B2 (ja) 新規なｃｉｐ２ａバリアント及びその使用
KR101890392B1 (ko) Ｗｎｔ３ａ를 포함하는 난소암의 진단을 위한 마커 및 조성물
KR20170124683A (ko) 담도암 진단용 신규 바이오마커로서의 융합 유전자 및 융합 단백질
US20230111706A1 (en) Mest as biomarker for cancer diagnosis and prognosis and method for using thereof
KR101709980B1 (ko) 전립선암 전이에 대한 바이오마커 및 이의 용도
KR101888022B1 (ko) 담도암의 항암제 내성 진단용 신규 바이오마커 및 이의 용도
KR20190037071A (ko) 대장암의 항암제 내성 진단용 바이오마커 및 이의 용도
WO2006013474A2 (en) Ppgalnac-t6 mrna or peptide as a new marker for detection cancer cells
US20120100144A1 (en) Biomarker and Treatment for Cancer
KR101890388B1 (ko) Ｌｅｆ１을 포함하는 난소암의 진단을 위한 마커 및 조성물
KR101890390B1 (ko) Ｐｙｙ를 포함하는 난소암의 진단을 위한 마커 및 조성물
KR101890387B1 (ko) Ｆｏｘａ２를 포함하는 난소암의 진단을 위한 마커 및 조성물
KR101890389B1 (ko) Ｖａｖ３를 포함하는 난소암의 진단을 위한 마커 및 조성물
KR101890391B1 (ko) Ｎｋｘ３―２를 포함하는 난소암의 진단을 위한 마커 및 조성물
KR20100127498A (ko) Ｎｄｒｇ２를 이용한 대장암의 진단
WO2015152477A1 (ko) 유방암 재발 또는 전이 억제용 제제의 스크리닝 방법
KR101821402B1 (ko) 관절염 진단 방법
KR101588018B1 (ko) 암에 대한 바이오마커 및 이를 이용한 암 진단 방법
WO2012011778A2 (ko) 암 진단 키트 및 암 예방 또는 치료용 약제학적 조성물
JP2022032795A (ja) 子宮内膜癌の発症の予測方法
WO2018236065A1 (ko) 대장암 환자의 항암제 치료 반응성 예측용 마커

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12748850

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14001655

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 12748850

Country of ref document: EP

Kind code of ref document: A2