WO2012145596A1 - Filamentous fungi having an altered viscosity phenotype - Google Patents
Filamentous fungi having an altered viscosity phenotype Download PDFInfo
- Publication number
- WO2012145596A1 WO2012145596A1 PCT/US2012/034405 US2012034405W WO2012145596A1 WO 2012145596 A1 WO2012145596 A1 WO 2012145596A1 US 2012034405 W US2012034405 W US 2012034405W WO 2012145596 A1 WO2012145596 A1 WO 2012145596A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gene
- strain
- crzl
- protein
- variant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/36—Adaptation or attenuation of cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
Definitions
- 61/478,162, and 61/478,160 both filed on April 22, 2011 and 61/480,610, 61/480,602 and 61/480,629, each filed on April 29, 2011, which are hereby incorporated by reference in their entirety.
- the present strains and methods relate to genetic mutations in filamentous fungi that give rise to strain variants having altered growth characteristics. Such variants are well-suited for growth in submerged cultures, e.g. , for the large-scale production of enzymes and other proteins or metabolites for commercial applications.
- Filamentous fungi are capable of expressing native and heterologous proteins to high levels, making them well-suited for the large-scale production of enzymes and other proteins for industrial, pharmaceutical, animal health and food and beverage applications.
- Filamentous fungi 2 o are typically grown in mycelial submerged cultures in bioreactors, which are adapted to
- the morphological characteristics of the mycelium affect the rheological properties of the broth, thereby affecting bioreactor performance.
- the viscosity of the broth becomes sufficiently high to significantly interfere with the dissolution of oxygen and nutrients, thereby adversely affecting the growth of the fungi. Additionally, the power required to mix and aerate viscous broth can significantly increase the cost of production, and incur higher capital expenditures in terms of motors and power supplies.
- a variant strain of filamentous fungus derived from a parental strain is
- the variant strain comprising a genetic alteration that causes cells of the variant strain to produce an altered amount of functional Crzl protein compared to cells of the parental strain, wherein the cells of the variant strain are produced during aerobic fermentation in submerged culture cell broth that (i) requires an altered amount of agitation to maintain a preselected dissolved oxygen content compared to the cells of the parental strain, and/or (ii) maintains an altered dissolved oxygen content at a preselected amount of agitation, compared to the cells of the parental strain.
- the altered amount of functional Crzl protein is a reduced amount
- the variant strain produces during aerobic fermentation in submerged culture a cell broth that (i) requires reduced agitation to maintain a preselected dissolved oxygen content compared to the cells of the parental strain, and/or (ii) maintains an increased dissolved oxygen content at a preselected amount of agitation, compared to the cells of the parental strain.
- the genetic alteration comprises a disruption of the crzl gene present in the parental strain.
- disruption of the crzl gene is the result of deletion of all or part of the crzl gene.
- disruption of the crzl gene is the result of deletion of a portion of genomic DNA comprising the crzl gene.
- disruption of the crzl gene is the result of mutagenesis of the crzl gene.
- disruption of the crzl gene is performed using site-specific recombination. In some embodiments, disruption of the crzl gene is performed in combination with introducing a selectable marker at the genetic locus of the crzl gene.
- the variant strain does not produce functional Crzl protein. In some embodiments, the variant strain does not produce Crzl protein.
- the variant strain further comprises a gene encoding a protein of interest. In some embodiments, the variant strain further comprises a disruption of the sft>3 gene. In some embodiments, the variant strain further comprises a disruption of the sebl gene. In some embodiments, the variant strain further comprises a disruption of the sft>3 and sebl genes. In some embodiments, the variant strain further comprises a disruption of at least one gene selected from the group consisting of the sfb3 gene, the sebl gene, the mpgl gene, the gasl gene, and the tps2 gene. In some embodiments, the variant strain produces substantially the same amount of, or more, protein per unit amount of biomass as the parental strain.
- the filamentous fungus is a Pezizomycotina species.
- the filamentous fungus is a Trichoderma spp., Aspergillus spp., Fusarium spp., Scedosporium spp., Penicillium spp., Chrysosporium spp., Cephalosporium spp., Talaromyces spp., Geosmithia spp., and Neurospora spp.
- the filamentous fungus can include, but is not limited to, Trichoderma reesei (previously classified as Trichoderma longibrachiatum and Hypocrea jecorina), Aspergillus niger, Aspergillus fumigatus, Aspergillus itaconicus, Aspergillus oryzae, Aspergillus nidulans, Aspergillus terreus, Aspergillus sojae, Aspergillus japonicus, Scedosporium prolificans, Neurospora crassa, Penicillium funiculosum, Penicillium chrysogenum, Talaromyces (Geosmithia) emersonii, Fusarium venenatum, and 5 Chrysosporium lucknowense.
- the filamentous fungus is Trichoderma reesei.
- a method for producing a variant strain of filamentous fungus cells comprising: introducing a genetic alteration into a parental strain of filamentous fungal cell, which genetic alteration alters the production of functional Crzl protein compared to o the cells of the parental strain, thereby producing a variant filamentous fungal cell that produces during aerobic fermentation in submerged culture a cell broth that (i) requires an altered amount of agitation to maintain a preselected dissolved oxygen content, compared to the cells of the parental strain, and/or (ii) maintains an altered dissolved oxygen content at a preselected amount of agitation, compared to the cells of the parental strain.
- the genetic alteration reduces or prevents the production of
- the genetic alteration comprises disrupting the crzl gene in a parental filamentous fungal cell using genetic manipulation. In some embodiments, the genetic alteration comprises deleting the crzl gene in a parental filamentous fungal cell using genetic manipulation. In some embodiments, the genetic alteration is performed using site-specific 5 genetic recombination.
- disruption of the crzl gene is performed in combination with introducing a selectable marker at the genetic locus of the crzl gene.
- the variant strain produces substantially the same amount of, or more, protein per unit amount of biomass as the parental strain.
- disruption of the crzl gene is performed 0 in combination with disrupting the sft>3 gene.
- disruption of the crzl gene is performed in combination with disrupting at least one gene selected from the group consisting of the sft>3 gene, the sebl gene, the mpgl gene, the gasl gene, and the tps2 gene.
- the variant strain produces substantially the same amount of, or more, protein per unit amount of biomass as the parental strain.
- the filamentous fungus is a Pezizomycotina species.
- the filamentous fungus is a Trichoderma spp., Aspergillus spp., Fusarium spp., Scedosporium spp., Penicillium spp., Chrysosporium spp., Cephalosporium spp., Talaromyces spp., Geosmithia spp., and Neurospora spp.
- the filamentous fungus can include, but is not limited to, Trichoderma reesei (previously classified as Trichoderma longibrachiatum and Hypocrea jecorina), Aspergillus niger, Aspergillus fumigatus, Aspergillus itaconicus, Aspergillus oryzae, Aspergillus nidulans, Aspergillus terreus, Aspergillus sojae, Aspergillus japonicus, Scedosporium prolificans, Neurospora crassa, Penicillium funiculo sum, Penicillium chrysogenum, Talaromyces (Geosmithia) emersonii, Fusarium venenatum, and Chrysosporium lucknowense.
- the filamentous fungus is Trichoderma reesei.
- the parental strain further comprises a gene encoding a protein of interest.
- the gene encoding the protein of interest is present in the parental strain prior to introducing the genetic alteration that reduces or prevents the production of functional Crzl protein.
- the protein of interest within the parental strain is encoded by an endogenous gene or a heterologous gene.
- a variant strain of filamentous fungus derived from a parental strain comprising: (a) a genetic alteration that results in (i) a requirement for reduced agitation in submerged culture to maintain a preselected dissolved oxygen content, compared to the cells of the parental strain, and/or (ii) maintenance of an increased dissolved oxygen content in submerged culture at a preselected amount of agitation, compared to the cells of the parental strain, and (b) a gene encoding a protein of interest, wherein the gene encoding the protein of interest is present in the variant strain prior to the genetic alteration in (a).
- the genetic alteration of the resulting variant strain comprises a disruption of the crzl gene present in the parental strain.
- disruption of the crzl gene is performed in combination with introducing a selectable marker at the genetic locus of the crzl gene.
- disruption of the crzl gene is performed in combination with disrupting the sft>3 gene.
- disruption of the crzl gene is performed in combination with disrupting the sebl gene.
- disruption of the crzl gene is performed in combination with disrupting at least one gene selected from the group consisting of the sfb3 gene, the sebl gene, the mpgl gene, the gasl gene, and the tps2 gene.
- Figure 1 is a map of the crzl disruption vector, pRATT261-crzlD, as described in Example 1.
- the present strains and methods relate to variant strains of filamentous fungus cells having genetic modifications that affect their morphology and growth characteristics.
- the variant cells When the variant cells are grown in submerged culture, they produce a cell broth that has different rheological properties compared to a cell broth comprising cells of the parental strain.
- Some of these variant strains are well-suited for the large-scale production of enzymes and other commercially important proteins .
- Trichoderma reesei refers to a filamentous fungus of the phylum Ascomycota, subphylum Pezizomycotina. This organism was previously classified as
- Trichoderma longibrachiatum or as Hypocrea jecorina.
- variant strain of filamentous fungus cells refer to strains of filamentous fungus cells that are derived ⁇ i.e., obtained from or obtainable from) from a parental (or reference) strain belonging to the Pezizomycotina, e.g., by genetic manipulation.
- parental and variant strains can be described as having certain characteristics, such as genetic modifications, expression phenotypes,
- protein of interest refers to a polypeptide that is desired to be expressed in a filamentous fungus.
- a protein can be an enzyme, a substrate-binding protein, a surface-active protein, a structural protein, or the like, and can be expressed at high levels, and can be for the purpose of commercialization.
- the protein of interest can be encoded by an endogenous gene or a heterologous gene relative to the variant strain and/or the parental strain.
- the protein of interest can be expressed intracellularly or as a secreted protein.
- the phrase "substantially free of an activity," or similar phrases, means that a specified activity is either undetectable in an admixture or present in an amount that would 5 not interfere with the intended purpose of the admixture.
- polypeptide and protein are used interchangeably to refer to polymers of any length comprising amino acid residues linked by peptide bonds.
- the conventional one-letter or three-letter codes for amino acid residues are used herein.
- the polymer can be linear or branched, it can comprise modified o amino acids, and it can be interrupted by non-amino acids.
- the terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component.
- proteins As used herein, functionally and/or structurally similar proteins are deemed “related proteins.” Such proteins can be derived from organisms of different genera and/or species, or even different classes of organisms (e.g. , bacteria and fungi). Related proteins also encompass o homologs determined by primary sequence analysis, determined by secondary or tertiary
- derivative polypeptide/protein refers to a protein, which is derived or derivable from a protein by addition of one or more amino acids to either or both the N- and C-terminal end(s), substitution of one or more amino acids at one or a number of
- the preparation of a protein derivative can be achieved by modifying a DNA sequence, which encodes for the native protein, transformation of that DNA sequence into a suitable host, and expression of the modified DNA 0 sequence to form the derivative protein.
- variant proteins include "variant proteins.” Variant proteins differ from a reference/parental protein (e.g. , a wild-type protein) by substitutions, deletions, and/or insertions at a small number of amino acid residues.
- the number of differing amino acid residues between the variant and parental protein can be one or more, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or more amino acid residues.
- Variant proteins can share at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99%, or more, amino acid sequence identity with a reference protein.
- a variant protein can also differ from a reference protein in selected motifs, domains, epitopes, conserved regions, and the like.
- analogous sequence refers to a sequence within a protein that provides similar function, tertiary structure, and/or conserved residues as the protein of interest (i.e., typically the original protein of interest). For example, in epitope regions that contain an a- helix or a ⁇ -sheet structure, the replacement amino acids in the analogous sequence preferably maintain the same specific structure.
- the term also refers to nucleotide sequences, as well as amino acid sequences. In some embodiments, analogous sequences are developed such that the replacement amino acids result in a variant enzyme showing a similar or improved function.
- the tertiary structure and/or conserved residues of the amino acids in the protein of interest are located at or near the segment or fragment of interest.
- the replacement amino acids preferably maintain that specific structure.
- homologous protein refers to a protein that has similar activity and/or structure to a reference protein. Homologs are not necessarily evolutionarily related. Thus, it is intended that the term encompasses the same, similar, or corresponding enzyme(s) (e.g., in terms of structure and function) obtained from different organisms. In some embodiments, it is desirable to identify a homolog that has a quaternary, tertiary and/or primary structure similar to the reference protein. In some embodiments, homologous proteins induce similar immunological response(s) as a reference protein. In some embodiments, homologous proteins are engineered to produce enzymes with desired activity(ies).
- the degree of homology between sequences can be determined using any suitable method known in the art (see, e.g., Smith and Waterman (1981) Adv. Appl. Math. 2:482;
- PILEUP is a useful program to determine sequence homology levels.
- PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pair- wise alignments. It can also plot a tree showing the clustering relationships used to create the alignment.
- PILEUP uses a simplification of the progressive alignment method of Feng and Doolittle, (Feng and Doolittle (1987) J. Mol. Evol. 35:351-60). The method is similar to that described by Higgins and Sharp ((1989) CABIOS 5: 151-53).
- Useful PILEUP parameters including a default gap weight of 3.00, a default gap length weight of 0.10, and weighted end gaps.
- Another example of a useful algorithm is the BLAST algorithm, described by Altschul et al. ((1990) J. Mol. Biol.
- BLAST program is the WU-BLAST-2 program (see, e.g., Altschul et al. (1996) Meth. Enzymol. 266:460-80). Parameters "W,” "T,” and "X” determine the sensitivity and speed of the alignment.
- the BLAST program uses as defaults a word- length (W) of 11, the BLOSUM62 scoring matrix (see, e.g., Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89: 10915) alignments (B) of 50, expectation (E) of 10, M'5, N'-4, and a comparison of both strands.
- the phrases “substantially similar” and “substantially identical,” in the context of at least two nucleic acids or polypeptides, typically means that a polynucleotide or polypeptide comprises a sequence that has at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or even at least about 99% identity, or more, compared to the reference ⁇ e.g. , wild-type) sequence.
- Sequence identity can be determined using known programs such as BLAST, ALIGN, and CLUSTAL using standard parameters.
- BLAST Altschul, et al. (1990) J. Mol. Biol. 215:403-410; Henikoff et al. (1989) Proc. Natl. Acad. Sci. USA 89: 10915; Karin et al. (1993) Proc. Natl. Acad. Sci USA 90:5873; and Higgins et al. (1988) Gene 73:237-244
- Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. Also, databases can be searched using FASTA
- polypeptides are substantially identical.
- first polypeptide is immunologically cross- reactive with the second polypeptide.
- polypeptides that differ by conservative amino acid substitutions are immunologically cross-reactive.
- a polypeptide is substantially identical to a second polypeptide, for example, where the two peptides differ only by a conservative substitution.
- Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions ⁇ e.g., within a range of medium to high stringency).
- the term "gene” is synonymous with the term “allele” in referring to a nucleic acid that encodes and directs the expression of a protein or RNA. Vegetative forms of filamentous fungi are generally haploid, therefore a single copy of a specified gene (i.e., a single allele) is sufficient to confer a specified phenotype.
- wild-type and “native” are used interchangeably and refer to genes, proteins, or strains found in nature.
- deletion of a gene refers to its removal from the genome of a host cell. Where a gene includes control elements (e.g. , enhancer elements) that are not located
- deletion of a gene refers to the deletion of the coding sequence, and optionally adjacent enhancer elements, including but not limited to, for example, promoter and/or terminator sequences.
- disruption of a gene refers broadly to any genetic or chemical manipulation, i.e., mutation, that substantially prevents a cell from producing a function gene product, e.g. , a protein, in a host cell.
- methods of disruption include complete or partial deletion of any portion of a gene, including a polypeptide-coding sequence, a promoter, an enhancer, or another regulatory element, or mutagenesis of the same, where mutagenesis encompasses substitutions, insertions, deletions, inversions, and combinations and variations, thereof, any of which mutations substantially prevent the production of a function gene product.
- a gene can also be disrupted using RNAi, antisense, or any other method that abolishes gene expression.
- the terms “genetic manipulation” and “genetic alteration” are used interchangeably and refer to the alteration/change of a nucleic acid sequence.
- the alteration can included but is not limited to a substitution, deletion, insertion or chemical modification of at least one nucleic acid in the nucleic acid sequence.
- cell broth refers collectively to medium and cells in a liquid/submerged culture.
- cell mass refers to the cell component (including intact and lysed cells) present in a liquid/submerged culture. Cell mass can be expressed in dry or wet weight.
- rheology refers to a branch of physics dealing with the deformation and flow of matter.
- viscosity is a measure of the resistance of a fluid to deformation by mechanical stress, such as shear stress or tensile stress.
- viscosity can also refer to the resistance of a cell broth comprising filamentous fungus cells to mechanical stress, e.g. , as provided by a rotor/impeller.
- viscosity of a cell broth can be difficult to measure directly, indirect measurements of viscosity can be used, such as the dissolved oxygen content of the culture broth at a preselected amount of agitation, the amount of agitation required to maintain a preselected dissolved oxygen content, the amount of power required to agitate a cell broth to maintain a preselected dissolved oxygen content, or even colony morphology on solid medium.
- an "altered-viscosity" variant strain of filamentous fungus cells refers to a variant strain that produces a cell broth that has a reduced or increased viscosity (i.e. , reduced or increased resistance to shear or tensile stress) compared to an equivalent cell broth produced by a parental strain.
- comparable cell broths or equivalent cell broths have comparable cell masses.
- the difference between a variant, altered viscosity strain and a parental strain, with respect to any direct or indirect measure of viscosity is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or even at least 50%, or more.
- a "reduced-viscosity" variant strain of filamentous fungus cells refers to a variant strain that produces a cell broth that has reduced viscosity (i.e. , reduced resistance to shear or tensile stress) compared to an equivalent cell broth produced by a parental strain.
- the difference between a variant, altered viscosity strain and a parental strain, with respect to any direct or indirect measure of viscosity is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or even at least 50%, or more.
- dissolved oxygen refers to the amount of oxygen (0 2 ) present in a liquid medium as measured in vol/vol units.
- the dissolved oxygen level can be maintained at a high level, e.g., between 170-100% and 20%, between 100-80% and 20%, between 70% and 20%, between 65% and 20%, between 60% and 20%, between 55% and 20%, between 50% and 20%, between 45% and 20%, between 44% and 20%, between 43% and 20%, between 42% and 20%, between 41% and 20%, between 40% and 20%, between 35% and 20%, between 30% and
- the dissolved oxygen can be high at the beginning of the fermentation and to be permitted to fall as the fermentation progresses.
- the dissolved oxygen level can be controlled by the rate at which the fermentation is agitated, e.g. stirred, and/or by the rate of addition of air or oxygen.
- the culture can be agitated, e.g., stirred at between 400-700 rpm and the dissolved oxygen level is maintained above 20%, above 25%, above 30%, above 35%, above 40%, above 45%, above 50% and above 55% or more by altering the air or oxygen flow rate and impeller speed.
- a "primarily genetic determinant" refers to a gene, or genetic
- a "functional polypeptide/protein” is a protein that possesses an activity, o such as an enzymatic activity, a binding activity, a surface-active property, or the like, and
- Functional polypeptides can be thermostable or thermolabile, as specified.
- a functional gene is a gene capable of being used by cellular components to produce an active gene product, typically a protein.
- Functional genes are the5 antithesis of disrupted genes, which are modified such that they cannot be used by cellular components to produce an active gene product, or have a reduced ability to be used by cellular components to produce an active gene product.
- variant cells “maintain or retain a high level of protein expression and/or secretion” compared to a parental strain if the difference in protein expression between the variant o strain and a parental strain is less than about 20%, less than about 15%, less than about 10%, less than about 7%, less than about 5%, or even less than about 3%.
- host cells have been "modified to prevent the production of a specified protein” if they have been genetically or chemically altered to prevent the production of a functional protein/polypeptide that exhibits an activity characteristic of the wild-type protein, 5 particularly an activity that promotes elongation of hyphae or otherwise increases the viscosity of a filamentous fungus in liquid culture.
- modifications include, but are not limited to, deletion or disruption of the gene encoding the protein, modification of the gene such that the encoded polypeptide lacks the aforementioned activity, modification of the gene to affect post- translational processing or stability, and combinations, thereof.
- a "protein of interest” is a protein that is desired to be produced in a
- proteins of interest are commercially important for industrial, pharmaceutical, animal health, and food and beverage use, making them desirable to produce in large quantities. Proteins of interest are to be distinguished from the myriad other proteins expressed by the filamentous fungus cells, which are generally not of interest as products and are mainly considered background protein contaminants.
- a variant strain produces "substantially the same amount" of protein per unit amount of biomass as a parental strain if the amount of protein produced by the variant strain is no more than 20% reduced, no more than 15% reduced, no more than 10% reduced, an even no more than 5% reduced compared to the amount of protein produced by the parental strain, wherein the amount of protein is normalized to the total amount of biomass of cells from which protein production is measured, wherein biomass can be expressed in terms of either wet (e.g., of cell pellet) or dry weight.
- a variant strain produces "substantially more protein per unit amount of biomass" than a parental strain if the amount of protein produced by the variant strain is at least 5% increased, at least 10% increased, at least 15% increased, or more, compared to the parental strain, wherein the amount of protein is normalized to the total amount of biomass of cells from which protein production is measured, wherein biomass can be expressed in terms of either wet (e.g., of cell pellet) or dry weight.
- fluorochromes are fluorescent dyes. Preferred fluorochromes bind to cellulose and/or chitin in the cell walls of fungi.
- a variant strain of filamentous fungus derived from a parental strain comprising a genetic alteration that causes cells of the variant strain to produce an altered amount of functional Crzl protein compared to cells of the parental strain.
- the cells of the variant strain subsequently produce, during aerobic fermentation in submerged culture, a cell broth that requires an altered amount of agitation to maintain a preselected dissolved oxygen content, or a cell mass that maintains an altered dissolved oxygen content at a preselected amount of agitation, compared to the cells of the parental strain.
- the genetic alteration causes cells of the variant strain to produce a reduced amount of functional Crzl protein compared to cells of the parental strain, and the resulting cell broth requires reduced agitation to maintain a preselected dissolved oxygen content, or maintains a higher dissolved oxygen content at a preselected amount of agitation, compared to the cells of the parental strain.
- the cell mass of the variant strain exhibits reduced viscosity compared to the cell mass of the parental strain, which accounts for the observations relating to dissolved oxygen content and agitation as described in the Examples.
- the reduction in the amount of functional Crzl protein can result from disruption of the crzl gene present in the parental strain.
- variant strains need only comprise a disrupted crzl gene, while all other genes can remain intact.
- the variant strains can optionally include additional genetic alterations compared to the parental stain from which they are derived. Such additional genetic alterations are not necessary to confer a reduction in viscosity but can further reduce viscosity or confer other advantages for the variant strain.
- Disruption of the crzl gene can be performed using any suitable methods that substantially prevent expression of a function crzl gene product, i.e., the Crzl protein.
- Exemplary methods of disruption as are known to one of skill in the art include but are not limited to: Complete or partial deletion of the crzl gene, including complete or partial deletion of, e.g., the Crzl -coding sequence, the promoter, the terminator, an enhancer, or another regulatory element; and complete or partial deletion of a portion of the chromosome that includes any portion of the crzl gene.
- Particular methods of disrupting the crzl gene include making nucleotide substitutions or insertions in any portion of the crzl gene, e.g., the Crzl- coding sequence, the promoter, the terminator, an enhancer, or another regulatory element.
- deletions, insertions, and/or substitutions are made by genetic manipulation using sequence- specific molecular biology techniques, as opposed to by chemical mutagenesis, which is generally not targeted to specific nucleic acid sequences. Nonetheless, chemical mutagenesis can be used to disrupt the crzl gene.
- Mutations in the crzl gene can reduce the efficiency of the crzl promoter, reduce the efficiency of a crzl enhancer, interfere with the splicing or editing of the crzl mRNA, interfere with the translation of the crzl mRNA, introduce a stop codon into the Crzl -coding sequence to prevent the translation of full-length Crzl protein, change the coding sequence of the Crzl protein to produce a less active or inactive protein or reduce Crzl interaction with other nuclear protein components, change the coding sequence of the Crzl protein to produce a less stable protein or target the protein for destruction, cause the Crzl protein to misfold or be incorrectly modified ⁇ e.g., by glycosylation), or interfere with cellular trafficking of the Crzl protein.
- these and other genetic manipulations is to reduce or prevent the expression of a functional Crzl protein, or reduce or prevent the normal biological activity of the Crzl protein, thereby producing a morphology change that results in a reduced viscosity phenotype.
- the genetic alteration increases or restores the expression of a functional Crzl protein, or increases the normal biological activity of the Crzl protein, thereby producing a morphology change that results in an increased or restored viscosity phenotype.
- Exemplary genetic alterations that increase or restore Crzl function are those that introduce addition copies of the crzl gene into a cell, increase the efficiency of the crzl promoter, enhancer, or other control element, increase the translation of the mRNA encoding the Crzl protein, increase the stability of mRNA encoding the Crzl protein, introduce changes in the crzl gene that increase the activity or stability of the Crzl protein, introduce changes in the crzl gene that modulate the interaction with other proteins or nucleic acids and the like.
- Other genetic alterations that increase or restore Crzl function are those that reverse the effect of genetic alterations, which reduce or prevent the expression of a functional Crzl protein.
- Filamentous fungus cells for manipulation and use as described are generally from the phylum Ascomycota, subphylum Pezizomycotina, particularly fungi that have a vegetative hyphae state and include a homolog of the crzl gene.
- Such organisms include filamentous fungus cells used for the production of commercially important industrial and pharmaceutical proteins, including, but are not limited to Trichoderma spp., Aspergillus spp., Fusarium spp., Scedosporium spp., Penicillium spp., Chrysosporium spp., Cephalosporium spp., Talaromyces spp., Geosmithia spp., and Neurospora spp.
- Particular organisms include, but are not limited to, Trichoderma reesei (previously classified as Trichoderma longibrachiatum or Hypocrea jecorina), Aspergillus niger, Aspergillus fumigatus, Aspergillus itaconicus, Aspergillus oryzae, Aspergillus nidulans, Aspergillus terreus, Aspergillus sojae, Aspergillus japonicus,
- calcineurin mediated Ca 2+ signaling has been shown to be required for growth, development, and virulence in many organisms. It is necessary for adaption to diverse environmental conditions including high cation levels and alkaline pH.
- the gene crzl encodes a calcineurin-regulated transcription factor.
- the Crzlp transcription factor is dephosphorylated when the phosphatase calcineurin is activated by Ca 2+ /calmodulin.
- amino acid sequence of the Aspergillus fumigatus Crzl protein is shown below as SEQ ID NO:4:
- amino acid sequence of the Aspergillus flavus Czrl protein is shown below as SEQ ID NO:6:
- the amino acid sequence of the Crzl protein that is altered in production levels has a specified degree of overall amino acid sequence identity to the amino acid sequence of SEQ ID NOs: 1, 2, 3, 4, 5, or 6, e.g., at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99% identity, to SEQ ID NOs: 1, 2, 3, 4, 5, or 6.
- the nucleotide sequences encoding each amino acid sequence can be identified from a BLAST search for each corresponding protein as is know to one skilled in the art.
- the crzl gene that is disrupted encodes a Crzl protein that has a specified degree of overall amino acid sequence identity to the amino acid sequence of SEQ ID NOs: 1, 2, 3, 4, 5, or 6, e.g., at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least o about 96%, at least about 97%, at least about 98%, or even at least about 99% identity, to SEQ ID NOs: 1, 2, 3, 4, 5, or 6, e.g., at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least o about 96%, at least about 97%, at least about 98%, or even at least about 99% identity, to SEQ ID
- amino acid sequence information readily allows the skilled person to identify a Crzl protein, and the nucleic acid sequence encoding a Crzl protein, in any filamentous fungi, and to make appropriate disruptions in the crzl gene to affect the production of the Crzl5 protein.
- the polynucleotide sequences encoding SEQ ID NOs: 1, 2, 3, 4, 5, and 6 can be found in the GenBank or JGI databases, as are known to one of skill in the art.
- a method for altering the morphology of filamentous fungus cells is provided.
- the variant filamentous fungus cells exhibit altered growth morphology on solid medium and produce cell broth having different viscosities when grown in submerged culture o compared to parental cell growth and cell broth viscosities.
- the method comprises disrupting the crzl gene in a parental strain using suitable genetic methods, wherein during aerobic fermentation the disrupted crzl variant strain produces during aerobic fermentation in submerged culture a cell broth that requires reduced agitation to maintain a preselected dissolved oxygen content, or maintains an increased dissolved 5 oxygen content at a preselected amount of agitation, compared to the cells of the parental strain.
- disruption of the crzl gene is performed by genetic manipulation using sequence-specific molecular biology techniques, as opposed to chemical mutagenesis, which is generally not targeted to specific nucleic acid sequences.
- the parental strain into which the reduced viscosity phenotype is introduced creating a reduced viscosity strain already comprises a gene of interest intended to be expressed at high levels.
- the present methods obviate the need to introduce a gene of interest into a pre-existing reduced viscosity strain for production.
- the present methods can be used to produce a reduced viscosity variant strain of filamentous fungus cells from a parental strain already comprising a gene of interest.
- the present strains can have a fully defined genome, making them well-suited for subsequent genetic manipulation, complementation, mating, and the like.
- the present strains are still capable of high levels of protein production, for example, by the manipulation(s) that resulted in the attendant viscosity alteration.
- reduced viscosity strains can be produced from essentially any parental strain, including parental strains that already produce a protein intended for high level expression (i. e. , a protein of interest), already encoding a selectable marker, or already including other features that are desirable in a production host.
- the present strain and methods eliminate the need to transfer a gene encoding a protein of interest into a preexisting reduced viscosity production strain.
- the present strains and methods find use in the production of commercially important protein in submerged cultures of filamentous fungi.
- Commercially important proteins include, for example, cellulases, xylanases, pectinases, lyases, proteases, kinases, amylases, pullulanases, lipases, esterases, perhydrolases, transferases, laccases, catalases, oxidases, reductases,
- chlorophyllases hydrophobin, chymosin, carbonic anhydrase, hymidylate synthase,
- dihydrofolate reductase dihydrofolate reductase, tyrosine kinases, multi-drug resistance proteins (e.g., ABC P-gp proteins), CAD (carbamyl-P synthase, aspartate transcarbamylase, dihydroorotase),
- topoisomerases ribonucleotide reductase
- antibodies and other enzymes and non-enzyme proteins capable of being expressed in filamentous fungi.
- Such proteins can be suitable for industrial, pharmaceutical, animal health and food and beverage use.
- a variant strain of filamentous fungus derived from a parental strain comprising a genetic alteration that causes cells of the variant strain to produce an altered amount of functional Crzl protein compared to cells of the parental strain, wherein the cells of the variant strain produce during aerobic fermentation in submerged culture a cell broth that (i) requires an altered amount of agitation to maintain a preselected dissolved oxygen content compared to the cells of the parental strain, and/or (ii) maintains an altered
- the altered amount of functional Crzl protein is a reduced amount
- the variant strain produces during aerobic fermentation in submerged culture a cell broth that (i) requires reduced agitation to maintain a preselected o dissolved oxygen content compared to the cells of the parental strain, and/or (ii) maintains an increased dissolved oxygen content at a preselected amount of agitation, compared to the cells of the parental strain.
- the genetic alteration comprises a disruption of the crzl gene present in the parental strain.
- disruption of the crzl gene is the result of deletion of all or part of the crzl gene.
- disruption of the crzl gene is the result of deletion of a portion of genomic DNA comprising the crzl gene.
- disruption of the crzl gene is the o result of mutagenesis of the crzl gene.
- disruption of the crzl gene is performed using site-specific recombination.
- disruption of the crzl gene is performed in combination with introducing a selectable marker at the genetic locus of 5 the crzl gene.
- the variant strain does not produce functional Crzl protein.
- the variant strain does not produce Crzl protein.
- the variant strain of any of paragraphs 1-10, the variant strain
- the variant strain produces substantially the same amount of, or more, protein per unit amount of biomass as the parental strain.
- the filamentous fungus is a Pezizomycotina species.
- the filamentous fungus is a Trichoderma spp.
- the filamentous fungus is Trichoderma reesei.
- a method for producing a variant strain of filamentous fungus cells comprising: introducing a genetic alteration into a parental strain of filamentous fungal cell, which genetic alteration alters the production of functional Crzl protein compared to the cells of the parental strain, thereby producing a variant filamentous fungal cell that produces during aerobic fermentation in submerged culture a cell broth that (i) requires an altered amount of agitation to maintain a preselected dissolved oxygen content, compared to the cells of the parental strain, and/or (ii) maintains an altered dissolved oxygen content at a preselected amount of agitation, compared to the cells of the parental strain.
- the genetic alteration reduces or prevents the production of functional Crzl protein, thereby producing a variant filamentous fungal cell that produces during aerobic fermentation in submerged culture a cell broth that (i) requires reduced agitation to maintain a preselected dissolved oxygen content, compared to the cells of the parental strain, and/or (ii) maintains an increased dissolved oxygen content at a preselected amount of agitation, compared to the cells of the parental strain.
- the genetic alteration comprises disrupting the crzl gene in a parental filamentous fungal cell using genetic manipulation.
- the genetic alteration comprises deleting the crzl gene in a parental filamentous fungal cell using genetic
- the genetic alteration is performed using site- specific genetic recombination.
- disruption of the crzl gene is performed in combination with introducing a selectable marker at the genetic locus of the crzl gene.
- disruption of the crzl gene is performed in combination with disrupting the sfb3 gene.
- disruption of the crzl gene is performed in combination with disruption of at least one gene selected from the group consisting of the sft>3 gene, the sebl gene, the mpgl gene, the gasl gene, and the tps2 gene.
- the variant strain produces substantially the same amount of, or more, protein per unit amount of biomass as the parental strain.
- the filamentous fungus is a Pezizomycotina species.
- the filamentous fungus is a Trichoderma spp.
- the filamentous fungus is Trichoderma reesei.
- the parental strain further comprises a gene encoding a protein of interest.
- the gene encoding the protein of interest is present in the parental strain prior to introducing the genetic alteration that reduces or prevents the production of functional Crzl protein.
- a variant strain of filamentous fungus derived from a parental strain comprising:
- the genetic alteration comprises a disruption of the crzl gene present in the parental strain.
- disruption of the crzl gene is performed in combination with introducing a selectable marker at the genetic locus of the crzl
- disruption of the crzl gene is performed in combination with disrupting at least one gene selected from the group consisting of the sft>3 gene, the sebl gene, the mpgl gene, the gasl gene, and the tps2 gene.
- disruption of the crzl l o gene is performed in combination with disrupting the sebl gene.
- a Trichoderma reesei Morph strain was deleted for four major cellulase genes, including cbhl, cbhll, egll, and eglV, which makes it particular suitable for expressing other proteins in the absence of or in reduced cellulase background. See, WO 05/001036.
- Trichoderma glucoamylase gene under control of the CBH1 promoter, using amdS as a marker.
- a transformant containing two tandem copies of glucoamylase (TrGA 29-9) was subsequently isolated, and random chemical mutagenesis was used to produce a mutant (77B7).
- a spontaneous pyr2 mutant derivative was subsequently isolated by 5-/Zworo- orotic acid (FOA) selection.
- the crzl disruption cassette plasmid pRATT261 ( Figure 1) was prepared using standard molecular biology procedures. This plasmid included a DNA sequence having a 2.6 Kb region homologous to the DNA sequence spanning part of the third exon and contiguous upstream sequences (Left Flank). Also included within the plasmid was a DNA sequence having a 2.4 Kb region homologous to the DNA sequence spanning part of the third exon of the crzl gene and contiguous downstream sequences (Right Flank). These sequences were designed to target the crzl gene and replace the regions of the genome between the Left and Right Flanks, region 122703 to 123270 on Scaffold 4, with the intervening cassette sequences. These intervening sequences included a pyr2 selection marker from Trichoderma atroviride intended to minimize homology to the endogenous T. reesei pyr2 in the genome of the strain to be transformed.
- This crzl disruption cassette was amplified by PCR using primers RPG486 and RPG489. Multiple PCR reactions were pooled and cleaned using standard molecular biology procedures for use in the subsequent steps.
- the untranslated region is italicized and flanked 5' and 3' by upstream or downstream sequence, coding regions are in bold and introns are in lower case (SEQ ID NO: 13): GAAACGCAGCTCAGACTGTGATTCGCACCGCTGTACGCGTCCTGCCGCTGTGATAGGGCCGCACCCC CCCAGCACCTTGCATTGCTGCCGCCAGTGCACAGCCTCCTCGGAAGGCTGACTGTGGAATCTGCCTC GCGACAACGAGGTACGGAGACAGACAGACCAAGCGCTCGGCCGCCATCATGGCCCATGAACCCCAGC GTGGAAGGTCGCCGTCGGCCGGTGGCTTTCAGTCTGATATAAACCAATCCCACTCGCCGGCACGGAG CCCGCTGGCACCCACAAATGAGCAGCCATCCGCTGGTCTTGGAGTTGGACTCGGCgt cgacct ggat t cgt cacagcagcaacaact gcagcagcagcaacaacaact gcagcagcag
- Primer pair RPG492 and RPG253 amplified a DNA fragment starting outside the 5 ' end of the disruption cassette region and ending within 3 ' region.
- Primer pair RPG491 and RPG273 amplified a DNA fragment starting within the 5' region of the disruption cassette and ending outside the 3 ' end of the disruption cassette region.
- the generated strain with confirmed homologous integration of the crzl disruption cassette was named Morph 77B7 Acrzl .
- Morph 77B7 Acrzl obtained from the above procedure was observed to have altered morphology in liquid culture having shorter filaments than the Morph 77B7 parent.
- cultures containing the Morph 77B7 Acrzl mutant also showed a higher level of dissolved oxygen during growth compared to cultures containing the Morph 77B7 parent (Table 2).
- a dissolved oxygen (DO) probe was calibrated to 100% when there was no added pressure in the headspace (i.e., 0 bar gauge, 1 bar absolute). The pressure in the headspace was then set to 0.7 bar (gauge), after which the oxygen probe read 170% before the seed culture was added.
- the fermentor contained two, four-blade turbines that provided mixing via a variable speed motor that was initially set at 500 rpm.
- DO content levels dropped, at least partly as a consequence of the increased viscosity of the broth due to the proliferation of filamentous fungus hyphae. When DO content level fell below 40%, the agitation rate was increased to maintain the DO content level at 40%.
- the DO content level Upon reaching 750 rpm agitation, the DO content level would be allowed to drop below 40%. If the DO content level did not fall below 40%, then it was unnecessary to increase the agitation rate during the fermentation run, and the initial agitation rate was higher than necessary. When the glucose was completely consumed, the amount of biomass produced in each fermentor was measured, and found to be substantially the same for both strains.
- the DO content level in each fermentor at a given level of agitation, and the amount of agitation required to maintain a given DO content level are indirect measures of the viscosity of the different broths, due to the different strain growth phenotypes. Although it would be ideal to vary only one variable (e.g., DO content or agitation) and measure the other, it is desirable to prevent the DO content level from falling below 40% to ensure the production of sufficient biomass in each fermentor, thereby permitting a more meaningful comparison among the growth characteristics of the different strains.
- the amount of agitation can be estimated by the amount of power supplied to the motor driving the fermentor turbine, which provides a metric that correlates with the viscosity of the broth.
- the extra power required to agitate the suspended culture is proportional to the agitation rate raised to the 3rd power.
- Morph 77B7 Acrzl has a reduction in broth viscosity compared to the parent Morph 77B7.
- the Morph 77B7 control strain saw agitation increased to 616 rpm and then saw DO content level drop down to as low as 40%.
- the strain Morph 77B7 Acrzl did not require as much energy to achieve the same biomass concentration. Agitation rate never increased above 500 rpm and the % DO never dropped below 100.
- the Sft>3 gene (also known as Lstl) has previously only been characterized in budding yeast ⁇ i.e., Saccharomyces cerevisiae), where it encodes a protein associated with the COPII protein coat surrounding transport vesicles that carry proteins from the endoplasmic reticulum to the Golgi apparatus.
- Sfl>3, as well as Sfl>2, are homologs of Sec24, all of which genes are l o involved with packaging specific cargo proteins into the vesicles.
- Asfl>3 had similar viscosity properties, and produced similar levels of a protein of interest (TrGA) in suspended culture, demonstrating that a reduced viscosity growth phenotype can be imparted to a filamentous fungus by disrupting the sft>3 gene. Alterations in the Sfb3 protein resulting in alterations in viscosity are further described in PCT Publication No. WO
- Sebl from Trichoderma atroviride is a STRE-element-binding protein, and the sebl gene is believed to be an orthologue of the yeast msn2/4 gene and the Aspergillus nidulans msnA gene. Notably, the sebl gene cannot complement the msn2/4 gene in yeast, so is probably not a functional homologue (Peterbauer, C. et al. ((2002) Molecular Genetics and Genomics 268:223-
- Sebl is involved with but not essential in the osmotic stress response but has been found to be associated with altered morphology, particularly those giving rise to a low viscosity phenotype when sebl is disrupted. Details of the sebl disruption can be found in U.S. Provisional Application No. 61/478,160, filed April 22, 2011, incorporated by reference herein in its entirety.
- the mpgl gene encodes a GTP:alpha-D-mannose-l-phoshate guanyltransferase. Over- expression of the mpgl gene increases GDP-mannose levels, which can play a major regulatory role in early stages of protein glycosylation.
- MAGI 10-8g the mpgl deletion variant strain
- the MAGI control strain saw agitation increased to the maximum of 750 rpm and then saw DO drop down to as low as 35%.
- the strain MAGI 10-8g did not require as much energy to achieve the same biomass concentration. Agitation rate was increased slightly to 513 rpm when the % DO dropped to 40%. Protein production was not adversely affected in MAGI 10-8g compared to MAGI (not shown). Details of the mpgl disruption can be found in U.S.
- the Gel/Gas/Phr family of fungal P(l,3)-glucanosyltransferases plays an important role in cell wall biogenesis by processing the main component P(l,3)-glucan (Popolo et al., 2008).
- gasl encodes a beta-l,3-glucanosyltransferase that is a GPI (and/or glucan)- anchored protein capable of breaking and joining beta-l,3-glucans.
- GPI and/or glucan
- a Trichoderma reesei Morph strain was deleted for four major cellulase genes, including cbhl, cbhll, egll, and eglV, which makes it particular suitable for expressing other proteins in the absence of or in reduced cellulase background. See, WO 05/001036.
- the Morph strain had been previously transformed with a native Trichoderma glucoamylase gene (TrGA) under control of the CBH1 promoter, using amdS as a marker.
- a transformant containing two tandom copies of glucoamylase (TrGA 29-9) was subsequently isolated, and random chemical mutagenesis was used to produce a mutant (77B7).
- a spontaneous pyr2 mutant derivative was subsequently isolated by 5-/Zworo-orotic acid (FOA) selection.
- the Trichoderma reesei gasl (PID 22914) was deleted from mutant Morph 77B7.
- the gene tpsl encodes a trehalose-phosphate phosphatase involved in the synthesis of the disaccharide trehalose.
- Trehalose is a stress induced sugar that buffers the refolding of denatured proteins in the cytoplasm and ER (Singer, M et al. 1998, Simola, M et al. 2000). This disaccharide is produced in large quantities by diverse organisms in response to a variety of stresses. In yeast, trehalose stabilizes proteins at high temperatures and assists in refolding heat damaged proteins (Simola, M et al. 2000).
- Trichoderma reesei Morph strain was prepared as described above.
- the Trichoderma reesei tpsl (PID 48707) was deleted from mutant Morph 77B7.
- Morph 77B7 Atpsl has a reduction in broth viscosity compared to the parent Morph 77B7.
- the Morph 77B7 control strain saw agitation increased to 616 rpm and then saw DO content level drop down to as low as 40%.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Mycology (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Botany (AREA)
- Cell Biology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2833756A CA2833756C (en) | 2011-04-22 | 2012-04-20 | Filamentous fungi having an altered viscosity phenotype |
| DK12717560.2T DK2699667T3 (en) | 2011-04-22 | 2012-04-20 | Filamentous fungi with an altered VISCOSITETSFÆNOTYPE |
| CN201280019665.6A CN103502430B (zh) | 2011-04-22 | 2012-04-20 | 具有粘度改变表型的丝状真菌 |
| US14/113,549 US9868958B2 (en) | 2011-04-22 | 2012-04-20 | Filamentous fungi having an altered viscosity phenotype |
| KR1020137030474A KR101952467B1 (ko) | 2011-04-22 | 2012-04-20 | 변경된 점성 표현형을 갖는 사상균 |
| BR112013026535A BR112013026535A2 (pt) | 2011-04-22 | 2012-04-20 | "cepas variantes de fundos filamentosos tendo modificação genética para maior produção de proteína crz1 e crescimento alterado e seu método de produção". |
| AU2012245323A AU2012245323B2 (en) | 2011-04-22 | 2012-04-20 | Filamentous fungi having an altered viscosity phenotype |
| JP2014506566A JP6042869B2 (ja) | 2011-04-22 | 2012-04-20 | 粘度の表現型が変化した糸状菌 |
| EP12717560.2A EP2699667B1 (en) | 2011-04-22 | 2012-04-20 | Filamentous fungi having an altered viscosity phenotype |
Applications Claiming Priority (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161478160P | 2011-04-22 | 2011-04-22 | |
| US201161478162P | 2011-04-22 | 2011-04-22 | |
| US61/478,162 | 2011-04-22 | ||
| US61/478,160 | 2011-04-22 | ||
| US201161480602P | 2011-04-29 | 2011-04-29 | |
| US201161480610P | 2011-04-29 | 2011-04-29 | |
| US201161480629P | 2011-04-29 | 2011-04-29 | |
| US61/480,629 | 2011-04-29 | ||
| US61/480,602 | 2011-04-29 | ||
| US61/480,610 | 2011-04-29 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2012145596A1 true WO2012145596A1 (en) | 2012-10-26 |
Family
ID=46018122
Family Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/034405 Ceased WO2012145596A1 (en) | 2011-04-22 | 2012-04-20 | Filamentous fungi having an altered viscosity phenotype |
| PCT/US2012/034399 Ceased WO2012145592A1 (en) | 2011-04-22 | 2012-04-20 | Filamentous fungi having an altered viscosity phenotype |
| PCT/US2012/034409 Ceased WO2012145598A1 (en) | 2011-04-22 | 2012-04-20 | Filamentous fungi having an altered viscosity phenotype |
Family Applications After (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/034399 Ceased WO2012145592A1 (en) | 2011-04-22 | 2012-04-20 | Filamentous fungi having an altered viscosity phenotype |
| PCT/US2012/034409 Ceased WO2012145598A1 (en) | 2011-04-22 | 2012-04-20 | Filamentous fungi having an altered viscosity phenotype |
Country Status (10)
| Country | Link |
|---|---|
| US (3) | US9587242B2 (https=) |
| EP (3) | EP2699668B1 (https=) |
| JP (3) | JP6042867B2 (https=) |
| KR (3) | KR101952467B1 (https=) |
| CN (3) | CN103517981B (https=) |
| AU (4) | AU2012245319A1 (https=) |
| BR (3) | BR112013025434A2 (https=) |
| CA (3) | CA2833756C (https=) |
| DK (3) | DK2673290T3 (https=) |
| WO (3) | WO2012145596A1 (https=) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2015532120A (ja) * | 2012-10-22 | 2015-11-09 | メルク・シャープ・アンド・ドーム・コーポレーションMerck Sharp & Dohme Corp. | Crz1突然変異真菌細胞 |
| US9593341B2 (en) | 2011-04-22 | 2017-03-14 | Danisco Us Inc. | Filamentous fungi having an altered viscosity phenotype |
| WO2019209576A1 (en) | 2018-04-24 | 2019-10-31 | Danisco Us Inc | Filamentous fungal strains comprising reduced viscosity phenotypes |
| WO2020028126A1 (en) | 2018-07-30 | 2020-02-06 | Danisco Us Inc | Mutant and genetically modified filamentous fungal strains comprising enhanced protein productivity phenotypes and methods thereof |
Families Citing this family (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3000870B1 (en) * | 2011-04-22 | 2018-01-24 | Danisco US Inc. | Filamentous fungi having an altered viscosity phenotype |
| WO2018226900A2 (en) | 2017-06-06 | 2018-12-13 | Zymergen Inc. | A htp genomic engineering platform for improving fungal strains |
| WO2019236848A1 (en) | 2018-06-06 | 2019-12-12 | Zymergen Inc. | Manipulation of genes involved in signal transduction to control fungal morphology during fermentation and production |
| KR20210018354A (ko) * | 2018-06-08 | 2021-02-17 | 에멀쥐 아이엔씨 | 진균성 균사체를 성장시키는 방법 및 식용 산물을 만드는 방법 |
| JP7459509B2 (ja) | 2018-07-30 | 2024-04-02 | 東レ株式会社 | トリコデルマ属糸状菌の変異株およびタンパク質の製造方法 |
| BR112021006248A2 (pt) * | 2018-10-11 | 2021-07-06 | Toray Industries | cepa mutante de trichoderma reesei e métodos para produzir uma proteína e para produzir uma celulase |
| US20200354756A1 (en) * | 2019-04-03 | 2020-11-12 | Danisco Us Inc | Disruption of mvb12 in yeast is associated with increased alcohol production and tolerance |
| FR3104169B1 (fr) * | 2019-12-04 | 2022-10-21 | Ifp Energies Now | Souche de champignon ayant une viscosite diminuee |
| AU2021219964A1 (en) * | 2020-02-14 | 2022-09-29 | Inbiose N.V. | Production of glycosylated product in host cells |
| EP3926039A1 (en) | 2020-06-17 | 2021-12-22 | AB Enzymes GmbH | Use of a nuclease for reducing the viscosity and/or preventing an increase in viscosity of a fermentation broth |
| US11479779B2 (en) | 2020-07-31 | 2022-10-25 | Zymergen Inc. | Systems and methods for high-throughput automated strain generation for non-sporulating fungi |
| CN111944779B (zh) * | 2020-08-28 | 2022-06-21 | 山东省科学院生物研究所 | 一种海藻糖合成双功能酶编码基因TvTPS/TPP及其应用 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001009352A2 (en) * | 1999-07-30 | 2001-02-08 | Nederlandse Organisatie Voor Toegepast-Natuurwetenschappelijk Onderzoek (Tno) | Use of aspergillus sojae as host for recombinant protein production |
| WO2002079399A2 (en) * | 2001-03-14 | 2002-10-10 | Genencor International, Inc. | Regulatable growth of filamentous fungi |
| US20040224388A1 (en) * | 1999-03-24 | 2004-11-11 | Nigel Dunn-Coleman | Hyphal growth in fungi |
| WO2005001036A2 (en) | 2003-05-29 | 2005-01-06 | Genencor International, Inc. | Novel trichoderma genes |
| WO2012027580A1 (en) | 2010-08-25 | 2012-03-01 | Danisco Us Inc. | Filamentous fungi having an altered viscosity phenotype |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FI943133A0 (fi) * | 1994-06-29 | 1994-06-29 | Alko Ab Oy | Transgena vaexter |
| MXPA02010155A (es) * | 2000-04-13 | 2004-08-19 | Mark Aaron Emalfarb | Nuevas secuencias reguladoras de expresion y productos de expresion en el campo de hongos filamentosos. |
| AU5354401A (en) * | 2000-04-13 | 2001-10-30 | Emalfarb, Mark Aaron | High-throughput screening of expressed DNA libraries in filamentous fungi |
| EP1502103B1 (en) * | 2002-05-03 | 2006-09-13 | DSM IP Assets B.V. | Process for the monitoring of contaminant removal during the purification process of a pharmaceutical product produced by a host cell |
| EP1689766B1 (en) * | 2003-11-06 | 2012-04-25 | Danisco US Inc. | Expression in filamentous fungi of protease inhibitors and variants thereof |
| US20090117227A1 (en) * | 2006-02-28 | 2009-05-07 | Suntory Limited | Gene encoding trehalose-6-phosphate phosphatase and use thereof |
| EP3000870B1 (en) | 2011-04-22 | 2018-01-24 | Danisco US Inc. | Filamentous fungi having an altered viscosity phenotype |
| CN103517981B (zh) * | 2011-04-22 | 2017-02-15 | 丹尼斯科美国公司 | 具有粘度改变表型的丝状真菌 |
-
2012
- 2012-04-20 CN CN201280019432.6A patent/CN103517981B/zh active Active
- 2012-04-20 JP JP2014506564A patent/JP6042867B2/ja active Active
- 2012-04-20 US US14/113,930 patent/US9587242B2/en active Active
- 2012-04-20 US US14/113,799 patent/US9593341B2/en active Active
- 2012-04-20 KR KR1020137030474A patent/KR101952467B1/ko active Active
- 2012-04-20 KR KR1020137030475A patent/KR20140033047A/ko not_active Ceased
- 2012-04-20 EP EP12717561.0A patent/EP2699668B1/en active Active
- 2012-04-20 AU AU2012245319A patent/AU2012245319A1/en not_active Abandoned
- 2012-04-20 WO PCT/US2012/034405 patent/WO2012145596A1/en not_active Ceased
- 2012-04-20 WO PCT/US2012/034399 patent/WO2012145592A1/en not_active Ceased
- 2012-04-20 JP JP2014506567A patent/JP6042870B2/ja active Active
- 2012-04-20 DK DK12717558.6T patent/DK2673290T3/en active
- 2012-04-20 CA CA2833756A patent/CA2833756C/en active Active
- 2012-04-20 CA CA2833539A patent/CA2833539C/en active Active
- 2012-04-20 DK DK12717560.2T patent/DK2699667T3/en active
- 2012-04-20 WO PCT/US2012/034409 patent/WO2012145598A1/en not_active Ceased
- 2012-04-20 CN CN201280019710.8A patent/CN103502266B/zh active Active
- 2012-04-20 US US14/113,549 patent/US9868958B2/en active Active
- 2012-04-20 AU AU2012245323A patent/AU2012245323B2/en not_active Ceased
- 2012-04-20 DK DK12717561.0T patent/DK2699668T3/en active
- 2012-04-20 CN CN201280019665.6A patent/CN103502430B/zh active Active
- 2012-04-20 BR BR112013025434A patent/BR112013025434A2/pt not_active Application Discontinuation
- 2012-04-20 BR BR112013026559A patent/BR112013026559A2/pt not_active Application Discontinuation
- 2012-04-20 EP EP12717560.2A patent/EP2699667B1/en active Active
- 2012-04-20 JP JP2014506566A patent/JP6042869B2/ja active Active
- 2012-04-20 EP EP12717558.6A patent/EP2673290B1/en active Active
- 2012-04-20 AU AU2012245325A patent/AU2012245325B2/en not_active Ceased
- 2012-04-20 CA CA2833765A patent/CA2833765C/en active Active
- 2012-04-20 BR BR112013026535A patent/BR112013026535A2/pt not_active Application Discontinuation
- 2012-04-20 KR KR1020137030515A patent/KR101952469B1/ko active Active
-
2017
- 2017-09-28 AU AU2017235968A patent/AU2017235968B2/en not_active Ceased
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040224388A1 (en) * | 1999-03-24 | 2004-11-11 | Nigel Dunn-Coleman | Hyphal growth in fungi |
| WO2001009352A2 (en) * | 1999-07-30 | 2001-02-08 | Nederlandse Organisatie Voor Toegepast-Natuurwetenschappelijk Onderzoek (Tno) | Use of aspergillus sojae as host for recombinant protein production |
| WO2002079399A2 (en) * | 2001-03-14 | 2002-10-10 | Genencor International, Inc. | Regulatable growth of filamentous fungi |
| WO2005001036A2 (en) | 2003-05-29 | 2005-01-06 | Genencor International, Inc. | Novel trichoderma genes |
| WO2012027580A1 (en) | 2010-08-25 | 2012-03-01 | Danisco Us Inc. | Filamentous fungi having an altered viscosity phenotype |
Non-Patent Citations (46)
| Title |
|---|
| ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 10 |
| ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410 |
| ALTSCHUL ET AL., METH. ENZYMOL., vol. 266, 1996, pages 460 - 80 |
| BORGIA P T ET AL: "THE ORLA GENE FROM ASPERGILLUS NIDULANS ENCODES A TREHALOSE-6- PHOSPHATE PHOSPHATASE NECESSARY FOR NORMAL GROWTH AND CHITIN SYNTHESIS AT ELEVATED TEMPERATURES", MOLECULAR MICROBIOLOGY, vol. 20, no. 6, 1 June 1996 (1996-06-01), WILEY-BLACKWELL PUBLISHING LTD, GB, pages 1287 - 1296, XP002060302, ISSN: 0950-382X, DOI: 10.1111/J.1365-2958.1996.TB02647.X * |
| BURLINGAME RP, VERDOES JC: "Maximizing Protein Expression in Filamentous Fungi", 1 May 2006 (2006-05-01), XP002680849, Retrieved from the Internet <URL:http://license.icopyright.net/user/viewFreeUse.act?fuid=MTY0ODk0ODU%3D> [retrieved on 20120724] * |
| CHOI J ET AL: "MoCRZ1, a gene encoding a calcineurin-responsive transcription factor, regulates fungal growth and pathogenicity of Magnaporthe oryzae", FUNGAL GENETICS AND BIOLOGY, vol. 46, no. 3, 1 March 2009 (2009-03-01), SAN DIEGO, CA, US, pages 243 - 254, XP025991148, ISSN: 1087-1845, [retrieved on 20090225], DOI: 10.1016/J.FGB.2008.11.010 * |
| CRAMER ROBERT A JR ET AL: "Calcineurin target CrzA regulates conidial germination, hyphal growth, and pathogenesis of Aspergillus fumigatus", EUKARYOTIC CELL, vol. 7, no. 7, July 2008 (2008-07-01), pages 1085 - 1097, XP002681100, ISSN: 1535-9778 * |
| DAI ZIYU ET AL: "Identification of genes associated with morphology in Aspergillus niger by using suppression subtractive hybridization", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 70, no. 4, 1 April 2004 (2004-04-01), AMERICAN SOCIETY FOR MICROBIOLOGY, US, pages 2474 - 2485, XP002428202, ISSN: 0099-2240, DOI: 10.1128/AEM.70.4.2474-2485.2004 * |
| DAISUKE HAGIWARA ET AL: "Functional analysis of C2H2 zinc finger transcription factor CrzA involved in calcium signaling in Aspergillus nidulans", CURRENT GENETICS ; EUKARYOTES WITH EMPHASIS ON YEASTS, FUNGI, PROTISTS, CELL ORGANELLES, vol. 54, no. 6, 11 November 2008 (2008-11-11), SPRINGER, BERLIN, DE, pages 325 - 338, XP019655387, ISSN: 1432-0983, DOI: 10.1007/S00294-008-0220-Z * |
| DEVEREUX ET AL., NUCLEIC ACIDS RES., vol. 12, 1984, pages 387 - 95 |
| FENG; DOOLITTLE, J. MOL. EVOL., vol. 35, 1987, pages 351 - 60 |
| GARCIA ET AL., J. BIOL. CHEM., vol. 279, 2004, pages 15183 - 15195 |
| HENIKOFF ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1989, pages 10915 |
| HENIKOFF; HENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1989, pages 10915 |
| HIGGINS ET AL., GENE, vol. 73, 1988, pages 237 - 244 |
| HIGGINS; SHARP, CABIOS, vol. 5, 1989, pages 151 - 53 |
| HUGHES, H.; STEPHENS, D.J., CELL. BIOL., vol. 129, 2008, pages 129 - 51 |
| I. V. GRIGORIEV; H. NORDBERG; I. SHABALOV; A. AERTS; M. CANTOR; D. GOODSTEIN; A. KUO; S. MINOVITSKY; R. NIKITIN; R. A. OHM: "The Genome Portal of the Department of Energy Joint Genome Institute", NUCLEIC ACIDS RES, 2011, pages GKR947VL - GKR947 |
| KARABABA ET AL., MOL. MICROBIOL., vol. 59, 2006, pages 1429 - 1451 |
| KARHINEN, L. ET AL., TRAFFIC, vol. 6, 2005, pages 562 - 74 |
| KARIN ET AL., PROC. NATL. ACAD. SCI USA, vol. 90, 1993, pages 5873 |
| KARLIN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873 - 87 |
| KOTHE, G.; FREE, S., FUNGAL GENET. BIOL, vol. 23, 1998, pages 248 - 258 |
| LAGORCE ET AL., J. BIOL.CHEM., vol. 278, 2003, pages 20345 - 20357 |
| MUNRO, C. ET AL., MOL. MICROBIOL., vol. 63, 2009, pages 1399 - 1413 |
| NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 |
| PAPAGIANNI M: "Fungal morphology and metabolite production in submerged mycelial processes", BIOTECHNOLOGY ADVANCES, vol. 22, no. 3, 1 January 2004 (2004-01-01), ELSEVIER PUBLISHING, BARKING, GB, pages 189 - 259, XP004479966, ISSN: 0734-9750, DOI: 10.1016/J.BIOTECHADV.2003.09.005 * |
| PARDINI ET AL., J. BIOL. CHEM., vol. 281, 2006, pages 40399 - 40411 |
| PASSOLUNGHI, S. ET AL., MICROBIAL CELL FACTORIES, vol. 9, 2010, pages 7 - 17 |
| PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444 - 48 |
| PEARSON; LIPMAN, PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444 |
| PENG, R. ET AL., J. BIOL.CHEM., vol. 275, 2000, pages 11521 - 28 |
| PETERBAUER C K ET AL: "The Trichoderma atroviride seb1 (stress response element binding) gene encodes an AGGGG-binding protein which is involved in the response to high osmolarity stress.", MGG MOLECULAR GENETICS AND GENOMICS, vol. 268, no. 2, October 2002 (2002-10-01), pages 223 - 231, XP002680848, ISSN: 1617-4615 * |
| PETERBAUER, C. ET AL., MOLECULAR GENETICS AND GENOMICS, vol. 268, 2002, pages 223 - 31 |
| PROKISCH, H. ET AL., GEN. GENET, vol. 256, 1997, pages 104 - 114 |
| R. PENG: "Evidence for Overlapping and Distinct Functions in Protein Transport of Coat Protein Sec24p Family Members", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 275, no. 15, 6 April 2000 (2000-04-06), pages 11521 - 11528, XP055015580, ISSN: 0021-9258, DOI: 10.1074/jbc.275.15.11521 * |
| ROBERG, K.J. ET AL., J. CELL. BIOL., vol. 145, 1999, pages 659 - 72 |
| SCHIRAWSKI JAN ET AL: "Endoplasmic reticulum glucosidase II is required for pathogenicity of Ustilago maydis.", THE PLANT CELL, vol. 17, no. 12, December 2005 (2005-12-01), pages 3532 - 3543, XP002680850, ISSN: 1040-4651 * |
| SCHUMACHER JULIA ET AL: "Calcineurin-responsive zinc finger transcription factor CRZ1 of Botrytis cinerea is required for growth, development, and full virulence on bean plants", EUKARYOTIC CELL, vol. 7, no. 4, April 2008 (2008-04-01), pages 584 - 601, XP002680851, ISSN: 1535-9778 * |
| SHIMONI, Y. ET AL., J. CELL. BIOL., vol. 151, 2000, pages 973 - 84 |
| SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 |
| SORIANI FREDERICO MARIANETTI ET AL: "Functional characterization of the Aspergillus fumigatus CRZ1 homologue, CrzA.", MOLECULAR MICROBIOLOGY, vol. 67, no. 6, March 2008 (2008-03-01), pages 1274 - 1291, XP002681101, ISSN: 1365-2958 * |
| SPIELVOGEL ANJA ET AL: "Two zinc finger transcription factors, CrzA and SltA, are involved in cation homoeostasis and detoxification in Aspergillus nidulans + Supplementary Online Data", BIOCHEMICAL JOURNAL, vol. 414, no. Part 3, September 2008 (2008-09-01), pages 419 - 429+4PP, XP002681102 * |
| TALBOT N ET AL: "Identification and characterization of MPG1, a gene", THE PLANT CELL, vol. 5, no. 11, 1 November 1993 (1993-11-01), AMERICAN SOCIETY OF PLANT BIOLOGISTS, US, pages 1575 - 1590, XP002103524, ISSN: 1040-4651, DOI: 10.1105/TPC.5.11.1575 * |
| TURCHINI, A. ET AL., J. BACTERIOL., vol. 182, 2000, pages 1167 - 71 |
| YOSHIMOTO ET AL., J. BIOL. CHEM., vol. 227, 2002, pages 31079 - 31088 |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9593341B2 (en) | 2011-04-22 | 2017-03-14 | Danisco Us Inc. | Filamentous fungi having an altered viscosity phenotype |
| JP2015532120A (ja) * | 2012-10-22 | 2015-11-09 | メルク・シャープ・アンド・ドーム・コーポレーションMerck Sharp & Dohme Corp. | Crz1突然変異真菌細胞 |
| US10100343B2 (en) | 2012-10-22 | 2018-10-16 | Merck Sharp & Dohme Corp. | CRZ1 mutant fungal cells |
| WO2019209576A1 (en) | 2018-04-24 | 2019-10-31 | Danisco Us Inc | Filamentous fungal strains comprising reduced viscosity phenotypes |
| US11976266B2 (en) | 2018-04-24 | 2024-05-07 | Danisco Us Inc. | Filamentous fungal strains comprising reduced viscosity phenotypes |
| WO2020028126A1 (en) | 2018-07-30 | 2020-02-06 | Danisco Us Inc | Mutant and genetically modified filamentous fungal strains comprising enhanced protein productivity phenotypes and methods thereof |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2012245323B2 (en) | Filamentous fungi having an altered viscosity phenotype | |
| US9725726B2 (en) | Filamentous fungi having an altered viscosity phenotype |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12717560 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012717560 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2012245323 Country of ref document: AU Date of ref document: 20120420 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2014506566 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2833756 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20137030474 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14113549 Country of ref document: US |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112013026535 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112013026535 Country of ref document: BR Kind code of ref document: A2 Effective date: 20131015 |