WO2015129942A1 - 개선된 유방암에 대한 정보제공 방법 및 그 진단용 키트 - Google Patents

개선된 유방암에 대한 정보제공 방법 및 그 진단용 키트 Download PDF

Info

Publication number
WO2015129942A1
WO2015129942A1 PCT/KR2014/001697 KR2014001697W WO2015129942A1 WO 2015129942 A1 WO2015129942 A1 WO 2015129942A1 KR 2014001697 W KR2014001697 W KR 2014001697W WO 2015129942 A1 WO2015129942 A1 WO 2015129942A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
her2
breast cancer
probe
qpcr
Prior art date
Application number
PCT/KR2014/001697
Other languages
English (en)
French (fr)
Inventor
왕혜영
김연
이혜영
Original Assignee
(주)옵티팜
연세대학교 원주산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)옵티팜, 연세대학교 원주산학협력단 filed Critical (주)옵티팜
Priority to CA2948051A priority Critical patent/CA2948051A1/en
Priority to US15/121,377 priority patent/US20200131579A1/en
Publication of WO2015129942A1 publication Critical patent/WO2015129942A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1096—Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00—Nucleic acid detection characterised by assay method
    • C12Q2561/101—Taqman
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00—Nucleic acid detection characterised by assay method
    • C12Q2561/113—Real time assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the present invention relates to an improved method for providing information on breast cancer and a diagnostic kit therefor, and more particularly, to an improved breast cancer diagnostic kit using one-tube nested PCR and a diagnostic method thereof. .
  • Breast cancer occurs through multiple stages of genetic variation in each individual cell. Metastasis is an active, multistage process involving neovascularization, including local infiltration into the surrounding interstitial tissues, lymphatic vessels, and blood vessels, and circulating blood flow. Invasion and transfer to other organs. The small size of the tumor may lead to the spread of cancer cells, and even after surgery to remove the primary tumor, cancer cells may remain in the lymphatic system or circulating blood flow, and these cancer cells, which cannot be detected by conventional methods, may be the cause of breast cancer recurrence. Lose. For this reason, the detection of breast cancer cells in the peripheral blood of breast cancer patients has emerged as an important prognostic factor for predicting the survival of patients.
  • Human epidermal growth factor receptor 2 (HER2) receptor, a 185 kDa membrane glycoprotein with tyrosine kinase activity, plays an important role in the activation of subcellular signaling systems that regulate epithelial cell growth and differentiation.
  • HER2 Human epidermal growth factor receptor 2
  • amplification of the HER2 gene or overexpression of HER2 protein is observed in 10-34% of breast cancer patients.
  • Analysis of HER2 status is important for the prognosis of patients and for the treatment of tratuzumab (Herceptin, Roche), an anti-HER2 monoclonal antibody.
  • Southern or Western blotting was used as a method of HER2 gene amplification or protein overexpression, but it was not clinically applied.
  • Immunohistochemical staining is the most widely used primary screening test, but differs by organ and is controversial in terms of technical accuracy and reproducibility of results (Press MF, Sauter G, Bernstein L, Villalobos IE, Mirlacher M). , Zhou JY, et al. Clin Cancer Res 2005; 11: 6598-607.)
  • Fluorescence in situ hybridization FISH is currently known to be the most reliable, and because DNA itself is very stable, it can be used in paraffin embedded tissues. It has the advantage of being more sensitive to the state of tissue than immunohistochemical staining and having a high reading agreement between pathologists.
  • HER2 status criterion is considered to be FISH, but it is not widely used due to limitations such as cost, time, and lack of laboratory facilities.
  • RT-PCR reverse transcriptase-polymerase chain reaction
  • the present invention has been made in view of the above problems and the need for the above-described problem, and an object of the present invention is to provide an information providing method for improved diagnosis of breast cancer.
  • Another object of the present invention is to provide a kit for diagnosing breast cancer.
  • the present invention comprises the steps of: a) isolating full-length RNA from cells obtained from the blood of a suspected cancer; b) synthesizing cDNA from the isolated full-length RNA; c) human synthesized cDNA One or more primer pairs selected from the group consisting of primer pairs and probes capable of amplifying epidermal growth factor receptor (HER) 2, primer pairs and probes capable of amplifying glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and Performing real-time PCR using a probe; And d) comparing the amplified amount with the amount expressed for a normal person;
  • HER epidermal growth factor receptor
  • GPDH glyceraldehyde-3-phosphate dehydrogenase
  • the primer pair that can amplify the human epidermal growth factor receptor (HER) 2 is a group consisting of primer pairs of SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 6 and 7, and SEQ ID NO: 8 and 9 It is a primer pair selected from or a mixture of these primer pairs, and the probe provides an information providing method for the diagnosis of breast cancer, characterized in that at least one of the probes of SEQ ID NO: 5, SEQ ID NO: 10 and 11.
  • the step of comparing the amplified amount with the amount amplified for a normal person is preferably performed by a standard or cutoff value, but is not limited thereto.
  • primer pairs capable of amplifying the GAPDH are described in SEQ ID NOs: 12 and 13, and the probe preferably has a nucleotide sequence described in SEQ ID NO: 14, but is not limited thereto.
  • the present invention is selected from the group consisting of primer pairs of SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 6 and 7, and SEQ ID NO: 8 and 9 capable of amplifying human epidermal growth factor receptor (HER) 2 Primer pairs or mixtures of these primer pairs;
  • primer pairs of SEQ ID NO: 1 and 2 SEQ ID NO: 3 and 4, SEQ ID NO: 6 and 7, and SEQ ID NO: 8 and 9 capable of amplifying human epidermal growth factor receptor (HER) 2 Primer pairs or mixtures of these primer pairs;
  • HER human epidermal growth factor receptor
  • a breast cancer diagnostic composition comprising a primer pair and a probe capable of amplifying GAPDH as an active ingredient.
  • the 5 'end of the probe is preferably labeled with a fluorescent material, but is not limited thereto.
  • the present invention provides a kit for diagnosing breast cancer comprising the composition of the present invention.
  • a method for separating totally used full RNA and synthesizing cDNA therefrom can be carried out through a known method.
  • a method for separating totally used full RNA and synthesizing cDNA therefrom can be carried out through a known method.
  • For a detailed description of this process see Joseph Sambrook et al., Molecular Cloning, A Laboratory Manual. , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And Noonan, K.F. And the like can be incorporated as a reference of the present invention.
  • Primers of the invention can be chemically synthesized using phosphoramidite solid support methods, or other well known methods. Such nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, “capsulation”, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, eg, uncharged linkages such as methyl phosphonate, phosphoester, phosph Modifications to poroamidates, carbamates, etc.) or charged linkers (eg, phosphorothioates, phosphorodithioates, etc.).
  • Nucleic acids may be selected from one or more additional covalently linked residues, such as proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), inserts (eg, acridine, psoralene, etc.). ), Chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents. Nucleic acid sequences of the invention can also be modified using a label that can provide a detectable signal directly or indirectly. Examples of labels include radioisotopes, fluorescent molecules, biotin, and the like.
  • the amplified target sequences (HER 2, and GAPDH gene) can be labeled with a detectable labeling substance.
  • the labeling material may be, but is not limited to, a fluorescent, phosphorescent, chemiluminescent or radioactive material.
  • the labeling substance may be fluorescein, phycoerythrin, rhodamine, lissamine Cy-5 or Cy-3.
  • real-time RT-PCR may be performed by labeling Cy-5 or Cy-3 at the 5'-end and / or 3 'end of the primer to label the target sequence with a detectable fluorescent label. .
  • the label using radioactive material is added to the PCR reaction solution by adding radioactive isotopes such as 32 P or 35 S to the PCR reaction solution during real-time RT-PCR, and the amplification product is radioactively incorporated into the amplification product.
  • radioactive isotopes such as 32 P or 35 S
  • the amplification product is radioactively incorporated into the amplification product.
  • One or more sets of oligonucleotide primers used to amplify a target sequence can be used.
  • Labeling is carried out in a variety of ways conventionally practiced in the art, such as nick translation methods, random priming methods (Multiprime DNA labeling systems booklet, "Amersham” (1989)) and chination methods (Maxam & Gilbert, Methods). in Enzymology, 65: 499 (1986)). Labels provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetric, X-ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, hybridization high frequency, nanocrystals.
  • the present invention is to measure the expression level at the mRNA level via RT-PCR.
  • a novel primer pair and fluorescence-labeled probe specifically binding to the HER 2 and GAPDH genes are required.
  • the primers and probes specified by specific nucleotide sequences may be used, but the present invention is limited thereto. If the specific binding to these genes can provide a detectable signal to perform real-time RT-PCR can be used without limitation.
  • FAM and Quen (Quencher) means a fluorescent dye.
  • Real-time RT-PCR method applied to the present invention can be carried out through known procedures commonly used in the art.
  • the step of measuring the mRNA expression level can be used without limitation as long as it is a method capable of measuring the normal mRNA expression level, depending on the type of probe label used can be performed by radiometric measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. It doesn't work.
  • the fluorescence measurement method uses Cy-5 or Cy-3 at the 5'-end of a primer to perform real-time RT-PCR to label a target sequence with a detectable fluorescent label.
  • the labeled fluorescence may be measured using a fluorimeter.
  • the radioactivity measuring method is to add a radioactive isotope such as 32 P or 35 S to the PCR reaction solution when real-time RT-PCR is performed to label the amplification product, and then radioactive measuring apparatus, for example, Geiger counter (Geiger Radioactivity can be measured using a counter or a liquid scintillation counter.
  • a fluorescent-labeled probe is attached to the PCR product amplified by the realtime RT-PCR to emit fluorescence of a specific wavelength, and at the same time, the fluorescence measuring device of the realtime PCR device The mRNA expression level of the genes are measured in real time, and the measured values are calculated and visualized through a PC so that the examiner can easily check the expression level.
  • the diagnostic kit may be a kit for diagnosing breast cancer, which includes an essential element necessary for performing reverse transcriptase.
  • the reverse transcription polymerase kit may comprise each primer pair specific for the gene of the present invention.
  • the primer is a nucleotide having a sequence specific to the nucleic acid sequence of each marker gene, and may be about 7 bp to 50 bp in length, more preferably about 10 bp to 30 bp in length.
  • reverse transcriptase kits include test tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary), enzymes such as deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase, DNAse, RNAse inhibitor DEPC - May include DEPC-water, sterile water, and the like.
  • reaction buffers pH and magnesium concentrations vary
  • enzymes such as deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase
  • DNAse DNAse
  • RNAse inhibitor DEPC - May include DEPC-water, sterile water, and the like.
  • the term "information providing method for diagnosing cancer” in the present invention is to provide objective basic information necessary for diagnosing cancer as a preliminary step for diagnosis and excludes the clinical judgment or findings of the doctor.
  • primer refers to a short nucleic acid sequence that is capable of forming base pairs with complementary templates with nucleic acid sequences having short free 3-terminal hydroxyl groups and that serves as a starting point for template strand copying.
  • Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) at appropriate buffers and temperatures.
  • Primers of the invention are sense and antisense nucleic acids having 7 to 50 nucleotide sequences as primers specific for each marker gene. Primers can incorporate additional features that do not change the basic properties of the primers that serve as a starting point for DNA synthesis.
  • probe is a single chain nucleic acid molecule and includes a sequence that is complementary to a target nucleic acid sequence.
  • realtime RT-PCR refers to a target primer and label using cDNA produced after reverse transcription of RNA into complementary DNA (cDNA) using reverse transcriptase. It is a molecular biological polymerization method that amplifies a target using a target probe and simultaneously detects a signal generated from a label of a target probe on the amplified target.
  • HER2 expression rate was confirmed in breast cancer patients using mRNA RT-qPCR, and to improve the sensitivity, the sensitivity comparison with single PCR using one-tube nested RT-qPCR method and HER2 expression rate in breast cancer patients were compared.
  • the present invention was carried out to help more effectively treat and diagnose breast cancer.
  • the base sequence used in the present invention is shown in FIG.
  • HER2 The expression sensitivity of HER2 was confirmed using HER2-positive breast cancer cell lines SK-BR-3 and MCF-7.
  • Sensitivity using RT-qPCR of HER2 with the nucleotide sequence (position 605) of the front part described in FIGS. 1-7 indicates the sensitivity of detecting SK-BR-3 cells up to 10 1 in MCF7 and up to 10 2 in MCF7. It could be confirmed (Fig. 17-18). Comparing the Ct values of 605-612 sites, the sensitivity of 612 sites was relatively high at 10. 6 and 18.64, 17.06, 21.28 and 20.47 of SKBR3 and MCF7 cell lines, respectively.
  • the sensitivity of RT-qPCR of HER2 with the base sequence (612 position) of the HER2 can confirm the sensitivity of detecting SK-BR-3 cells 10 1 and 10 2 in MCF7. there was.
  • HER2 also has a primer and a probe (p1) of the nucleotide sequence of the 2725 portion located at the 4-box 8-16 sensitivity using RT-qPCR of HER2 is a SK-BR-3 cells 10 1 to 10 1 detected in MCF7 Sensitivity could be confirmed (FIGS. 21-22).
  • HER2-positive breast cancer cell lines were prepared by mixing the nucleotide sequences of the front part (605-612) and the middle part (2725-2740) with each other in order to determine the sensitivity change when the two base sequences were mixed than the prepared single RT-qPCR.
  • the expression sensitivity of HER2 was confirmed using SK-BR-3 and MCF-7.
  • the sensitivity was higher than the result obtained when the P1-P2mix was put in each of 2725-2740 sites.
  • Fig. 33-34 front part 605 and the middle part (position 2725) of the nucleotide sequence has a sensitivity using RT-qPCR of HER2 is a SK-BR-3 cells 10 1, the MCF7 possible to detect 1 to 10 Sensitivity was confirmed.
  • Sensitivity using RT-qPCR of HER2 with the base sequence of the front part (605) and the middle part (2740 position) can confirm the sensitivity that can detect SK-BR-3 cells up to 10 1 in MCF7, up to 10 2 in MCF7 37-38).
  • the sensitivity was higher than that of single RT-qPCR, but in this case, the Ct values of SKBR-MCF7 cell line, which were obtained when mixing the previous 612 sequences, were 17.04 and 19.56, respectively.
  • the sensitivity change was investigated using the one-tube nested RT-qPCR method to increase the sensitivity than the results of the single RT-qPCR and multiplex RT-qPCR.
  • the expression sensitivity of HER2 was confirmed using the HER2-positive breast cancer cell lines SK-BR-3 and MCF-7 using the nucleotide sequence of the front (position 605-612). As a result, the sensitivity was confirmed that the detection of one SK-BR-3 cells, up to 10 1 in MCF7 (Fig. 41-42).
  • the nucleotide sequence of the first part (605-612) is used as it is, and the middle part was compared with HER2 expression of one-tube nested RT-qPCR by mixing two probes (P1-2) with each pair of primers.
  • the method using the one-tube nested RT-qPCR condition was also shown in the one-tube nested RT-qPCR as the value of the primer or probe at the single or multiplex RT-qPCR was mixed.
  • the one-tube nested RT-qPCR method itself was more sensitive than the results of single RT-qPCR or multiplex RT-qPCR, but the result of mixing the 2725 and 2740 sequences in the middle was not good.
  • Tables 1 and 2 compare HER2 expression according to single-multiplex RT-qPCR
  • Table 3 shows the comparison of HER2 expression according to one-tube nested RT-qPCR
  • HER2 expression of the HER2 negative cell line MDA-MB-231 cell line was set to 1
  • the amount of HER2 expression of MCF7 was about 5.4
  • the amount of HER2 expression of SK-BR-3 was about 56.9.
  • FIG. 54 is a comparison of expression levels using single RT-qPCR.
  • FIG. 55 is a comparison of expression amounts using multiplex RT-qPCR and
  • FIG. 56 is a one-tube nested RT-qPCR.
  • the blue box in the figure is IHC 2 + / FISH positive and IHC.
  • Patient samples identified as HER2-positive with 3+ or single RT-qPCR and multiplex RT-qPCR were distributed in the negative and positive boundaries, whereas in one-tube nested RT-qPCR conditions. All showed positive expression results.
  • RNA quality of the specimen is very important. Samples of high quality RNA may yield accurate results, while low RNA quality may result in false positives or false negatives. Therefore, in the present invention, the degree of RNA quality is presented based on the expression level of GAPDH. As shown in FIGS. 57-59, when the expression level of GAPDH was classified based on the Ct value of RT-qPCR, the lower the Ct value of GAPDH, the more accurate the results were obtained.
  • the ROC curve (receiver operating characteristic) is a graph showing the performance of a binary classifier.
  • FPR false positive rate
  • Table 4 is a list of nucleotide sequences used in the present invention.
  • the present invention uses a gene amplification method using HER 2 mRNA based on the real-time RT-PCR method that can produce a simple and quantitative result, it can detect an invisible amount than the protein detection method In addition, since the antigen-antibody reaction is not used, a cheap test method can be provided. In addition, it was confirmed that the sensitivity is higher than the known sequence, and also there is no step to identify the band by using electrophoresis, it is easier to confirm the result. In addition, the one-tube nested RT-qPCR method of the present invention has an effect that the sensitivity is better than the result of a single RT-qPCR or multiplex RT-qPCR.
  • FIG. 1-16 shows the nucleotide sequence position used in the present invention in the HER2 gene (4.6Kb) of the front (605-612 region; Figure 1-7) and the middle (2.7kb-4 position; Figure 8-16)
  • the present invention was carried out using a primer & probe base sequence prepared for two sites.
  • 17-18 shows the comparison of HER2 expression using cell lines with base sequences of different sites
  • 19-20 is a comparison of HER2 expression using a cell line
  • 21-22 is a comparison of the expression of HER2 using the primer and P1 probe of 2725 sites
  • 23-24 is a comparison of the expression of HER2 using primers and P2 probe of 2725 sites
  • 25-26 is a comparison of the expression of HER2 using a primer of 2725 and P1-2mix probe
  • 27-28 is a comparison of HER2 expression using a primer and a P1 probe at 2740 sites
  • 29-30 shows HER2 expression using 2740 primer and P2 probe
  • 31-32 is a comparison of the expression of HER2 using the primer and P1 + 2mix probe of 2740 sites
  • 33-34 is a comparison of the amount of HER2 expression using the nucleotide sequence of the front part 605 and the middle part (2725 position)
  • 35-36 shows the expression of HER2 using the nucleotide sequence of the front part 612 and the middle part (2725 position)
  • 37-38 is a comparison of the amount of HER2 expression using the nucleotide sequence of the front portion 605 and the middle portion (2740 position)
  • 39-40 shows the expression of HER2 using the nucleotide sequence of the front part 612 and the middle part (2740 position)
  • 41-42 is a comparison of the expression of HER2 of one-tube nested RT-qPCR using the front part (605-612) sequence
  • 43-45 is a comparison of HER2 expression of one-tube nested RT-qPCR using the nucleotide sequence of the middle portion (2725-2740)
  • 46-48 is a comparison of HER2 expression of one-tube nested RT-qPCR using nucleotide sequences of a mixture of the front portion (605-612) and the middle portion (2725-2740).
  • 49-50 shows a comparison of HER2 expression of one-tube nested RT-qPCR using nucleotide sequences in which a front portion (605-612) and a middle portion (2725) are mixed.
  • 51-52 is a comparison of the amount of HER2 expression of the one-tube nested RT-qPCR using the nucleotide sequence of the front portion (605-612) and the middle portion (2740)
  • 57-59 shows ROC curve assay for clinical cut-off determination
  • FFPE Form Fixed Paraffin Embbeded tissue from 199 patients at Sinchon Severance Hospital.
  • IHC immunohistochemical staining
  • FISH fluorescence in situ
  • breast cancer cell lines SK-BR3, MCF7, and MDA-MB 231 were used to confirm the expression of HER2.
  • Paraffin blocks were cut into 4 ⁇ m thicknesses, attached to slides, and sufficiently dried, and immunohistochemical staining was performed using a BenchMark ST (Ventana medical system, USA) automatic immunostaining machine.
  • the primary antibody was diluted 1: 1,000 with polyclonal rabbit anti-human c-erbB-2 oncoprotein (A0485, DakoCytomation, Glostrup, Denmark). After staining the slides in this manner, it was determined by dividing the slide into four grades, 0, 1+, 2+, 3+, depending on the degree of staining of the HER2 protein on the cell membrane of cancer cells. Among them, 0, 1+ was diagnosed as HER2 negative, 3+ was diagnosed as positive, and 2+ was diagnosed as positive or FISH according to the clinical information of the patient.
  • HER2 IHC In the HER2 IHC method, patients with 2+ came out, the tissue block fixed with paraffin was cut to 4 ⁇ m thickness using a microtome, attached to the slide, and then commercialized HER2 DNA through deparaffinization and water treatment.
  • the probe kit (Vysis Inc, Downers Grove, IL, USA) was used in accordance with the manufacturer's instructions.
  • HER2 expression was positive when the Amplification Index was 2.2 or higher, depending on gene expression.
  • RNA isolated was quantified using NanoQuant system (TECAN).
  • RNA Isolated total RNA 0.5 ⁇ 3ug, random primer (Invitrogen) 0.25ug, dNTP (Intron) 250 uM, Tris-HCl (pH 8.3) 50 mM, KCl 75 mM, MgCl 2 3 mM, DTT 8 mM and MMLV reverse transcriptase
  • Add 200 units Add DEPC treated DW to a final volume of 30 ul, mix well, and react the synthetic reaction solution for 10 minutes at 25 °C, 50 minutes at 37 °C, and 15 minutes at 70 °C in thermocycler (ABI).
  • CDNA was synthesized.
  • composition of the real-time PCR reactions consisted of 25 mM TAPS (pH 9.3 at 25 ° C), 50 mM KCl, 2 mM MgCl 2 , 1 mM 2-mercaptoethanol, 200 ⁇ M each dNTP, 1 unit Taq polymerase (TAKARA) and Forward 10pmole was added to the primer and reverse primer respectively, and 10pmole was also added to the probe. 2ul of the synthesized cDNA was added to a final volume of 20ul. The base sequences of each primer and probe are shown in Table 4.
  • PCR reaction was performed using CFX 96 (Bio-rad, USA) and proceeded by two methods of denaturation temperature.
  • Single RT-PCR was performed once at 94 ° C. for 3 minutes, followed by 40 cycles of 30 seconds at denaturation temperature 95 ° C. and 40 seconds at annealing temperature 55 ° C.,
  • One-tube nested RT-PCR it is performed once at 94 ° C. for 3 minutes, 30 seconds at denaturation temperature 95 ° C., 10 cycles at annealing temperature 60 ° C., and then 30 seconds at 95 ° C., 55 ° C. A cycle of 40 seconds at 40 cycles was performed.
  • the Ct value represents the number of cycles in which amplification began to increase significantly during the PCR process.
  • ⁇ Ct means a numerical value (mRAN expression ratio) of the vertical axis in FIG. 3.
  • ⁇ Ct value of SKBR3 Ct value of HER2 in SKBR3-Ct value of reference gene (GAPDH) in SKBR3
  • ⁇ Ct value of THP-1 Ct value of HER2 at THP-1-Ct value of reference (GAPDH) gene at THP-1
  • ⁇ Ct value in breast cancer tissue Ct value of HER2 in breast cancer tissue-Ct value of reference (GAPDH) gene in tissue
  • ⁇ Ct value of THP-1 Ct value of HER2 at THP-1-Ct value of reference (GAPDH) gene at THP-1
  • R (expression) ⁇ Ct value in tissue of breast cancer patient- ⁇ Ct value in THP-1
  • the Ct value of the reference gene used in this experiment represents the Ct value for GAPDH, and the reference gene may include other house keeping genes in addition to the GAPDH used in this experiment.
  • SKBR3 As a positive control, it is possible to confirm whether HER2 expression is actually overexpressed.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 개선된 유방암에 대한 정보제공 방법 및 그 진단용 키트에 관한 것으로, 더욱 상세하게는 원튜브 네스티드 피시알(one-tube nested PCR)을 이용한 개선된 유방암 진단키트와 그 진단방법에 관한 것이다.

Description

개선된 유방암에 대한 정보제공 방법 및 그 진단용 키트
본 발명은 개선된 유방암에 대한 정보제공 방법 및 그 진단용 키트에 관한 것으로, 더욱 상세하게는 원튜브 네스티드 피시알(one-tube nested PCR)을 이용한 개선된 유방암 진단키트와 그 진단방법에 관한 것이다.
유방암은 각 개개의 세포에서 다단계의 유전적인 변이를 거치면서 발생하게 되며, 전이는 신생혈관 형성 등을 포함한 능동적인 다단계의 과정으로서 암세포의 주변 간질조직, 림프관, 혈관으로의 국소 침윤, 순환혈류로의 침투 및 다른 장기로의 이동 등의 과정이 포함된다. 종양의 크기가 작아도 암세포의 확산이 발견될 수 있고, 수술로 원발 종양을 제거한 후에도 림프계나 순환 혈류에 암세포가 잔존할 수 있어 보편적인 방법으로는 발견할 수 없는 이들 암세포가 유방암 재발의 원인이라고 보여진다. 이러한 이유로 유방암 환자의 말초혈액에 존재하는 유방암 세포를 발견하는 것이 환자의 생존을 예측하는 중요한 예후인자로 부각되고 있으며 이에 따라 보조치료의 방법을 선택하는 기준과 일차 치료 후 추적조사의 유용한 방법이 될 것으로 보여진다. 그러나 혈액표본에 대한 직접적인 세포검사는 진단적 예민도가 매우 낮으며 면역화학적인 검사가 시행되기도 하지만 역시 진단적 민감도가 낮으며 경우에 따라서는 위양성의 결과를 얻기도 한다.
Human epidermal growth factor receptor 2 (HER2) 수용체는 타이로신 카이나제 활동을 지닌 185 kDa의 막당단백질로 상피 세포의 성장과 분화를 조절하는 세포 하 신호전달체계의 활성화에 중요한 역할을 한다. 유방암 환자에서 HER2 유전자의 증폭이나 HER2 단백질의 과발현은 유방암환자의 10-34%에서 관찰된다. HER2 상태에 대한 분석은 환자의 예후와 anti-HER2 monoclonal antibody인 tratuzumab (Herceptin, Roche) 치료에 중요하다. 초창기에는 HER2 유전자 증폭이나 단백질 과발현 유무를 알아보는 방법으로 Southern 또는 Western blotting이 쓰였으나 임상 적용은 되지 못하였다. 면역조직화학 염색 방법(IHC)이 일차 선별검사로 가장 널리 쓰이고 있으나 기관별 차이가 있고, 기술적인 정확성이나 결과의 재연성면에서 논란이 많다.(Press MF, Sauter G, Bernstein L, Villalobos IE, Mirlacher M, Zhou JY, et al. Clin Cancer Res 2005; 11:6598-607.) 형광제자리부합법(fluorescence in situ hybridization, FISH)은 현재 가장 믿을만하다고 알려져 있으며, DNA 자체가 매우 안정적이므로 파라핀 포매 조직에서 행할 수 있고 면역조직화학염색보다 조직의 상태에 민감하지 않으며 병리의사 간의 판독 일치율이 높은 장점이 있다. 그러나 검사 과정이 복잡하고 판독 시 암실에서 형광현미경을 통해 진행하여야 하는 불편함이 있으며 형광을 사용하기 때문에 결과의 영구 보존이 불가능하다는 단점이 있으며 또한 형광 probe의 값이 매우 비싸기 때문에 규모가 작은 병원등에서는 수행이 불가능하다고 알려져 있다(Lewis F, Jackson P, Lane S, Coast G, Hanby AM. Histopathology 2004;45:207-17.). HER2 유전자 증폭은 종괴의 침습성과 나쁜 예후와 관련이 있다고 알려지기 시작하였으나( Re@villion F, Bonneterre J, Peyrat JP. Eur J Cancer 1998;34:791-808.) 임상적으로 크게 주목을 받기 시작한 것은 항암 치료 및 tratuzumab 치료와의 관련성이 밝혀지면서부터이다. HER2를 목표로 하는 분자표적치료는 HER2 유전자 증폭이 있는 환자군이 고려 대상이 된다. 현재 가장 정확한 HER2 상태 판단 기준은 FISH로 여겨지나 비용과 시간이 많이 들고, 실험 여력을 갖춘 기관이 부족하다는 점 등 제약이 있어 널리 보급되지는 못한 상태이다.
유방암 환자의 말초혈액이나 골수에서 유방암세포의 미세전이를 발견하는 연구가 점차적으로 주목을 받고 있으며, 임상적인 환자의 관리에서 환자의 병기에 관계없이 수술 전, 후로 유방암 세포의 미세전이 유무를 확인하는 일은 진단이나 수술 후 추적관리면 모두에서 중요한 요소가 될 것이다. 최근 암세포 특이 mRNA에 대한 역전사-중합효소연쇄 반응(RT-PCR) 법은 여러 가지 종류의 암 환자에서 말초혈액이나 골수에서 미세잔여암을 진단하는데 매우 유용하면서도 진단적 민감도가 매우 높은 방법으로 연구되고 있다(Ghossein RA, Juan R. Cancer 1996;78:10-6.)
본 발명은 상기의 문제점을 해결하고 상기의 필요성에 의하여 안출된 것으로서 본 발명의 목적은 개선된 유방암의 진단을 위한 정보제공방법을 제공하는 것이다.
본 발명의 다른 목적은 유방암진단용 키트를 제공하는 것이다.
상기의 목적을 달성하기 위하여 본 발명은 a) 암 의심환자의 혈액에서 얻은 세포로부터 전장 RNA를 분리하는 단계;b) 상기 분리된 전장 RNA로부터 cDNA를 합성하는 단계;c) 상기 합성된 cDNA를 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 프라이머쌍 및 프로브, 및 글리세르알데히드 -3-인산 탈수소효소(GAPDH)를 증폭할 수 있는 프라이머쌍 및 프로브로 구성된 군으로부터 선택된 하나 이상의 프라이머쌍 및 프로브를 이용하여 실시간-PCR을 수행하는 단계; 및d) 상기 증폭된 양을 정상인에 대해 발현된 양과 비교하는 단계;를 포함하며,
여기서, 상기 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 프라이머쌍은 서열번호 1 및 2, 서열번호 3 및 4, 서열번호 6 및 7, 및 서열번호 8 및 9의 프라이머 쌍으로 구성된 군으로부터 선택된 프라이머쌍 또는 이들 프라이머 쌍의 혼합물이고, 프로브는 서열번호 5, 서열번호 10 및 11의 프로브 중 하나 이상인 것을 특징으로 하는 유방암의 진단을 위한 정보제공방법을 제공한다.
본 발명의 일 구현예에 있어서, 상기 증폭된 양을 정상인에 대해 증폭된 양과 비교하는 단계는 표준 또는 컷오프 값에 의하여 수행되는 것이 바람직하나 이에 한정되지 아니한다.
본 발명의 다른 구현예에 있어서, 상기 GAPDH를 증폭할 수 있는 프라이머쌍은 서열번호 12 및 13에 기재되고, 프로브는 서열번호 14에 기재된 염기서열을 가지는 것이 바람직하나 이에 한정되지 아니한다.
또 본 발명은 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 서열번호 1 및 2, 서열번호 3 및 4, 서열번호 6 및 7, 및 서열번호 8 및 9의 프라이머 쌍으로 구성된 군으로부터 선택된 프라이머쌍 또는 이들 프라이머 쌍의 혼합물; 및
GAPDH를 증폭할 수 있는 프라이머쌍과 및 프로브를 유효성분으로 포함하는 유방암 진단용 조성물을 제공한다.
본 발명의 일 구현예에 있어서, 상기 프로브의 5'말단은 형광물질로 표지된 것이 바람직하나 이에 한정되지 아니한다.
또 본 발명은 상기 본 발명의 조성물을 포함하는 유방암 진단용 키트을 제공한다.
일반적으로 사용되는 전장 RNA(Total RNA)를 분리하는 방법 및 이로부터 cDNA를 합성하는 방법은 공지된 방법을 통해 수행될 수 있으며, 이 과정에 대한 자세한 설명은 Joseph Sambrook 등, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); 및 Noonan, K.F. 등에 개시되어 있어 본 발명의 참조로서 삽입될 수 있다.
본 발명의 프라이머는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비제한적인 예로는 메틸화, "캡화", 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다. 핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예: 뉴클레아제, 독소, 항체, 시그날 펩타이드, 폴리-L-리신 등), 삽입제(예: 아크리딘, 프소랄렌 등), 킬레이트화제(예: 금속, 방사성 금속,철, 산화성 금속 등), 및 알킬화제를 함유할 수 있다. 본 발명의 핵산 서열은 또한 검출 가능한 시그널을 직접 또는 간접적으로 제공할 수 있는 표지를 이용하여 변형시킬 수 있다. 표지의 예로는 방사성 동위원소, 형광성 분자, 바이오틴 등이 있다.
본 발명의 방법에 있어서, 상기 증폭된 표적 서열(HER 2, 및 GAPDH 유전자)은 검출가능한 표지 물질로 표지될 수 있다. 일 구현예에서, 상기 표지 물질은 형광, 인광, 화학발광단 또는 방사성을 발하는 물질일 수 있으나,이에 제한되지 않는다. 바람직하게는, 상기 표지 물질은 루오리신(fluorescein),피코에리트린(phycoerythrin), 로다민, 리사민 (lissamine) Cy-5 또는 Cy-3일 수 있다. 표적 서열의 증폭시 프라이머의 5'-말단 및/또는 3' 말단에 Cy-5 또는 Cy-3를 표지하여 real-time RT-PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지될 수 있다.
또한, 방사성 물질을 이용한 표지는 real-time RT-PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하면 증폭 산물이 합성되면서 방사성이 증폭 산물에 혼입되어 증폭 산물이 방사성으로 표지될 수 있다. 표적 서열을 증폭하기 위해 이용된 하나 이상의 올리고뉴클레오티드 프라이머 세트를 이용할 수 있다.
표지는 당업계에서 통상적으로 실시되는 다양한 방법, 예컨대, 닉 트랜스레이션 (nick translation) 방법, 무작위 프라이밍 방법 (Multiprime DNA labelling systems booklet, "Amersham"(1989)) 및 카이네이션 방법 (Maxam & Gilbert, Methods in Enzymology, 65:499(1986))을 통해 실시될 수 있다. 표지는 형광, 방사능, 발색 측정,중량 측정, X-선 회절 또는 흡수, 자기, 효소적 활성, 매스 분석, 결합 친화도, 혼성화 고주파, 나노크리스탈에 의하여 검출할 수 있는 시그널을 제공한다.
본 발명의 한 측면에 따르면, 본 발명에서는 RT-PCR을 통해 mRNA 수준에서 발현수준을 측정하게 된다. 이를 위하여 상기 HER 2, 및 GAPDH 유전자에 특이적으로 결합하는 신규한 프라이머 쌍과 형광이 표지된 프로브가 요구되며, 본 발명에서 특정한 염기서열로 특정된 해당 프라이머 및 프로브를 사용할 수 있으나 이에 제한되는 것은 아니며, 이들 유전자에 특이적으로 결합하여 검출가능한 시그널을 제공하여 real-time RT-PCR을 수행할 수 있는 것이면, 제한 없이 사용될 수 있다. 상기에서 FAM과 Quen(Quencher)는 형광염료를 의미한다.
본 발명에 적용되는 real-time RT-PCR 방법은 당업계에서 통상적으로 사용되는 공지의 과정을 통해 수행될 수 있다.
mRNA 발현수준을 측정하는 단계는 통상의 mRNA 발현수준을 측정할 수 있는 방법이면 제한 없이 사용될 수 있으며, 사용한 프로브 표지의 종류에 따라 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있으나, 이에 제한되지 않는다.
증폭 산물을 검출하는 방법 중의 하나로서, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 real-time RT-PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 real-time RT-PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성 측정기구, 예를 들면, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다.
본 발명의 바람직한 일구현예에 따르면, 상기 realtime RT-PCR을 통해 증폭된 PCR 산물에 형광이 표지된 프로브가 붙어 특정 파장의 형광을 내게 되고, 증폭과 동시에 realtime PCR 장치의 형광 측정기에서 본 발명의 유전자들의 mRNA 발현수준을 실시간으로 측정하고, 측정된 값이 계산되어 PC를 통해 시각화 되게 되어 검사자는 쉽게 그 발현 정도를 확인할 수 있다.
본 발명의 다른 측면에 따르면 상기 진단 키트는 역전사 중합효소반응을 수행하기 위해 필요한 필수 요소를 포함하는 것을 특징으로 하는 유방암 진단용 키트일 수 있다. 역전사 중합효소반응 키트는 상기 본 발명의 유전자에 대한 특이적인 각각의 프라이머 쌍을 포함할 수 있다. 프라이머는 각 마커 유전자의 핵산서열에 특이적인 서열을 가지는 뉴클레오타이드로서, 약 7 bp 내지 50 bp의 길이, 보다 바람직하게는 약 10 bp 내지 30 bp 의 길이일 수 있다.
그 외 역전사 중합효소반응 키트는 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드(dNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNAse, RNAse 억제제 DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다.
본 발명에서 용어 "암 진단을 위한 정보제공방법"은 진단을 위한 예비적 단계로서 암의 진단을 위하여 필요한 객관적인 기초정보를 제공하는 것이며 의사의 임상학적 판단 또는 소견은 제외된다.
용어 "프라이머"는 짧은 자유 3말단 수산화기를 가지는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 중합효소 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성이 개시할 수 있다. 본 발명의 프라이머는, 각 마커 유전자특이적인 프라이머로 7개 내지 50개의 뉴클레오타이드 서열을 가진 센스 및 안티센스 핵산이다. 프라이머는 DNA 합성의 개시점으로 작용하는 프라이머의 기본 성질을 변화시키지 않는 추가의 특징을 혼입할 수 있다.
용어 "프로브"는 단일쇄 핵산 분자이며, 타깃 핵산 서열에 상보적인 서열을 포함한다.
용어 "실시간 역전사 중합효소 반응(realtime RT-PCR)"이라 함은 역전사효소를 이용하여 RNA를 상보적인 DNA(cDNA)로 역전사 시킨 후에 만들어진 cDNA를 주형(template) 으로하여 타겟 프라이머와 표지를 포함하는 타겟 프로브를 이용해 타겟을 증폭함과 동시에 증폭된 타겟에 타겟 프로프의 표지에서 발생하는 신호를 정량적으로 검출해 내는 분자생물학적 중합방법이다.
이하 본 발명을 설명한다.
본 발명에서는 mRNA RT-qPCR을 이용하여 유방암 환자에서 HER2 발현율을 확인하였으며, 또한 민감도를 높이고자 one-tube nested RT-qPCR법을 이용하여 single PCR과의 민감도 비교와 유방암 환자에서의 HER2 발현율을 비교하여 효과적인 치료를 위하여 조직 검체 뿐만 아니라 혈액 내에서 발현하는 HER2와 혈액 내 암 관련 마커의 발현 양상을 통하여 더 효과적인 유방암 치료 및 진단에 도움을 주고자 본 발명을 진행하였다
이하 본 발명을 상세하게 설명한다.
본 발명에서 사용된 염기서열은 도 1에 나타내었다.
RT-qPCR을 이용한 각 Cell line 별 HER2 발현양 비교
(1) Single RT-qPCR을 이용한 각 Cell line 별 HER2 발현양 비교
i) 앞부분의 염기서열(605-612위치)를 이용한 Cell line 별 HER2 발현양 비교
HER2 양성 유방암 세포주인 SK-BR-3과 MCF-7을 이용하여 HER2의 발현 민감도를 확인하였다.
도 1-7에서 기재된 앞 부분의 다른 위치의 염기서열(605위치)을 가지고 HER2의 RT-qPCR을 이용한 민감도는 SK-BR-3 세포를 101, MCF7에서는 102까지 검출할 수 있는 민감도를 확인할 수 있었다(도 17-18). 605-612부위의 Ct값을 비교해 보면 SKBR3과 MCF7 cell line의 106에서 각각 18.64와 17.06, 21.28과 20.47로 612부위에서의 민감도가 상대적으로 높게 나타났다.
또한 도 19-20에서 보면 앞부분의 염기서열(612위치)을 가지고 HER2의 RT-qPCR을 이용한 민감도는 SK-BR-3 세포를 101, MCF7에서는 102까지 검출할 수 있는 민감도를 확인 할 수 있었다.
ii) 중간부분의 염기서열(2.7kb 위치)를 이용한 Cell line 별 HER2 발현양 비교
① 도 8-16의 4번 박스에 위치한 2725부분의 염기서열의 프라이머와 프로브(p1)을 가지고 HER2의 RT-qPCR을 이용한 민감도는 SK-BR-3 세포를 101, MCF7에서는 101까지 검출 할 수 있는 민감도를 확인할 수 있었다 (도 21-22).
② 2725부분의 염기서열의 프라이머와 프로브(p2)을 가지고 HER2의 RT-qPCR을 이용한 민감도는 SK-BR-3 세포를 101, MCF7에서는 102까지 검출할 수 있는 민감도를 확인 할 수 있었다 (도 23-24).
③ 2725부분의 염기서열의 프라이머와 프로브(p1-2mix)을 가지고 HER2의 RT-qPCR을 이용한 민감도는 SK-BR-3 세포를 101, MCF7에서는 101까지 검출할 수 있는 민감도를 확인 할 수 있었다 (도 25-26).
④ 도 1B의 4번 박스에 위치한 2740부분의 염기서열의 프라이머와 프로브(p1)을 가지고 HER2의 RT-qPCR을 이용한 민감도는 SK-BR-3 세포를 101, MCF7에서는 102까지 검출 할 수 있는 민감도를 확인할 수 있었다 (도 27-28).
⑤ 2740부분의 염기서열의 프라이머와 프로브(p2)을 가지고 HER2의 RT-qPCR을 이용한 민감도는 SK-BR-3 세포를 101, MCF7에서는 102까지 검출할 수 있는 민감도를 확인할 수 있었다 (도 29-30).
⑥ 2740부분의 염기서열의 프라이머와 프로브(P1-2mix)을 가지고 HER2의 RT-qPCR을 이용한 민감도는 SK-BR-3 세포를 한 개, MCF7에서는 101까지 검출할 수 있는 민감도를 확인할 수 있었다 (도 31-32).
2725-2740부위에서의 Ct값을 비교해 보면
2725부위의 동일 프라이머를 사용하면서 프로브의 위치만 변경하여 P1/P2/P1+2mix의 SKBR3과 MCF7 cell line의 106에서 각각 18.09/17.53/18.09로, 2740부위의 동일 프라이머를 사용하면서 프로브의 위치만 변경하여 P1/P2/P1+2mix의 SKBR3과 MCF7 cell line의 106에서 각각 17.72/16.77/16.72로 2725보다는 2740부위에서, P1과 P2보다는 P1+2mix에서 민감도가 상대적으로 높게 나타났다.
이처럼 single RT-qPCR을 통하여 위치에 따른 염기서열이 각기 다른 결과를 나타내어 민감도가 달라지는 것을 확인할 수 있었다.
(2) multiplex RT-qPCR을 이용한 각 Cell line 별 HER2 발현양 비교
앞에서 진행된 제작된 single RT-qPCR보다 두 염기서열을 혼합하였을 때의 민감도 변화를 알아보기 위하여 앞부분(605-612위치)과 중간부분 (2725-2740부위)의 염기서열을 서로 혼합하여 HER2 양성 유방암 세포주인 SK-BR-3과 MCF-7을 이용하여 HER2의 발현 민감도를 확인하였다.
Single RT-qPCR에서 2725-2740부위에서 P1-P2mix가 각각 넣었을 때의 결과보다 민감도가 높아서 P1-P2mix의 동일 조건으로 진행하였다.
① 도 33-34에서 보면 앞부분(605)과 중간부분(2725위치)의 염기서열을 가지고 HER2의 RT-qPCR을 이용한 민감도는 SK-BR-3 세포를 101, MCF7에서는 101까지 검출 할 수 있는 민감도를 확인할 수 있었다.
② 앞부분(612)과 중간부분(2725위치)의 염기서열을 가지고 HER2의 RT-qPCR을 이용한 민감도는 SK-BR-3 세포를 101, MCF7에서는 101까지 검출 할 수 있는 민감도를 확인 할 수 있었다(도 35-36).
③ 앞부분(605)과 중간부분(2740위치)의 염기서열을 가지고 HER2의 RT-qPCR을 이용한 민감도는 SK-BR-3 세포를 101, MCF7에서는 102까지 검출할 수 있는 민감도를 확인 할 수 있었다(도 37-38).
④ 앞부분(612)과 중간부분(2740위치)의 염기서열을 가지고 HER2의 RT-qPCR을 이용한 민감도는 SK-BR-3 세포를 한 개, MCF7에서는 102까지 검출할 수 있는 민감도를 확인할 수 있었다(도 39-40).
multiplex RT-qPCR의 경우는 앞에서 진행된 single RT-qPCR보다 민감도가 높아졌으나 이 경우도 앞부분의 612부위의 염기서열을 혼합할 때 나온 SKBR-MCF7 cell line의 Ct값은 각각 17.04와 19.56인 반면 605부위의 염기서열을 혼합할 때 나온 SKBR-MCF7 cell line의 Ct값은 각각 17.57과 20.32로 민감도가 낮아져서 어떤 부위의 염기서열을 서로 혼합하느냐에 따라 그 결과값이 달라 지는 것을 확인할 수 있었다.
(3) One-tube nested RT-qPCR을 이용한 각 Cell line별 HER2 발현양 비교
먼저, 앞에서 진행된 제작된 single RT-qPCR과 multiplex RT-qPCR의 결과보다 민감도를 높이고자 one-tube nested RT-qPCR 방법을 이용하여 민감도 변화를 알아보았다. 먼저 앞부분(605-612위치)의 염기서열을 이용하여 HER2 양성 유방암 세포주인 SK-BR-3과 MCF-7을 이용하여 HER2의 발현 민감도를 확인하였다. 그 결과 민감도는 SK-BR-3 세포를 한 개, MCF7에서는 101까지 검출할 수 있는 민감도를 확인 할 수 있었다(도 41-42).
SKBR3 cell line의 경우(106) single-multiplex RT-qPCR의 결과(각각 Ct값 18.64과 17.57)인 반면 one-tube nested RT-qPCR의 경우는 10.04로 나와 높은 민감도를 확인할 수 있었다.
다음, 중간부분(2725-2740)의 염기서열을 이용하여 one-tube nested RT-qPCR의 HER2 양성 유방암 세포주인 SK-BR-3을 이용하여 HER2의 발현 민감도를 확인하였다. Probe를 위치에 따라 P1/P2/P1+2mix로 각각 민감도 테스트를 진행하였다.
① 우선 SK-BR-3 세포를 이용하여 P1 프로브를 사용하였을 때의 결과를 보면, 106의 Ct값은 6.95로 높은 민감도를 보였으나 102 세포에서만 검출되었으며(도 43), P2 프로브를 사용 하였을때도 마찬가지로 106의 Ct값은 7.33으로 높은 민감도를 보였으나 102의 세포에서만 검출되었고(도 44), P1과 P2를 혼합하여 민감도를 확인한 결과 106의 Ct값은 7.76의 높은 민감도를 보였으나 102 세포에서만 검출되었다 (도 45).
② 앞부분(605-612)과 중간부분(2725-2740)의 염기서열을 혼합하여 one-tube nested RT-qPCR의 HER2발현양 비교하였다. 먼저 P1 프로브를 사용하였을 때의 결과를 보면 106의 Ct값은 6.95로 높은 민감도를 보이며 101 세포에서 검출되었으며(도 46), P2 프로브를 사용 하였을때도 마찬가지로 106의 Ct값은 6.54으로 높은 민감도를 보이며 101의 세포에서 검출되었고(도 47), P1과 P2를 혼합하여 민감도를 확인한 결과 106의 Ct값은 7.63의 높은 민감도를 보였으나 102 세포에서만 검출되었다 (도 48).
③ 앞부분(605-612)의 염기서열은 그대로 사용하며 중간부분을 각각 한 쌍의 프라이머에 2개의 프로브(P1-2)를 혼합하여 one-tube nested RT-qPCR의 HER2발현양 비교하여 보았다.
먼저 중간부분(2725)을 혼합하여 SK-BR-3와 MCF-7을 이용하여 HER2의 발현 민감도를 확인한 결과 106의 Ct값이 6.14와 9.61으로 높은 민감도를 보이며 전체 민감도가 세포 한 개와 101까지 검출되었고(도 49-50),
중간부분(2740)을 혼합한 결과에서는 106의 Ct값이 4.29와 9.2로 높은 민감도를 보이며 전체 민감도가 세포 101과 102까지 검출됨을 확인할 수 있었다(도 51-52).
앞서 진행된 실험을 3가지 방법에 따라 정리해 본 결과
Single RT-qPCR에서는 프라이머, 프로브의 위치에 따라 나타나는 HER2발현양상이 달라졌으며 앞쪽부분에서는 605부위보다는 612위치에서, 중간부분에서는 2725보다는 2740에서 P1이나 P2 각각의 프로브보다는 P1과 P2프로브를 합쳤을 때 민감도가 더 높게 나타났으며(106-105-104-103-102-101-100에서의 Ct값이 각각 16.72-18.96-20.23-23.27-25.79-26.7-34.27) 이 결과는 cell line이 달라져도 같은 경향을 보여줬다(표 1 및 2).
또한 multiplex RT-qPCR의 경우에는 605-2725, 612-2725, 605-2740부위들 보다는 612-2740부위의 염기서열을 혼합하였을 때 다른 3경우보다는 민감도가 높게 나타났다(106-105-104-103-102-101-100에서의 Ct값이 각각 17.04-19.29-23.37-23.8-27.91-31.25-33.49).
One-tube nested RT-qPCR조건을 이용한 방법에서도 앞선 single이나 multiplex RT-qPCR에서 어떠한 위치의 프라이머나 프로브를 섞느냐에 따라 나오는 값이 달라졌듯이 one-tube nested RT-qPCR에서도 보여줬다. one-tube nested RT-qPCR방법 자체는 Single RT-qPCR이나 multiplex RT-qPCR의 결과에서 보다 민감도는 좋아졌으나 중간부분의 2725와 2740부위의 염기서열을 섞은 경우는 오히려 결과값이 좋지 못하였다. 따라서 본 발명의 one-tube nested RT-qPCR방법의 최적 조건은 앞부분(605-612)-2740-P1-2mix로 나타났으며 각 Ct값의 비교를 보면 각각 106-105-104-103-102-101-100에서 4.29-10.26-13.28-16.26-19.79-23.04-25.65로 Single RT-qPCR<multiplex RT-qPCR<One-tube nested RT-qPCR으로 민감도가 104~106 이상이 높아지는 것을 확인할 수 있었다(표 3).
표 1
Single RT-qPCR (Ct) Multiplex RT-qPCR (Ct)
SKBR3 605 612 2725-P1 2725-P2 2725-P1-2 2740-P1 2740-P2 2740-P1-2 605-2725-P1-2 612-2725-P1-2 605-2740-P1-2 612-2740-P1-2
106 18.64 17.06 18.09 17.53 18.09 17.72 16.77 16.72 17.8 18.09 17.57 17.04
105 22.56 21.58 20.87 20.57 21.29 21.44 20.81 18.96 20.46 20.53 20.82 19.29
104 25.55 24.22 24.97 24.12 23.27 24.67 24.49 20.23 24.06 22.66 23.57 23.37
103 29.32 28.32 27.52 27.61 27.05 27.33 26.71 23.27 27.43 26.18 22.82 23.8
102 32 31.2 31.34 31.17 30.82 31.44 31.39 25.79 28.39 28.28 29.1 27.91
101 35.16 34.72 34.59 32.54 35.16 35.18 35.07 26.7 37.52 31.4 31.85 31.25
100 N/A 39.18 N/A N/A 37.84 37.84 N/A 34.27 N/A 38.04 39.39 33.49
표 2
Single RT-qPCR (Ct) Multiplex RT-qPCR (Ct)
MCF7 605 612 2725-P1 2725-P2 2725-P1-2 2740-P1 2740-P2 2740-P1-2 605-2725-P1-2 612-2725-P1-2 605-2740-P1-2 612-2740-P1-2
106 21.28 20.47 　 　 18.09 　 　 16.39 19.34 19.34 20.32 19.56
105 25.6 24.71 22.14 24.09 21.49 23.95 23.72 21.53 23.79 22.82 22.36 24.03
104 28.64 27.53 24.19 26.98 25.16 27.26 26.82 26.11 28.37 26.1 25.01 25.45
103 32.19 31.33 27.16 30.56 26.88 30.34 29.95 29.24 28.99 28.56 28.39 26.78
102 35.06 34.63 30.52 35.16 25.99 34.89 33.42 30 34.95 33.36 31.24 33.53
101 N/A N/A 35.24 N/A 33.87 N/A N/A 33.16 35.6 37.25 37.66 38.18
100 N/A N/A 36.08 N/A 36.16 N/A N/A 33.75 39.39 39.66 39.44 N/A
표 1 및 2는 Single-Multiplex RT-qPCR에 따른 HER2발현양 비교
표 3
one-tube nested RT-qPCR (Ct)
SKBR3 605-612 2725-2740-P1 2725-2740-P2 2725-2740-P1-2mix 605(612)-2725(2740)-P1 605(612)-2725(2740)-P2 605(612)-2725(2740)-P1-2mix 605(612)-2725-P1-2mix 605(612)-2740-P1-2mix
106 10.04 6.95 7.33 7.76 6.95 6.54 7.63 6.14 4.29
105 13.63 8.89 8.71 8.22 7.33 7.35 9.18 10.89 10.26
104 17.15 11.93 11.36 12.08 12.3 12.33 11.51 14.01 13.28
103 20.4 16.5 17.23 18.43 14.95 16.5 15.23 17.06 16.26
102 24.08 28.82 33.57 37.19 21.5 25.1 26.77 20.8 19.79
101 28.04 N/A N/A N/A 21.97 26.23 N/A 25.15 23.04
100 29.76 N/A N/A N/A N/A N/A N/A N/A 25.65
표 3은 one-tube nested RT-qPCR에 따른 HER2발현양 비교
유방암 세포주를 이용한 HER2 mRNA의 발현양상 비교
유방암 세포 cell line인 SK-BR3, MCF7, MDA-MB-231 세포주를 이용하여 각 세포주의 HER2의 발현양을 비교 하였다. HER2 음성 세포 주인 MDA-MB-231 세포주의 HER2 발현을 1로 정했을 때, MCF7의 HER2 발현양은 약 5.4로 나타났고, SK-BR-3의 HER2 발현양은 약 56.9를 나타내는 것을 확인 할 수 있었다.
임상적 Cut-off의 설정
신촌 세브란스 병원에서 제공 받은 유방암 환자의 199명의 FFPE 검체를 이용하여 HER2 RT-qPCR을 수행한 후 그 결과를 유방암 환자의 IHC Score와 FISH 결과와 비교해 보았다. IHC 0 인 경우 0으로 IHC 1+인 경우 25로 IHC 2+이면서 FISH음성일 경우 50으로 IHC 2+면서 FISH 양성일 경우는 75로 IHC 3+ 인 경우는 100으로 각각 Score를 지정한 후 그 결과를 HER2 RT-qPCR과 one-tube nested RT-qPCR의 결과를 비교하였다.
도 54는 single RT-qPCR을 이용한 발현양 비교이며 도 55는 multiplex RT-qPCR, 도 56은 one-tube nested RT-qPCR 각각 이용한 발현양 비교로 도 안의 파란박스는 IHC 2+/FISH 양성과 IHC 3+로 HER2 양성으로 확인된 환자 검체이나 single RT-qPCR과 multiplex RT-qPCR의 경우는 검체 일부가 음성과 양성의 경계선에서 발현양이 분포되어 있었으나 반면 one-tube nested RT-qPCR 조건의 경우는 모두 양성발현의 결과를 보여주었다.
임상평가에서도 one-tube nested RT-qPCR 조건의 경우가 다른 두 방법의 경우보다 민감도가 높아짐을 확인 할 수 있었다.
ROC curve를 이용한 임상결과 분석
FFPE 검체를 이용한 실험에서는 검체의 RNA quality가 매우 중요하다. RNA의 quality가 높은 검체는 정확한 결과를 나타낼 수 있는 반면에 RNA quality가 낮다면 위양성 혹은 위음성의 결과를 나타낼 수 있다. 따라서 본 발명에서는 RNA quality의 정도를 GAPDH의 발현양을 기준으로 제시하였다. 도 57-59에서 볼 수 있듯이 GAPDH의 발현 정도를 RT-qPCR의 Ct 값을 기준으로 하여 분류해 보았을 때 GAPDH의 Ct 값이 낮은 값을 가질수록 더 정확한 결과를 나타내는 것을 확인 할 수 있었다.
이때 ROC curve(receiver operating characteristic)는 어떤 검사의 판단결과(binary classifier)의 performance를 보여주는 그래프로,
TPR(true positive rate) or sensitivity, 을 y 축으로
FPR(false positive rate) or 1-specificity 을 x 축으로 가진다.
즉, TRP = y축 = sensitivity = (TP / (TP + FN)
FPR = x 축 = 1-specificity = 1 - [ TN / (TN + FP)] 로 계산된다.
표 4
position name sequence (5'-3') Modification
605 HER605-F AACCTGGAACTCACCTACCTGCCCAC(서열번호 1) 　
　 HER689-R CGATGAGCACGTAGCCCTGCAC (서열번호 2) 　
　 　 　 　
612 HER612-F AACTCACCTACCTGCCCACCAAT (서열번호 3) 　
　 HER680-R CACGTAGCCCTGCACCTCCT(서열번호 4) 　
　 HER637-P CAGCCTGTCCTTCCTGCAGGATATC(서열번호 5) FAM-BHQ1
　 　 　 　
2725 HER2725-F AGAAATCTTAGACGAAGCATACGTGAT(서열번호 6) 　
　 HER2865-R TCCCGGACATGGTCTAAGAGGCA (서열번호 7) 　
　 　 　 　
2740 HER2740-F1 AAGCATACGTGATGGCTGGTG T (서열번호 8) 　
　 HER2853-R1 TCTAAGAGGCAGCCATAGGGCATA(서열번호 9) 　
　 　 　 　
　 HER2-P1 ATATGTCTCCCGCCTTCTGGGCATCT(서열번호 10) FAM-BHQ1
　 HER2-P2 CATCCACGGTGCAGCTGGTGACACA(서열번호 11) FAM-BHQ1
　 　 　 　
　 GAPDH-F CCATCTTCCAGGAGCGAGATCC(서열번호 12) 　
　 GAPDH-R ATGGTGGTGAAGACGCCAGTG(서열번호 13) 　
　 GAPDH-P TCCACGACGTACTCAGCGCCAGCA(서열번호 14) Cy5-BHQ2
표 4는 본 발명에서 사용된 염기서열 목록
본 발명은 간편하고 정량적인 결과를 도출할 수 있는 실시간 RT-PCR법에 기초하여 HER 2 mRNA를 이용한 유전자 증폭 방법을 이용하기 때문에 단백질을 검출하는 방법보다 눈에 보이지 않은 정도의 양도 검출할 수 있고, 항원항체 반응을 사용하지 않기 때문에 값싼 검사 방법을 제공할 수 있다. 또 기존에 알려진 서열에 비하여 더 민감도가 높다는 것을 확인할 수 있었고, 또한 전기 영동을 이용하여 밴드를 확인하는 단계가 없기 때문에 더 손쉽게 결과를 확인할 수 있다. 또한 본 발명의 one tube nested RT-qPCR방법 자체는 Single RT-qPCR이나 multiplex RT-qPCR의 결과에서 보다 민감도가 좋아지는 효과가 있다.
도 1-16은 본 발명에 사용된 염기서열 위치로 HER2 유전자 (4.6Kb)에서 앞부분(605-612부위;도 1-7)과 중간부분(2.7kb-4번 위치;도 8-16)의 두 부위를 대상으로 제작된 primer & probe염기서열을 이용하여 본 발명을 진행하였다.
도 17-18은 앞부분의 서로 다른 부위의 염기서열을 가지고 Cell line을 이용한 HER2발현양 비교
도 19-20은 Cell line을 이용한 HER2발현양 비교
도 21-22는 2725부위의 프라이머와 P1프로브를 이용한 HER2발현양 비교
도 23-24는 2725부위의 프라이머와 P2프로브를 이용한 HER2발현양 비교
도 25-26은 2725부위의 프라이머와 P1-2mix프로브를 이용한 HER2발현양 비교
도 27-28은 2740부위의 프라이머와 P1프로브를 이용한 HER2발현양 비교
도 29-30은 2740부위의 프라이머와 P2프로브를 이용한 HER2발현양 비교
도 31-32는 2740부위의 프라이머와 P1+2mix 프로브를 이용한 HER2발현양 비교
도 33-34는 앞부분(605)과 중간부분(2725위치)의 염기서열을 이용한 HER2발현양 비교
도 35-36은 앞부분(612)과 중간부분(2725위치)의 염기서열을 이용한 HER2발현양 비교
도 37-38은 앞부분(605)과 중간부분(2740위치)의 염기서열을 이용한 HER2발현양 비교
도 39-40은 앞부분(612)과 중간부분(2740위치)의 염기서열을 이용한 HER2발현양 비교
도 41-42는 앞 부분(605-612) 염기서열을 이용한 one-tube nested RT-qPCR의 HER2발현양 비교
도 43-45는 중간 부분(2725-2740)의 염기서열을 이용한 one-tube nested RT-qPCR의 HER2발현양 비교
도 46-48은 앞 부분(605-612)과 중간 부분(2725-2740)을 혼합한 염기서열을 이용한 one-tube nested RT-qPCR의 HER2발현양 비교
도 49-50은 앞부분(605-612)과 중간부분(2725)을 혼합한 염기서열을 이용한 one-tube nested RT-qPCR의 HER2발현양 비교
도 51-52는 앞부분(605-612)과 중간부분(2740)을 혼합한 염기서열을 이용한 one-tube nested RT-qPCR의 HER2발현양 비교
도 53은 유방암 세포주를 이용한 HER2 mRNA의 발현양상 비교
도 54-56는 IHC-FISH결과에 따른 single RT-qPCR의 임상 발현양비교
도 57-59는 임상적 Cut-off 결정을 위한 ROC curve 분석법
이하, 본 발명의 실시예에 대하여 첨부된 도면을 참조하면서 상세히 설명하기로 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1: 재료
2010년부터 2011년까지 신촌 세브란스병원에서 199명의 환자의 FFPE (Formalin Fixed Paraffin Embbeded) 조직을 이용하였다. 환자의 조직학적 HER2의 발현여부는 면역조직화학 염색법 (IHC)과 형광동소보합법 (FISH)을 수행하여 확인하였다. 또한 HER2의 발현 여부를 확인하기 위하여 유방암 Cell line인 SK-BR3, MCF7, MDA-MB 231을 사용하여 HER2의 발현 여부를 확인하였다.
실시예 2: 면역조직화학염색법 (Immunohistochemistry ; IHC)
파라핀 블록을 4 ㎛ 두께로 박절하여 슬라이드에 부착시키고 충분히 건조시킨 후 BenchMark ST (Ventana medical system, USA) 자동면역염색기기를 이용하여 면역조직화학염색을 시행하였다. 일차항체는 polyclonal rabbit anti-human c-erbB-2 oncoprotein (A0485, DakoCytomation, Glostrup, Denmark)을 1:1,000으로 희석하여 이용하였다. 이러한 방법으로 슬라이드를 염색한 후 암세포의 세포막에 HER2 단백질이 염색되는 정도에 따라 4가지 등급, 즉 0, 1+, 2+, 3+으로 나누어 판정하였다. 그 중에서 0, 1+ 일 경우 HER2 음성으로 진단하고, 3+ 일 경우 양성으로 진단하였으며, 2+일 경우 환자의 임상정보에 따라 양성 혹은 FISH를 수행하여 진단을 하였다.
실시예 3: 형광동소보합법 (Fluorescence in situ Hybridization ; FISH )
HER2 IHC법에서 2+가 나온 환자를 대상으로 하여, 파라핀으로 고정되어 있는 조직 블록을 microtome을 이용하여 4 ㎛ 두께로 박절하여 슬라이드에 부착시킨 후, 탈파라핀화 및 함수 과정을 거쳐 상용화된 HER2 DNA probe kit (Vysis Inc, Downers Grove, IL, USA)를 이용하여 제조사의 지침에 따라 실험을 진행하였다. HER2 발현 여부는 유전자 발현 정도에 따라서 Amplification Index가 2.2 이상일 경우 양성으로 판독하였다.
실시예 4: 분리된 조직에서 Total RNA 분리
FFPE 조직을 10 ㎛의 두께로 박절한 2장의 조각을 이용하여, 탈파라핀화 과정을 거친 후 자동핵산 추출 장비인 MagNApure LC RNA Isolation Kit III (Roche) 를 이용하여 RNA를 추출하였다.
Cell line의 경우 각각의 Cell line의 세포 수를 1 x 106으로 맞춘 후 Trizol을 이용하여 제조 업체의 프로토콜에 따라 Total RNA를 분리 하였다. 분리한 Total RNA는 NanoQuant system (TECAN)을 이용하여 정량 하였다.
실시예 5: 분리된 Total RNA로부터 cDNA 제작 및 Real-time PCR 수행
i. cDNA 합성
분리된 total RNA 0.5~3ug, random primer (Invitrogen) 0.25 ug, dNTP(Intron) 250 uM, Tris-HCl(pH 8.3) 50 mM, KCl 75 mM, MgCl2 3 mM, DTT 8 mM 와 MMLV 역전사 중합효소 200 units (Invitrogen)을 첨가하고 최종부피를 30 ul가 되도록 DEPC treated DW를 넣고 잘 섞은 후 합성 반응액을 thermocycler (ABI)에서 25℃에서 10 분, 37℃에서 50 분, 70℃에서 15 분간 반응시켜 cDNA를 합성하였다.
ii. RT-qPCR 수행
Real-time PCR의 반응물의 조성은 25 mM TAPS (pH 9.3 at 25°C), 50 mM KCl, 2 mM MgCl2, 1 mM 2-mercaptoethanol, 200 μM each dNTP, 1 unit Taq polymerase (TAKARA)와 Forward primer와 Reverse primer를 각각 10pmole을 넣어주고, probe 또한 10pmole을 넣어 주고, 합성된 cDNA를 2ul를 넣고 최종 부피를 20ul가 되게 수행한다. 각각의 프라이머와 프로브의 염기서열은 표 4에 기재되었다.
PCR 반응은 CFX 96 (Bio-rad, USA) 이용하였으며 변성 온도 2가지의 방법으로 진행하였다.
Single RT-PCR의 경우에는 94℃에서 3분 동안 1회 수행하고, 변성 온도 95℃에서 30초, 어닐링 온도 55℃에서 40초인 사이클을 40회 반복하여 수행하였고,
One-tube nested RT-PCR의 경우에는 94℃에서 3분 동안 1회 수행하고, 변성 온도 95℃에서 30초, 어닐링 온도 60℃에서 10사이클을 먼저 수행한 후 다시 95℃에서 30초, 55℃에서 40초인 사이클을 40회 반복하여 수행하였다.
또한 각각의 어닐링 과정 후 형광을 측정하는 과정을 추가하여, 각 사이클 별로 증가되는 형광 값을 측정하였다.
실시예 6: 결과의 분석
각 실험의 결과는 Bio-Rad CFX manager v1.6 (Bio-Rad)을 이용하여 분석 하였다. 유방암 세포인 SK-BR3와 MCF7을 106부터 1세포까지 단계적으로 희석하여 상대적 정량 곡선을 그려서 Ct value를 이용하여 발현양을 비교 정량하여 발현율을 살펴 보았다. 이때 GAPDH의 발현양을 기준으로 하여 각각의 HER2의 발현양을 비교 하였고, HER2 음성 유방암 세포 주인 MDA-MB-231의 HER2 발현양을 1로 기준을 정한 후 각 검체 및 세포주의 HER2의 발현양을 제시하였다.
실시예 7: Software 분석을 통한 증폭여부 확인 및 증폭된 산물의 정량
qRT-PCR의 특정유전자 발현량을 정량하는 방법 중 하나인 Comparative Ct Method를 이용하여 하기 관계식에 의거하여 측정하였고 이 공식은 Bio-Rad CFX Manager Software에 내재되어 있어 자동으로 계산되어 나온다.
[관계식 1]
ΔΔCt= ΔCt(sample) - ΔCt(reference gene)
여기에서 Ct값이란 PCR과정 중 증폭이 뚜렷하게 증가되기 시작한 Cycle의 수치를 나타낸다.
ΔΔCt는 하기 도 3에서 세로축의 수치(mRAN expression ratio)를 의미한다.
[관계식 2]
양성대조군에서 HER2의 발현량 분석 관계식
SKBR3의 ΔCt 값 = SKBR3에서 HER2의 Ct 값- SKBR3에서 reference gene (GAPDH)의 Ct 값
THP-1의 ΔCt 값 = THP-1에서 HER2의 Ct 값 - THP-1에서 reference (GAPDH) gene의 Ct 값
R (발현량) = SKBR3의 ΔCt값 - THP-1의 ΔCt값
[관계식 3]
유방암 환자 조직 샘플에 대한 HER2의 발현량 분석 관계식
유방암 환자 조직에서의 ΔCt 값 = 유방암 환자 조직에서 HER2의 Ct 값 - 조직에서 reference(GAPDH) gene 의 Ct 값
THP-1의 ΔCt 값 = THP-1에서 HER2의 Ct 값 - THP-1에서 reference (GAPDH) gene의 Ct 값
R (발현량) = 유방암 환자 조직에서 ΔCt값 - THP-1에서의 ΔCt값
본 실험에서 사용된 reference gene의 Ct 값은 GAPDH에 대한 Ct값을 나타내며, reference gene이란 본 실험에 사용된 GAPDH이외에도 다른 house keeping gene이 포함될 수 있다.
SKBR3 : positive control 로써 실제로 HER2의 발현이 과발현 되었는지를 확인할 수 있다.

Claims (7)

  1. a) 암 의심환자의 혈액에서 얻은 세포로부터 전장 RNA를 분리하는 단계;
    b) 상기 분리된 전장 RNA로부터 cDNA를 합성하는 단계;
    c) 상기 합성된 cDNA를 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 프라이머쌍 및 프로브, 및 글리세르알데히드 -3-인산 탈수소효소(GAPDH)를 증폭할 수 있는 프라이머쌍 및 프로브로 구성된 군으로부터 선택된 하나 이상의 프라이머쌍 및 프로브를 이용하여 실시간-PCR을 수행하는 단계; 및
    d) 상기 증폭된 양을 정상인에 대해 발현된 양과 비교하는 단계;를 포함하며,
    여기서, 상기 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 프라이머쌍은 서열번호 1 및 2, 서열번호 3 및 4, 서열번호 6 및 7, 및 서열번호 8 및 9의 프라이머 쌍으로 구성된 군으로부터 선택된 프라이머쌍 또는 이들 프라이머 쌍의 혼합물이고, 프로브는 서열번호 5, 서열번호 10 및 11의 프로브 중 하나 이상인 것을 특징으로 하는 유방암의 진단을 위한 정보제공방법.
  2. 제 1항에 있어서, 상기 증폭된 양을 정상인에 대해 증폭된 양과 비교하는 단계는 표준 또는 컷오프 값에 의하여 수행되는 것을 특징으로 하는 유방암의 진단을 위한 정보제공방법.
  3. 제 1항에 있어서, 상기 GAPDH를 증폭할 수 있는 프라이머쌍은 서열번호 12 및 13에 기재되고, 프로브는 서열번호 14에 기재된 염기서열을 가지는 것을 특징으로 하는 유방암의 진단을 위한 정보제공방법.
  4. 인간 표피 증식인자 수용체 (HER) 2를 증폭할 수 있는 서열번호 1 및 2, 서열번호 3 및 4, 서열번호 6 및 7, 및 서열번호 8 및 9의 프라이머 쌍으로 구성된 군으로부터 선택된 프라이머쌍 또는 이들 프라이머 쌍의 혼합물; 및
    GAPDH를 증폭할 수 있는 프라이머쌍과 및 프로브를 유효성분으로 포함하는 유방암 진단용 조성물.
  5. 제 4항에 있어서, 상기 GAPDH를 증폭할 수 있는 프라이머쌍은 서열번호 12 및 13에 기재되고, 프로브는 서열번호 14에 기재된 염기서열을 가지는 것을 특징으로 하는 유방암 진단용 조성물.
  6. 제 4항 또는 제5항에 있어서, 상기 프로브의 5'말단은 형광물질로 표지된 것을 특징으로 하는 유방암 진단용 조성물.
  7. 제4항 또는 제5항의 조성물을 포함하는 유방암 진단용 키트.
PCT/KR2014/001697 2014-02-25 2014-02-28 개선된 유방암에 대한 정보제공 방법 및 그 진단용 키트 WO2015129942A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CA2948051A CA2948051A1 (en) 2014-02-25 2014-02-28 Improved method for providing information on breast cancer and diagnostic kit therefor
US15/121,377 US20200131579A1 (en) 2014-02-25 2014-02-28 Improved method for providing information on breast cancer and diagnostic kit therefor

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020140022078A KR101586846B1 (ko) 2014-02-25 2014-02-25 개선된 유방암에 대한 정보제공 방법 및 그 진단용 키트
KR10-2014-0022078 2014-02-25

Publications (1)

Publication Number Publication Date
WO2015129942A1 true WO2015129942A1 (ko) 2015-09-03

Family

ID=54009247

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/001697 WO2015129942A1 (ko) 2014-02-25 2014-02-28 개선된 유방암에 대한 정보제공 방법 및 그 진단용 키트

Country Status (4)

Country Link
US (1) US20200131579A1 (ko)
KR (1) KR101586846B1 (ko)
CA (1) CA2948051A1 (ko)
WO (1) WO2015129942A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MA41742B1 (fr) * 2017-12-29 2020-02-28 Moroccan Foundation For Advanced Science Innovation And Res Mascir Méthode pour la détermination du seuil de positivité de la surexpression de la protéine her2 dans le cancer de sein et d'autres cancers.

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013077479A1 (ko) * 2011-11-24 2013-05-30 엠앤디(주) 실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트
KR20130057711A (ko) * 2011-11-24 2013-06-03 엠앤디 (주) 실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013077479A1 (ko) * 2011-11-24 2013-05-30 엠앤디(주) 실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트
KR20130057711A (ko) * 2011-11-24 2013-06-03 엠앤디 (주) 실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ANDERGASSEN, U. ET AL.: "Detection of Tumor Cell -Specific mRNA in the Peripheral Blood of Patients with Breast Cancer-Evaluation of Several Markers with Real-Time Reverse Transcription-PCR", INT. J. MOL. SCI., vol. 14, no. 1, 8 January 2013 (2013-01-08), pages 1093 - 1104, XP055221536 *
BENOY, I. H. ET AL.: "Detection of circulating tumour cells in blood by quantitative real- time RT-PCR: effect of pre-analytical time", CLIN. CHEM. LAB. MED., vol. 44, no. 9, 2006, pages 1082 - 1087 *
LAMY, P. J. ET AL.: "Reliability and discriminant validity of HER2 gene quantification and chromosome 17 aneusomy analysis by real-time PCR in primary breast cancer", INT. J. BIOL. MARKERS, vol. 21, no. 1, 2006, pages 20 - 29, XP055221538 *
LIANIDOU, E. S. ET AL.: "Circulating tumor cells in breast cancer: detection systems, molecular characterization, and future challenges", CLIN. CHEM., vol. 57, no. 9, 22 July 2011 (2011-07-22), pages 1242 - 1255, XP055101669 *

Also Published As

Publication number Publication date
CA2948051A1 (en) 2015-09-03
US20200131579A1 (en) 2020-04-30
KR20150100360A (ko) 2015-09-02
KR101586846B1 (ko) 2016-01-19

Similar Documents

Publication Publication Date Title
USRE49542E1 (en) Method for the detection of cancer
DK2456889T3 (en) Markers of endometrial cancer
EP2890815A2 (en) Methods for diagnosis and treatment of cancer
WO2011122857A9 (ko) 유방암 예후 예측을 위한 조성물 및 이를 포함하는 키트
WO2011081421A2 (en) Complement c9 as markers for the diagnosis of cancer
WO2015129942A1 (ko) 개선된 유방암에 대한 정보제공 방법 및 그 진단용 키트
WO2014014157A1 (ko) 위암 진단 및 치료를 위한 ａｄｃｙ3의 용도
GB2519830A (en) Methods for monitoring treatment response and relapse in ovarian cancer
WO2012115493A9 (ko) 암에 대한 바이오마커 및 이를 이용한 암 진단
WO2010126338A2 (ko) 유방암 진단용 바이오마커 및 유방암 진단제
WO2013077479A1 (ko) 실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트
WO2021025412A1 (ko) 보체 성분 c8 감마를 이용한 알츠하이머병의 진단방법
WO2015046638A1 (ko) 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소 연쇄반응 키트
WO2015093670A1 (ko) 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소연쇄반응 키트
JP6820014B2 (ja) 子宮体がんのリンパ節転移能の評価方法
WO2018155948A1 (ko) 폐암 환자의 생존 예후 예측용 마커
WO2022092702A1 (ko) 인간 유방암 및 동물 유선암의 진단 및 악성도 평가를 위한 바이오마커로서 smp30의 용도
KR101528331B1 (ko) 조직 및 혈액을 이용한 유방암의 치료제 선별 검사 및 조기진단을 위한 역전사 정량적 중합효소연쇄반응 키트
WO2011132872A9 (ko) 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트
KR101350747B1 (ko) 실시간 역전사효소 중합반응을 이용한 유방암의 진단을 위한 정보제공방법 및 이를 위한 유방암진단용 키트
WO2023234586A1 (ko) 신규한 mfsd7-atp5l 융합유전자 및 이의 용도
WO2023149608A1 (ko) 흑색종 치료 내성 예측용 trim51 바이오마커 및 이의 용도
WO2024151138A1 (ko) 엑소좀을 이용한 편평상피세포 폐암 진단 또는 예후 예측용 바이오마커 및 이의 용도
WO2023128429A1 (ko) 대장암 및 진행 선종의 선별 검사 방법 및 그 응용
Mollerup et al. In situ hybridization

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14883759

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2948051

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14883759

Country of ref document: EP

Kind code of ref document: A1