WO2012031773A1 - Sdf-1 binding nucleic acids and the use thereof in cancer treatment - Google Patents
Sdf-1 binding nucleic acids and the use thereof in cancer treatment Download PDFInfo
- Publication number
- WO2012031773A1 WO2012031773A1 PCT/EP2011/004554 EP2011004554W WO2012031773A1 WO 2012031773 A1 WO2012031773 A1 WO 2012031773A1 EP 2011004554 W EP2011004554 W EP 2011004554W WO 2012031773 A1 WO2012031773 A1 WO 2012031773A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- sdf
- acid molecule
- cancer
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/69—Boron compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
- A61K31/7076—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/31—Combination therapy
Definitions
- the present invention is related to nucleic acid molecules binding to the CXC chemokine stromal cell-derived factor- 1 (SDF-1), methods for the treatment of cancer, and their use in the manufacture of a medicament.
- SDF-1 CXC chemokine stromal cell-derived factor- 1
- Stromal-cell derived factor- 1 (abbr.: SDF-1 ; synonyms, CXCL12; PBSF [pre-B-cell growth- stimulating factor]; TPAR-1 [TPA repressed gene 1]; SCYB12; TLSF [thymic lymphoma cell stimulating factor]; hIRH [human intercrine reduced in hepatomas]) is an angiogenic CXC chemokine that does not contain the ELR motif typical of the IL-8-like chemokines (Salcedo, Wasserman et al. 1999; Salcedo and Oppenheim 2003) but binds and activates the G-protein coupled receptor CXCR4.
- SDF-1 there are two forms of SDF-1 , SDF-la (68 amino acids, SEQ ID NO: l)and SDF- ⁇ ⁇ (SEQ ID NO: 2), which, compared to SDF-1 a carries five additional amino acids at the C-terminus (Shirozu, Nakano et al. 1995).
- SDF-1 receptor CXCR4 Since the SDF-1 receptor CXCR4 is widely expressed on leukocytes, mature dendritic cells, endothelial cells, brain cells, and megakaryocytes, the activities of SDF-1 are pleiotropic. This chemokine, more than any other identified thus far, exhibits the widest range of biological functions.. The most significant functional effects of SDF-1 are:
- SDF-1 is required to maintain stem cells and progenitor cells, e.g. hematopoietic progenitor (usually CD34+) cells in the bone marrow of the adult; SDF-1 supports proliferation of pre-B cells and augments the growth of bone marrow B cell progenitors and it induces specific migration of pre- and pro-B cells, while not acting as a significant chemoattractant for mature B cells;
- progenitor cells e.g. hematopoietic progenitor (usually CD34+) cells in the bone marrow of the adult
- CD34+ hematopoietic progenitor
- SDF-1 is one of the most efficacious T cell chemoattractants.
- SDF-1 and its receptor CXCR4 are essential for embryonic development.
- Altered expression levels of SDF-1 or its receptor CXCR4 or altered responses towards those molecules are said to be associated with many human diseases, such as retinopathy (Brooks, Caballero et al. 2004; Butler, Guthrie et al. 2005; Meleth, Agron et al. 2005); cancer of breast (Muller, Homey et al. 2001 ; Cabioglu, Sahin et al. 2005), ovaries (Scotton, Wilson et al. 2002), pancreas (Koshiba, Hosotani et al. 2000), thyroid (Hwang, Chung et al. 2003) andnasopharynx (Wang, Wu et al.
- glioma Zhou, Larsen et al. 2002
- neuroblastoma Geminder, Sagi-Assif et al. 2001
- B cell chronic lymphocytic leukemia Burger, Tsukada et al. 2000
- WHIM syndrome WHIM is an abbreviation for Warts, Hypogammaglobulinemia, Infections, Myelokathexis syndrome) (Gulino, Moratto et al. 2004; Balabanian, Lagane et al. 2005b; Kawai, Choi et al. 2005); immunologic deficiency syndromes (Arya, Ginsberg et al.
- Marechal Arenzana-Seisdedos et al. 1999; Soriano, Martinez et al. 2002); pathologic neovascularization (Salvucci, Yao et al. 2002; Yamaguchi, Kusano et al. 2003; Grunewald, Avraham et al. 2006); inflammation (Murdoch 2000; Fedyk, Jones et al. 2001; Wang, Guan et al. 2001); multiple sclerosis (Krumbholz, Theil et al. 2006); rheumatoid arthritis / osteoarthritis (Buckley, Amft et al. 2000; Kanbe, Takagishi et al. 2002; Grassi, Cristino et al. 2004).
- Tumors are not just masses of cancer cells: infiltration of tumors with immune-cells is a characteristic of cancer. Many human cancers have a complex chemokine network that influences the extent and phenotype of this infiltrate, as well as tumor growth, survival, migration, and angiogenesis. Most solid tumors contain many non-malignant stromal cells. Indeed, stromal cells sometimes outnumber cancer cells. The predominant stromal cells that are found in cancers are macrophages, lymphocytes, endothelial cells and fibroblasts.
- SDF-1 receptor CXCR4 is most commonly found in tumor cells of mouse and man: tumor cells from at least 23 different types of human cancers of epithelial, mesenchymal, and haematopoietic origin express CXCR4 (Balkwill 2004) with SDF-1 being the only known ligand for CXCR4.
- SDF-1 is found in primary tumor sites in lymphoma (Corcione, Ottonello et al. 2000) and brain tumors of both neuronal and astrocytic lineage.
- both receptors for SDF-1 namely CXCR4 and the CXCR7 promote tumor growth, metastatic potential and resistance to (chemotherapy induced) apoptosis in a number of tumors, e.g breast cancer, glioblastomas, ovarian cancer, neuroblastoma, lung cancer colorectal and prostate cancer
- chemotherapy induced apoptosis in a number of tumors, e.g breast cancer, glioblastomas, ovarian cancer, neuroblastoma, lung cancer colorectal and prostate cancer
- the problem underlying the present invention is to provide a means which specifically interacts with SDF-1, whereby the means are suitable for the prevention and/or treatment of and/or cancer.
- Another problem underlying the present invention is to provide a means which supports the therapy of cancer, whereby such therapy of cancer typically makes use of chemotherapy and/or radiation.
- a further problem underlying the present invention is to provide a means which is suitable for use an adjunct therapy in the treatment of cancer.
- a still further problem underlying the present invention is to provide a means which is capable of chemosensitizing patient suffering cancer and/or chemosensitizing cells forming or being part of a cancer.
- the problem underlying the present invention is solved in a first aspect which is also the first embodiment of the first aspect, by a nucleic acid molecule capable of binding to SDF-1, preferably capable of inhibiting SDF-1, whereby the nucleic acid molecule is for use in a method for the treatment and/or prevention of a disease or disorder, for use in a method for the treatment of a subject suffering from a disease or disorder or being at risk of developing a disease or disorder as an adjunct therapy, or for use as a medicament for the treatment and/or prevention of a disease or disorder, whereby the disease or disorder is cancer.
- the cancer is a cancer selected from the group of hematological cancer, whereby preferably the hematological cancer is selected from the group comprising leukemia and myeloma.
- leukemia is selected from the group comprising chronic lymphoid leukemia and acute myeloid leukemia.
- myeloma is multiple myeloma.
- the cancer is a cancer selected from the group of solid tumors, whereby preferably the solid tumors are selected from the group comprising glioblastoma, colorectal cancer, breast cancer, lymphoma, prostate cancer, pancreatic cancer, renal cancer, ovarian cancer and lung cancer.
- the adjunct therapy sensitizes the subject, wherein the sensitized subject is more responsive to a therapy for the treatment and/or prevention of the disease or disorder.
- the therapy for the treatment and/or prevention of the diseases or disorder comprises the administration of a further pharmaceutically active agent and/or irradiating the subject and/or surgery and/or cellular therapy.
- the further pharmaceutically active agent is selected from the group comprising of an antibody, an alkylating agent, an anti-metabolite, a plant alkaloid, a plant terpenoid, a topoisomerase inhibitor, Leucovorin, Methotrexate, Tamoxifen, Sorafenib, Lenalidomide, Bortezomib, Dexamethasone, Flurouracil, and Prednisone.
- the antibody is selected from the group comprising Rituximab, Ofatumumab, Cetuximab, Ibritumomab-Tiuxetan, Tositumomab, Trastuzumab, Bevacizumab, and Alemtuzumab.
- the alkylating agent is selected from the group comprising cisplatin, carboplatin, oxaliplatin, mechlorethamine, cyclophosphamide, chlorambucil, doxorubicin, lioposomal doxorubicin, bendamustine, temozolomide and Melphalan.
- the anti-metabolite is selected from the group comprising purineazathioprine, mercaptopurine, fludarabine, pentostatin, and cladribine.
- the plant terpenoid is selected from the group comprising a taxane more preferably selected from the group comprising Docetaxel, Paclitaxel, podophyllotoxin and epothilone.
- the topoisomerase inhibitor is selected from the group comprising camptothecin, irinotecan, and mitoxantrone.
- the nucleic acid molecule is capable of blocking the interaction between SDF-1 and an SDF-1 receptor, whereby the SDF-1 receptor is selected from the group comprising CXCR4 and CXCR7.
- the treatment or prevention of the disease or disorder is caused by the nucleic acid molecule inhibiting the interaction between SDF-1 and an SDF-1 receptor.
- the nucleic acid molecule is selected from the group comprising an SDF-1 binding nucleic acid molecule of type B, an SDF-1 binding nucleic acid molecule of type C, an SDF-1 binding nucleic acid molecule of type A and an SDF-1 binding nucleic acid molecule of type D.
- the SDF-1 binding nucleic acid molecule of type B comprises a central stretch of nucleotides, whereby the central stretch of nucleotides comprises the following nucleotide sequence:
- the central stretch of nucleotides comprises the following nucleotide sequence:
- the SDF-1 binding nucleic acid molecule of type B comprises in 5'->3' direction a first terminal stretch of nucleotides, the central stretch of nucleotides, and a second terminal stretch of nucleotides.
- the SDF-1 binding nucleic acid molecule of type B comprises in 5'->3' direction a second terminal stretch of nucleotides, the central stretch of nucleotides, and a first terminal stretch of nucleotides.
- the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' XiX 2 SVNS 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' BVBSX3X 4 3', whereby
- Xi is either absent or is A, X 2 is G, X3 is C and X4 is either absent or is U; or Xi is absent, X 2 is either absent or is G, X 3 is either absent or is C and X4 is absent.
- the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' XiX 2 CRWG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' KRYSX 3 X4 3', whereby Xi is either absent or A, X 2 is G, X 3 is C and X 4 is either absent or U.
- the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' X[X 2 CGUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' UACGX 3 X 4 3', whereby Xi is either absent or A, X 2 is G, X3 is C, and X 4 is either absent or U, preferably the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' AGCGUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' UACGCU 3'.
- the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' XiX 2 SSBS 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' BVSSX 3 X 4 3', whereby Xi is absent, X 2 is either absent or G, X 3 is either absent or C, and X 4 is absent, preferably the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' GCGUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' UACGC 3'.
- the SDF-1 binding nucleic acid molecule of type B comprises a nucleotide sequence according to any one of SEQ ID NO: 5 to SEQ ID NO: 20 and SEQ ID NO: 22 to SEQ ID NO: 28, preferably any one of SEQ ID NO: 5 to SEQ ID NO: 7, SEQ ID NO: 16, SEQ ID NO: 22 and SEQ ID NO: 28, more preferably any one of SEQ ID NO: 22 and SEQ ID NO: 28.
- the SDF-1 binding nucleic acid molecule of type C comprises a central stretch of nucleotides, whereby the central stretch of nucleotides comprises a nucleotide sequence of GGUYAGGGCUHRX A AGUCGG (SEQ ID NO: 108), whereby XA is either absent or is A.
- the central stretch of nucleotides comprises a nucleotide sequence of 5' GGUYAGGGCUHRAAGUCGG 3' (SEQ ID NO: 109), 5' GGUYAGGGCUHRAGUCGG 3' (SEQ ID NO: 110) or 5' GGUUAGGGCUHGAAGUCGG 3' (SEQ ID NO: 1 1 1), preferably 5' GGUUAGGGCUHGAAGUCGG 3' (SEQ ID NO: 1 1 1).
- the SDF-1 binding nucleic acid molecule of type C comprises in 5'->3' direction a first terminal stretch of nucleotides, the central stretch of nucleotides, and a second terminal stretch of nucleotides.
- the SDF-1 binding nucleic acid molecule of type C comprises in 5'->3' direction a second terminal stretch of nucleotides, the central stretch of nucleotides, and a first terminal stretch of nucleotides.
- the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' RKSBUSNVGR 3' (SEQ ID NO: 138) and the second stretch of nucleotides comprises a nucleotide sequence of 5' YYNRCASSMY 3' (SEQ ID NO: 139), preferably the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' RKSBUGSVGR 3 '(SEQ ID NO: 140) and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' YCNRCASSMY 3' (SEQ ID NO: 141).
- the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' XsSSSV 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' BSSSXs 3', whereby X s is either absent or is S, preferably the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' SGGSR 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' YSCCS 3'.
- the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' GCCGG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CCGGC 3';
- the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' CGUGCGCUUGAGAUAGG 3 '(SEQ ID NO: 220) and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CUGAUUCUCACG 3' (SEQ ID NO: 221); or
- the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' UGAGAUAGG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CUGAUUCUCA 3' (SEQ ID NO: 222); or
- the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' GAGAUAGG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CUGAUUCUC 3'.
- the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NO: 95 to SEQ ID NO: 107, SEQ ID NO: 1 12 to SEQ ID NO: 137, SEQ ID NO: 223 and SEQ ID NO: 224, preferably any one of SEQ ID NO: 120, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 223 and SEQ ID NO: 224.
- the SDF-1 binding nucleic acid molecule of type A comprises a central stretch of nucleotides, whereby the central stretch of nucleotides comprises a nucleotide sequence of 5' AAAGYRACAHGUMAAX A UGAAAGGUA C 3' (SEQ ID NO: 74), whereby XA is either absent or is A.
- the central stretch of nucleotides comprises a nucleotide sequence of
- 5' AAAGYRACAHGUMAAAUGAAAGGUARC 3' (SEQ ID NO: 76), or 5' AAAGYAACAHGUCAAUGAAAGGUARC 3'(SEQ ID NO: 77), preferably the central stretch of nucleotides comprises a nucleotide sequence of 5' AAAGYAACAHGUCAAUGAAAGGUARC 3' (SEQ ID NO: 77).
- the SDF-1 binding nucleic acid molecule of type A comprises in 5'->3' direction a first terminal stretch of nucleotides, the central stretch of nucleotides, and a second terminal stretch of nucleotides.
- the SDF-1 binding nucleic acid molecule of type A comprises in 5'->3' direction a second terminal stretch of nucleotides, the central stretch of nucleotides, and a first terminal stretch of nucleotides.
- the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' XiX 2 NNBV 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' BNBNX 3 X4 3' whereby Xi is either absent or R, X 2 is S, X 3 is S and X 4 is either absent or Y; or
- Xi is absent, X 2 is either absent or S, X 3 is either absent or S and X 4 is absent.
- the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' RSHRYR 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' YRYDSY 3', preferably the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' GCUGUG 3 ' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CGCAGC 3'.
- the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' X 2 BBBS 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' SBBVX 3 3', whereby X 2 is either absent or is S and X 3 is either absent or is S; preferably the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' CUGUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CGCAG 3'; or the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' GCGUG 3 'and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CGCGC 3'.
- the SDF-1 binding nucleic acid molecule of type A comprises a nucleotide sequence according to any one of SEQ ID NO: 60 to SEQ ID NO: 73, SEQ ID NO: 78 to SEQ ID NO: 82, SEQ ID NO: 84 to SEQ ID NO: 87, SEQ ID NO: 89 to SEQ ID NO: 94, and SEQ ID NO: 145, preferably any one of SEQ ID NO: 60, SEQ ID NO: 63, SEQ ID NO: 66, SEQ ID NO: 78, SEQ ID NO: 84, and SEQ ID NO: 146, more preferably any one of SEQ ID NO: 84 and SEQ ID NO: 146.
- the SDF-1 binding nucleic acid molecule of type D comprises a nucleotide sequence according to any one of SEQ ID NO: 142 to SEQ ID NO: 144.
- the SDF-1 is human SDF-1, whereby preferbaly the human SDF-1 is human S
- the nucleic acid molecule comprises a modification, whereby the modification is
- the modification is selected from the group comprising a HES moiety, a PEG moiety, biodegradable modifications and combinations thereof.
- the modification is a PEG moiety consisting of a straight or branched PEG, whereby preferably the molecular weight of the straight or branched PEG is from about 20,000 to 120,000 Da, more preferably from about 30,000 to 80,000 Da and most preferably about 40,000 Da.
- the modification is a HES moiety, whereby preferably the molecular weight of the HES moiety is from about 10,000 to 200,000 Da, more preferably from about 30,000 to 170.000 Da and most preferably about 150,000 Da.
- the modification is attached to the nucleic acid molecule via a linker, wherein preferably the linker is a biostable or biodegradable linker.
- the modification is attached to the nucleic acid molecule at the 5' -terminal nucleotide of the nucleic acid molecule and/or the 3 '-terminal nucleotide of the nucleic acid molecule and/or to a nucleotide of the nucleic acid molecule between the 5 '-terminal nucleotide of the nucleic acid molecule and the 3 '-terminal nucleotide of the nucleic acid molecule
- a fiftieth embodiment of the first aspect which is also an embodiment of the first, the second, the third, the fourth, the fifth, the sixth, the seventh, the eighth, the ninth, the tenth, the eleventh, the twelfth, the thirteenth, the fourteenth, the fifteenth, the sixteenth, the seventeenth, the eighteenth, the nineteenth, the twentieth, the twenty-first, the twenty-second, the twenty-third, the twenty-fourth, the twenty-fifth, the twenty-sixth, the twenty-seventh, the twenty-eighth, the twenty-ninth, the thirtieth, the thirty-first, the thirty-second, the thirty-third, the thirty-fourth, the thirty-fifth, the thirty-sixth, the thirty-seventh, the thirty-eighth, the thirty-ninth, the fortieth, the forty-first, the forty-second, the forty-third, the forty-fourth, the forty-fifth, the forty-sixth,
- a fifty-first embodiment of the first aspect which is also an embodiment of the first, the second, the third, the fourth, the fifth, the sixth, the seventh, the eighth, the ninth, the tenth, the eleventh, the twelfth, the thirteenth, the fourteenth, the fifteenth, the sixteenth, the seventeenth, the eighteenth, the nineteenth, the twentieth, the twenty-first, the twenty-second, the twenty-third, the twenty-fourth, the twenty-fifth, the twenty-sixth, the twenty- seventh, the twenty-eighth, the twenty-ninth, the thirtieth, the thirty-first, the thirty-second, the thirty-third, the thirty-fourth, the thirty-fifth, the thirty-sixth, the thirty-seventh, the thirty-eighth, the thirty-ninth, the fortieth, the forty-first, the forty-second, the forty-third, the forty-fourth, the forty-fifth, the forty-sixth, the forty-seven
- a pharmaceutical composition comprising as a first pharmaceutically active agent the nucleic acid molecule according to any one of the first, the second, the third, the fourth, the fifth, the sixth, the seventh, the eighth, the ninth, the tenth, the eleventh, the twelfth, the thirteenth, the fourteenth, the fifteenth, the sixteenth, the seventeenth, the eighteenth, the nineteenth, the twentieth, the twenty-first, the twenty-second, the twenty-third, the twenty-fourth, the twenty-fifth, the twenty-sixth, the twenty-seventh, the twenty-eighth, the twenty-ninth, the thirtieth, the thirty-first, the thirty-second, the thirty-third, the thirty-fourth, the thirty-fifth, the thirty-sixth, the thirty-seventh, the thirty-eighth, the thirty-ninth, the fortieth, the forty-
- the adjunct therapy sensitizes the subject, wherein the sensitized subject is more responsive to a therapy for the treatment and/or prevention of the disease or disorder.
- the therapy for the treatment and/or prevention of the diseases or disorder comprises the administration of a further pharmaceutically active agent and/or irradiating the subject and/or surgery and/or cellular therapy.
- the further pharmaceutically active agent is a pharmaceutically active agent selected from the group comprising an antibody, an alkylating agent, an anti-metabolite, a plant alkaloid, preferably vincristine, a plant terpenoid, a topoisomerase inhibitor, Leucovorin, Methotrexate, Tamoxifen, Sorafenib, Lenalidomide, Bortezomib, Dexamethasone, Flurouracil, and Prednisone.
- a pharmaceutically active agent selected from the group comprising an antibody, an alkylating agent, an anti-metabolite, a plant alkaloid, preferably vincristine, a plant terpenoid, a topoisomerase inhibitor, Leucovorin, Methotrexate, Tamoxifen, Sorafenib, Lenalidomide, Bortezomib, Dexamethasone, Flurouracil, and Prednisone.
- the antibody is selected from the group comprising Rituximab, Ofatumumab, Cetuximab, Ibritumomab-Tiuxetan, Tositumomab, Trastuzumab, Bevacizumab, and Alemtuzumab.
- the alkylating agent is selected from the group comprising cisplatin, carboplatin, oxaliplatin, mechlorethamine, cyclophosphamide, chlorambucil, doxorubicin, lioposomal doxorubicin, bendamustine, temozolomide and Melphalan.
- the anti-metabolite is selected from the group comprising purineazathioprine, mercaptopurine, fludarabine, pentostatin, and cladribine.
- the plant terpenoid is selected from the group comprising a taxane more preferably selected from the group comprising Docetaxel, Paclitaxel, podophyllotoxin and epothilone.
- the topoisomerase inhibitor is selected from the group comprising camptothecin, irinotecan, and mitoxantrone.
- the cancer is a cancer selected from the group of hematological cancer, whereby preferably the hematological cancer is selected from the group of leukemia and myeloma.
- leukemia is selected from the group comprising chronic lymphoid leukemia and acute myeloid leukemia.
- myeloma is multiple myeloma.
- the cancer is a cancer selected from the group of solid tumors, whereby preferably the solid tumors are selected from the group comprising glioblastoma, colorectal cancer, breast cancer, lymphoma, prostate cancer, pancreatic cancer, renal cancer, ovarian cancer and lung cancer.
- a medicament comprising one or several dosage units of at least a first pharmaceutically active agent
- the first pharmaceutically active agent is a nucleic acid molecule capable of binding to SDF- 1 as defined in any one of the first, the second, the third, the fourth, the fifth, the sixth, the seventh, the eighth, the ninth, the tenth, the eleventh, the twelfth, the thirteenth, the fourteenth, the fifteenth, the sixteenth, the seventeenth, the eighteenth, the nineteenth, the twentieth, the twenty-first, the twenty-second, the twenty-third, the twenty-fourth, the twenty-fifth, the twenty-sixth, the twenty-seventh, the twenty-eighth, the twenty-ninth, the thirtieth, the thirty-first, the thirty-second, the thirty-third, the thirty-fourth, the thirty-fifth, the thirty-sixth, the thirty-seven
- the adjunct therapy sensitizes the subject, wherein the sensitized subject is more responsive to a therapy for the treatment and/or prevention of the disease or disorder.
- the therapy for the treatment and/or prevention of the diseases or disorder comprises the adminstriation of a further pharmaceutically active agent and/or irradiating the subject and/or surgery and/or cellular therapy.
- the medicament comprises a further pharmaceutically active agent, preferably one or several dosage units of a further pharmaceutically active agent, whereby the further pharmaceutically active agent is selected from the group comprising an antibody, an alkylating agent, an anti-metabolite, a plant alkaloid, preferably vincristine, a plant terpenoid, a topoisomerase inhibitor, Leucovorin, Methotrexate, Tamoxifen, Sorafenib, Lenalidomide, Bortezomib, Dexamethasone and Flurouracil.
- the further pharmaceutically active agent is selected from the group comprising an antibody, an alkylating agent, an anti-metabolite, a plant alkaloid, preferably vincristine, a plant terpenoid, a topoisomerase inhibitor, Leucovorin, Methotrexate, Tamoxifen, Sorafenib, Lenalidomide, Bortezomib, Dexamethasone and Flurou
- the medicament comprises the further pharmaceutically active agent, preferably one or several dosage units of the further pharmaceutically active agent, whereby the further pharmaceutically active agent is selected from the group comprising an antibody, an alkylating agent, an anti-metabolite, a plant alkaloid, preferably vincristine, a plant terpenoid, a topoisomerase inhibitor, Leucovorin, Methotrexate, Tamoxifen, Sorafenib, Lenalidomide, Bortezomib, Dexamethasone Flurouracil, and Prednisone.
- the further pharmaceutically active agent is selected from the group comprising an antibody, an alkylating agent, an anti-metabolite, a plant alkaloid, preferably vincristine, a plant terpenoid, a topoisomerase inhibitor, Leucovorin, Methotrexate, Tamoxifen, Sorafenib, Lenalidomide, Bortezomib, Dexamethas
- the antibody is selected from the group comprising Rituximab, Ofatumumab, Cetuximab, Ibritumomab-Tiuxetan, Tositumomab, Trastuzumab, Bevacizumab, and Alemtuzumab.
- the alkylating agent is selected from the group comprising cisplatin, carboplatin, oxaliplatin, mechlorethamine, cyclophosphamide, chlorambucil, doxorubicin, lioposomal doxorubicin, bendamustine, temozolomide and Melphalan.
- the anti-metabolite is selected from the group comprising purineazathioprine, mercaptopurine fludarabine, pentostatin, and cladribine.
- the plant terpenoid is selected from the group of a taxane, more preferably selected from the group comprising Docetaxel, Paclitaxel, podophyllotoxin and epothilone.
- the topoisomerase inhibitor is selected from the group comprising camptothecin, irinotecan and mitoxantrone.
- the cancer is a cancer selected from the group of hematological cancer, whereby preferably the hematological cancer is selected from the group comprising leukemia and myeloma.
- leukemia is selected from the group comprising chronic lymphoid leukemia and acute myeloid leukemia.
- myeloma is multiple myeloma.
- the cancer is a cancer selected from the group of solid tumors, whereby preferably the solid tumors are selected from the group comprising glioblastoma, colorectal cancer, breast cancer, lymphoma, prostate cancer, pancreatic cancer, renal cancer, ovarian cancer and lung cancer.
- a fourth aspect which is also the first embodiment of the fourth aspect, by use of a nucleic acid molecule as defined in any one of the first, the second, the third, the fourth, the fifth, the sixth, the seventh, the eighth, the ninth, the tenth, the eleventh, the twelfth, the thirteenth, the fourteenth, the fifteenth, the sixteenth, the seventeenth, the eighteenth, the nineteenth, the twentieth, the twenty-first, the twenty-second, the twenty-third, the twenty-fourth, the twenty-fifth, the twenty-sixth, the twenty-seventh, the twenty-eighth, the twenty-ninth, the thirtieth, the thirty-first, the thirty- second, the thirty-third, the thirty-fourth, the thirty-fifth, the thirty-sixth, the thirty-seventh, the thirty-eighth, the thirty-ninth, the fortieth, the forty-first, the forty-second, the forty-
- the adjunct therapy sensitizes the subject, wherein the sensitized subject is more responsive to a therapy for the treatment and/or prevention of the disease or disorder.
- the therapy for the treatment and/or prevention of the diseases or disorder comprises the administration of a further pharmaceutically active agent and/or irradiating the subject and/or surgery and/or cellular therapy.
- the medicament is used in combination with a further pharmaceutically active agent, whereby the further pharmaceutically active agent is a pharmaceutically active agent selected from the group comprising an antibody, an alkylating agent, an anti -metabolite, a plant alkaloid, preferably vincristine, a plant terpenoid, a topoisomerase inhibitor, Leucovorin, Methotrexate, Tamoxifen, Sorafenib, Lenalidomide, Bortezomib, Dexamethasone, Flurouracil, and Prednisone.
- a pharmaceutically active agent selected from the group comprising an antibody, an alkylating agent, an anti -metabolite, a plant alkaloid, preferably vincristine, a plant terpenoid, a topoisomerase inhibitor, Leucovorin, Methotrexate, Tamoxifen, Sorafenib, Lenalidomide, Bortezomib, Dexamethasone,
- the further pharmaceutically active agent is a pharmaceutically active agent selected from the group comprising an antibody, an alkylating agent, an anti-metabolite, a plant alkaloid, preferably vincristine, a plant terpenoid, a topoisomerase inhibitor, Leucovorin, Methotrexate, Tamoxifen, Sorafenib, Lenalidomide, Bortezomib, Dexamethasone, Flurouracil, and Prednisone.
- a pharmaceutically active agent selected from the group comprising an antibody, an alkylating agent, an anti-metabolite, a plant alkaloid, preferably vincristine, a plant terpenoid, a topoisomerase inhibitor, Leucovorin, Methotrexate, Tamoxifen, Sorafenib, Lenalidomide, Bortezomib, Dexamethasone, Flurouracil, and Prednisone.
- the antibody is selected from the group comprising Rituximab, Cetuximab, Ibritumomab-Tiuxetan, Tositumomab, Trastuzumab, Bevacizumab, and Alemtuzumab.
- the alkylating agent is selected from the group comprising cisplatin, carboplatin, oxaliplatin, mechlorethamine, cyclophosphamide, chlorambucil, doxorubicin, lioposomal doxorubicin, bendamustine, temozolomide and Melphalan.
- the anti-metabolite is selected from the group comprising purineazathioprine, mercaptopurine fludarabine, pentostatin, and cladribine.
- the plant terpenoid is selected from the group comprising a taxane, more preferably selected from the group of Docetaxel, Paclitaxel, podophyllotoxin and epothilone.
- the topoisomerase inhibitor is selected from the group comprising camptothecin, irinotecan, and mitoxantrone.
- the cancer is a cancer selected from the group of hematological cancer, whereby preferably the hematological cancer is selected from the group comprising leukemia and myeloma.
- leukemia is selected from the group comprising chronic lymphoid leukemia and acute myeloid leukemia.
- myeloma is multiple myeloma.
- the cancer is a cancer selected from the group of solid tumors, whereby preferably the solid tumors are selected from the group comprising glioblastoma, colorectal cancer, breast cancer, lymphoma, prostate cancer, pancreatic cancer, renal cancer, ovarian cancer and lung cancer.
- a fifth aspect which is also the first embodiment of the fifth aspect, by a method for the treatment of a subject suffering from or being at risk of developing cancer, whereby the method comprises a step a) of administering to the subject a pharmaceutically effective amount of a nucleic acid molecule capable of binding to SDF-1 as defined in any one of the first, the second, the third, the fourth, the fifth, the sixth, the seventh, the eighth, the ninth, the tenth, the eleventh, the twelfth, the thirteenth, the fourteenth, the fifteenth, the sixteenth, the seventeenth, the eighteenth, the nineteenth, the twentieth, the twenty first, the twenty second, the twenty third, the twenty fourth, the twenty fifth, the twenty-sixth, the twenty seventh, the twenty-eighth, the twenty-ninth, the thirtieth, the thirty-first, the thirty-second, the thirty-third, the thirty-fourth, the thirty-fifth, the thirty-sixth, the thirty-
- the method comprises a step b) of irradiating the subject and/or surgery and/or cellular therapy and/or administering a pharmaceutically effective amount of a further pharmaceutically active agent to the subject, whereby the further pharmaceutically active agent is a pharmaceutically active agent selected from the group comprising an antibody, an alkylating agent, an anti-metabolite, a plant alkaloid, preferably vincristine, a plant terpenoid, a topoisomerase inhibitor, Leucovorin, Methotrexate, Tamoxifen, Sorafenib, Lenalidomide, Bortezomib, Dexamethasone, Flurouracil, and Prednisone.
- the further pharmaceutically active agent is a pharmaceutically active agent selected from the group comprising an antibody, an alkylating agent, an anti-metabolite, a plant alkaloid, preferably vincristine, a plant terpenoid, a topoisomerase inhibitor, Leucovorin,
- the adjunct therapy sensitizes the subject, wherein the sensitized subject is more responsive to a therapy for the treatment and/or prevention of the disease or disorder.
- the therapy for the treatment and/or prevention of the disease or disorder comprises the adminstriation of a further pharmaceutically active agent and/or irradiating the subject and/or surgery and/or cellular therapy as performed in step b).
- the antibody is selected from the group comprising Rituximab, Cetuximab, Ibritumomab-Tiuxetan, Tositumomab, Trastuzumab, Bevacizumab, and Alemtuzumab.
- the alkylating agent is selected from the group comprising cisplatin, carboplatin, oxaliplatin, mechlorethamine, cyclophosphamide, chlorambucil, doxorubicin, lioposomal doxorubicin, bendamustine, temozolomide and Melphalan.
- the anti-metabolite is selected from the group comprising purineazathioprine, mercaptopurine, fludarabine, pentostatin, and cladribine.
- the plant terpenoid is selected from the group comprising taxanes, more preferably selected from the group of Docetaxel, Paclitaxel, podophyllotoxin and epothilone.
- the topoisomerase inhibitor is selected from the group comprising camptothecin, irinotecan, and mitoxantrone.
- the cancer is a cancer selected from the group of hematological cancer, whereby preferably the hematological cancer is selected from the group comprising leukemia and myeloma.
- leukemia is selected from the group comprising chronic lymphoid leukemia and acute myeloid leukemia.
- myeloma is multiple myeloma.
- the cancer is a cancer selected from the group of solid tumors, whereby preferably the solid tumors are selected from the group comprising glioblastoma, colorectal cancer, breast cancer, lymphoma, prostate cancer, pancreatic cancer, renal cancer, ovarian cancer and lung cancer.
- the present inventors have found that the nucleic acid molecules according to the present invention inhibit the binding of SDF-1 to its SDF-1 receptors and thus, either directily or indirectly, are used for the treatment of cancer. Furthermore, the instant inventors have found that the nucleic acid molecules according to the present invention are suitable to block the interaction of SDF-1 with the SDF-1 receptors CXCR4 and CXCR7, respectively. Insofar, the SDF-1 binding nucleic acid molecule according to the present invention can also be viewed as antagonists of CXCR4 and CXCR7, respectively.
- SDF-1 refers to any SDF-1 including, but not limited to, mammalian SDF-1.
- the mammalian SDF-1 is selected from the group comprising mice, rat, rabbit, hamster, monkey and human SDF-1.
- the SDF-1 is human SDF-1 also referred to as SDF-la (SEQ ID NO: 1) and/ or human SDF-1 ⁇ (SEQ ID NO: 2), most preferably human SDF-1 also referred to as SDF-la (SEQ ID NO: 1)
- SDF-1 acts through two different receptors, the receptors CXCR4 and RDC1/CXCR7 (Balabanian, Lagane et al. 2005a, Burns, Summers et al. 2006) (see the introductory part of the instant application). Elevated expression of CXCR4 and CXCR7 was shown for several cancer types as described herein.
- a) should be less effective due to the two different SDF-1 receptors expressed on cells, preferably cancer cells;
- b) is limited to a distinct population of cells, preferably to a distinct population of cancer cells, due to the individual SDF-1 receptors expressed on the cells.
- Cancer is a term for malignant neoplasms, a great and heterogeneous group of diseases in which cells display uncontrolled growth, invasion and often metastasizes, wherein the cancer cells spread to other locations in the body, to regional lymph nodes or distant body sites like brain, bone, liver, or other organs.
- These three malignant properties of cancer differentiate malignant tumors from benign tumors, whereby, as used hererin, the term cancer shall also encompass malignant tumors which in turn are also referref to herein as tumors.
- Malignant tumors fall into two categories based on their origin: Hematological and solid tumors. Hematological tumors are cancer types affecting blood, bone marrow, and lymph nodes. Solid tumors are formed by an abnormal growth of body tissue cells other than blood, bone marrow or lymphatic cells.
- Brain Tumor such as Astrocytomas, Brain and Spinal Cord Tumors, Brain Stem Glioma, Childhood, Central Nervous System Atypical Teratoid/Rhabdoid Tumor, Central Nervous System Embryonal Tumors, Craniopharyngioma, Ependymoblastoma, Ependymoma, Medulloblastoma, Medulloepithelioma, Pineal Parenchymal Tumors of Intermediate Differentiation, Supratentorial Primitive Neuroectodermal Tumors and Pineoblastoma
- Eye Cancer such as Intraocular Melanoma and Retinoblastoma
- GIST Gastrointestinal Stromal Tumors
- Germ Cell Tumor extracranial, extragonadal or ovarian
- Intraocular Melanoma Islet Cell Tumors (Endocrine Pancreas)
- Leukemia such Acute Lymphoblastic Leukemia (abbr. ALL), Acute Myeloid Leukemia (abbr.
- Lymphoma such as AIDS-Related Lymphoma, Burkitt, Mycosis Fungoides and Sezary Syndrome, Hodgkin, Non-Hodgkin and leukemia of Primary Central Nervous System (abbr. CNS)
- Sarcoma such as Ewing Sarcoma Family of Tumors, Kaposi Sarcoma, Soft Tissue Sarcoma, Uterine Sarcoma
- Thymoma and Thymic Carcinoma are Thymoma and Thymic Carcinoma
- the SDF-1 - CXCR4 axis has been shown to play a role in stem cell mobilization including cancer stem cells, vasculogenesis, tumor growth and metastasis.
- the SDF-1 receptor CXCR4 is expressed in a variety of cancers and hematological malignancies in vivo as is CXCR7 (Maksym, Tarnowski et al., 2009; Wang, Shiosawa et al., 2008; Miao, Lucker et al., 2007).
- the growth and invasion signal for tumor cells is SDF-1, in particulaur if the cells express the receptors for SDF-1 (Batchelor et al., 2007; Zhu et al., 2009; Xu et al., 2009; Kozin et al., 2010).
- CXCR4 as well as SDF-1 are induced by hypoxia (Ceradini et al. 2004). Together with VEGF they represent a potent synergistic axis that initiates and maintains angiogenic/vascologenic pathways (Kryczek et al. 2005). The role in vasculogenesis is supported by evidence that SDF-1 attracts CXCR4 expressing endothelial progenitor cells from the circulation (Sengupta et al. 2005). SDF-1 - CXCR4 mediated recruitment of bone marrow derived cells that support vascularization may also be the reason for recurrence of glioblastoma after irradiation therapy (Kioi et al., 2010).
- SDF-1 induces VEGF secretion, while VEGF increases CXCR4 expression (Salcedo et al. 1999) and angiogenesis signals. Therefore inhibition of the SDF-1 - CXCR4 axis may reduce or prevent tumor growth by inhibition of angiogenesis/vasculogenesis either with monotherapy or particularly in combination with other antivascular agents such as VEGF inhibitors.
- the inhibition of the SDF-1 - CXCR4 axis and the SDF-1 - CXCR7 axis with only one compound such as the SDF-1 binding nucleic acid molecule according to the present invention should be effective in treating cancer and/or tumors, in particular a wide range of both haematological and solid tumors either as monotherapy or in combination with other treatments such as, but not limited to, drug therapy, cellular therapy, irradiation and surgery.
- the inhibition of the SDF-1 - CXCR4 axis and the SDF-1 - CXCR7 axis with only one compound such as the SDF-1 binding nucleic acid molecule accordimg to the present invention should be more effective in treating cancer and/or tumors, in particular a wide range of both haematological and solid tumors either as monotherapy or in combination with other treatments such as but not limited to drug therapy, cellular therapy, irradiation and surgery.
- drug therapy comprises the treatment and/or prevention of a disease or disorder by a drug, preferably a pharmaceutically active agent, more preferably a pharmaceutically active agent as defined herein.
- processed tissue from the organs, embryos, or fetuses of animals such as sheep or cows is injected into a subject suffering from or being at risk of developing a disease or disorder, whereby preferably the disease or disorder is cancer and cell therapy a form of cancer treatment.
- non-hematological cancers can be cured if entirely removed by surgery.
- complete surgical excision is usually impossible.
- surgical procedures or surgery for cancer include mastectomy for breast cancer, prostatectomy for prostate cancer, and lung cancer surgery for non-small cell lung cancer.
- the goal of the surgery can be either the removal of only the tumor, or of the entire organ.
- Surgery is often combined with other cancer treatments or therapies, such as chemotherapy and radiation.
- Cancer surgery may be used to achieve one or more goals. Such goals may include, but are not limted to, cancer prevention, diagnosis, staging, primary treatment, debulking and relieving symtoms or side effects.
- Radiotherapy also referred to X-ray therapy or irradiation
- Radiotherapy is the use of ionizing radiation to kill cancer cells. Radiotherapy is used in the medical art to treat almost every type of solid tumor. Irradiation is also used to treat leukemia and lymphoma. Radiotherapy injures or destroys cells in the area being treated by damaging their genetic material, making it impossible for these cells to continue to grow and divide. The effects of radiotherapy are localized and confined to the region being treated. Radiation dose to each site depends on a number of factors, including the radiosensitivity of each cancer type and whether there are tissues and organs nearby that may be damaged by radiation. The goal of radiotherapy is to damage as many cancer cells as possible, while limiting harm to nearby healthy tissue.
- an SDF-1 binding nucleic molecule accorrding to the present invention is preferred if the physiological effect of the SDF-1 - CXCR4 axis and/or SDF-1 - CXCR7 axis is related to higher plasma levels of SDF-1.
- particular therapeutic agents such as paclitaxel and bevacizumab produce an elevation of plasma SDF-1 levels which can have a negative effect on tumor therapy by releasing more bone marrow derived endothelial progenitor cells or by stimulating growth, invasiveness or metastasis (Shaked, Henke et al., 2008; Xu, Duda et al., 2009).
- the co-application of an SDF-1 binding nucleic acid will ameliorate the effects of elevated plasma SDF-1 levels.
- SDF-1 binding nucleic molecule As a process known as chemosensitization.
- the sensitization of tumor cells to chemotherapy or radiotherapy is known as 'chemosensitization' or 'radiosensitization', respectively.
- Such 'chemosensitization' or 'radiosensitization' preferably by the nucleic acid molecules according to the present invention, sensitizes the subject sufferring from a disease or disorder, whereby the sensitized subject is more responsive to a therapy for the treatment and/or prevention of the disease or disorder, whereby preferably the disease or the disorder is cancer.
- Such treatment used together with a primary treatment, preferably a cancer treatment is an adjunct therapy according to the present invention and also referred to as adjunctive therapy. The purpose of such adjunct therapy is to assist a primary treatment, preferably a primary cancer treatment.
- the inhibition of the SDF-1 - CXCR4 axis and/or SDF-1 - CXCR7 axis will be particularly effective in treating a wide range of both haematological and solid tumors either as monotherapy or in combination with other treatments such as but not limited to drug therapy, cellular therapy, irradiation and surgery.
- the SDF-1 binding and the interaction between SDF-1 and SDF-1 receptor inhibiting nucleic acid molecules according to the present invention can help to attenuate such diseases, whereby inhibition of SDF-1 by the SDF-1 binding nucleic acid molecules according to the present invention leads to chemosensitization of malignant cells to be treated by chemotherapy, reduction or inhibition of growth and invasiveness, inhibition of angiogenesis/vasculogenesis, inhibition of metastasis and/or inhibition of elevated plasma SDF-1 levels derived from the response of the host to chemotherapy.
- the present invention is based on the surprising finding that it is possible to generate nucleic acid molecules binding specifically and with high affinity to SDF-1, thereby inhibiting and antagonizing the effects of SDF-1, in particular the effects of SDF-1 on its receptors such as CXCR4 and CXCR7.
- An antagonists to SDF-1 is a molecule that binds to SDF-1 - such as the SDF-1 binding nucleic acid molecules according to the present invention - and inhibts the function of SDF-1, preferably in an in vitro assay or in an in vivo model as described in the Examples.
- nucleic acid according to the present invention is a nucleic acid molecule.
- nucleic acid and nucleic acid molecule are used herein in a synonymous manner if not indicated to the contrary.
- nucleic acids are preferably also referred to herein as the nucleic acid molecules according to the present invention, the nucleic acids according to the present invention, the inventive nucleic acids or the inventive nucleic acid molecules.
- the features of the nucleic acid according to the present invention as described herein can be realised in any aspect of the present invention where the nucleic acid is used, either alone or in any combination.
- the present inventors have identified a number of different SDF-1 binding nucleic acid molecules, whereby the nucleic acid molecules can be characterised in terms of stretches of nucleotides which are also referred to herein as Boxes (see Example 1). As experimentally shown in examples 5 to 1 1 the inventors could surprisingly demonstrate in several systems that SDF-1 binding nucleic acid molecules are suitbale for the treatment of cancer and actually capable of treating cancer.
- SDF-1 binding nucleic acid molecules comprise three different stretches of nucleotides: the first terminal stretch of nucleotides, the central stretch of nucleotides and second terminal stretch of nucleotides.
- SDF-1 binding nucleic acid molecules of the present invention comprise at their 5' -end and the 3 '-end the terminal stretches of nucleotides: the first terminal stretch of nucleotides and the second terminal stretch of nucleotides (also referred to as 5 '-terminal stretch of nucleotides and 3 '-terminal stretch of nucleotides).
- the first terminal stretch of nucleotides and the second terminal stretch of nucleotides can, in principle due to their base complementarity, hybridize to each other, whereby upon hybridization a double-stranded structure is formed. However, such hybridization is not necessarily realized in the molecule under physiological and/or non- physiological conditions.
- the three stretches of nucleotides of SDF-1 binding nucleic acid molecules - the first terminal stretch of nucleotides, the central stretch of nucleotides and second terminal stretch of nucleotides - are arranged to each other in 5' -> 3 '-direction: the first terminal stretch of nucleotides - the central stretch of nucleotides - the second terminal stretch of nucleotides.
- the second terminal stretch of nucleotides, the central stretch of nucleotides and the terminal first stretch of nucleotides are arranged to each other in 5' - 3 '-direction.
- the central stretch and the nucleotides forming the same are individually and more preferably in their entirety essential for binding to human SDF- 1.
- the nucleic acid according to the present invention is a single nucleic acid molecule.
- the single nucleic acid molecule is present as a multitude of the single nucleic acid molecule or as a multitude of the single nucleic acid molecule species.
- nucleic acid molecule in accordance with the invention preferably consists of nucleotides which are covalently linked to each other, preferably through phosphodiester links or linkages.
- the nucleic acids according to the present invention comprise two or more stretches or part(s) thereof can, in principle, hybridise with each other. Upon such hybridisation a double-stranded structure is formed. It will be acknowledged by the ones skilled in the art that such hybridisation may or may not occur, particularly under in vitro and/or in vivo conditions. Also, in case of such hybridisation, it is not necessarily the case that the hybridisation occurs over the entire length of the two stretches where, at least based on the rules for base pairing, such hybridisation and thus formation of a double- stranded structure may, in principle, occur.
- a double-stranded structure is a part of a nucleic acid molecule or a structure formed by two or more separate strands or two spatially separated stretches of a single strand of a nucleic acid molecule, whereby at least one, preferably two or more base pairs exist which are base pairing preferably in accordance with the Watson-Crick base pairing rules. It will also be acknowledged by the one skilled in the art that other base pairing such as Hoogsten base pairing may exist in or form such double-stranded structure. It is also to be acknowledged that the feature that two stretches hybridize preferably indicates that such hybridization is assumed to happen due to base complementarity of the two stretches. In a preferred embodiment the term arrangement as used herein, means the order or sequence of structural or functional features or elements described herein in connection with the nucleic acids disclosed herein.
- the nucleic acids according to the present invention are capable of binding to SDF-1.
- the present inventors assume that the SDF-1 binding results from a combination of three-dimensional structural traits or elements of the claimed nucleic acid molecule, which are caused by orientation and folding patterns of the primary sequence of nucleotides forming such traits or elements, whereby preferably such traits or elements are the first terminal stretch of nucleotides, the central stretch of nucleotides and the second terminal stretch of nucleotides of SDF-1 binding nucleic acid molcules.
- the individual trait or element may be formed by various different individual sequences the degree of variation of which may vary depending on the three-dimensional structure such element or trait has to form.
- the overall binding characteristic of the claimed nucleic acid results from the interplay of the various elements and traits, respectively, which ultimately results in the interaction of the claimed nucleic acid with its target, i. e. SDF-1.
- SDF-1 target
- the central stretch of nucleotides that is characteristic for SDF-1 binding nucleic acids seems to be important for mediating the binding of the claimed nucleic acid molecules with SDF-1. Accordingly, the nucleic acids according to the present invention are suitable for the interaction with SDF-1.
- nucleic acids according to the present invention are antagonists to SDF-1. Because of this the nucleic acids according to the present invention are suitable for the treatment and prevention, respecticely, of any disease or condition which is associated with or caused by SDF-1. Such diseases and conditions may be taken from the prior art which establishes that SDF-1 is involved or associated with said diseases and conditions, respectively, and which is incorporated herein by reference providing the scientific rationale for the therapeutic use of the nucleic acids according to the invention.
- nucleic acids according to the present invention shall also comprise nucleic acids which are essentially homologous to the particular sequences disclosed herein.
- substantially homologous shall be understood such as the homology is at least 75%, preferably 85%, more preferably 90% and most preferably more that 95 %, 96 %, 97 %, 98 % or 99%.
- the actual percentage of homologous nucleotides present in the nucleic acid according to the present invention will depend on the total number of nucleotides present in the nucleic acid.
- the percent modification can be based upon the total number of nucleotides present in the nucleic acid.
- the homology between two nucleic acid molecules can be determined as known to the person skilled in the art. More specifically, a sequence comparison algorithm may be used for calculating the percent sequence homology for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
- the test sequence is preferably the sequence or nucleic acid molecule which is said to be homologous or to be tested whether it is homologous, and if so, to what extent, to a different nucleic acid molecule, whereby such different nucleic acid molecule is also referred to as the reference sequence.
- the reference sequence is a nucleic acid molecule as described herein, preferably a nucleic acid molecule having a sequence according to any one of SEQ ID NO: 5 to SEQ ID NO: 225, more preferably a nucleic acid molecule having a sequence according to any one of SEQ ID NO: 22, SEQ ID NO: 28, SEQ ID NO: 120, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 223, SEQ ID NO: 224, SEQ ID NO: 84, SEQ ID NO: 146, SEQ ID NO: 142, SEQ ID NO: 143, and SEQ ID NO: 144.
- Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman (Smith & Waterman, 1981) by the homology alignment algorithm of Needleman & Wunsch (Needleman & Wunsch, 1970) by the search for similarity method of Pearson & Lipman (Pearson & Lipman, 1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection.
- BLAST basic local alignment search tool
- NCBI National Center for Biotechnology Information
- the nucleic acids according to the present invention shall also comprise nucleic acids which have a certain degree of identity relative to the nucleic acids disclosed herein and defined by their nucleotide sequence. More preferably, the instant invention also comprises those nucleic acid molecules which have an identity of at least 75%, preferably 85%, more preferably 90% and most preferably more than 95 %, 96 %, 97 %, 98 % or 99% relative to the nucleic acids disclosed herein and defined by their nucleotide sequence or a part thereof.
- inventive nucleic acid or nucleic acid according to the present invention shall also comprise those nucleic acids comprising the nucleic acids sequences disclosed herein or part thereof, such as, e.g., a metabolite or derivative of the nucleic acid according to the present invention, preferably to the extent that the nucleic acids or said parts are involved in the or capable of binding to SDF-1.
- a nucleic acid may be derived from the ones disclosed herein, e.g., by truncation. Truncation may be related to either or both of the ends of the nucleic acids as disclosed herein. Also, truncation may be related to the inner sequence of nucleotides, i.e.
- truncation shall comprise the deletion of as little as a single nucleotide from the sequence of the nucleic acids disclosed herein. Truncation may also be related to more than one stretch of the inventive nucleic acid(s), whereby the stretch can be as little as one nucleotide long.
- the binding of a nucleic acid according to the present invention can be determined by the ones skilled in the art using routine experiments or by using or adopting a method as described herein, preferably as described herein in the example part.
- the nucleic acids according to the present invention may be either D-nucleic acids or L- nucleic acids.
- the inventive nucleic acids are L-nucleic acids.
- one or several parts of the nucleic acid are present as D-nucleic acids or at least one or several parts of the nucleic acids are L-nucleic acids.
- the term "part" of the nucleic acids shall mean as little as one nucleotide.
- Such nucleic acids are generally referred to herein as D- and L-nucleic acids, respectively. Therefore, in a particularly preferred embodiment, the nucleic acids according to the present invention consist of L-nucleotides and comprise at least one D-nucleotide.
- Such D-nucleotide is preferably attached to a part different from the stretches defining the nucleic acids according to the present invention, preferably those parts thereof, where an interaction with other parts of the nucleic acid is involved.
- such D-nucleotide is attached at a terminus of any of the stretches and of any nucleic acid according to the present invention, respectively.
- such D- nucleotides may act as a spacer or a linker, preferably attaching modifications such as PEG and HES to the nucleic acids according to the present invention.
- nucleic acid molecules described herein in their entirety in terms of their nucleic acid sequence(s) are limited to the particular nucleotide sequence(s).
- the terms “comprising” or “comprise(s)” shall be interpreted in such embodiment in the meaning of containing or consisting of.
- nucleic acids according to the present invention are part of a longer nucleic acid whereby this longer nucleic acid comprises several parts whereby at least one such part is a nucleic acid, or a part thereof, according to the present invention.
- the other part(s) of these longer nucleic acids can be either one or several D- nucleic acid(s) or L-nucleic acid(s). Any combination may be used in connection with the present invention.
- These other part(s) of the longer nucleic acid can exhibit a function which is different from binding, preferably from binding to SDF-1.
- nucleic acids according to the invention comprise, as individual or combined moieties, several of the nucleic acids of the present invention.
- nucleic acid comprising several of the nucleic acids of the present invention is also encompassed by the term longer nucleic acid.
- L-nucleic acids as used herein are nucleic acids consisting of L-nucleotides, preferably consisting completely of L-nucleotides.
- D-nucleic acids as used herein are nucleic acids consisting of D-nucleotides, preferably consisting completely of D-nucleotides.
- nucleic acid and nucleic acid molecule are used herein in an interchangeable manner if not explicitly indicated to the contrary.
- any nucleotide sequence is set forth herein in 5'— > 3' direction.
- any position of a nucleotide is determined or referred to relative to the 5' end of a sequence, a stretch or a substretch.
- a second nucleotide is the second nucleotide counted from the 5' end of the sequence, stretch and substretch, respectively.
- a penultimate nucleotide is the seond nucleotide counted from the 3' end of a sequence, stretch and substretch, respectively.
- the nucleic acid may consist of desoxyribonucleotide(s), ribonucleotide(s) or combinations thereof.
- L-nucleic acids are enantiomers of naturally occurring nucleic acids.
- D-nucleic acids are not very stable in aqueous solutions and particularly in biological systems or biological samples due to the widespread presence of nucleases.
- Naturally occurring nucleases, particularly nucleases from animal cells are not capable of degrading L-nucleic acids. Because of this the biological half-life of the L-nucleic acid is significantly increased in such a system, including the animal and human body. Due to the lacking degradability of L- nucleic acid no nuclease degradation products are generated and thus no side effects arising therefrom observed.
- L-nucleic acid delimits the L-nucleic acid of factually all other compounds which are used in the therapy of diseases and/or disorders involving the presence of SDF-1.
- L-nucleic acids which specifically bind to a target molecule through a mechanism different from Watson Crick base pairing, or aptamers which consists partially or completely of L- nucleotides, particularly with those parts of the aptamer being involved in the binding of the aptamer to the target molecule, are also called aptamers. Aptamers and aptmers as such are known to a person skilled in the art and are, among others, described in 'The Aptamer Handbook' (eds. Klussmann, 2006).
- inventive nucleic acids regardless whether they are present as D-nucleic acids, L-nucleic acids or D,L-nucleic acids or whether they are DNA or RNA, may be present as single stranded or double stranded nucleic acids.
- inventive nucleic acids are single stranded nucleic acids which exhibit defined secondary structures due to the primary sequence and may thus also form tertiary structures.
- inventive nucleic acids may also be double stranded in the meaning that two strands which are complementary or partially complementary to each other are hybridised to each other.
- the inventive nucleic acids may be modified. Such modifications may be related to the single nucleotide of the nucleic acid and are well known in the art. Examples for such modification are described by, among others, Venkatesan et al. (Venkatesan, Kim et al. 2003) and Kusser (Kusser 2000). Such modification can be a H atom, a F atom or O-CH3 group or NH 2 -group at the 2' position of the individual nucleotide of which the nucleic acid consists. Also, the nucleic acid according to the present invention can comprises at least one LNA nucleotide. In an embodiment the nucleic acid according to the present invention consists of LNA nucleotides.
- the nucleic acids according to the present invention may be a multipartite nucleic acid.
- a multipartite nucleic acid as used herein is a nucleic acid which consists of at least two separate nucleic acid strands. These at least two nucleic acid strands form a functional unit whereby the functional unit is a ligand to a target molecule.
- the at least two nucleic acid strands may be derived from any of the inventive nucleic acids by either cleaving the nucleic acid molecule to generate two strands or by synthesising one nucleic acid corresponding to a first part of the inventive, i.e. overall nucleic acid and another nucleic acid corresponding to the second part of the overall nucleic acid.
- both the cleavage and the synthesis may be applied to generate a multipartite nucleic acid where there are more than two strands as exemplified above.
- the at least two separate nucleic acid strands are typically different from two strands being complementary and hybridising to each other although a certain extent of complementarity between said at least two separate nucleic acid strands may exist and whereby such complementarity may result in the hybridisation of said separate strands.
- a fully closed, i.e. circular structure for the nucleic acids according to the present invention is realized, i.e. that the nucleic acids according to the present invention are closed in an embodiment, preferably through a covalent linkage, whereby more preferably such covalent linkage is made between the 5' end and the 3' end of the nucleic acid sequences as disclosed herein or any derivative thereof.
- a possibility to determine the binding constants of the nucleic acid molecules according to the present invention is the use of the methods as described in example 3 and 4 which confirms the above finding that the nucleic acids according to the present invention exhibit a favourable KD value range.
- An appropriate measure in order to express the intensity of the binding between the individual nucleic acid molecule and the target which is in the present case SDF- 1 is the so-called KD value which as such as well the method for its determination are known to the one skilled in the art.
- the KD value shown by the nucleic acids according to the present invention is below 1 ⁇ .
- a KD value of about 1 ⁇ is said to be characteristic for a non-specific binding of a nucleic acid to a target.
- the KD value of a group of compounds such as the nucleic acids according to the present invention is within a certain range.
- the above-mentioned KD of about 1 ⁇ is a preferred upper limit for the KD value.
- the lower limit for the KD of target binding nucleic acids can be as little as about 10 picomolar or can be higher. It is within the present invention that the KD values of individual nucleic acids binding to SDF-1 is preferably within this range.
- Preferred ranges can be defined by choosing any first number within this range and any second number within this range.
- Preferred upper KD values are 250 nM and 100 nM
- preferred lower KD values are 50 nM, 10 nM, 1 nM, 100 pM and 10 pM.
- the more preferred upper K D value is 2.5 nM
- the more preferred lower KD value is 100 pM.
- the nucleic acid molecules according to the present invention inhibit the function of the respective target molecule which is in the present case SDF-1.
- the inhibition of the function of SDF-1 - for instance the stimulation of the respective receptors as described previously - is achieved by binding of nucleic acid molecules according to the present invention to SDF-1 and forming a complex of a nucleic acid molecule according to the present invention and MCP-1 and SDF-1.
- Such complex of a nucleic acid molecule and SDF-1 cannot stimulate the receptors that normally are stimulated by SDF-1.
- the inhibition of receptor function by nucleic acid molecules according to the present invention is independent from the respective receptor that can be stimulated by SDF-1 but results from preventing the stimulation of the receptor by MCP-1 and SDF-1 by the nucleic acid molecules according to the present invention.
- a possibility to determine the inhibitory constant of the nucleic acid molecules according to the present invention is the use of the methods as described in example 5 and 6 (for the CXCR4 and CXCR7, respectively) which confirms the above finding that the nucleic acids according to the present invention exhibit a favourable inhibitory constant which allows the use of said nucleic acids in a therapeutic treatment scheme.
- the IC50 value shown by the nucleic acid molecules according to the present invention is below 1 ⁇ .
- An IC50 value of about 1 ⁇ is said to be characteristic for a nonspecific inhibition of target functions by a nucleic acid molecule.
- the IC50 value of a group of compounds such as the nucleic acid molecules according to the present invention is within a certain range.
- the above-mentioned IC 50 of about 1 ⁇ is a preferred upper limit for the IC 50 value.
- the lower limit for the IC 50 of target binding nucleic acid molecules can be as little as about 10 picomolar or can be higher.
- the IC 50 values of individual nucleic acids binding to SDF-1 is preferably within this range.
- Preferred ranges can be defined by choosing any first number within this range and any second number within this range.
- Preferred upper IC 50 values are 250 nM and 100 nM
- preferred lower ICso values are 50 nM, 10 n , 1 nM, 100 pM and 10 pM. The more preferred upper IC 50 value is 2.5 nM, the more preferred lower IC 50 value is 100 pM.
- the nucleic acid molecules according to the present invention may have any length provided that they are still able to bind to the target molecule. It will be acknowledged in the art that there are preferred lengths of the nucleic acids according to the present inventions. Typically, the length is between 15 and 120 nucleotides. It will be acknowledged by the ones skilled in the art that any integer between 15 and 120 is a possible length for the nucleic acids according to the present invention. More preferred ranges for the length of the nucleic acids according to the present invention are lengths of about 20 to 100 nucleotides, about 20 to 80 nucleotides, about 20 to 60 nucleotides, about 20 to 50 nucleotides and about 29 to 450 nucleotides.
- the nucleic acids disclosed herein comprise a moiety which preferably is a high molecular weight moiety and/or which preferably allows to modify the characteristics of the nucleic acid in terms of, among others, residence time in the animal body, preferably the human body.
- a particularly preferred embodiment of such modification is PEGylation and HESylation of the nucleic acids according to the present invention.
- PEG stands for poly(ethylene glycole) and HES for hydroxyethly starch.
- PEGylation as preferably used herein is the modification of a nucleic acid according to the present invention whereby such modification consists of a PEG moiety which is attached to a nucleic acid according to the present invention.
- HESylation as preferably used herein is the modification of a nucleic acid according to the present invention whereby such modification consists of a HES moiety which is attached to a nucleic acid according to the present invention.
- modifications as well as the process of modifying a nucleic acid using such modifications, is described in European patent application EP 1 306 382, the disclosure of which is herewith incorporated in its entirety by reference.
- PEG being such high molecular weight moiety the molecular weight is preferably about 20,000 to about 120,000 Da, more preferably from about 30,000 to about 80,000 Da and most preferably about 40,000 Da.
- HES being such high molecular weight moiety
- the molecular weight is is preferably from about 50 to about 1000 kDa, more preferably from about 100 to about 700 kDa and most preferably from 200 to 500 kDa.
- HES exhibits a molar substitution of 0.1 to 1.5, more preferably of 1 to 1.5 and exhibits a substitution sample expressed as the C2/C6 ratio of approximately 0.1 to 15, preferably of approximately 3 to 10.
- the process of HES modification is, e.g., described in German patent application DE 1 2004 006 249.8 the disclosure of which is herewith incorporated in its entirety by reference.
- the modification can, in principle, be made to the nucleic acid molecules of the present invention at any position thereof.
- such modification is made either to the 5' - terminal nucleotide, the 3 '-terminal nucleotide and/or any nucleotide between the 5' nucleotide and the 3' nucleotide of the nucleic acid molecule.
- the modification and preferably the PEG and/or HES moiety can be attached to the nucleic acid molecule of the present invention either directly or indirectly, preferably through a linker. It is also within the present invention that the nucleic acid molecule according to the present invention comprises one or more modifications, preferably one or more PEG and/or HES moiety. In an embodiment the individual linker molecule attaches more than one PEG moiety or HES moiety to a nucleic acid molecule according to the present invention.
- the linker used in connection with the present invention can itself be either linear or branched. This kind of linkers are known to the ones skilled in the art and are further described in patent applications WO2005/074993 and WO2003/035665.
- the linker is a biodegradable linker.
- the biodegradable linker allows to modify the characteristics of the nucleic acid according to the present invention in terms of, among other, residence time in an animal body, preferably in a human body, due to release of the modification from the nucleic acid according to the present invention. Usage of a biodegradable linker may allow a better control of the residence time of the nucleic acid according to the present invention.
- a preferred embodiment of such biodegradable linker is a biodegradable linker as described in, but not limited to, international patent applications WO2006/052790, WO2008/034122, WO2004/092191 and WO2005/099768.
- the modification or modification group is a biodegradable modification, whereby the biodegradable modification can be attached to the nucleic acid molecule of the present invention either directly or indirectly, preferably through a linker.
- the biodegradable modification allows to modify the characteristics of the nucleic acid according to the present invention in terms of, among other, residence time in an animal body, preferably in a human body, due to release or degradation of the modification from the nucleic acid according to the present invention. Usage of biodegradable modification may allow a better control of the residence time of the nucleic acid according to the present invention.
- biodegradable modification is biodegradable as described in, but not restricted to, international patent applications WO2002/065963, WO2003/070823, WO2004/1 13394 and WO2000/41647, preferably in WO2000/41647, page 18, line 4 to 24.
- modifications can be used to modify the characteristics of the nucleic acids according to the present invention, whereby such other modifications may be selected from the group of proteins, lipids such as cholesterol and sugar chains such as amylase, dextran etc..
- the present inventors assume that the glomerular filtration rate of the thus modified nucleic acids is significantly reduced compared to the nucleic acids not having this kind of high molecular weight modification which results in an increase in the residence time in the animal body.
- the specificity of the nucleic acids according to the present invention is not affected in a detrimental manner.
- the nucleic acids according to the present invention have among others, the surprising characteristic - which normally cannot be expected from pharmaceutically active compounds - such that a pharmaceutical formulation providing for a sustained release is not necessarily required to provide for a sustained release of the nucleic acids according to the present invention.
- nucleic acids according to the present invention in their modified form comprising a high molecular weight moiety, can as such already be used as a sustained release-formulation as they act, due to their modification, already as if they were released from a sustained-release formulation.
- the modification(s) of the nucleic acid molecules according to the present invention as disclosed herein and the thus modified nucleic acid molecules according to the present invention and any composition comprising the same may provide for a distinct, preferably controlled pharmacokinetics and biodistribution thereof. This also includes residence time in circulation and distribution to tissues. Such modifications are further described in the patent application WO2003/035665.
- nucleic acids according to the present invention do not comprise any modification and particularly no high molecular weight modification such as PEGylation or HESylation.
- Such embodiment is particularly preferred when the nucleic acid according to the present invention shows preferential distribution to any target organ or tissue in the body or when a fast clearance of the nucleic acid according to the present invention from the body after administration is desired.
- Nucleic acids according to the present invention as disclosed herein with a preferential distribution profile to any target organ or tissue in the body would allow establishment of effective local concentrations in the target tissue while keeping systemic concentration of the nucleic acids low.
- nucleic acids according to the present invention may be used for the generation or manufacture of a medicament.
- Such medicament or a pharmaceutical composition according to the present invention contains at least one of the inventive nucleic acids selected from the group of SDF-1 binding nucleic acids, optionally together with further pharmaceutically active compounds, whereby the inventive nucleic acid preferably acts as pharmaceutically active compound itself.
- Such medicaments comprise in preferred embodiments at least a pharmaceutically acceptable carrier.
- Such carrier may be, e.g., water, buffer, PBS, glucose solution, preferably a 5% glucose salt balanced solution, starch, sugar, gelatine or any other acceptable carrier substance.
- Such carriers are generally known to the one skilled in the art. It will be acknowledged by the person skilled in the art that any embodiments, use and aspects of or related to the medicament of the present invention is also applicable to the pharmaceutical composition of the present invention and vice versa.
- the SDF-1 binding nucleic acids according to the present invention interact with or bind to human or murine SDF-1 , a skilled person will generally understand that the SDF-1 binding nucleic acids according to the present invention can easily be used for the treatment, prevention and/or diagnosis of any disease as described herein of humans and animals.
- the nucleic acid molecules according to the present invention can be used for the treatment and prevention of any of the diseases, disorder or condition described herein, irrespective of the mode of action underlying such disease, disorder and condition.
- nucleic acid molecules according to the present invention in connection with the various diseases, disorders and conditions is provided, thus rendering the claimed therapeutic, preventive and diagnostic applicability of the nucleic acid molecules according to the present invention plausible.
- SDF-1 - SDF-1 receptor axis as outlined in connection therewith said axis may be addressed by the nucleic acid molecules according to the present invention such that the claimed therapeutic, preventive and diagnostic effect is achieved.
- particularities of the diseases, disorders and conditions, of the patients and any detail of the treatment regimen described in connection therewith may be subject to preferred embodiments of the instant application.
- leukemia cells may be protected from conventional therapies (chemotherapy combined with various targeted agents such as specific antibodies or kinase inhibitors) within particular tissue microenvironments, refered to as niches.
- Such niches are found particularly in the bone marrow where they can harbour malignant cells that are then able to expand and produce a relapse following the initial therapy (Burger and Kipps, 2002; Burger and Burkle, 2007; Meads et al., 2008; Burger, Ghia et al., 2009).
- This preservation of malignant cells during chemotherapy is thought to be largely due to direct contact between the malignant cells and stromal cells (Lagneaux, Delforge et al.
- therapies that can be enhanced by combination with SDF-1 binding nucleic acids according to the present invention include the following but not limited to Fludarabine, Cyclophosphamide, Rituxan, Chlorambucil, Lenalidomide, Bortezomib, Dexamethasone, Melphalan, Imatinib or Nilotinib.
- CXCR4 Error-Relja et al, 2006; Muller, Homey et al., 2001 ; Koshiba, Hosotani et al., 2000, Ehtesham, Stevenson, et al., 2008; Zeelenberg, Ruuls-Van Stalle et al., 2003; Sauer, Seidler et al., 2005; Su, Zhang et al., 2005
- CXCR7 Burns, Summers et al. 2006; Miao et al., 2007; Wang et al., 2008; Zheng, Li et al., 2010
- SDF-1 can be produced by the malignant cells themselves or by the stromal cells within the tumor. Once again in this complex environment the exact mechanism by which tumour cells grow and escape from chemotherapy or other therapeutic approaches are not clearly defined. However it is clear that the SDF-1 - CXCR4 axis and the SDF-1 - CXCR7 play an important role.
- CXCR4 sensitizes glioma cell lines to in vitro chemotherapy (Redjal et al., 2006) and high expression of CXCR4 is predictive of poor outcome in breast cancer (Holm, Abreo et al., 2008; Mizell, Smith et al., 2009) and gastro-intestinal cancers (Schimanski et al., 2008). Therefore the use of SDF-1 binding nucleic acids according to the present invention to inhibit the action of SDF-1 on either CXCR4 or CXCR7 receptors in a wide variety of solid tumors will enhance current therapy by making the cells more vulnerable to the therapy either by direct action or by blocking interactions with other cells in the tumor.
- CXCR4 also conveys signals that are thought to be critical for recruitment and retention of pro-angiogenic and immunosuppressive bone marrow-derived cells (BMDCs). This pathway may therefore also be used for VEGF-independent angiogenesis. As a consequence, blocking the SDF1-CXCR4 axis to sensitize tumors to anti- VEGF therapy or radiation has emerged as an attractive strategy treatment for solid cancers.
- BMDCs pro-angiogenic and immunosuppressive bone marrow-derived cells
- CXCR4 blockade may not be sufficient to block the effects of SDF-1, which may also bind to CXCR7 on cancer or stromal cells.
- CXCR7 has been recently reported to be expressed in brain tumor cells and mediate anti-apoptotic effects, and has also been shown to regulate the invasion, angiogenesis and tumor growth of human hepatocellular carcinomas.
- the action of SDF-1 binding nucleic acids to block the action of SDF-1 on both the CXCR7 and CXCR4 receptors in a single agent would provide a particular efficacy compared to specific receptor blockers.
- the medicament according to the present invention may be used in combination with a further medicament or a further pharmaceutically active agent, whereby the further medicament or the further pharmaceutically active agent damages, destroys and/or labels (the) cancer cells.
- the therapy which is based on the nucleuc acid molecule is preferably an adjunct therapy to the therapy making use of or being based on the further medicament or further pharmaceutically active agent.
- Such further medicament or further pharmaceutically active agent are preferably selected from but not restricted to the group comprising
- antibodies such as Rituximab (target: CD20), Cetuximab (target: epidermal growth factor receptor), Ibritumomab-Tiuxetan (target: CD20), Tositumomab (target: CD20), Trastuzumab (target: HER2/neu), Bevacizumab (target: VEGF), Alemtuzumab (target: CD52) ;
- alkylating agents such as cisplatin, carboplatin, oxaliplatin, mechlorethamine, cyclophosphamide, chlorambucil, Doxorubicin, liposomal Doxorubicin, bendamustine, Melphalan;, temozolomide
- anti-metabolites such as purineazathioprine, mercaptopurine, fludarabine, pentostatin, cladribine
- plant alkaloids such vinca alkaloids, plant terpenoids such as taxanes, preferably Docetaxel, Paclitaxel, podophyllotoxin, epothilone;
- topoisomerase inhibitors such as camptothecins, irinitecan, mitoxantrone;
- agents that can be used as further pharmaceutically active agent in the treatment of cancer include, but are not limited toimmunsuppressive drugs, cytokines and cytostatic drugs (for reference: "Allgemeine und Spezielle Pharmakologie und Toxikologie 201 1", editor: Thomas Karow; Pulheim, Germany). Such agents well known in the art are used in the treatment of cancer according to the current standard of care for the particular cancer patient population.
- the further medicament or pharmaceutically active agent has or may provide the function of a chemotherapy.
- chemotherapy radiotherapy can be used.
- the medicament according to the present invention in combination with or without the further medicament or further pharmaceutically active agent, and with or without radiotherapy, can be used for the treatment and/or prevention of cancer, preferably
- hematological cancer whereby more preferably the hematological cancer is selected from the group of leukemia, and myeloma.
- solid tumors whereby more solid tumors are selected from the group of glioblastoma, colorectal cancer, breast cancer, lymphoma, prostate cance, pancreatic cancer, lung cancer, renal cancer, andovarian cancer
- breast cancer is selected from the group of advanced HER2-negative breast cancer.
- leukemia is selected from the group of chronic lymphoid leukemia and acute myeloid leukemia.
- myeloma is selected from the group of multiple myeloma.
- the preferred further medicament or a further pharmaceutically active agent for the treatmnet of Glioblastoma is radiotherapy or chemotherapy with temozolomide or therapy with bevacizumab.
- the preferred further medicament or a further pharmaceutically active agent for the treatmnet of colorectal cancer is selected from the group comprising fluorouracil, Leucovorin, Oxaliplatin, Irinotecan and bevacizumab.
- the preferred further medicament or a further pharmaceutically active agent for the treatmnet of advanced HER2-negative breast cancer is selected from the group of Doxorubicin,- Paclitaxel, Docetaxel,- Methotrexate, Fluorouracil,- Bevacizumab, Tamoxifen, and aromatase inhibitors.
- the preferred further medicament or a further pharmaceutically active agent for the treatment of chronic lymphoid leukemia is selected from the group comprising fludarabine, ⁇ cyclophosphamide, ⁇ rituximab,Chlorambucil, alemtuzumab, vincristine, pentostatin, mitoxantrone, doxorubicin, cladribine, and bendamustine.
- the preferred further medicament or a further pharmaceutically active agent for the treatment of ultiple myeloma is selected from the group comprising Lenalidomide, ⁇ Bortezomib, ⁇ Dexamethasone, ⁇ Melphalan, Cyclophosphamide, liposomal doxorubicin, and prednisone.
- such medicament is for use in combination with other treatments for any of the diseases disclosed herein, particularly those for which the medicament of the present invention is to be used.
- Combination therapy includes the administration of a medicament of the invention and at least a second or further agent as part of a specific treatment regimen intended to provide the beneficial effect from the co-action of these therapeutic agents, i. e. the medicament of the present invention and said second or further agent.
- the beneficial effect of the combination includes, but is not limited to, pharmacokinetic or pharmacodynamic co-action resulting from the combination of therapeutic agents.
- Administration of these therapeutic agents in combination typically is carried out over a defined time period (usually minutes, hours, days or weeks depending upon the combination selected).
- Combination therapy may be, but generally is not, intended to encompass the administration of two or more of these therapeutic agents as part of separate monotherapy regimens.
- Combination therapy is intended to embrace administration of these therapeutic agents in a sequential manner, that is, wherein each therapeutic agent is administered at a different time, as well as administration of these therapeutic agents, or at least two of the therapeutic agents, in a substantially simultaneous manner.
- Substantially simultaneous administration can be accomplished, for example, by administering to a subject a single capsule having a fixed ratio of each therapeutic agent or in multiple, single capsules for each of the therapeutic agents.
- Sequential or substantially simultaneous administration of each therapeutic agent can be effected by any appropriate route including, but not limited to, topical routes, oral routes, intravenous routes, intramuscular routes, and direct absorption through mucous membrane tissues.
- the therapeutic agents can be administered by the same route or by different routes.
- a first therapeutic agent of the combination selected may be administered by injection while the other therapeutic agents of the combination may be administered topically.
- Combination therapy also can embrace the administration of the therapeutic agents as described above in further combination with other biologically active ingredients.
- the combination therapy further comprises a non-drug treatment
- the non-drug treatment may be conducted at any suitable time so long as a beneficial effect from the co-action of the combination of the therapeutic agents and non-drug treatment is achieved. For example, in appropriate cases, the beneficial effect is still achieved when the non-drug treatment is temporally removed from the administration of the therapeutic agents, perhaps by days or even weeks.
- the medicament according to the present invention can be administered, in principle, in any form known to the ones skilled in the art.
- a preferred route of administration is systemic administration, more preferably by parenteral administration, preferably by injuction.
- the medicament may be administered locally.
- Other routes of administration comprise intramuscular, intraperitoneal, and subcutaneous, per orum, intranasal, intratracheal or pulmonary with preference given to the route of administration that is the least invasive, while ensuring efficiancy.
- Parenteral administration is generally used for subcutaneous, intramuscular or intravenous injections and infusions. Additionally, one approach for parenteral administration employs the implantation of a slow-release or sustained-released systems, which assures that a constant level of dosage is maintained, that are well known to the ordinary skill in the art.
- preferred medicaments of the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles, inhalants, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in that art.
- suitable intranasal vehicles, inhalants, or via transdermal routes using those forms of transdermal skin patches well known to those of ordinary skill in that art.
- the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen.
- Other preferred topical preparations include creams, ointments, lotions, aerosol sprays and gels.
- Subjects that will respond favorably to the method of the invention include medical and veterinary subjects generally, including human beings and human patients.
- subjects for whom the methods and means of the invention are useful are cats, dogs, large animals, avians such as chickens, and the like.
- the medicament of the present invention will generally comprise an effective amount of the active component(s) of the therapy, including, but not limited to, a nucleic acid molecule of the present invention, dissolved or dispersed in a pharmaceutically acceptable medium.
- Pharmaceutically acceptable media or carriers include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the medicament of the present invention.
- the present invention is related to a pharmaceutical composition.
- Such pharmaceutical composition comprises at least one of the nucleic acids according to the present invention and preferably a pharmaceutically acceptable binder.
- binder can be any binder used and/or known in the art. More particularly such binder is any binder as discussed in connection with the manufacture of the medicament disclosed herein.
- the pharmaceutical composition comprises a further pharmaceutically active agent.
- compositions may be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection; as tablets or other solids for oral administration; as time release capsules; or in any other form currently used, including eye drops, creams, lotions, salves, inhalants and the like.
- injectables either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection; as tablets or other solids for oral administration; as time release capsules; or in any other form currently used, including eye drops, creams, lotions, salves, inhalants and the like.
- sterile formulations such as saline-based washes, by surgeons, physicians or health care workers to treat a particular area in the operating field may also be particularly useful.
- Compositions may also be delivered via microdevice, microparticle or sponge.
- a medicament Upon formulation, a medicament will be administered in a manner compatible with the dosage formulation, and in such amount as is pharmacologically effective.
- the formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but drug release capsules and the like can also be employed.
- the medicament of the invention can also be administered in oral dosage forms as timed release and sustained release tablets or capsules, pills, powders, granules, elixirs, tinctures, suspensions, syrups and emulsions.
- Suppositories are advantageously prepared from fatty emulsions or suspensions.
- the pharmaceutical composition or medicament may be sterilized and/or contain adjuvants, such as preserving, stabilizing, wetting or emulsifying agents, solution promoters, salts for regulating the osmotic pressure and/or buffers. In addition, they may also contain other therapeutically valuable substances.
- adjuvants such as preserving, stabilizing, wetting or emulsifying agents, solution promoters, salts for regulating the osmotic pressure and/or buffers.
- they may also contain other therapeutically valuable substances.
- the compositions are prepared according to conventional mixing, granulating, or coating methods, and typically contain about 0.1% to 75%, preferably about 1% to 50%, of the active ingredient.
- Liquid, particularly injectable compositions can, for example, be prepared by dissolving, dispersing, etc.
- the active compound is dissolved in or mixed with a pharmaceutically pure solvent such as, for example, water, saline, aqueous dextrose, glycerol, ethanol, and the like, to thereby form the injectable solution or suspension.
- a pharmaceutically pure solvent such as, for example, water, saline, aqueous dextrose, glycerol, ethanol, and the like.
- solid forms suitable for dissolving in liquid prior to injection can be formulated.
- the medicaments and nucleic acid molecules, respectively, of the present invention can also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles and multilamellar vesicles.
- Liposomes can be formed from a variety of phospholipids, containing cholesterol, stearylamine or phosphatidylcholines.
- a film of lipid components is hydrated with an aqueous solution of drug to a form lipid layer encapsulating the drug, what is well known to the ordinary skill in the art.
- nucleic acid molecules described herein can be provided as a complex with a lipophilic compound or non-immunogenic, high molecular weight compound constructed using methods known in the art.
- liposomes may bear such nucleic acid molecules on their surface for targeting and carrying cytotoxic agents internally to mediate cell killing.
- nucleic-acid associated complexes is provided in U.S. Patent No. 6,01 1 ,020.
- the medicaments and nucleic acid molecules, respectively, of the present invention may also be coupled with soluble polymers as targetable drug carriers.
- soluble polymers can include polyvinylpyrrolidone, pyran copolymer, polyhydroxypropyl-methacrylamide-phenol, polyhydroxyethylaspanamidephenol, or polyethyleneoxidepolylysine substituted with palmitoyl residues.
- the medicaments and nucleic acid molecules, respectively, of the present invention may be coupled to a class of biodegradable polymers useful in achieving controlled release of a drag, for example, polylactic acid, polyepsilon capro lactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates and cross- linked or amphipathic block copolymers of hydrogels.
- a pharmaceutical composition and medicament, respectively, to be administered may also contain minor amounts of non-toxic auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and other substances such as for example, sodium acetate, and triethanolamine oleate.
- the dosage regimen utilizing the nucleic acid molecules and medicaments, respectively, of the present invention is selected in accordance with a variety of factors including type, species, age, weight, sex and medical condition of the patient; the severity of the condition to be treated; the route of administration; the renal and hepatic function of the patient; and the particular aptamer or salt thereof employed.
- An ordinarily skilled physician or veterinarian can readily determine and prescribe the effective amount of the drug required to prevent, counter or arrest the progress of the condition.
- Effective plasma levels of the nucleic acid according to the present invention preferably range from 500 fM to 200 ⁇ , preferably from 1 nM to 20 ⁇ , more preferably from 5 nM to 20 ⁇ , most preferably 50 nM to 20 ⁇ in the treatment of any of the diseases disclosed herein.
- the nucleic acid molecules and medicaments, respectively, of the present invention may preferably be administered in a single daily dose, every second or third day, weekly, every second week, in a single monthly dose or every third month.
- the medicament as described herein constitutes the pharmaceutical composition disclosed herein.
- the present invention is related to a method for the treatment of a subject who is in need of such treatment, whereby the method comprises the administration of a pharmaceutically active amount of at least one of the nucleic acids according to the present invention.
- the subject suffers from a disease or is at risk to develop such disease, whereby the disease is any of those disclosed herein, particularly any of those diseases disclosed in connection with the use of any of the nucleic acids according to the present invention for the manufacture of a medicament.
- the term treatment comprises in a preferred embodiment additionally or alternatively prevention and/or follow-up.
- the terms disease and disorder shall be used in an interchangeable manner, if not indicated to the contrary.
- the term comprise is preferably not intended to limit the subject matter followed or described by such term. However, in an alternative embodiment the term comprises shall be understood in the meaning of containing and thus as limiting the subject matter followed or described by such term.
- D-RNA D-nucleic acid level
- SEQ ID NO: 4 biotinyl
- Fig. 1 shows an alignment of sequences of SDF-1 binding nucleic acid molecules of "type A"
- Figs. 2A+B show derivatives of SDF-1 binding nucleic acid molecule 192 -A 10-001
- Fig. 3 shows an alignment of sequences of SDF-1 binding nucleic acid molecules of "type B"
- Figs. 4A+B show derivatives of SDF-1 binding nucleic acid molecules 193-C2-001 and 193-G2-001 (SDF-1 binding nucleic acid molecules of type B);
- Fig. 5 shows an alignment of sequences of SDF-1 binding nucleic acid molecules of "type C"
- Fig. 6 shows derivatives of SDF-1 binding nucleic acid molecule 190- A3 -001
- Figs. 7A+B show derivatives of SDF-1 binding nucleic acid moleculs 190-D5-001
- Fig. 8 shows derivatives of SDF-1 binding nucleic acid molecule 197-B2
- Fig. 9 shows further SDF-1 binding nucleic acid molecules molecules which are, in addition to other SDF-1 binding nucleic acid molecules, also referred to as SDF-1 binding nucleic acid molecules of "type D";
- Fig. 10 shows the efficacy of SDF-1 binding Spiegelmers 193-G2-012-5'-PEG
- Fig. 18A+B show the efficacy of human SDF-1 binding Spiegelmer NOX-A12 to reverse SDF-1 dose-dependent adhesion of Jurkat cells to fibronectin, whereby Jurkat cells were incubated with SDF-1 alone (A), with SDF-1 and increasing concentrations of human SDF-1 binding Spiegelmer NOX-A12 or with SDF-1 and increasing concentrations of control Spiegelmer revNOX-A12 (B) for 30 minutes and seeded on fibronectin coated plates for 15 minutes; cells were subsequently washed off with media and attached cells were quantified using Cell Titer Glo Reagent; error bars indicate SD.
- Example 1 Nucleic acids that bind human SDF-1
- nucleotide' is used herein in a synonymous manner if not indicated to the contrary.
- L-nucleic acid molecules that bind to human SDF-1 and the respective nucleotide sequences are depicted in Figures 1 to 9.
- the nucleic acids were characterized on the aptamer, i. e. D- nucleic acid level using competitive or direct pull-down binding assays with biotinylated human D-SDF-1 (protocol, see Example 3).
- Spiegelmers were tested with the natural configuration of SDF-1 (L-SDF-1) by surface plasmon resonance measurement using a Biacore 2000 instrument (protocol, see Example 5) and a cell culture in vitro chemotaxis assay (protocol, see Example 4).
- the SDF-1 binding nucleic acid molecules exhibit different sequence motifs, three main types are defined in Figs. 1, 2 A and 2B (Type A), Figs. 3, 4A and 4B (Type B), Figs. 5, 4, 7A, 7B and 8 (Type C).
- the nucleic acid molecules exhibit different sequence motifs.
- the IUPAC abbreviations for ambiguous nucleotides is used: s strong G or C;
- R purine G or A
- nucleic acid sequence or sequence of stretches and boxes, respectively is indicated in the 5'— > 3' direction.
- sequences of SDF-1 binding nucleic acid moleculess of type A comprise one central stretch of nucleotides which is flanked by the first (5'-) terminal and the second (3'-) terminal stretch of nucleotides (also referred to as first terminal stretch of nucleotides and second stretch of nucleotides) whereby both stretches can hybridize to each other.
- first terminal stretch of nucleotides and second stretch of nucleotides also referred to as first terminal stretch of nucleotides and second stretch of nucleotides
- sequences of the defined boxes or stretches of nucleotides may be different between the SDF-1 binding nucleic acids of type A which influences the binding affinity to SDF-1.
- SDF-1 binding nucleic acids of type A which influences the binding affinity to SDF-1.
- the central strectch of nucleotides and its nucleotide sequences as described in the following are individually and more preferably in their entirety essential for binding to SDF-1.
- Type A SDF-1 binding nucleic acid 191-A6 central nucleotide sequence: lAAAGUAACACGUAAAAUGAAAGGUAACI, SEQ ID NO: 54
- carrying the additional nucleotide 'A' within the central nucleotide sequence and still binding to SDF-1 let conclude an alternative central nucleotide sequence (
- Type A SDF-1 binding nucleic acid 192-A 10-001 was characterized for its binding affinity to human SDF-1.
- the IC 50 inhibitory concentration 50% of 0.12 nM for 192-A 10-001 was measured using a cell culture in vitro chemotaxis assay. Consequently, all Type A SDF-1 binding nucleic acids as depicted in Fig. 1 were analyzed in a competitive pull-down binding assay vs. 192-A 10-001.
- Type A SDF-1 binding nucleic acids 192-B 1 1 and 192-ClO showed equal binding affinities as 192-A 10-001 in these competition experiments.
- Weaker binding affinity was determined for Type A SDF-1 binding nucleic acids 192-G10, 192-F10, 192-C9, 192-E10, 192-D1 1 , 192-G1 1 , 192-H1 1 and 191-A6.
- the Type A SDF-1 binding nucleic acids 192-D 10, 192-E9 and 192-H9 have much weaker binding affinity than 192-A10-001.
- the Type A SDF- 1 binding nucleic acid 192-B1 1 and 192-C10 exhibit equal binding affinity to SDF-1 as 192-A 10-001. However, they show slight differences in the nucleotide sequence of the central stretch of nucleotides. Therefore the consensus sequence of the three molecules binding to SDF-1 with almost the same high affinity can be summarized by the nucleotide sequence
- 192-A10-001 represents the nucleotide sequence with the best binding affinity of Type A SDF-1 binding nucleic acids.
- Five or six out of the six nucleotides of the 5 '-terminal stretch (also referred to as first terminal stretch) of Type A SDF-1 binding nucleic acids may hybridize to the respective five or six nucleotides out of the six nucleotides of the 3 '-terminal stretch (also referred to as second terminal stretch) to form a terminal helix.
- these nucleotides are variable at several positions, the different nucleotides allow for hybridization of five or six out of the six nucleotides of the 5'- and 3 '-terminal stretches each.
- the 5 '-terminal and 3 '-terminal stretches of Type A SDF-1 binding nucleic acids as shown in Fig.
- Type A SDF-1 binding nucleic acid 192-A 10-001 were analyzed in a competitive pull-down binding assay vs. the original molecule 192-A10-001 and 192-A10-008 (Fig. 2A and 2B).
- the determined 5 '-terminal and 3 '-terminal stretches with a length of five and four nucleotides of the derivatives of Type A SDF-1 binding nucleic acid 192-A 10-001 as shown in Figs. 2 A and 2B can be described in a generic formula for the 5'-terminal stretch ('X 2 BBBS', Type A Formula-6-5') and of the 3'-terminal stretch ('SBBVX 3 '; Type A Formula-6-3'), whereby X 2 is either absent or is 'S' and X 3 is either absent or is 'S'.
- the nucleotide sequence of the 5'- and 3 '-terminal stretches has an influence on the binding affinity of Type A SDF-1 binding nucleic acids. This is not only shown by the nucleic acids 192-F10 and 192-E10, but also by derivatives of 192-A 10-001 (Fig. 2B).
- the central stretch of 192-F10 and 192-E10 are identical to 192-B1 1 and 192-ClO, but comprise slight differences at the 3 '-end of 5 '-terminal stretch and at the 5 '-end of 3 '-terminal stretch resulting in reduced binding affinity.
- Type A SDF-1 binding nucleic acid 192-A 10-001 ( 192- A 10- 014/ -015/ -016/ -017/ -018/ -019/ -020/ -021/ -022/ -023) bearing four 5'- and 3'-terminal nucleotides respectively were tested as aptamers for their binding affinity vs. 192-A 10-001 or its derivative 192-A 10-008 (both have the identical binding affinity to SDF-1).
- Type A SDF-1 binding nucleic acids 192- A 10-002 and 192- A 10-08 the preferred combination of 5'- and 3'-terminal stretches are 'CUGUG' and 'CGCAG' (5'- and 3'- terminal stretches of Type A SDF-1 binding nucleic acid 192-A10-002) and 'GCGUG' and 'CGCGC (5'- and 3'-terminal stretches of Type A SDF-1 binding nucleic acid 192-A10- 008).
- X is 'R' or absent
- X 2 is 'S'
- X 3 is 'S'
- X 4 is ⁇ ' or absent
- Xi is absent, X 2 is 'S' or absent, X 3 is 'S' or absent and X4 is absent.
- Spiegelmers 192 -A 10-008 was covalently coupled to a 40 kDa polyethylene glycol (PEG) moiety at the 5 '-end as described in chapter 2.
- PEG polyethylene glycol
- sequences of SDF-1 binding nucleic acids of type B comprise one central stretch of nucleotides which is flanked by 5'- and 3 '-terminal stretches (also referred to as first and second terminal stretch of nucleotides) that can hybridize to each other.
- 5'- and 3 '-terminal stretches also referred to as first and second terminal stretch of nucleotides
- hybridization is not necessarily given in the molecule.
- 'SDF-1 binding nucleic acid molecules of type B' and 'Type B SDF-1 binding nucleic acids' or Type B SDF-1 binding nucleic acid molecules' are used herein in a synonymous manner if not indicated to the contrary.
- the sequences of the defined boxes or stretches may be different between the SDF-1 binding nucleic acids which influences the binding affinity to SDF-1.
- the central stretch of nucleotides and its nucleotide sequences as described in the following are individually and more preferably in their entirety essential for binding to SDF-1.
- the SDF-1 binding nucleic acids 193-G2-001 , 193-C2-001 and 193-F2-001 that differ in one position of the central stretch of nucleotides were analyzed in a competitive pull-down binding assay vs.
- the SDF-1 binding nucleic acid 192-A10-001 D of 1.5 nM determined in a pull-down binding assay, IC 50 of 0.12 nM).
- Each of the SDF-1 binding nucleic acids 193-G2-001, 193- C2-001 and 193-F2 showed superior binding to human SDF-1 in comparison to SDF-1 binding nucleic acid 192-A 10-001 whereby the binding affinity of 193-G2-001 is as good as 193-C2-001 and 193-F2-001 (Fig. 3).
- the data suggests that the difference in the nucleotide sequence of the central stretch of nucleotides of SDF-1 binding nucleic acids 193-G2-001, 193-C2-001 and 193-F2-001 has no influence on the binding affinity to SDF-1.
- SDF-1 binding nucleic acids 193-G1-002, 193-D2-002, 193-A1-002, 193-D3-002, 193-B3-002, 193- H3-002, 193-E3-002 and 193 -D 1-002 showed reduced binding to human SDF-1 in comparison to SDF-1 binding nucleic acid 193-G2-001.
- SDF-1 binding nucleic acid 193-G2- 001 was characterized for its binding affinity to human SDF-1.
- the IC 50 (inhibitory concentration 50%) of 0.08 nM for 193-G2-001 was measured using a cell culture in vitro chemotaxis assay.
- nucleotides out of the six nucleotides of the 5 '-terminal stretch of SDF-1 binding nucleic acids may hybridize to the respective four, five or six out of the six nucleotides of the 3 '-terminal stretch of SDF-1 binding nucleic acids to form a terminal helix.
- nucleotides are variable at several positions, the different nucleotides allow the hybridization for four, five or six nucleotides out of the six nucleotides of the 5'- and 3'- terminal stretches each.
- the 5'-terminal and 3'-terminal stretches of SDF-1 binding nucleic acids as shown in Fig.
- SDF-1 binding nucleic acids 193- Gl-002, 193-D2-002, 193-A1-002 and 193-D3-002 have weaker binding affinities to SDF-1 although they share the identical central stretch of nucleotides with 193-C2-001, 193-G2-001 and 193-F2-001 (Fig. 3).
- SDF-1 binding nucleic acids 193-G1-002, 193-D2-002, 193-A1-002 and 193-D3-002 may be due to the number of nucleotides and sequence of the 5'- and 3 '-terminal stretches.
- Truncated derivatives of the SDF-1 binding nucleic acids 193-G2-001 and 193-C2-001 were analyzed in a competitive pull-down binding assay vs. 193-G2-001 and 193-G2-012, respectively (Fig. 4A and 4B). These experiments showed that a reduction of the six terminal nucleotides (5'end: AGCGUG; 3'end: UACGCU) of SDF-1 binding nucleic acids 193-G2- 001 and 193-C2-001 to five nucleotides (5'end: GCGUG; 3'end: UACGC) lead to molecules with similar binding affinity (193-C2-002 and 193-G2-012).
- KD 0.3 nM
- a truncation to four (5'end: CGUG; 3'end: UACG; 193-C2-003) or less nucleotides (193-C2-004, 193- C2-005, 193-C2-006, 193-C2-007) resulted in a reduced binding affinity to SDF-1 which was measured by using the competition pull-down binding assay (Fig. 4A).
- the nucleotide sequence of the five terminal nucleotides at the 5'- and 3 '-end, respectively, has an influence on the binding affinity of SDF-1 binding nucleic acids.
- the 5 '-terminal and 3 '-terminal stretches with a length of five and four nucleotides of the derivatives of SDF-1 binding nucleic acids 193-C2-003 and 193-G2-012 as shown in Figs. 4 A and 4B can be described in a generic formula for the 5'-terminal stretch ('XiX 2 SSBS'), whereby Xi is absent, X 2 is either absent or is 'G', and of the 3 '-terminal stretch ('BVSSX 3 X 4 '), and whereby X 3 is either absent or is 'C and X 4 is absent.
- SDF- 1 binding nucleic acids 193-G2-001 and 193-C2-01 and their derivatives 193-G2-012 and 193-C2-002 the preferred combination of 5'- and 3'-terminal stretches are 'X)X 2 GCGUG' (5'-terminal stretch) and 'UACGCX3X 4 ' (3'-terminal stretch), whereas Xi is either 'A' or absent, X 2 is 'G' and X 3 is 'C and 'X 4 is 'U' or absent.
- Xi is 'A' or absent, X 2 is 'G', X 3 is 'C and X 4 is 'U' or absent; or Xi is absent, X 2 is 'G' or absent, X 3 is 'C or absent and X 4 is absent.
- Spiegelmers 193-G2-012 was covalently coupled to a 40 kDa polyethylene glycol (PEG) moiety at the 5 '-end as described in chapter 2 (PEGylated-nucleic acid molecule: 193-G2-012-5'-PEG also referred to as NOX-A12).
- PEG polyethylene glycol
- NOX-A12 polyethylene glycol
- the PEGylated Spiegelmer NOX-A12 was analyzed in cell culture in an in vitro chemotaxis-assay and an inhibition of SDF-1 induced chemotaxis was determined (IC 50 of 0.2 nM).
- the PEGylated Spiegelmer NOX-A12 was analyzed by Biacore measurement and a binding constant (KD) of 0.2 nM was determined.
- sequences of SDF-1 binding nucleic acids of type C comprise one central stretch of nucleotides which is flanked by 5'- and 3 '-terminal stretches (also referred to as first terminal stretch and second terminal stretch of nucleotides) that can hybridize to each other.
- first terminal stretch and second terminal stretch of nucleotides also referred to as first terminal stretch and second terminal stretch of nucleotides
- hybridization is not necessarily given in the molecule.
- 'SDF-1 binding nucleic acid molecules of type C and 'Type C SDF-1 binding nucleic acids' or Type C SDF-1 binding nucleic acid molecules' are used herein in a synonymous manner if not indicated to the contrary.
- sequences of the defined boxes or stretches may be different between the SDF-1 binding nucleic acids of Type C which influences the binding affinity to SDF-1.
- Type C SDF-1 binding nucleic acids Based on binding analysis of the different SDF-1 binding nucleic acids summarized as Type C SDF-1 binding nucleic acids, the central stretch of nucleotides and its nucleotide sequence as described in the following are individually and more preferably in their entirety essential for binding to SDF- 1.
- Type C SDF-1 binding nucleic acid 197-Dl the central stretch of nucleotides of all identified sequences of Type C
- SDF-1 binding nucleic acids share the nucleotide sequence
- Type C SDF-1 binding nucleic acid 197-Dl central stretch of nucleotides:
- Type C SDF-1 binding nucleic acids as depicted in Fig. 5 were analyzed in a competitive pull-down binding assay vs.
- the Type C SDF-1 binding nucleic acids 191-D5-001, 197-B2, 190-A3-001 , 197-H1, 197-H3 and 197-E3 showed weaker binding affinities than 192- A 10-001 in competition experiments.
- Type C SDF-1 binding nucleic acid 190- A3 -001 comprises a 5' -terminal stretch of 17 nucleotides (' CGUGCGCUUGAGAUAGG' , SEQ ID NO: 220) and a 3'-terminal stretch of 12 nucleotides ('CUGAUUCUCACG', SEQ ID NO: 221) whereby on the one hand the four nucleotides at the 5 '-end of the 5 '-terminal stretch and the four nucleotides at the 3' -end of the 3 '-terminal stretch may hybridize to each other to form a terminal helix.
- nucleotides 'UGAGA' in the 5 '-terminal stretch may hybridize to the nucleotides 'UCUCA' in the 3 '-terminal stretch to form a terminal helix.
- a reduction to nine nucleotides of the 5 '-terminal stretch ('UGAGAUAGG') and to ten ('CUGAUUCUC A', SEQ ID NO: 222) nucleotides of the 3'-terminal stretch ('CUGAUUCUC') of molecule 190-A3-001 does not have an influence on the binding affinity to SDF-1 (190-A3-003; Fig. 13).
- Type C SDF-1 binding nucleic acids 191-D5-001, 197-B2 and 197-Hl central stretch of nucleotides: IGGUUAGGGCUAGAAGUCGGI, SEQ ID 57, 197-H3/191-A5 (central stretch of nucleotides: GGUUAGGGCUCGAAGUCGGI, SEQ ID NO: 58 and 197-E3/197-B1
- the respective ten (197-B2, 197-E3, 197-H3) or nine out of the ten (191-D5-001, 197-H1) nucleotides of the 5'-terminal stretch may hybridize to the respective ten (197-B2, 197-E3, 197-H3) or nine out of the ten (191-D5-001 , 197-H1) nucleotides of the 3 '-terminal stretch (Fig. 5).
- the 5 '-terminal stretch of Type C SDF-1 binding nucleic acids 197-B2, 191-D5-001 , 197-H1 , 197-E3 and 197-H3 as mentioned above plus 191 -A5, 197-B1, 197-H2, 197-D1 and 197-D2 comprise a common generic nucleotide sequence of 'RKSBUSNVGR' (Type C Formula-5-5', SEQ ID NO: 138).
- Type C SDF-1 binding nucleic acids 197-B2, 191-D5-001 , 197- Hl, 197-E3 and 197-H3 can be summarized in the generic formula 'RKSBUGSVGR' (Type C Formula-6-5'; 5'-terminal stretch, SEQ ID NO: 140) and 'YCNRCASSMY' (Type C Formula-6-3'; 3 '-terminal stretch, SEQ ID NO: 141).
- Truncated derivatives of Type C SDF-1 binding nucleic acid 191-D5-001 were constructed and tested in a competitive pull-down binding assay vs. the original molecule 191-D5-001 (Fig. 7 A, Fig. 7B).
- the length of the 5'- and 3 '-terminal stretches were shortened from ten nucleotides (191-D5-001) each to seven nucleotides each (191-D5-004) as depicted in Fig. 14A whereby nine out of the ten (191-D5-001) or six out of the seven nucleotides (191-D5- 004) of the 5 '-terminal stretch and of the 3 '-terminal stretch, respectively can hybridize to each other.
- Type C SDF-1 binding nucleic acid 191-D5-007 surprisingly binds somewhat better to SDF-1 than 191-D5-001 (determined on aptamer level using the competition binding assay).
- the IC 50 inhibitory concentration 50%) of 0.1 nM for 191-D5-007 was measured using a cell- culture in vitro chemotaxis assay. Further truncation of both terminal stretches to four nucleotides (191-D5-010, Fig.7A).
- sequences of the 5'-terminal and 3'-terminal stretches of 191 -D5-001-derivatives that show the best binding affinity to SDF-1 and comprise a 5 '-terminal and 3 '-terminal stretch of five nucleotides respectively (191-D5-007, 191-D5-024-29a, 191-D5-024-29b) can be summarized in a generic formula (5'-terminal stretch: 'SGGSR', Type C Formula-8-5'; 3'- terminal stretch: , YSCCS', Type C Formula-8-3').
- Truncated derivatives of Type C SDF-1 binding nucleic acid 197-B2 were analyzed in a competitive pull-down binding assay vs.
- 197-B2 has the same binding affinity to SDF-1 as 191-D5-007.
- the 5'- and 3'-terminal stretches were shortened without loss of binding affinity from ten nucleotides (197-B2) each to five nucleotides each (197-B2-005) whereby the nucleotides of the 5'-terminal stretch and of the 3' -terminal stretch can completely hybridize to each other.
- sequences of the 5' -terminal and 3 '-terminal stretches of 197-B2 derivatives that show the best binding affinity to SDF-1 and comprise a 5 '-terminal and 3 '-terminal stretch of five nucleotides respectively can be summarized in a generic formula (5'-terminal stretch: 'GCSGG', Type C Formula-9-5'; 3'-terminal stretch: ,CCKGC, Type C Formula-9-3').
- Spiegelmers 197-B2-006 and 191-D5-007 were covalently coupled to a 40 kDa polyethylene glycol (PEG) moiety at their 5'-ends as described in chapter 2.
- PEG polyethylene glycol
- the PEGylated Spiegelmers 197-B2-006 and 191-D5- 007 were analyzed in cell culture in an in vitro chemotaxis.
- the PEG-moiety has no influence on Spiegelmers potency to inhibit SDF-1 induced chemotaxis.
- any of the sequences shown in Figs. 1 through 9 are nucleic acid molecules according to the present invention, including those truncated forms thereof but also including those extended forms thereof under the proviso, however, that the thus truncated and extended, respectively, nucleic acid molecules are still capable of binding to the target.
- Aptamers and Spiegelmers were produced by solid-phase synthesis with an ABI 394 synthesizer (Applied Biosystems, Foster City, CA, USA) using 2'TBDMS RNA phosphoramidite chemistry (Damha and Ogilvie, 1993).
- rA(N-Bz)-, rC(Ac)-, rG(N-ibu)-, and rU- phosphoramidites in the D- and L-configuration were purchased from ChemGenes, Wilmington, MA. Aptamers and Spiegelmers were purified by gel electrophoresis.
- the Spiegelmers were produced by solid-phase synthesis with an AktaPilotlOO synthesizer (Amersham Biosciences; General Electric Healthcare, Freiburg) using 2'TBDMS RNA phosphoramidite chemistry (Damha and Ogilvie, 1993).
- L-rA(N-Bz)-, L-rC(Ac)-, L-rG(N- ibu)-, and L-rU- phosphoramidites were purchased from ChemGenes (Wilmington, MA, USA).
- the 5'-amino-modifier was purchased from American International Chemicals Inc. (Framingham, MA, USA).
- the Spiegelmers were synthesized DMT-ON; after deprotection, it was purified via preparative RP-HPLC (Wincott F. et al, 1995) using Sourcel5RPC medium (Amersham). The 5'DMT-group was removed with 80% acetic acid (90 min at RT). Subsequently, aqueous 2 M NaOAc solution was added and the Spiegelmer was desalted by tangential-flow filtration using a 5 K regenerated cellulose membrane (Millipore, Bedford, MA).
- the Spiegelmers were covalently coupled to a 40 kDa polyethylene glycol (PEG) moiety at the 5' -end.
- PEG polyethylene glycol
- the pH of the Spiegelmer solution was brought to 8.4 with 1 M NaOH. Then, 40 kDa PEG- NHS ester (JenKem Technology USA Inc., Allen, TX) was added at 37°C every 30 min in six portions of 0.25 equivalents until a maximal yield of 75 to 85% was reached. The pH of the reaction mixture was kept at 8 - 8.5 with 1 M NaOH during addition of the PEG-NHS ester.
- aptamers were 5 '-phosphate labeled by T4 polynucleotide kinase (Invitrogen, Düsseldorf, Germany) using [ ⁇ - 32 ⁇ ] -labeled ATP (Hartmann Analytic, Braunschweig, Germany).
- the specific radioactivity of labeled aptamers was 200,000 - 800,000 cpm/pmol.
- Aptamers were incubated after de- and renaturation at 10, 20, 30 or 40 pM concentration at 37°C in selection buffer (20 mM Tris-HCl pH 7.4; 137 mM NaCl; 5 mM KCl; 1 mM MgCl 2 ; 1 mM CaCl 2 ; 0.1% [w/vol] Tween-20) together with varying amounts of biotinlayted human D-SDF-1 for 4 - 12 hours in order to reach equilibrium at low concentrations.
- selection buffer (20 mM Tris-HCl pH 7.4; 137 mM NaCl; 5 mM KCl; 1 mM MgCl 2 ; 1 mM CaCl 2 ; 0.1% [w/vol] Tween-20) together with varying amounts of biotinlayted human D-SDF-1 for 4 - 12 hours in order to reach equilibrium at low concentrations.
- Selection buffer was supplemented with 10 ⁇ g/ml human serum albumin (Sigma- Aldrich, Steinheim, Germany), and 10 ⁇ g/ml yeast RNA (Ambion, Austin, USA) in order to prevent adsorption of binding partners with surfaces of used plasticware or the immobilization matrix.
- concentration range of biotinlayted human D-SDF-1 was set from 8 pM to 100 nM; total reaction volume was 1 ml.
- Peptide and peptide-aptamer complexes were immobilized on 1.5 ⁇ Streptavidin Ultralink Plus particles (Pierce Biotechnology, Rockford, USA) which had been preequilibrated with selection buffer and resuspended in a total volume of 6 ⁇ .
- aptamers to be tested competed with the reference aptamer for target binding, thus decreasing the binding signal in dependence of their binding characteristics.
- the aptamer that was found most active in this assay could then serve as a new reference for comparative analysis of further aptamer variants.
- the Biacore 2000 instrument (Biacore AB, Uppsala, Sweden) was used to analyze binding of Spiegelmers to human SDF- ⁇ .
- human SDF-lcc was dialyzed against water for 1 - 2 h (Millipore VSWP mixed cellulose esters; pore size, 0.025 ⁇ ) to remove interfering amines.
- CM4 sensor chips (Biacore AB, Uppsala, Sweden) were activated before protein coupling by a 35- ⁇ 1 injection of a 1 : 1 dilution of 0.4 M NHS and 0.1 M EDC at a flow of 5 ⁇ /min.
- Human MCP-1 or human SDF- ⁇ was then injected in concentrations of 0.1 - 1.5 ⁇ g/ml at a flow of 2 ⁇ /min until the instrument's response was in the range of 1000 - 2000 RU (relative units). Unreacted NHS esters were deactivated by injection of 35 ⁇ ethanolamine hydrochloride solution (pH 8.5) at a flow of 5 ⁇ /min. The sensor chip was primed twice with binding buffer and equilibrated at 10 ⁇ /min for 1 - 2 hours until the baseline appeared stable.
- the stimulation solutions (SDF-1 + various concentrations of Spiegelmer) were made up as 10X solutions in a 0.2 ml low profile 96-tube plate. 212 ⁇ HBH were pipetted into the lower compartments of the transport plate and 23,5 ⁇ of the stimulation solutions were added. All conditions were made up as triplicates. After 20 to 30 min the filter plate was inserted into the plate containing the stimulation solutions and 75 ⁇ of a cell suspension with 1.33 x 10 6 /ml or 2.67 x 10 6 /ml, respectively, were added to the wells of the filter plate (1 x 10 5 or 2 x 10 s cells/well). The cells were then allowed to migrate for 3 h at 37°C.
- the value for the sample without Spiegelmer was set 100% and the values for the samples with Spiegelmer were calculated as per cent of this.
- the per cent-values were plotted against Spiegelmer concentration and the IC 50 -value (concentration of Spiegelmer at which 50% of the activity without Spiegelmer is present) was determined graphically from the resulting curve.
- Human SDF-1 was found to stimulate migration of Jurkat cells in a dose dependent manner, with half-maximal stimulation at about 0.3 nM.
- Human SDF-1 was found to stimulate migration of cells of the human leukemic monocyte lymphoma cell line U937 in a dose dependent manner, with half-maximal stimulation at about 3 nM.
- Human SDF-1 was found to stimulate migration of cells of the human pre-B cell leukemia cell line BV-173 in a dose dependent manner, with half-maximal stimulation at about 3 nM.
- Human SDF-1 was found to stimulate migration of cells of the human pre-B ALL cell line Nalm-6 in a dose dependent manner, with half-maximal stimulation at about 0.3 nM.
- the leukemia lines BV-173 and U-937 were tested positive also for CXCR7 expression.
- the potency of SDF-binding aptmer NOX-A12 to block interaction of SDF-1 and CXCR7 was determined as shown in Example 6.
- SDF-1 also binds to the chemokine receptor CXCR7.
- the inhibitory potential of SDF-l-binding Spiegelmer NOX-A12 towards CXCR7 was tested in a complementation assay with CHO cells stably expressing CXCR7 and ⁇ -arrestin both fused to a fragment of ⁇ -galactosidase (PathHunterTM - ⁇ -arrestin assay, DiscoveRX, CA, USA).
- PathHunterTM - ⁇ -arrestin assay DiscoveRX, CA, USA.
- PathHunter eXpress CHO-Kl Human CXCR7 ⁇ -arrestin cells were plated for 48 hours in OCC2 Medium and stimulated with 10 nM SDF-1 and various concentrations of SDF-l- binding Spiegelmer NOX-A12 for 90 minutes. Following stimulation, signal was detected using the PathHSch Detection Kit and the manufacturer's recommended protocol (DiscoveRX, CA, USA).
- Rat aortae were cut into rings, embedded in a collagen matrix and incubated with SDF-1 and SDF-1 plus human SDF-1 binding Spiegelmer 193-G2-012-5 '-PEG or SDF plus an nonfunctional PEGylated Control Spiegelmer that does not bind SDF-1. After 6 to 7 days, sprouting (i.e. outgrowth of endothelial cells) was analysed by taking pictures and determining a sprouting index.
- Aortae from male rats were obtained from Bagheri Life sciences (Berlin, Germany). The aortae were prepared freshly and transported on ice in MCDB 131 -Medium (Invitrogen, Düsseldorf, Germany) containing 50 units/ml penicillin, 50 ⁇ x Jm ⁇ streptomycin (both Invitrogen, Düsseldorf, Germany) and 2.5 ⁇ g/ml fungizone (Cambrex, USA).
- a single aorta was transferred to a cell culture dish together with the medium and residual connective tissue was removed. Then the aorta was cut with a scalpel into rings of about 1 to 2 mm length. The rings were washed intensively (at least five times) in Medium 199 (Invitrogen, Düsseldorf, Germany) and then placed in wells of a 24 well plate, containing 450 ⁇ of collagen solution per well.
- Medium 199 Invitrogen, Düsseldorf, Germany
- This collagen solution was prepared by mixing 9 ml rat tail collagen (3 mg/ml in 0,1% acetic acid; Sigma, Deisenhofen, Germany) with 1.12 ml 10X Medium 199 (Invitrogen, Düsseldorf, Germany), 1,12 ml 10X Collagen- buffer (0,05 N NaOH, 200 mM HEPES, 260 mM NaHC0 3 ) and 0.6 ml 200 mM Glutamin.
- the rings were oriented such that the trimmed edges were perpendicular to the bottom of the well.
- the collagen was allowed to solidify by incubating the plates for at least one hour at 37°C. Thereafter 1 ml MCDB 131 -medium with additions (SDF-1 and Spiegelmers) was added per well. Rings were then incubated at 37°C for six to seven days. As control for sprouting the experiments were additionally done with VEGF (Vascular endothelial growth factor).
- VEGF Vascular endothelial growth factor
- Sprouting was documented by taking pictures with a digital camera. In some cases rings were fixed by addition of 1 ml 10% paraformaldehyde and stored at 2-8°C for further documentation. Pictures were analysed with the Scion Image image processing software. After calibration with the help of a picture taken from a stage micrometer, a line was drawn in a distance of 0.33 mm from one edge of a ring. A plot histogram along this line was generated by the software, histograms were printed and peaks (representing sprouts crossing the line) were counted. This number was taken as sprouting index. 4 to 5 rings per condition were evaluated. Statistical analysis was performed with WinSTAT for Excel.
- Example 8 Effect of SDF-1 binding Spiegelmer NOX-A12 on chemosensitization of leukemia cells
- MM cell line RPMI 8226 was established. Aim of the experiment was to show whether SDF-1 binding Spiegelmer NOX-A12 sensitizes MM cells in coculture with stromal cells to effects of chemotherapeutic agents. Stromal MS-5 cells secreting SDF 1 were incubated with SDF-1 binding Spiegelmer NOX-A12 or the non-functional revNOX-A12. The MM cell line RPMI-8226 was added to the confluent stromal cell layer. The cells were then incubated with the chemotherapeutic agent F ara A (Fludarabine) for 40 hours. Cell Viability viability was measured.
- F ara A Fludarabine
- the murine stromal cell line MS-5 (ACC 441) was purchased from the DSMZ, the Multiple Myeloma cell line RPMI8226 (CCL-155) was purchased from the ATCC.
- the Multiple Myeloma cell line RPMI8226 was maintained in RPMI medium 1640 GlutaMAX (Invitrogen) supplemented with 10% FBS (Biochrom) and penicillin-streptomycin, the MS-5 cells were cultured in MEM alpha GlutaMAX (Invitrogen) with 10% FBS and penicillin- streptomycin.
- stromal MS-5 cells were seeded the day before onto 24- well plates (the inner eight wells) at a concentration of 8 x 104/ mL / well in MEM alpha GlutaMAX medium (+ 10% FBS) and incubated at 37 °C in 5% C02.
- the confluent stromal cell layer was washed and 0.5 mL RPMI medium 1640 (+1% FBS) was added to the wells.
- SDF-1 binding Spiegelmer NOX-A12 or revNOX-A12 was subsequently added to the wells to a final concentration of 100 nM and incubated for four hours.
- Example 9 Effect of SDF-1 binding Spiegelmer NOX-A12 on proliferation of leukemia cells
- Aim of the experiment was to show whether SDF-1 binding Spiegelmer NOX-A12 has an impact on proliferation of leukemia cells in coculture with bone marrow (abbr. BM) stromal cells.
- Murine stromal MS-5 cells secreting SDF-1 were incubated with SDF-1 binding Spiegelmer NOX-A12 or the non- functional Spiegelmer revNOX-A12.
- the leukemic T-cell line Jurkat was added to the confluent stromal cell layer and incubated for 40 hours at 37 °C and 5% C02. Cell numbers were quantified by Flow Cytometry using the Guava EasyCyte and ViaCount Reagent.
- the murine stromal cell line MS-5 (ACC 441) were purchased from the DSMZ and were cultured in MEM alpha GlutaMAX (Invitrogen) with 10% FBS and penicillin-streptomycin.
- MEM alpha GlutaMAX Invitrogen
- stromal MS-5 cells were seeded the day before onto 24-well plates (the inner eight wells) at a concentration of 8 x 104/mL /well in MEM alpha GlutaMAX medium (+ 10% FBS) and incubated at 37 °C in 5% C02.
- the confluent stromal cell layer was washed and 0.5 mL RPMI medium 1640 (+1% FBS) was added to the wells.
- SDF-1 binding Spiegelmer NOX-A12 or Spiegelmer revNOX A12 was subsequently added to the wells to a final concentration of 100 nM and incubated for four hours.
- 2 x 105 Jurkat cells (-logarithmic growth phase; washed once) in RPMI medium 1640 (+1% FBS) were added to the confluent stromal cell layer and incubated for 48 hours at 37°C with 5% C02.
- the cells were then collected in 15 mL tubes, attached cells were trypsinized including MS-5 cells. The collected cells were washed twice with PBS (+1% BSA). 150 ⁇ .
- SDF-1 binding Spiegelmer NOX-A12 While 1 nM SDF-1 binding Spiegelmer NOX-A12 showed no effect on the Jurkat cell number after 40 hours of cultivation, the cell number was reduced up to 20 % when stromal MS-5 cells were preincubated with 10 or 100 nM SDF-1 binding Spiegelmer NOX-A12 (Fig. 17). Thus, SDF-1 secreted by stromal cells apparently stimulates the proliferation of Jurkat cells. The SDF-1 dependent induction of proliferation can be blocked by SDF-1 binding Spiegelmer NOX-A12 leading to the detection of fewer a lower amount of leukemic cells.
- Example 10 Effect of SDF-1 binding Spiegelmer NOX-A12 on adhesive properties of leukemia cells
- ECM extracellular matrix
- the T cell leukemia Jurkat (ACC 282) were purchased from the DSMZ were maintained in RPMI medium 1640 GlutaMAX (Invitrogen) supplemented with 10% FBS (Biochrom) and penicillin-streptomycin.
- RPMI medium 1640 GlutaMAX (Invitrogen) supplemented with 10% FBS (Biochrom) and penicillin-streptomycin.
- FBS Biochrom
- penicillin-streptomycin 96-well culture plates were incubated with 10 ⁇ g/mL human fibronectin (R&D systems) in PBS for 2 hours at 37 °C. The plates were washed twice with 100 ⁇ , PBS and subsequently blocked with PBS-BSA (0.1 %) for two hours at 37°C. The wells were then washed with RPMI medium.
- Jurkat cells from logarithmic growth phase were washed with RPMI medium (+ 0.1% BSA) and incubated with various concentrations of human SDF-1 (R&D systems) and NOX-A12 for 15 minutes at 37°C.
- NOX-A12 and SDF-1 were preincubated for 30 minutes, lx 105 stimulated Jurkat cells were seeded to the Fibronectin-coated 96- well plates and incubated for 30 minutes. The plates were then washed five times with RPMI medium. Attached cells were quantified by using Cell Titer Glo Reagent (Promega). Therefor, 50 RPMI medium was added to each well, followed by 50 of Cell Titer Glo Reagent. The plates were mixed for two minutes, followed by incubation at room temperature for 10 minutes. Cell number was quantified by relative luminescence signal.
- SDF-1 binding Spiegelmer NOX-A12 was shown to reverse this effect, the control Spiegelmer revNOX-A12 not (Fig. 18B).
- SDF-1 binding Spiegelmer NOX-A12 might have an impact on the disruption of leukemic cell interactions with their protective ECM environment.
- this example might explain SDF-1 binding Spiegelmer NOX-A12 dependent detachment and mobilization of hematopoetic cells from the bone marrow niche.
- Example 11 Disruption of the interaction of multiple myeloma cells with the bone
- the SDF-1 /CXCR4 axis plays a major role in homing and trafficking of multiple myeloma (abbr. MM) cells to the bone marrow (abbr. BM). Therefore, de-adhesion of MM cells from the surrounding BM milieu through SDF-1 inhibition enhances MM sensitivity to therapeutic agents.
- Azab et al. published a protocol to test the CXCR4 inhibitor AMD3100 potency to disupt the interaction of MM cells with the BM environment in vivo that affects localization MM cells [, which in turn enhances the sensitivity of MM cells to chemotherapy.
- SCID mice severe combined immunodeficient mice are used whereby Luc+/GFP+ MM.
- IS cells (2 X 10 6 /mouse) are injected into the tail vein of SCID mice. After 3 to 4 weeks, sufficient tumor progression is detected by bioluminescence imaging (for protocol see Azab et al. 2009).
- mice are randomly divided into 4 groups: group 1 , control mice (received vehicle: 5% glucose); group 2, mice treated every other day with 20 mg/kg NOX-A12 subcutaneous injection; group 3, mice treated with intraperitoneal bortezomib injection of 0.5 mg/kg twice a week; group 4, mice treated with intraperitoneal bortezomib injection of 0.5 mg/kg twice a week and every other day with 20 mg/kg NOX-A12 subcutaneous injection.
- group 1 control mice (received vehicle: 5% glucose); group 2, mice treated every other day with 20 mg/kg NOX-A12 subcutaneous injection; group 3, mice treated with intraperitoneal bortezomib injection of 0.5 mg/kg twice a week; group 4, mice treated with intraperitoneal bortezomib injection of 0.5 mg/kg twice a week and every other day with 20 mg/kg NOX-A12 subcutaneous injection.
- the localization of the MM tumor cells in the bone marrow is determined in vivo confocal microscopy using a fluorescence labelled anti-SDF antibody (for protocol see Azab et al. 2009), whereby the administration of NOX-A12 leads to MM cell mobilization from bone marrow to the blood (as determined by ex vivo flow cytometry; for protocol see Azab et al. 2009) and to a reduction of tumor growth when administered together with bortezomib (by in vivo bioluminescence detection; for protocol see Mitsiades et al., 2003; Mitsiades et al.2004).
- CXCR4 antagonists targeting the microenvironment in leukemia and other cancers. Leukemia 23(1): 43-52.
- CXCR7 (RDC1) promotes breast and lung tumor growth in vivo and is expressed on tumor-associated vasculature. Proc Natl Acad Sci U S A 104(40): 15735-40.
- Vascular endothelial growth factor and basic fibroblast growth factor induce expression of CXCR4 on human endothelial cells: In vivo neovascularization induced by stromal-derived factor- 1 alpha. Am J Pathol 154(4): 1 125-1 135
- CXCR4 is a major chemokine receptor on glioma cells and mediates their survival. J Biol Chem 277(51): 49481-7.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Genetics & Genomics (AREA)
- Epidemiology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Immunology (AREA)
- Developmental Biology & Embryology (AREA)
- Oncology (AREA)
- Hematology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (16)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/821,669 US20130310442A1 (en) | 2010-09-09 | 2011-09-09 | SDF-1 Binding Nucleic Acids and the use Thereof in Cancer Treatment |
| HK13112259.6A HK1184699B (en) | 2010-09-09 | 2011-09-09 | Sdf-1 binding nucleic acids and the use thereof in cancer treatment |
| BR112013005664A BR112013005664B8 (pt) | 2010-09-09 | 2011-09-09 | Ácidos nucleicos que se ligam a sdf-1 e uso dos mesmos no tratamento de câncer |
| ES11757776.7T ES2678497T3 (es) | 2010-09-09 | 2011-09-09 | Ácidos nucleicos que se unen a SDF-1 y su uso en el tratamiento del cáncer |
| CN201180043233.4A CN103108641B (zh) | 2010-09-09 | 2011-09-09 | Sdf-1结合性核酸及其在癌症治疗中的用途 |
| AU2011300818A AU2011300818B2 (en) | 2010-09-09 | 2011-09-09 | SDF-1 binding nucleic acids and the use thereof in cancer treatment |
| JP2013527497A JP6243736B2 (ja) | 2010-09-09 | 2011-09-09 | Sdf−1結合核酸および癌治療におけるその使用 |
| RU2013115739A RU2679495C2 (ru) | 2010-09-09 | 2011-09-09 | Связывающиеся с sdf1 нуклеиновые кислоты и их применение при лечении рака |
| DK11757776.7T DK2613789T3 (en) | 2010-09-09 | 2011-09-09 | SDF-1-binding nucleic acids and their use in cancer treatment |
| SG2013011150A SG188220A1 (en) | 2010-09-09 | 2011-09-09 | Sdf-1 binding nucleic acids and the use thereof in cancer treatment |
| EP11757776.7A EP2613789B1 (en) | 2010-09-09 | 2011-09-09 | Sdf-1 binding nucleic acids and the use thereof in cancer treatment |
| KR1020137006584A KR101937939B1 (ko) | 2010-09-09 | 2011-09-09 | B형 sdf-1 결합 핵산 및 암 치료를 위한 이의 용도 |
| CA2810950A CA2810950C (en) | 2010-09-09 | 2011-09-09 | Sdf-1 binding nucleic acids and the use thereof in cancer treatment |
| MX2013002722A MX357770B (es) | 2010-09-09 | 2011-09-09 | Ácidos nucleicos de enlace sdf-1 y el uso de los mismos en el tratamiento de cáncer. |
| US14/947,173 US9387221B2 (en) | 2010-09-09 | 2015-11-20 | SDF-1 binding nucleic acids and the use thereof in cancer treatment |
| US15/201,477 US10093934B2 (en) | 2010-09-09 | 2016-07-03 | SDF-1 binding nucleic acids and the use thereof in cancer treatment |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP10009397.0 | 2010-09-09 | ||
| EP10009397 | 2010-09-09 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/821,669 A-371-Of-International US20130310442A1 (en) | 2010-09-09 | 2011-09-09 | SDF-1 Binding Nucleic Acids and the use Thereof in Cancer Treatment |
| US14/947,173 Continuation US9387221B2 (en) | 2010-09-09 | 2015-11-20 | SDF-1 binding nucleic acids and the use thereof in cancer treatment |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2012031773A1 true WO2012031773A1 (en) | 2012-03-15 |
Family
ID=44653255
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2011/004554 Ceased WO2012031773A1 (en) | 2010-09-09 | 2011-09-09 | Sdf-1 binding nucleic acids and the use thereof in cancer treatment |
Country Status (14)
| Country | Link |
|---|---|
| US (3) | US20130310442A1 (https=) |
| EP (1) | EP2613789B1 (https=) |
| JP (1) | JP6243736B2 (https=) |
| KR (1) | KR101937939B1 (https=) |
| CN (1) | CN103108641B (https=) |
| AU (1) | AU2011300818B2 (https=) |
| BR (1) | BR112013005664B8 (https=) |
| CA (1) | CA2810950C (https=) |
| DK (1) | DK2613789T3 (https=) |
| ES (1) | ES2678497T3 (https=) |
| MX (1) | MX357770B (https=) |
| RU (1) | RU2679495C2 (https=) |
| SG (2) | SG10201506725QA (https=) |
| WO (1) | WO2012031773A1 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017178119A1 (en) * | 2016-04-15 | 2017-10-19 | Noxxon Pharma Ag | Method of modulating the number and the distribution of tumor-infiltrating leukocytes in tumors |
| WO2021261601A1 (ja) | 2020-06-26 | 2021-12-30 | ラクオリア創薬株式会社 | レチノイドとがん治療薬との併用療法が有効ながん患者の選択方法およびレチノイドとがん治療薬との併用医薬 |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2011300818B2 (en) * | 2010-09-09 | 2015-11-12 | TME Pharma AG | SDF-1 binding nucleic acids and the use thereof in cancer treatment |
Citations (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6011020A (en) | 1990-06-11 | 2000-01-04 | Nexstar Pharmaceuticals, Inc. | Nucleic acid ligand complexes |
| WO2000041647A1 (en) | 1999-01-19 | 2000-07-20 | The Children's Hospital Of Philadelphia | Sustained delivery of polyionic bioactive agents |
| WO2002065963A1 (en) | 2001-02-16 | 2002-08-29 | Expression Genetics, Inc. | Biodegradable cationic copolymers of poly(alkylenimine) and poly(ethylene glycol) for the delivery of bioactive agents |
| WO2003035665A1 (de) | 2001-10-26 | 2003-05-01 | Noxxon Pharma Ag | Modifizierte l-nukleinsäure |
| EP1306382A1 (de) | 2001-10-26 | 2003-05-02 | Noxxon Pharma AG | Modifizierte L-Nukleinsäure |
| WO2003070823A2 (en) | 2002-02-20 | 2003-08-28 | The General Hospital Corporation | Conjugates comprising a biodegradable polymer and uses therefor |
| WO2004087068A2 (en) * | 2003-03-27 | 2004-10-14 | Emory University | Cxcr4 antagonists and methods of their use |
| WO2004092191A2 (en) | 2003-04-13 | 2004-10-28 | Enzon Pharmaceuticals, Inc. | Polymeric oligonucleotide prodrugs |
| WO2004113394A2 (en) | 2003-06-20 | 2004-12-29 | Warwick Effect Polymers Limited | Living radical polymerization initiator comprising a functional group capable of reacting with polypeptides or the like, comb polymer obtained therewith, polypeptide conjugates and drugs obtained therefrom |
| WO2005099768A2 (en) | 2004-03-23 | 2005-10-27 | Complex Biosystems Gmbh | Polymeric prodrug with a self-immolative linker |
| WO2006052790A2 (en) | 2004-11-05 | 2006-05-18 | The Children's Hospital Of Philadelphia | Biodegradable linkers for molecular therapies |
| WO2007022523A2 (en) * | 2005-08-19 | 2007-02-22 | Genzyme Corporation | Methods to enhance chemotherapy |
| WO2008009437A2 (en) * | 2006-07-18 | 2008-01-24 | Noxxon Pharma Ag | Sdf-i binding nucleic acids |
| WO2008018641A1 (en) * | 2006-08-11 | 2008-02-14 | Ono Pharmaceutical Co., Ltd. | Monoclonal antibodies against stromal derived factor-1 (sdf-1) |
| WO2008034122A2 (en) | 2006-09-15 | 2008-03-20 | Enzon Pharmaceuticals, Inc. | Hindered ester-based biodegradable linkers for oligonucleotide delivery |
| WO2009019007A2 (en) * | 2007-08-06 | 2009-02-12 | Noxxon Pharma Ag | Sdf-1 binding nucleic acids and the use thereof |
Family Cites Families (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5840867A (en) | 1991-02-21 | 1998-11-24 | Gilead Sciences, Inc. | Aptamer analogs specific for biomolecules |
| US5582981A (en) | 1991-08-14 | 1996-12-10 | Gilead Sciences, Inc. | Method for identifying an oligonucleotide aptamer specific for a target |
| AU2855399A (en) | 1998-03-24 | 1999-10-18 | Chugai Seiyaku Kabushiki Kaisha | Vascularization inhibitors |
| ES2156581T5 (es) * | 1998-03-30 | 2015-01-21 | Northwest Biotherapeutics, Inc. | Aplicaciones terapéuticas y diagnósticas basadas en el papel del gen CXCR-4 en la tumorigénesis |
| CA2412493C (en) * | 2000-06-26 | 2010-11-09 | Wellstat Biologics Corporation | Purging of cells using viruses |
| US20060019917A1 (en) * | 2001-05-18 | 2006-01-26 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of stromal cell-derived factor-1 (SDF-1) gene expression using short interfering nucleic acid (siNA) |
| US7468253B2 (en) | 2001-06-07 | 2008-12-23 | Chemocentryx, Inc. | Method for multiple chemokine receptor screening for antagonists using RAM assay |
| CA2449628C (en) | 2001-06-07 | 2008-05-06 | Zheng Wei | Cell migration assay |
| EP1883651A1 (en) * | 2005-05-26 | 2008-02-06 | Rappaport Family Institute For Research in the Medical Sciences | Polypeptides and compositions comprising same and methods of using same for treating cxcr4 associated medical conditions |
| WO2008077945A2 (en) * | 2006-12-22 | 2008-07-03 | Ablynx N.V. | Anti-chemokine (ccl2, ccl3, ccl5, cxcl11, cxcl12) single-domain antibodies |
| AU2011300818B2 (en) * | 2010-09-09 | 2015-11-12 | TME Pharma AG | SDF-1 binding nucleic acids and the use thereof in cancer treatment |
-
2011
- 2011-09-09 AU AU2011300818A patent/AU2011300818B2/en active Active
- 2011-09-09 RU RU2013115739A patent/RU2679495C2/ru active
- 2011-09-09 DK DK11757776.7T patent/DK2613789T3/en active
- 2011-09-09 CN CN201180043233.4A patent/CN103108641B/zh active Active
- 2011-09-09 CA CA2810950A patent/CA2810950C/en active Active
- 2011-09-09 SG SG10201506725QA patent/SG10201506725QA/en unknown
- 2011-09-09 SG SG2013011150A patent/SG188220A1/en unknown
- 2011-09-09 US US13/821,669 patent/US20130310442A1/en not_active Abandoned
- 2011-09-09 EP EP11757776.7A patent/EP2613789B1/en active Active
- 2011-09-09 MX MX2013002722A patent/MX357770B/es active IP Right Grant
- 2011-09-09 ES ES11757776.7T patent/ES2678497T3/es active Active
- 2011-09-09 BR BR112013005664A patent/BR112013005664B8/pt active IP Right Grant
- 2011-09-09 JP JP2013527497A patent/JP6243736B2/ja active Active
- 2011-09-09 WO PCT/EP2011/004554 patent/WO2012031773A1/en not_active Ceased
- 2011-09-09 KR KR1020137006584A patent/KR101937939B1/ko active Active
-
2015
- 2015-11-20 US US14/947,173 patent/US9387221B2/en active Active
-
2016
- 2016-07-03 US US15/201,477 patent/US10093934B2/en active Active
Patent Citations (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6011020A (en) | 1990-06-11 | 2000-01-04 | Nexstar Pharmaceuticals, Inc. | Nucleic acid ligand complexes |
| WO2000041647A1 (en) | 1999-01-19 | 2000-07-20 | The Children's Hospital Of Philadelphia | Sustained delivery of polyionic bioactive agents |
| WO2002065963A1 (en) | 2001-02-16 | 2002-08-29 | Expression Genetics, Inc. | Biodegradable cationic copolymers of poly(alkylenimine) and poly(ethylene glycol) for the delivery of bioactive agents |
| WO2003035665A1 (de) | 2001-10-26 | 2003-05-01 | Noxxon Pharma Ag | Modifizierte l-nukleinsäure |
| EP1306382A1 (de) | 2001-10-26 | 2003-05-02 | Noxxon Pharma AG | Modifizierte L-Nukleinsäure |
| WO2003070823A2 (en) | 2002-02-20 | 2003-08-28 | The General Hospital Corporation | Conjugates comprising a biodegradable polymer and uses therefor |
| WO2004087068A2 (en) * | 2003-03-27 | 2004-10-14 | Emory University | Cxcr4 antagonists and methods of their use |
| WO2004092191A2 (en) | 2003-04-13 | 2004-10-28 | Enzon Pharmaceuticals, Inc. | Polymeric oligonucleotide prodrugs |
| WO2004113394A2 (en) | 2003-06-20 | 2004-12-29 | Warwick Effect Polymers Limited | Living radical polymerization initiator comprising a functional group capable of reacting with polypeptides or the like, comb polymer obtained therewith, polypeptide conjugates and drugs obtained therefrom |
| WO2005099768A2 (en) | 2004-03-23 | 2005-10-27 | Complex Biosystems Gmbh | Polymeric prodrug with a self-immolative linker |
| WO2006052790A2 (en) | 2004-11-05 | 2006-05-18 | The Children's Hospital Of Philadelphia | Biodegradable linkers for molecular therapies |
| WO2007022523A2 (en) * | 2005-08-19 | 2007-02-22 | Genzyme Corporation | Methods to enhance chemotherapy |
| WO2008009437A2 (en) * | 2006-07-18 | 2008-01-24 | Noxxon Pharma Ag | Sdf-i binding nucleic acids |
| WO2008018641A1 (en) * | 2006-08-11 | 2008-02-14 | Ono Pharmaceutical Co., Ltd. | Monoclonal antibodies against stromal derived factor-1 (sdf-1) |
| WO2008034122A2 (en) | 2006-09-15 | 2008-03-20 | Enzon Pharmaceuticals, Inc. | Hindered ester-based biodegradable linkers for oligonucleotide delivery |
| WO2009019007A2 (en) * | 2007-08-06 | 2009-02-12 | Noxxon Pharma Ag | Sdf-1 binding nucleic acids and the use thereof |
Non-Patent Citations (92)
| Title |
|---|
| ALSAYED Y., NGO H. ET AL.: "Mechanisms of regulation of CXCR4/SDF-1 (CXCL12)-dependent migration and homing in multiple myeloma", BLOOD, vol. 109, no. 7, 2007, pages 2708 - 17 |
| ALTSCHUL S.F., GISH W. ET AL.: "Basic local alignment search tool", J MOL BIOL., vol. 215, no. 3, 1990, pages 403 - 10, XP002949123, DOI: doi:10.1006/jmbi.1990.9999 |
| ALTSCHUL S.F., MADDEN T.L. ET AL.: "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", NUCLEIC ACIDS RES., vol. 25, no. 17, 1997, pages 3389 - 402, XP002905950, DOI: doi:10.1093/nar/25.17.3389 |
| ARYA S.K., GINSBERG C.C. ET AL.: "In vitro phenotype of SDF1 gene mutant that delays the onset of human immunodeficiency virus disease in vivo", J HUM VIROL, vol. 2, no. 3, 1999, pages 133 - 8 |
| AUERBACH R., LEWIS R. ET AL.: "Angiogenesis assays: a critical overview", CLIN CHEM., vol. 49, no. 1, 2003, pages 32 - 40, XP002595434, DOI: doi:10.1373/49.1.32 |
| AZAB A.K., RUNNELS J.M. ET AL.: "CXCR4 inhibitor AMD3100 disrupts the interaction of multiple myeloma cells with the bone marrow microenvironment and enhances their sensitivity to therapy", BLOOD, vol. 113, no. 18, 2009, pages 4341 - 51, XP002663167, DOI: doi:10.1182/blood-2008-10-186668 |
| AZAB ABDEL KAREEM ET AL: "CXCR4 inhibitor AMD3100 disrupts the interaction of multiple myeloma cells with the bone marrow microenvironment and enhances their sensitivity to therapy.", BLOOD 30 APR 2009 LNKD- PUBMED:19139079, vol. 113, no. 18, 30 April 2009 (2009-04-30), pages 4341 - 4351, XP002663167, ISSN: 1528-0020 * |
| BALABANIAN K., LAGANE B. ET AL.: "The chemokine SDF-1/CXCL12 binds to and signals through the orphan receptor RDC1 in T lymphocytes", J BIOL CHEM, vol. 280, no. 42, 2005, pages 35760 - 35766, XP003015681, DOI: doi:10.1074/jbc.M508234200 |
| BALABANIAN, K., LAGANE B. ET AL.: "WHIM syndromes with different genetic anomalies are accounted for by impaired CXCR4 desensitization to CXCL12", BLOOD, vol. 105, no. 6, 2005, pages 2449 - 57 |
| BALKWILL F.: "Cancer and the chemokine network", NAT REV CANCER, vol. 4, no. 7, 2004, pages 540 - 50, XP009046388, DOI: doi:10.1038/nrc1388 |
| BATCHELOR T.T., SORENSEN A.G. ET AL.: "AZD2171, a pan-VEGF receptor tyrosine kinase inhibitor, normalizes tumor vasculature and alleviates edema in glioblastoma patients", CANCER CELL., vol. 11, no. 1, 2007, pages 83 - 95, XP009159819, DOI: doi:10.1016/j.ccr.2006.11.021 |
| BROOKS H.L. JR., CABALLERO S. JR. ET AL.: "Vitreous levels of vascular endothelial growth factor and stromal-derived factor 1 in patients with diabetic retinopathy and cystoid macular edema before and after intraocular injection of triamcinolone", ARCH OPHTHALMOL, vol. 122, no. 12, 2004, pages 1801 - 7 |
| BROXMEYER H.E., ORSCHELL C.M.: "Rapid mobilization of murine and human hematopoietic stem and progenitor cells with AMD3100, a CXCR4 antagonis", J EXP MED., vol. 201, no. 8, 2005, pages 1307 - 18, XP009076434, DOI: doi:10.1084/jem.20041385 |
| BUCKLEY C.D., AMFT N. ET AL.: "Persistent induction of the chemokine receptor CXCR4 by TGF-beta 1 on synovial T cells contributes to their accumulation within the rheumatoid synovium", J IMMUNOL, vol. 165, no. 6, 2000, pages 3423 - 9 |
| BURGER J.A., BURKLE A ET AL.: "The CXCR4 chemokine receptor in acute and chronic leukaemia: a marrow homing receptor and potential therapeutic target.", BR J HAEMATOL., vol. 137, no. 4, 2007, pages 288 - 96 |
| BURGER J.A., GHIA P. ET AL.: "The microenvironment in mature B-cell malignancies: a target for new treatment strategies", BLOOD, vol. 114, no. 16, 2009, pages 3367 - 75 |
| BURGER J.A., KIPPS T.J. ET AL.: "Chemokine receptors and stromal cells in the homing and homeostasis of chronic lymphocytic leukemia B cells", LEUK LYMPHOMA., vol. 43, no. 3, 2002, pages 461 - 6 |
| BURGER J.A., PELED A.: "CXCR4 antagonists: targeting the microenvironment in leukemia and other cancers", LEUKEMIA, vol. 23, no. 1, 2009, pages 43 - 52, XP055011238, DOI: doi:10.1038/leu.2008.299 |
| BURGER J.A., TSUKADA N. ET AL.: "Blood-derived nurse-like cells protect chronic lymphocytic leukemia B cells from spontaneous apoptosis through stromal cell-derived factor-1", BLOOD, vol. 96, no. 8, 2000, pages 2655 - 63, XP002649433 |
| BURNS J.M., SUMMERS B.C. ET AL.: "A novel chemokine receptor for SDF-1 and I-TAC involved in cell survival, cell adhesion, and tumor development", J EXP MED, vol. 203, no. 9, 2006, pages 2201 - 2213, XP002447048, DOI: doi:10.1084/jem.20052144 |
| BUTLER J.M., GUTHRIE S.M. ET AL.: "SDF-1 is both necessary and sufficient to promote proliferative retinopathy", J CLIN INVEST, vol. 115, no. 1, 2005, pages 86 - 93, XP009102858 |
| CABIOGLU, N., SAHIN A. ET AL.: "Chemokine receptor CXCR4 expression in breast cancer as a potential predictive marker of isolated tumor cells in bone marrow", CLIN EXP METASTASIS, vol. 22, no. 1, 2005, pages 39 - 46, XP019235808, DOI: doi:10.1007/s10585-005-3222-y |
| CERADINI D.J., KULKARNI A.R. ET AL.: "Progenitor cell trafficking is regulated by hypoxic gradients through HIF-1 induction of SDF-1", NAT MED., vol. 10, no. 8, 2004, pages 858 - 64, XP008140707, DOI: doi:10.1038/nm1075 |
| CORCIONE A., OTTONELLO L. ET AL.: "Stromal cell-derived factor-1 as a chemoattractant for follicular center lymphoma B cells", J NATL CANCER INST, vol. 92, no. 8, 2000, pages 628 - 35 |
| DAMHA M.J., OGILVIE K.K. ET AL.: "Oligoribonucleotide synthesis. The silyl- phosphoramidite method", METHODS MOL BIOL., vol. 20, 1993, pages 81 - 114 |
| DAMIANO J.S., CRESS A.E. ET AL.: "Cell adhesion mediated drug resistance (CAM-DR): role of integrins and resistance to apoptosis in human myeloma cell lines", BLOOD, vol. 93, no. 5, 1999, pages 1658 - 67 |
| DEVINE S.M., FLOMENBERG N. ET AL.: "Rapid mobilization of CD34+ cells following administration of the CXCR4 antagonist AMD3100 to patients with multiple myeloma and non-Hodgkin's lymphoma", J CLIN ONCOL., vol. 22, no. 6, 2004, pages 1095 - 102, XP055096637, DOI: doi:10.1200/JCO.2004.07.131 |
| DILLMANN F., VELDWIJK M.R. ET AL.: "Plerixafor inhibits chemotaxis toward SDF-1 and CXCR4-mediated stroma contact in a dose-dependent manner resulting in increased susceptibility of BCR-ABL+ cell to Imatinib and Nilotinib", LEUK LYMPHOMA, vol. 50, no. 10, 2009, pages 16 |
| EHTESHAM M., STEVENSON C.B. ET AL.: "Preferential expression of chemokine receptor CXCR4 by highly malignant human gliomas and its association with poor patient survival", NEUROSURGERY, vol. 63, no. 4, 2008, pages E820 |
| ENGL T., RELJA B. ET AL.: "CXCR4 chemokine receptor mediates prostate tumor cell adhesion through alpha5 and beta3 integrins", NEOPLASIA, vol. 8, no. 4, 2006, pages 290 - 301 |
| FEDYK E.R., JONES D. ET AL.: "Expression of stromal-derived factor-1 is decreased by IL-1 and TNF and in dermal wound healing", J IMMUNOL., vol. 166, no. 9, 2001, pages 5749 - 54 |
| GEMINDER H., SAGI-ASSIF O. ET AL.: "A possible role for CXCR4 and its ligand, the CXC chemokine stromal cell-derived factor-1, in the development of bone marrow metastases in neuroblastoma", J IMMUNOL, vol. 167, no. 8, 2001, pages 4747 - 57 |
| GRASSI F., CRISTINO S. ET AL.: "CXCL12 chemokine up-regulates bone resorption and MMP-9 release by human osteoclasts: CXCL12 levels are increased in synovial and bone tissue of rheumatoid arthritis patients", J CELL PHYSIOL, vol. 199, no. 2, 2004, pages 244 - 51 |
| GRUNEWALD M., AVRAHAM I. ET AL.: "VEGF-induced adult neovascularization: recruitment, retention, and role of accessory cells", CELL, vol. 124, no. 1, 2006, pages 175 - 89 |
| GULINO, A.V., MORATTO D. ET AL.: "Altered leukocyte response to CXCL12 in patients with warts hypogammaglobulinemia, infections, myelokathexis (WHIM) syndrome", BLOOD, vol. 104, no. 2, 2004, pages 444 - 52 |
| HOLM N.T., ABREO F. ET AL.: "Elevated chemokine receptor CXCR4 expression in primary tumors following neoadjuvant chemotherapy predicts poor outcomes for patients with locally advanced breast cancer (LABC", BREAST CANCER RES TREAT., vol. 113, no. 2, 13 February 2008 (2008-02-13), pages 293 - 9, XP019671300 |
| HWANG J.H., CHUNG H.K. ET AL.: "CXC chemokine receptor 4 expression and function in human anaplastic thyroid cancer cells", J CLIN ENDOCRINOL METAB, vol. 88, no. 1, 2003, pages 408 - 16 |
| JIN L., TABE Y. ET AL.: "CXCR4 up-regulation by imatinib induces chronic myelogenous leukemia (CML) cell migration to bone marrow stroma and promotes survival of quiescent CML cells", MOL CANCER THER, vol. 7, no. 1, 2008, pages 48 - 58 |
| KANBE K., TAKAGISHI K. ET AL.: "Stimulation of matrix metalloprotease 3 release from human chondrocytes by the interaction of stromal cell-derived factor 1 and CXC chemokine receptor 4", ARTHRITIS RHEUM, vol. 46, no. 1, 2002, pages 130 - 7 |
| KAWAI T., CHOI U. ET AL.: "Enhanced function with decreased internalization of carboxy- terminus truncated CXCR4 responsible for WHIM syndrome", EXP HEMATOL, vol. 33, no. 4, 2005, pages 460 - 8, XP004803329, DOI: doi:10.1016/j.exphem.2005.01.001 |
| KIOI M., VOGEL H. ET AL.: "Inhibition of vasculogenesis, but not angiogenesis, prevents the recurrence of glioblastoma after irradiation in mice", J CLIN INVEST, vol. 120, no. 3, 2010, pages 694 - 705, XP002572686, DOI: doi:10.1172/JCI40283 |
| KLUSSMANN S.: "The Aptamer Handbook - Functional Oligonucleotides and their Applications", 2006, WILEY-VCH |
| KONOPLEVA M ET AL: "Therapeutic targeting of microenvironmental interactions in leukemia: Mechanisms and approaches", DRUG RESISTANCE UPDATES, CHURCHILL LIVINGSTONE, EDINBURGH, GB, vol. 12, no. 4-5, 1 August 2009 (2009-08-01), pages 103 - 113, XP026681855, ISSN: 1368-7646, [retrieved on 20090725], DOI: 10.1016/J.DRUP.2009.06.001 * |
| KOSHIBA T., HOSOTANI R. ET AL.: "Expression of stromal cell-derived factor 1 and CXCR4 ligand receptor system in pancreatic cancer: a possible role for tumor progression", CLIN CANCER RES, vol. 6, no. 9, 2000, pages 3530 - 5, XP002978934 |
| KOZIN S.V., KAMOUN W.S. ET AL.: "Recruitment of myeloid but not endothelial precursor cells facilitates tumor regrowth after local irradiation", CANCER RES, vol. 70, no. 14, 2010, pages 5679 - 85 |
| KRUMBHOLZ M., THEIL D. ET AL.: "Chemokines in multiple sclerosis: CXCL12 and CXCL 13 up-regulation is differentially linked to CNS immune cell recruitment", BRAIN, vol. 129, 2006, pages 200 - 211 |
| KRYCZEK I., LANGE A. ET AL.: "CXCL12 and vascular endothelial growth factor synergistically induce neoangiogenesis in human ovarian cancers", CANCER RES, vol. 65, no. 2, 2005, pages 465 - 72 |
| KURTOVA A.V., BALAKRISHNAN K. ET AL.: "Diverse marrow stromal cells protect CLL cells from spontaneous and drug-induced apoptosis: development of a reliable and reproducible system to assess stromal cell adhesion-mediated drug resistance", BLOOD, vol. 114, no. 20, 2009, pages 4441 - 50 |
| KUSSER W.: "Chemically modified nucleic acid aptamers for in vitro selections: evolving evolution.", J BIOTECHNOL, vol. 74, no. 1, 2000, pages 27 - 38, XP008042698, DOI: doi:10.1016/S1389-0352(99)00002-1 |
| LAGNEAUX L., DELFORGE A. ET AL.: "Chronic lymphocytic leukemic B cells but not normal B cells are rescued from apoptosis by contact with normal bone marrow stromal cells", BLOOD, vol. 91, no. 7, 1998, pages 2387 - 96 |
| LI J.K., YU L. ET AL.: "Inhibition of CXCR4 activity with AMD3100 decreases invasion of human colorectal cancer cells in vitro", WORLD J GASTROENTEROL, vol. 14, no. 15, 2008, pages 2308 - 2313 |
| MAKSYM R.B., TARNOWSKI M. ET AL.: "The role of stromal-derived factor-1--CXCR7 axis in development and cancer", EUR J PHARMACOL., vol. 625, no. 1-3, 2009, pages 31 - 40, XP026762245, DOI: doi:10.1016/j.ejphar.2009.04.071 |
| MARECHAL V., ARENZANA-SEISDEDOS F. ET AL.: "Opposite effects of SDF-1 on human immunodeficiency virus type 1 replication", J VIRO, vol. 73, no. 5, 1999, pages 3608 - 15, XP000996628 |
| MCGINNIS S., MADDEN T.L. ET AL.: "BLAST: at the core of a powerful and diverse set of sequence analysis tools", NUCLEIC ACIDS RES., vol. 32, 2004, pages W20 - 5 |
| MEADS M.B., HAZLEHURST L.A. ET AL.: "The bone marrow microenvironment as a tumor sanctuary and contributor to drug resistance", CLIN CANCER RES., vol. 14, no. 9, 2008, pages 2519 - 26, XP055195865, DOI: doi:10.1158/1078-0432.CCR-07-2223 |
| MEIKE BURGER ET AL: "Small peptide inhibitors of the CXCR4 chemokine receptor (CD184) antagonize the activation, migration, and antiapoptotic responses of CXCL12 in chronic lymphocytic leukemia B cells", BLOOD, AMERICAN SOCIETY OF HEMATOLOGY, US, vol. 106, no. 5, 1 September 2005 (2005-09-01), pages 1824 - 1830, XP002629047, ISSN: 0006-4971, [retrieved on 20050519], DOI: 10.1182/BLOOD-2004-12-4918 * |
| MELETH A.D., AGRON E. ET AL.: "Serum inflammatory markers in diabetic retinopathy", INVEST OPHTHALMOL VIS SCI, vol. 46, no. 11, 2005, pages 4295 - 301 |
| MIAO, Z., LUKER K.E. ET AL.: "CXCR7 (RDC1) promotes breast and lung tumor growth in vivo and is expressed on tumor-associated vasculature", PROC NATL ACAD SCI USA, vol. 104, no. 40, 2007, pages 15735 - 40, XP002481677, DOI: doi:10.1073/pnas.0610444104 |
| MITSIADES C.S., MITSIADES N. ET AL.: "Focus on multiple myeloma", CANCER CELL, vol. 6, no. 5, 2004, pages 439 - 44, XP002681269, DOI: doi:10.1016/j.ccr.2004.10.020 |
| MITSIADES C.S., MITSIADES N.S. ET AL.: "Fluorescence imaging of multiple myeloma cells in a clinically relevant SCID/NOD in vivo model: biologic and clinical implications", CANCER RES., vol. 63, no. 20, 2003, pages 6689 - 96 |
| MIZELL J., SMITH M. ET AL.: "Overexpression of CXCR4 in primary tumor of patients with HER-2 negative breast cancer was predictive of a poor disease-free survival: a validation study", ANN SURG ONCOL., vol. 16, no. 10, 2009, pages 2711 - 6, XP019745379, DOI: doi:10.1245/s10434-009-0551-0 |
| MULLER, A., HOMEY B. ET AL.: "Involvement of chemokine receptors in breast cancer metastasis", NATURE, vol. 410, no. 6824, 2001, pages 50 - 6, XP002292390, DOI: doi:10.1038/35065016 |
| MURDOCH, C.: "CXCR4: chemokine receptor extraordinaire", IMMUNOL REV, vol. 177, 2000, pages 175 - 84 |
| NEEDLEMAN, WUNSCH: "A general method applicable to the search for similarities in the amino acid sequence of two proteins", J MOL BIOL., vol. 48, no. 3, 1970, pages 443 - 53, XP024011703, DOI: doi:10.1016/0022-2836(70)90057-4 |
| NERVI B., RAMIREZ P. ET AL.: "Chemosensitization of acute myeloid leukemia (AML) following mobilization by the CXCR4 antagonist AMD3100", BLOOD, vol. 113, no. 24, 2 December 2008 (2008-12-02), pages 6206 - 14, XP055086971, DOI: doi:10.1182/blood-2008-06-162123 |
| PEARSON, LIPMAN: "Improved tools for biological sequence comparison", PROC. NAT'1. ACAD. SCI. USA, vol. 85, 1988, pages 2444, XP002060460, DOI: doi:10.1073/pnas.85.8.2444 |
| REDJAL N., CHAN J.A. ET AL.: "CXCR4 inhibition synergizes with cytotoxic chemotherapy in gliomas.", CLIN CANCER RES., vol. 12, no. 22, 2006, pages 6765 - 71, XP055074181, DOI: doi:10.1158/1078-0432.CCR-06-1372 |
| SALCEDO R., WASSERMAN K. ET AL.: "Vascular endothelial growth factor and basic fibroblast growth factor induce expression of CXCR4 on human endothelial cells: In vivo neovascularization induced by stromal-derived factor-lalpha", AM J PATHOL, vol. 154, no. 4, 1999, pages 1125 - 1135, XP009192298 |
| SALCEDO, R., OPPENHEIM J.J.: "Role of chemokines in angiogenesis: CXCL12/SDF-1 and CXCR4 interaction, a key regulator of endothelial cell responses", MICROCIRCULATION, vol. 10, no. 3-4, 2003, pages 359 - 70, XP008091927, DOI: doi:10.1038/sj.mn.7800200 |
| SALVUCCI 0., YAO L. ET AL.: "Regulation of endothelial cell branching morphogenesis by endogenous chemokine stromal-derived factor-1", BLOOD, vol. 99, no. 8, 2002, pages 2703 - 11, XP002481675, DOI: doi:10.1182/blood.V99.8.2703 |
| SAUR D., SEIDLER B. ET AL.: "CXCR4 expression increases liver and lung metastasis in a mouse model of pancreatic cancer", GASTROENTEROLOGY, vol. 129, no. 4, 2005, pages 1237 - 50, XP005155709, DOI: doi:10.1053/j.gastro.2005.06.056 |
| SCHIMANSKI C.C., GALLE P.R. ET AL.: "Chemokine receptor CXCR4-prognostic factor for gastrointestinal tumors.", WORLD J GASTROENTEROL., vol. 14, no. 30, 2008, pages 4721 - 4 |
| SCOTTON C.J., WILSON J.L. ET AL.: "Multiple actions of the chemokine CXCL12 on epithelial tumor cells in human ovarian cancer", CANCER RES., vol. 62, no. 20, 2002, pages 5930 - 8, XP002983372 |
| SENGUPTA N., CABALLERO S. ET AL.: "Preventing stem cell incorporation into choroidal neovascularization by targeting homing and attachment factors", INVEST OPHTHALMOL VIS SCI., vol. 46, no. 1, 2005, pages 343 - 8, XP002542847, DOI: doi:10.1167/iovs.04-0153 |
| SHAKED Y., HENKE E. ET AL.: "Rapid chemotherapy-induced acute endothelial progenitor cell mobilization: implications for antiangiogenic drugs as chemosensitizing agents", CANCER CELL., vol. 14, no. 3, 2008, pages 263 - 73, XP055380601, DOI: doi:10.1016/j.ccr.2008.08.001 |
| SHIROZU M., NAKANO T. ET AL.: "Structure and chromosomal localization of the human stromal cell-derived factor 1 (SDF1) gene", GENOMICS, vol. 28, no. 3, 1995, pages 495 - 500, XP003020969, DOI: doi:10.1006/geno.1995.1180 |
| SMITH, WATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 |
| SORIANO A., MARTINEZ C. ET AL.: "Plasma stromal cell-derived factor (SDF)-l levels, SDF1-3'A genotype, and expression of CXCR4 on T lymphocytes: their impact on resistance to human immunodeficiency virus type 1 infection and its progression", J INFECT DIS, vol. 186, no. 7, 2002, pages 922 - 31 |
| SU L., ZHANG J ET AL.: "Differential expression of CXCR4 is associated with the metastatic potential of human non-small cell lung cancer cells", CLIN CANCER RES., vol. 11, no. 23, 2005, pages 8273 - 80, XP055076137, DOI: doi:10.1158/1078-0432.CCR-05-0537 |
| TSENG D., LARTEY F. ET AL.: "56th Annual Meeting", 2008, RADIATION RESEARCH SOCIETY, article "MS 108) Inhibition of SDF-1/CXCR7 radiosensitizes ENU induced glioblastomas in the rat" |
| VENKATESAN N., KIM S.J. ET AL.: "Novel phosphoramidite building blocks in synthesis and applications toward modified oligonucleotides", CURR MED CHEM, vol. 10, no. 19, 2003, pages 1973 - 91, XP009045165, DOI: doi:10.2174/0929867033456909 |
| WANG J., GUAN E. ET AL.: "Role of tyrosine phosphorylation in ligand-independent sequestration of CXCR4 in human primary monocytes-macrophages.", J BIOL CHEM, vol. 276, no. 52, 2001, pages 49236 - 43 |
| WANG J., SHIOZAWA Y. ET AL.: "The role of CXCR7/RDC as a chemokine receptor for CXCL12/SDF-1 in prostate cancer", J BIOL CHEM, vol. 283, no. 7, 5 December 2007 (2007-12-05), pages 4283 - 4294, XP055383358, DOI: doi:10.1074/jbc.M707465200 |
| WANG N., WU Q.L. ET AL.: "Expression of chemokine receptor CXCR4 in nasopharyngeal carcinoma: pattern of expression and correlation with clinical outcome", J TRANSL MED, vol. 3, 2005, pages 26, XP021009873, DOI: doi:10.1186/1479-5876-3-26 |
| XU L., DUDA D.G. ET AL.: "Direct evidence that bevacizumab, an anti-VEGF antibody, up-regulates SDF1alpha, CXCR4, CXCL6, and neuropilin 1 in tumors from patients with rectal cancer", CANCER RES., vol. 69, no. 20, 2009, pages 7905 - 10, XP055000179, DOI: doi:10.1158/0008-5472.CAN-09-2099 |
| YAMAGUCHI J., KUSANO K.F. ET AL.: "Stromal cell-derived factor-1 effects on ex vivo expanded endothelial progenitor cell recruitment for ischemic neovascularization", CIRCULATION, vol. 107, no. 9, 2003, pages 1322 - 8 |
| YANG J., ZHANG B. ET AL.: "Breast cancer metastasis suppressor 1 inhibits SDF-lalpha- induced migration of non-small cell lung cancer by decreasing CXCR4 expression", CANCER LETT, vol. 269, no. 1, 2008, pages 46 - 56, XP023907650, DOI: doi:10.1016/j.canlet.2008.04.016 |
| ZAGZAG D., ESENCAY M. ET AL.: "Hypoxia- and vascular endothelial growth factor- induced stromal cell-derived factor-lalpha/CXCR4 expression in glioblastomas: one plausible explanation of Scherer's structures.", AM J PATHOL, vol. 173, no. 2, 2008, pages 545 - 560 |
| ZEELENBERG I.S., RUULS-VAN STALLE L. ET AL.: "The chemokine receptor CXCR4 is required for outgrowth of colon carcinoma micrometastases.", CANCER RES., vol. 63, no. 13, 2003, pages 3833 - 9 |
| ZHENG K., LI H.Y. ET AL.: "Chemokine receptor CXCR7 regulates the invasion, angiogenesis and tumor growth of human hepatocellular carcinoma cells", J EXP CLIN CANCER RES., vol. 29, 2010, pages 31, XP021083438, DOI: doi:10.1186/1756-9966-29-31 |
| ZHOU Y., LARSEN P.H. ET AL.: "CXCR4 is a major chemokine receptor on glioma cells and mediates their survival", J BIOL CHEM, vol. 277, no. 51, 2002, pages 49481 - 7 |
| ZHU A.X., SAHANI D.V. ET AL.: "Efficacy, safety, and potential biomarkers of sunitinib monotherapy in advanced hepatocellular carcinoma: a phase II study", J CLIN ONCOL, vol. 27, no. 18, 2009, pages 3027 - 35 |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017178119A1 (en) * | 2016-04-15 | 2017-10-19 | Noxxon Pharma Ag | Method of modulating the number and the distribution of tumor-infiltrating leukocytes in tumors |
| US20230146246A1 (en) * | 2016-04-15 | 2023-05-11 | Noxxon Pharma Ag | Method of Modulating the Number and the Distribution of Tumor-Infiltrating Leukocytes in Tumors |
| WO2021261601A1 (ja) | 2020-06-26 | 2021-12-30 | ラクオリア創薬株式会社 | レチノイドとがん治療薬との併用療法が有効ながん患者の選択方法およびレチノイドとがん治療薬との併用医薬 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103108641B (zh) | 2016-01-13 |
| US9387221B2 (en) | 2016-07-12 |
| US20130310442A1 (en) | 2013-11-21 |
| JP2013540725A (ja) | 2013-11-07 |
| EP2613789B1 (en) | 2018-04-18 |
| BR112013005664B8 (pt) | 2023-04-25 |
| US20160095875A1 (en) | 2016-04-07 |
| SG188220A1 (en) | 2013-04-30 |
| CA2810950A1 (en) | 2012-03-15 |
| RU2679495C2 (ru) | 2019-02-11 |
| RU2013115739A (ru) | 2014-10-20 |
| ES2678497T3 (es) | 2018-08-13 |
| HK1184699A1 (zh) | 2014-01-30 |
| AU2011300818A1 (en) | 2013-03-07 |
| CN103108641A (zh) | 2013-05-15 |
| MX357770B (es) | 2018-07-24 |
| CA2810950C (en) | 2023-02-14 |
| BR112013005664B1 (pt) | 2021-11-03 |
| US20160355821A1 (en) | 2016-12-08 |
| BR112013005664A2 (pt) | 2020-08-04 |
| JP6243736B2 (ja) | 2017-12-06 |
| EP2613789A1 (en) | 2013-07-17 |
| DK2613789T3 (en) | 2018-07-23 |
| MX2013002722A (es) | 2013-06-28 |
| AU2011300818B2 (en) | 2015-11-12 |
| KR101937939B1 (ko) | 2019-01-11 |
| KR20130114094A (ko) | 2013-10-16 |
| US10093934B2 (en) | 2018-10-09 |
| SG10201506725QA (en) | 2015-10-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9988636B2 (en) | SDF-1 binding nucleic acids and the use thereof | |
| KR101561652B1 (ko) | Sdf-1 결합형 c형 핵산분자 | |
| US10093934B2 (en) | SDF-1 binding nucleic acids and the use thereof in cancer treatment | |
| US20230146246A1 (en) | Method of Modulating the Number and the Distribution of Tumor-Infiltrating Leukocytes in Tumors | |
| HK1184699B (en) | Sdf-1 binding nucleic acids and the use thereof in cancer treatment | |
| HK1144956B (en) | Sdf-1 binding nucleic acids and the use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201180043233.4 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11757776 Country of ref document: EP Kind code of ref document: A1 |
|
| DPE2 | Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101) | ||
| ENP | Entry into the national phase |
Ref document number: 2011300818 Country of ref document: AU Date of ref document: 20110909 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2810950 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2013/002722 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2013527497 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2011757776 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 20137006584 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2013115739 Country of ref document: RU Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13821669 Country of ref document: US |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112013005664 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112013005664 Country of ref document: BR Kind code of ref document: A2 Effective date: 20130308 |