WO2011118967A2 - 간세포암종의 예후 진단용 단일 염기 다형성 - Google Patents

간세포암종의 예후 진단용 단일 염기 다형성 Download PDF

Info

Publication number
WO2011118967A2
WO2011118967A2 PCT/KR2011/001964 KR2011001964W WO2011118967A2 WO 2011118967 A2 WO2011118967 A2 WO 2011118967A2 KR 2011001964 W KR2011001964 W KR 2011001964W WO 2011118967 A2 WO2011118967 A2 WO 2011118967A2
Authority
WO
WIPO (PCT)
Prior art keywords
primer
seq
region
gene
hepatocellular carcinoma
Prior art date
Application number
PCT/KR2011/001964
Other languages
English (en)
French (fr)
Other versions
WO2011118967A3 (ko
Inventor
정영화
박능화
유은실
이영주
김정아
이단비
이세환
이종은
Original Assignee
울산대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 울산대학교 산학협력단 filed Critical 울산대학교 산학협력단
Priority to US13/636,782 priority Critical patent/US20130017975A1/en
Priority to CN201180025466.1A priority patent/CN102906277B/zh
Priority claimed from KR1020110025174A external-priority patent/KR101359851B1/ko
Publication of WO2011118967A2 publication Critical patent/WO2011118967A2/ko
Publication of WO2011118967A3 publication Critical patent/WO2011118967A3/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention provides a single base polymorphism (SNP) for prognostic diagnosis of hepatocellular carcinoma that shows a significant correlation with the overexpression of MTA1, a prognostic factor useful for predicting recurrence and poor survival after surgery for hepatocellular carcinoma, and microarray for prognostic diagnosis of hepatocellular carcinoma using the same. Or it relates to a diagnostic kit and a screening method for drugs for improving the prognosis of hepatocellular carcinoma.
  • SNP single base polymorphism
  • Hepatocellular carcinoma is a very common and important cancer that occupies the third place among all malignant tumors in Korean cancer occurrence and death. Hepatocellular carcinoma is the most representative hypervascular tumor among malignant tumors.
  • MTA1 metastatic tumor antigen 1
  • HIF1 hypoxia inducible factor 1
  • VEGF vascular endothelial growth factor
  • MTA1 is thought to play a very important role in the development, progression, hepatic recurrence and distant metastasis of HCC, and is a useful prognostic factor for predicting the recurrence and survival of HCC patients after surgery (Ryu SH). , et al., 2007).
  • SNPs single nucleotide polymorphisms
  • the present inventors have expressed the expression of MTA1, an angiogenesis related protein, and the expression of MTA1 and VEGF, which are thought to be related to the prognosis such as recurrence or survival as well as tumorigenesis of HCC.
  • the purpose of this study was to examine the correlation between SNPs of important angiogenic genes such as IGF2, HIF-1 ⁇ , and FGF2, and to analyze the effects of SNPs of angiogenic genes on prognosis such as recurrence and survival after hepatocellular carcinoma.
  • the present invention was completed.
  • an object of the present invention is to provide a single base polymorphism (SNP) that has a significant correlation with the overexpression of MTA1, a prognostic factor useful for predicting recurrence and poor survival after hepatocellular carcinoma surgery.
  • SNP single base polymorphism
  • Another object of the present invention is to provide a microarray for prognostic diagnosis of hepatocellular carcinoma using the single nucleotide polymorphism (SNP).
  • SNP single nucleotide polymorphism
  • Another object of the present invention is to provide a kit for prognostic diagnosis of hepatocellular carcinoma.
  • Another object of the present invention is to provide a prognostic method for prognostic hepatocellular carcinoma using the single nucleotide polymorphism (SNP).
  • SNP single nucleotide polymorphism
  • Another object of the present invention is to provide a method for screening a drug for improving the prognosis of hepatocellular carcinoma using the single nucleotide polymorphism (SNP).
  • SNP single nucleotide polymorphism
  • the present invention is GA or AA genotype of IVS4-81 (DL1002505) [SEQ ID NO: 1] of the MTA1 gene; GG genotype of 24684C / G (rs11938826) [SEQ ID NO: 2] of the FGF2 gene, GG genotype of -989C / G (rs308395) [SEQ ID NO: 3], or GG genotype of 16578A / G (rs308428) [SEQ ID NO: 4]; And one or more polynucleotides selected from the group consisting of CC or CT genotypes of -13021C / T (rs3741208) [SEQ ID NO: 5] of the IGF2 gene or complementary nucleotides thereof for the prognostic diagnosis of hepatocellular carcinoma. (SNP).
  • the present invention also provides a microarray for prognostic diagnosis of hepatocellular carcinoma, characterized in that it comprises a polynucleotide of the single base polymorphism (SNP) for prognostic diagnosis of the hepatocellular carcinoma, a polypeptide encoded by the same or cDNA thereof.
  • SNP single base polymorphism
  • the present invention also provides a kit for prognostic diagnosis of hepatocellular carcinoma comprising the microarray.
  • an embodiment of the present invention provides a kit for prognostic diagnosis of hepatocellular carcinoma using a single-base extension (SBE) reaction to genotype the SNP.
  • SBE single-base extension
  • Kit for prognostic diagnosis of hepatocellular carcinoma using the single base extension reaction is GA or AA genotype in IVS4-81 (DL1002505) [SEQ ID NO: 1] of the MTA1 gene; And the GG genotype of 24684C / G (rs11938826) [SEQ ID NO: 2], the GG genotype of -989C / G (rs308395) [SEQ ID NO: 3], or the GG genotype of 16578A / G (rs308428) [SEQ ID NO: 4]; It is designed to check whether or not.
  • the forward primer for amplifying the 16578A / G (rs308428) region of the FGF2 gene in the prognostic diagnostic kit for hepatocellular carcinoma includes a primer of SEQ ID NO: 12; Reverse primers for amplifying the 16578A / G (rs308428) region of the FGF2 gene may include a primer of SEQ ID NO: 13; Primer for genotyping 16578A / G (rs308428) region of the FGF2 gene is a primer of SEQ ID NO: 33;
  • the forward primer for amplifying the IVS4-81 (DL1002505) region of the MTA1 gene may include a primer of SEQ ID NO: 21; Reverse primers for amplifying the IVS4-81 (DL1002505) site of the MTA1 gene may include a primer of SEQ ID NO: 22;
  • the primer for genotyping of the IVS4-81 (DL1002505) region of the MTA1 gene may include a primer of SEQ ID NO: 23
  • the present invention comprises the steps of obtaining a nucleic acid sample from the sample; And GA or AA genotypes in IVS4-81 (DL1002505) of the MTA1 gene; GG genotype of 24684C / G (rs11938826) of the FGF2 gene, GG genotype of -989C / G (rs308395), or GG genotype of 16578A / G (rs308428); And determining the nucleotide sequence of any one or more polymorphic sites of a polynucleotide selected from the group consisting of CC or CT genotypes of -13021C / T (rs3741208) of the IGF2 gene or complementary nucleotides thereof. It provides a prognosis diagnostic method.
  • Determining the nucleotide sequence of the polymorphic site may comprise hybridizing the nucleic acid sample to a microarray to which the polynucleotide or its complementary nucleotide is immobilized and detecting the obtained hybridization result.
  • the present invention comprises the steps of contacting the candidate with a polypeptide encoded by the polynucleotide of the single base polymorphism (SNP) for prognostic diagnosis of hepatocellular carcinoma or a complementary nucleotide thereof; And it provides a method for screening a drug for improving the prognosis of hepatocellular carcinoma characterized in that it comprises the step of determining whether the candidate exhibits the activity to enhance or inhibit the function of the polypeptide.
  • SNP single base polymorphism
  • a single base polymorphism having a significant correlation with the overexpression of MTA1, a prognostic factor useful for predicting recurrence and poor survival after surgery for hepatocellular carcinoma, is used for prognostic diagnosis of hepatocellular carcinoma using the SNP.
  • Microarrays or diagnostic kits can be developed and screening drugs for improving the prognosis of hepatocellular carcinoma can improve postoperative poor prognosis of hepatocellular carcinoma.
  • Figure 1 shows the cumulative recurrence rate of hepatocellular carcinoma according to MTA1 expression level
  • Figure 2 shows the cumulative survival rate of hepatocellular carcinoma according to MTA1 expression level
  • 3 to 5 show genotyping results for confirming prognostic single base polymorphism of hepatocellular carcinoma using a prognostic kit for prognostic diagnosis of hepatocellular carcinoma according to an embodiment of the present invention.
  • the present invention is GA or AA genotype of IVS4-81 (DL1002505) [SEQ ID NO: 1] of the MTA1 gene; GG genotype of 24684C / G (rs11938826) [SEQ ID NO: 2] of the FGF2 gene, GG genotype of -989C / G (rs308395) [SEQ ID NO: 3], or GG genotype of 16578A / G (rs308428) [SEQ ID NO: 4]; And one or more polynucleotides selected from the group consisting of CC or CT genotypes of -13021C / T (rs3741208) [SEQ ID NO: 5] of the IGF2 gene or complementary nucleotides thereof for the prognostic diagnosis of hepatocellular carcinoma. (SNP).
  • SNP single nucleotide polymorphism
  • MTA1 metastatic tumor antigen 1
  • the prognosis of the hepatocellular carcinoma is related to the prognosis in the patient undergoing radical hepatotomy with hepatocellular carcinoma, and may be related to any one indicator selected from the tumor formation rate, recurrence risk, or survival rate of hepatocellular carcinoma.
  • the present invention also provides a microarray for prognostic diagnosis of hepatocellular carcinoma, characterized in that it comprises a polynucleotide of the single base polymorphism (SNP) for prognostic diagnosis of the hepatocellular carcinoma, a polypeptide encoded by the same or cDNA thereof.
  • SNP single base polymorphism
  • the microarray for prognostic diagnosis of hepatocellular carcinoma can be prepared by conventional methods known to those skilled in the art.
  • the polynucleotides constituting the prognostic microarray for hepatocellular carcinoma include amino-silane, poly-L-lysine and
  • the active group selected from the group consisting of aldehydes can be fixed to the coated substrate, and the substrate can be selected from the group consisting of silicon wafers, glass, quartz, metals and plastics.
  • a method of immobilizing the polynucleotide on a substrate a micropipetting method using a piezoelectric method, a method using a pin type spotter, or the like can be used.
  • the present invention also provides a kit for prognostic diagnosis of hepatocellular carcinoma comprising the microarray.
  • the diagnostic kit according to the present invention may further include a primer set used to separate and amplify DNA containing the SNP from the subject in addition to the microarray of the present invention.
  • a primer set used to separate and amplify DNA containing the SNP from the subject in addition to the microarray of the present invention.
  • an embodiment of the present invention provides a kit for prognostic diagnosis of hepatocellular carcinoma using a single-base extension (SBE) reaction to genotype the SNP.
  • SBE single-base extension
  • amplification (forward and reverse) and extension (genotyping) primers should be designed for single-base extension (SBE).
  • Kit for prognostic diagnosis of hepatocellular carcinoma using the single base extension reaction may be a kit for genotyping of the SNaPshot method.
  • Kit for prognostic diagnosis of hepatocellular carcinoma using the single base extension reaction is GA or AA genotype in IVS4-81 (DL1002505) [SEQ ID NO: 1] of the MTA1 gene; And the GG genotype of 24684C / G (rs11938826) [SEQ ID NO: 2], the GG genotype of -989C / G (rs308395) [SEQ ID NO: 3], or the GG genotype of 16578A / G (rs308428) [SEQ ID NO: 4]; It is designed to check whether or not.
  • the forward primer for amplifying the 16578A / G (rs308428) region of the FGF2 gene in the prognostic diagnostic kit for hepatocellular carcinoma includes a primer of SEQ ID NO: 12; Reverse primers for amplifying the 16578A / G (rs308428) region of the FGF2 gene may include a primer of SEQ ID NO: 13; Primer for genotyping 16578A / G (rs308428) region of the FGF2 gene is a primer of SEQ ID NO: 33;
  • the forward primer for amplifying the IVS4-81 (DL1002505) region of the MTA1 gene may include a primer of SEQ ID NO: 21; Reverse primers for amplifying the IVS4-81 (DL1002505) site of the MTA1 gene may include a primer of SEQ ID NO: 22;
  • the primer for genotyping of the IVS4-81 (DL1002505) region of the MTA1 gene may include a primer of SEQ ID NO: 23
  • the present invention comprises the steps of obtaining a nucleic acid sample from the sample; And GA or AA genotypes in IVS4-81 (DL1002505) of the MTA1 gene; GG genotype of 24684C / G (rs11938826) of the FGF2 gene, GG genotype of -989C / G (rs308395), or GG genotype of 16578A / G (rs308428); And determining the nucleotide sequence of any one or more polymorphic sites of a polynucleotide selected from the group consisting of CC or CT genotypes of -13021C / T (rs3741208) of the IGF2 gene or complementary nucleotides thereof. It provides a prognosis diagnostic method.
  • the nucleic acid may comprise cDNA synthesized from DNA, mRNA or mRNA.
  • Determining the nucleotide sequence of the polymorphic site may comprise hybridizing the nucleic acid sample to a microarray to which the polynucleotide or its complementary nucleotide is immobilized and detecting the obtained hybridization result.
  • DNA is isolated from tissues, body fluids, or cells of a subject, and then amplified by PCR, followed by SNP analysis.
  • SNP analysis can be performed by conventional methods known in the art.
  • the SNP analysis may be performed using a real-time PCR system, or may be performed through determination of the nucleotide sequence of the nucleic acid directly by the dideoxy method, or a probe including the sequence of the SNP site or a probe complementary thereto.
  • the present invention comprises the steps of contacting the candidate with a polypeptide encoded by the polynucleotide of the single base polymorphism (SNP) for prognostic diagnosis of hepatocellular carcinoma or a complementary nucleotide thereof; And it provides a method for screening a drug for improving the prognosis of hepatocellular carcinoma characterized in that it comprises the step of determining whether the candidate exhibits the activity to enhance or inhibit the function of the polypeptide.
  • SNP single base polymorphism
  • the reaction between the polypeptide and the candidate may be used in the conventional methods used to confirm the reaction between the protein-protein and the protein-compound.
  • a method for measuring activity after reacting the protein with a candidate substance a yeast two-hybrid method, a search for phage-displayed peptide clones that bind to the protein, and natural products
  • high throughput screening using a chemical library, drug hit HTS, cell-based screening, or screening using a DNA array can be used.
  • candidates may be individual nucleic acids, proteins, other extracts or natural products, compounds or the like that are suspected of having a potential prognostic agent for hepatocellular carcinoma according to a conventional selection method or randomly selected. have.
  • Target SNPs ID is as follows.
  • haplotype frequency is at least 5% of the SNPs using PHASE software v2.1 analyzed the incidence of haplotypes, and Haploview program v3.2 (http: //www.broad Linkage disequilibrium was analyzed using .mit.edu / mpg / haploview / index.php ).
  • a primer set capable of amplifying a region including the SNP of Example 1 and a TaqMan probe including the SNP region were prepared using primer express software. TaqMan probes were prepared for each wild type and mutant allele according to the sequence of the SNP.
  • One side of the TaqMan probe tagged the fluorescent dye and the other side produced a probe by tagging a quencher capable of suppressing the color of the fluorescent dye.
  • the fluorescent dyes of different colors were tagged with the wild type and the mutant alleles.
  • the results of SNP marker analysis were judged as final results by verifying the agreement of two or more independent callers.
  • the SNP marker results of the individuals are shown as major allele homozygote, heterozygote, and minor allele homozygote according to single nucleotide polymorphic alleles. Results for all subjects were expressed by the ratio of major alleles to minor alleles and the frequency of three genotypes, and the Hardy-Weinberg equilibrium was verified.
  • Liver cancer recurrence and survival were determined using medical records on the last day of follow-up. Patients who had not followed up for more than 3 months were evaluated by visiting the patient's place of residence.
  • MTA1 immunochemical staining for hepatocellular carcinoma tissue was performed using the avidin biotin peroxidase complex method, and the color reaction was confirmed by 3, 3'-diaminobenzidine and LSAB kit (DAKO, Carpentaria, CA, USA).
  • Paraffin-embedded tissue microsections taken from hepatocellular carcinoma and surrounding non-tumor sites were treated with xylene to remove paraffin and rehydrated with progressive concentrations of alcohol.
  • Antigen retrieval was performed for 10 minutes using citric acid buffer (pH 6.0) in a steam oven to amplify the reaction upon immunochemical staining.
  • Primary antibodies against MTA1 (Santa Cruz Biochemistry, Santa Cruz, CA, USA) were diluted 1: 200, and stained using a biotinylated secondary antibody (avitinylated antibody) and avidin biotin complex reagent, Control staining was performed with Harris hematoxylin.
  • Tissue sections were immersed in Tris buffered saline containing 2% goat serum, and 1% bovine serum albumin was used instead of the primary antibody, which was then used as a negative control. In each immunochemical staining slide, the site of the strongest staining reaction and the best representation of the overall tissue findings were selected.
  • the staining intensity of MTA1 is determined by the percentage of cells that show positive immunostaining in all cells, 1) none of all cells are stained at all, and 2) some cells show positive staining, but the percentage is 50%. 2+ (++) was defined as a case where more than 50% of the cells of 1 + (+) and 3) showed positive results in immunochemical staining.
  • Two or more observers judge the staining intensity without knowing each other's results, and when the judgments between the observers differ from each other, the score is adjusted through a trial.
  • the one-, three- and five-year cumulative relapse rates of MTA1-positive hepatocellular carcinoma were much higher than those of MTA1-negative hepatocellular carcinoma.
  • the cumulative recurrence rates of patients with high MTA1 expression levels (++) at 1 and 3 years were 41% and 71% respectively, patients with positive MTA1 expression levels (39%, 54%) and patients with negative MTA1 expression (25). %, 39%).
  • the one and three year cumulative survival rates (54%, 39%) of patients with MTA1-positive hepatocellular carcinoma were significantly higher than those of patients with MTA1-negative hepatocellular carcinoma (89%, 72%). It was short.
  • Primer sequences for amplification (forward and reverse) and extension (zinotyping) for genotyping of single base polymorphisms rs308428, DL1002505, rs308395, and rs11938826 showing significant association with MTA1 positive are shown in Table 3 below.
  • SEQ ID NO: 35 5′-AACACATAWTGTTGAGTGTGTGG-3 ′
  • a primer comprising SEQ ID NO: 40 (5′-AACACATAATGTTGAGTGTGTGG-3 ′) and SEQ ID NO 41 (5′-AACACATATTGTTGAGTGTGTGG-3 ′) comprising about 1: 1 It can be a set.
  • Sites containing single nucleotide polymorphism were first amplified by multiplex PCR.
  • the composition and PCR reaction conditions of the PCR reaction solution used in the PCR reaction are shown in Tables 4 and 5, respectively. More specifically, DNA was isolated from the sample sample and used as template DNA for the PCR reaction.
  • the PCR reaction was predenatured at 95 ° C. for about 15 minutes (1 cycle), denaturation at about 94 ° C. for about 30 seconds, annealing at about 55 ° C. for about 1 minute and 30 seconds, and at about 72 ° C.
  • the conditions for elongation of about 1 minute 30 seconds were final elongation at 35 cycles of 1 cycle at about 72 ° C. for about 10 minutes.
  • the reaction was finally held at about 4 ° C.
  • forward and reverse primers for each single nucleotide polymorphism of Table 3 were used as primers for the PCR reaction.
  • a PCR reaction was performed.
  • the composition and reaction conditions of the SNaPshot reactant are shown in Tables 8 and 9, respectively.
  • the PCR reaction was carried out for 25 cycles of 1 cycle of denaturation at about 96 ° C., annealing at about 50 ° C., annealing at about 50 ° C., and elongation at about 60 ° C. for about 30 seconds.
  • SAP was added to the SNaPshot reaction product.
  • the composition and reaction conditions of the SAP treated reactants are shown in Tables 10 and 11, respectively.
  • ABI 3730XL which is an automatic sequencing device
  • ABI 3730XL which is an automatic sequencing device
  • only a labeled portion is detected and appears as a peak as shown in FIGS. 3 to 5.
  • the fluorescence color represented by the peak was analyzed (using ddNTP labeled with a fluorescent dye of different color for each base) to confirm the sequence of the single nucleotide polymorphism site.
  • a single base polymorphism having a significant correlation with the overexpression of MTA1, a prognostic factor useful for predicting recurrence and poor survival after surgery for hepatocellular carcinoma, is used for prognostic diagnosis of hepatocellular carcinoma using the SNP.
  • Microarrays or diagnostic kits can be developed and screening drugs for improving the prognosis of hepatocellular carcinoma can improve postoperative poor prognosis of hepatocellular carcinoma.
  • SEQ ID NO: 1 shows the sequence of IVS4-81 (DL1002505) of the human MTA1 gene
  • SEQ ID NO: 2 shows the sequence of 24684C / G (rs11938826) of the human FGF2 gene
  • SEQ ID NO: 3 shows the sequence of -989C / G (rs308395) of the human FGF2 gene
  • SEQ ID NO: 4 shows the sequence of 16578A / G (rs308428) of the human FGF2 gene
  • SEQ ID NO: 5 shows the sequence of -13021C / T (rs3741208) of the human IGF2 gene
  • SEQ ID NO: 6 shows the sequence of a forward primer of rs1048201
  • SEQ ID NO: 7 shows the sequence of a reverse primer of rs1048201
  • SEQ ID NO: 8 shows the sequence of the genotyping primer of rs1048201
  • SEQ ID NO: 9 shows the sequence of the forward primer of rs6534367
  • SEQ ID NO: 10 shows the sequence of a reverse primer of rs6534367
  • SEQ ID NO: 11 shows the sequence of a genotyping primer of rs6534367
  • SEQ ID NO: 12 shows the sequence of the forward primer of rs308428
  • SEQ ID NO: 13 shows the sequence of a reverse primer of rs308428
  • SEQ ID NO: 14 shows the sequence of a genotyping primer of rs308428
  • SEQ ID NO: 15 shows the sequence of a forward primer of rs3741208
  • SEQ ID NO: 16 shows the sequence of a reverse primer of rs3741208
  • SEQ ID NO: 17 shows a sequence of a genotyping primer of rs3741208
  • SEQ ID NO: 18 shows the sequence of a forward primer of rs2585
  • SEQ ID NO: 19 shows the sequence of a reverse primer of rs2585
  • SEQ ID NO: 20 shows the sequence of a genotyping primer of rs2585
  • SEQ ID NO: 21 shows the sequence of a forward primer of DL1002505,
  • SEQ ID NO: 22 shows the sequence of a reverse primer of DL1002505,
  • SEQ ID NO: 23 shows the sequence of a genotyping primer of DL1002505,
  • SEQ ID NO: 24 shows the sequence of a forward primer of rs308395
  • SEQ ID NO: 25 shows the sequence of a reverse primer of rs308395
  • SEQ ID NO: 26 shows the sequence of a genotyping primer of rs308395
  • SEQ ID NO: 27 shows the sequence of a forward primer of rs11938826,
  • SEQ ID NO: 28 shows the sequence of a reverse primer of rs11938826,
  • SEQ ID NO: 29 shows the sequence of a genotyping primer of rs11938826,
  • SEQ ID NO: 30 shows the sequence of a forward primer of rs3213221
  • SEQ ID NO: 31 shows the sequence of a reverse primer of rs3213221
  • SEQ ID NO: 32 shows the sequence of a genotyping primer of rs3213221
  • SEQ ID NO: 33 shows the sequence of a genotyping primer of rs308428
  • SEQ ID NO: 34 shows the sequence of a forward primer of rs308395
  • SEQ ID NO: 35 shows the sequence of a reverse primer of rs308395
  • SEQ ID NO: 36 shows the sequence of a genotyping primer of rs308395
  • SEQ ID NO: 37 shows the sequence of a forward primer of rs11938826,
  • SEQ ID NO: 38 shows the sequence of a reverse primer of rs11938826,
  • SEQ ID NO: 39 shows the sequence of a genotyping primer of rs11938826,
  • SEQ ID NO: 40 shows the sequence of a reverse primer of rs308395
  • SEQ ID NO: 41 shows the sequence of a reverse primer of rs308395.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 간세포암종의 예후 진단용 단일 염기 다형성(SNP)에 관한 것으로, 상기 SNP는 간세포암종 수술후 재발 및 불량한 생존을 예측하는 데에 유용한 예후인자인 MTA1의 과발현과 유의성있는 상관관계를 나타내므로, 이러한 SNP를 이용하여 간세포암종의 예후 진단용 마이크로어레이 또는 진단키트를 개발할 수 있으며, 간세포암종의 예후 개선용 약물을 스크리닝함으로써 간세포암종의 수술후 나쁜 예후를 개선할 수 있다.

Description

간세포암종의 예후 진단용 단일 염기 다형성
본 발명은 간세포암종 수술후 재발 및 불량한 생존을 예측하는 데에 유용한 예후인자인 MTA1의 과발현과 유의성있는 상관관계를 나타내는 간세포암종의 예후 진단용 단일 염기 다형성(SNP), 이를 이용한 간세포암종의 예후 진단용 마이크로어레이 또는 진단키트 및 간세포암종의 예후 개선용 약물의 스크리닝 방법에 관한 것이다.
간세포암종(hepatocellular carcinoma; HCC)은 우리나라 암 발생과 사망에서 전체 악성 종양 중 3위를 차지할 만큼 매우 흔하고 중요한 암이다. 간세포암종은 악성 종양 중에서 가장 대표적인 과혈관성(hypervascular) 종양이다.
간세포암종에 관한 가장 바람직한 치료법은 수술이지만, 종양의 절개할 수 없는 크기 및 수, 나쁜 간기능, 다양한 간내 또는 원격 전이 등으로 인하여 간세포암종 환자 중 10 내지 20% 이하의 환자들만이 수술을 할 수 있다. 심지어 수술이 가능한 간세포암종 환자에서도 수술 후 잦은 재발이 오랜 기간 생존에 주요한 제한요소로 작용하고 있다.
간세포암종의 발생과 빠른 진행에는 여러 가지 기전이 관여하는데, 그 중에서도 저산소증에 의한 혈관 신생(angiogenesis)의 촉진이 매우 중요한 역할을 한다. 또한, 간 내에 저산소증이 발생할 경우, 전이성 종양 항원 1(metastatic tumor antigen 1; MTA1)은 저산소증 유도 인자(hypoxia inducible factor 1; HIF1)를 구조적으로 안정화시킴으로써 혈관 내피 성장 인자(vascular endothelial growth factor, VEGF)의 발현을 증가시켜 악성 종양의 혈관 신생 과정에 기여하게 된다(Moon EJ, et al., 2004; Moon EJ, et al., 2006).
본 발명자들은 이러한 MTA1의 발현과 간세포암종의 임상적 특징과의 상관관계를 알아보고자 근치적 수술 절제가 시행되었던 총 506명의 환자를 대상으로 시행하였던 연구에서 MTA1은 종양의 크기, 육안적 형태, 조직학적 분화도 및 주위 조직과 미세 혈관 침범과 밀접한 관련이 있었다. 아울러 MTA1이 강하게 발현될수록 수술 후 높은 재발율과 낮은 생존율을 나타내었다.
결론적으로, MTA1은 간세포암종의 발생, 진행, 간내 재발 및 원격 전이 과정에 매우 중요한 역할을 할 것으로 생각되며, 아울러 수술 후 간세포암종 환자의 재발과 생존을 예측할 수 있는 유용한 예후 인자임을 밝혔다(Ryu SH, et al., 2007).
한편, B형 간염 바이러스 감염 후 5-10 % 정도가 만성 B형 간염으로 이행하게 되고 이들 중 일부는 간경변이나 드물게 간세포암종이 발생하게 된다. 이렇듯 B형 간염 바이러스 감염 후 나타나는 다양한 임상경과는 바이러스 자체의 차이 뿐만 아니라 각 개인이 가지고 있는 유전적 소양의 차이에 따른 것으로 생각되고 있다.
유전적 소양이란 개인마다 유전자에 미세한 차이가 있다는 것을 말하는데, 최근 인간 유전체 연구를 통해 이 차이가 사람마다 어느 정도인지 보고되고 있다. 유전자의 기능에 변화를 주는 유전적 변이들 중에 단일 염기 다형성(single nucleotide polymorphisms; SNPs)이 있는데, 인간유전체에 존재하는 SNPs는 약 11백만 개의 SNPs 중에서 710,000개의 다형성이 유전자 내에 존재한다(NCBI, dbSNP).
이러한 염기 배열상의 작은 변화가 실제로 각종 질병에 대한 감수성 등에 영향을 주는지에 대한 연구가 활발하게 이루어지고 있으며, 이러한 특성을 결정하는 유전자를 발견하려는 노력을 하고 있다(Ludwig JA, and Weinstein JN, 2005; Suh Y, and Vijg J, 2005; Chanock S, 2001).
상기 종래기술의 문제점을 해결하기 위하여, 본 발명자는 간세포암종의 종양형성 뿐만 아니라, 재발이나 생존율 등의 예후와 관련이 있을 것으로 생각되는 신생혈관생성 관련 단백인 MTA1의 간암 조직 내 발현과 MTA1, VEGF, IGF2, HIF-1α, FGF2 등과 같은 중요 혈관 형성 유전자의 SNPs 사이의 상호관계를 규명하고자 하였고, 또한 간세포암종 환자들의 수술 후 재발이나 생존율과 같은 예후에 혈관 형성 유전자의 SNPs가 어떠한 영향을 미치는지 분석함으로써 본 발명을 완성하였다.
따라서, 본 발명의 목적은 간세포암종 수술후 재발 및 불량한 생존을 예측하는 데에 유용한 예후인자인 MTA1의 과발현과 유의성있는 상관관계를 나타내는 단일 염기 다형성(SNP)을 제공하는 데에 있다.
또한, 본 발명의 다른 목적은 상기 단일 염기 다형성(SNP)을 이용한 간세포암종의 예후 진단용 마이크로어레이를 제공하는 데에 있다.
또한, 본 발명의 또다른 목적은 간세포암종의 예후 진단용 키트를 제공하는 데에 있다.
또한, 본 발명의 또다른 목적은 상기 단일 염기 다형성(SNP)을 이용한 간세포암종의 예후 진단방법을 제공하는 데에 있다.
또한, 본 발명의 또다른 목적은 상기 단일 염기 다형성(SNP)을 이용한 간세포암종의 예후 개선용 약물의 스크리닝 방법을 제공하는 데에 있다.
상기 목적을 달성하기 위하여, 본 발명은 MTA1 유전자의 IVS4-81(DL1002505)[서열번호 1]에서 GA 또는 AA 유전자형; FGF2 유전자의 24684C/G(rs11938826)[서열번호 2]의 GG 유전자형, -989C/G(rs308395)[서열번호 3]의 GG 유전자형, 또는 16578A/G(rs308428)[서열번호 4]의 GG 유전자형; 및 IGF2 유전자의 -13021C/T(rs3741208)[서열번호 5]의 CC 또는 CT 유전자형으로 이루어진 군에서 하나 이상 선택된 폴리뉴클레오타이드 또는 그의 상보적 뉴클레오타이드를 포함하는 것을 특징으로 하는 간세포암종의 예후 진단용 단일 염기 다형성(SNP)을 제공한다.
또한, 본 발명은 상기 간세포암종의 예후 진단용 단일 염기 다형성(SNP)의 폴리뉴클레오타이드, 그에 의해 인코딩되는 폴리펩티드 또는 그의 cDNA를 포함하는 것을 특징으로 하는 간세포암종의 예후 진단용 마이크로어레이를 제공한다.
또한, 본 발명은 상기 마이크로어레이를 포함하는 간세포암종의 예후 진단용 키트를 제공한다.
또한, 본 발명의 일 실시예는 SNP를 지노타이핑하기 위해서 단일 염기 연장(single-base extension, SBE) 반응을 이용하는 간세포암종의 예후 진단용 키트를 제공한다.
상기 단일 염기 연장 반응을 이용하는 간세포암종의 예후 진단용 키트는 MTA1 유전자의 IVS4-81(DL1002505)[서열번호 1]에서 GA 또는 AA 유전자형; 및 FGF2 유전자의 24684C/G(rs11938826)[서열번호 2]의 GG 유전자형, -989C/G(rs308395)[서열번호 3]의 GG 유전자형, 또는 16578A/G(rs308428)[서열번호 4]의 GG 유전자형 여부를 확인할 수 있도록 설계된 것이다.
본 발명의 일 실시예는 FGF2 유전자의 16578A/G(rs308428) 부위 증폭용 정방향 프라이머; FGF2 유전자의 16578A/G(rs308428) 부위 증폭용 역방향 프라이머; FGF2 유전자의 16578A/G(rs308428) 부위 지노타이핑용 프라이머; MTA1 유전자의 IVS4-81(DL1002505) 부위 증폭용 정방향 프라이머; MTA1 유전자의 IVS4-81(DL1002505) 부위 증폭용 역방향 프라이머; MTA1 유전자의 IVS4-81(DL1002505) 부위 지노타이핑용 프라이머; FGF2 유전자의 -989C/G(rs308395) 부위 증폭용 정방향 프라이머; FGF2 유전자의 -989C/G(rs308395) 부위 증폭용 역방향 프라이머; FGF2 유전자의 -989C/G(rs308395) 부위 지노타이핑용 프라이머; FGF2 유전자의 24684C/G(rs11938826) 부위 증폭용 정방향 프라이머; FGF2 유전자의 24684C/G(rs11938826) 부위 증폭용 역방향 프라이머; 및 FGF2 유전자의 24684C/G(rs11938826) 부위 지노타이핑용 프라이머를 포함하고 단일 염기 연장 반응을 이용하는 간세포암종의 예후 진단용 키트를 제공한다.
일 실시예에 따르면, 상기 간세포암종의 예후 진단용 키트에서 상기 FGF2 유전자의 16578A/G(rs308428) 부위 증폭용 정방향 프라이머는 서열번호 12의 프라이머; 상기 FGF2 유전자의 16578A/G(rs308428) 부위 증폭용 역방향 프라이머는 서열번호 13의 프라이머; 상기 FGF2 유전자의 16578A/G(rs308428) 부위 지노타이핑용 프라이머는 서열번호 33의 프라이머; 상기 MTA1 유전자의 IVS4-81(DL1002505) 부위 증폭용 정방향 프라이머는 서열번호 21의 프라이머; 상기 MTA1 유전자의 IVS4-81(DL1002505) 부위 증폭용 역방향 프라이머는 서열번호 22의 프라이머; 상기 MTA1 유전자의 IVS4-81(DL1002505) 부위 지노타이핑용 프라이머는 서열번호 23의 프라이머; 상기 FGF2 유전자의 -989C/G(rs308395) 부위 증폭용 정방향 프라이머는 서열번호 34의 프라이머; 상기 FGF2 유전자의 -989C/G(rs308395) 부위 증폭용 역방향 프라이머는 서열번호 35의 프라이머; 상기 FGF2 유전자의 -989C/G(rs308395) 부위 지노타이핑용 프라이머는 서열번호 36의 프라이머; 상기 FGF2 유전자의 24684C/G(rs11938826) 부위 증폭용 정방향 프라이머는 서열번호 37의 프라이머; 상기 FGF2 유전자의 24684C/G(rs11938826) 부위 증폭용 역방향 프라이머는 서열번호 38의 프라이머; 및 상기 FGF2 유전자의 24684C/G(rs11938826) 부위 지노타이핑용 프라이머는 서열번호 38의 프라이머일 수 있다.
또한, 본 발명은 검체로부터 핵산 시료를 얻는 단계; 및 MTA1 유전자의 IVS4-81(DL1002505)에서 GA 또는 AA 유전자형; FGF2 유전자의 24684C/G(rs11938826)의 GG 유전자형, -989C/G(rs308395)의 GG 유전자형, 또는 16578A/G(rs308428)의 GG 유전자형; 및 IGF2 유전자의 -13021C/T(rs3741208)의 CC 또는 CT 유전자형으로 이루어진 군에서 선택된 폴리뉴클레오타이드 또는 그의 상보적 뉴클레오타이드 중 어느 하나 이상의 다형성 부위의 뉴클레오타이드 서열을 결정하는 단계를 포함하는 것을 특징으로 하는 간세포암종의 예후 진단방법을 제공한다.
상기 다형성 부위의 뉴클레오티드 서열을 결정하는 단계는 상기 폴리뉴클레오티드 또는 그의 상보적 뉴클레오티드가 고정된 마이크로어레이에 상기 핵산 시료를 혼성화하는 단계 및 얻어진 혼성화 결과를 검출하는 단계를 포함할 수 있다.
또한, 본 발명은 상기 간세포암종의 예후 진단용 단일 염기 다형성(SNP)의 폴리뉴클레오타이드 또는 그의 상보적 뉴클레오타이드에 의해 인코딩되는 폴리펩티드를 후보물질과 접촉시키는 단계; 및 후보물질이 상기 폴리펩티드의 기능을 증진시키는 활성 또는 억제하는 활성을 나타내는지를 결정하는 단계를 포함하는 것을 특징으로 하는 간세포암종의 예후 개선용 약물의 스크리닝 방법을 제공한다.
본 발명에 따르면, 간세포암종 수술후 재발 및 불량한 생존을 예측하는 데에 유용한 예후인자인 MTA1의 과발현과 유의성있는 상관관계를 나타내는 단일 염기 다형성(SNP)을 제공함으로써 이러한 SNP를 이용하여 간세포암종의 예후 진단용 마이크로어레이 또는 진단키트를 개발할 수 있으며, 간세포암종의 예후 개선용 약물을 스크리닝함으로써 간세포암종의 수술후 나쁜 예후를 개선할 수 있다.
도 1은 MTA1 발현 수준에 따른 간세포암종 누적 재발율을 나타낸 것이고,
도 2는 MTA1 발현 수준에 따른 간세포암종 누적 생존율을 나타낸 것이고,
도 3 내지 도 5는 본 발명의 일 실시예에 따른 간세포암종의 예후 진단용 키트를 이용한 간세포암종의 예후 진단용 단일 염기 다형성 여부를 확인하기 위한 지노타이핑 결과를 나타낸 것이다.
상기 목적을 달성하기 위하여, 본 발명은 MTA1 유전자의 IVS4-81(DL1002505)[서열번호 1]에서 GA 또는 AA 유전자형; FGF2 유전자의 24684C/G(rs11938826)[서열번호 2]의 GG 유전자형, -989C/G(rs308395)[서열번호 3]의 GG 유전자형, 또는 16578A/G(rs308428)[서열번호 4]의 GG 유전자형; 및 IGF2 유전자의 -13021C/T(rs3741208)[서열번호 5]의 CC 또는 CT 유전자형으로 이루어진 군에서 하나 이상 선택된 폴리뉴클레오타이드 또는 그의 상보적 뉴클레오타이드를 포함하는 것을 특징으로 하는 간세포암종의 예후 진단용 단일 염기 다형성(SNP)을 제공한다.
상기 단일 염기 다형성(SNP)은 전이성 종양 항원1(metastatic tumor antigen 1; MTA1)의 과발현과 유의성있는 상관관계를 나타낸다.
또한, 상기 간세포암종의 예후는 간세포암종으로 근치적 간절제술을 시행한 환자에서의 예후에 관한 것으로, 간세포암종의 종양 형성율, 재발 위험율 또는 생존율에서 선택된 어느 하나의 지표에 관한 것일 수 있다.
또한, 본 발명은 상기 간세포암종의 예후 진단용 단일 염기 다형성(SNP)의 폴리뉴클레오타이드, 그에 의해 인코딩되는 폴리펩티드 또는 그의 cDNA를 포함하는 것을 특징으로 하는 간세포암종의 예후 진단용 마이크로어레이를 제공한다.
상기 간세포암종의 예후 진단용 마이크로어레이는 당업자에게 공지된 통상적인 방법에 의해 제작될 수 있으며, 예를들어 상기 간세포암종의 예후 진단용 마이크로어레이를 구성하는 폴리뉴클레오타이드는 아미노-실란, 폴리-L-라이신 및 알데하이드로 이루어진 군에서 선택되는 활성기가 코팅된 기판에 고정될 수 있고, 상기 기판은 실리콘 웨이퍼, 유리, 석영, 금속 및 플라스틱으로 이루어진 군에서 선택될 수 있다. 상기 폴리뉴클레오티드를 기판에 고정화시키는 방법으로는 파이조 일렉트릭(piezoelectric) 방식을 이용한 마이크로피펫팅(micropipetting)법, 핀(pin) 형태의 스폿터(spotter)를 이용한 방법 등을 사용할 수 있다.
또한, 본 발명은 상기 마이크로어레이를 포함하는 간세포암종의 예후 진단용 키트를 제공한다.
본 발명에 따른 진단용 키트는 본 발명의 마이크로어레이 이외에 피검체로부터 해당 SNP를 포함하는 DNA를 분리 및 증폭하는데 사용되는 프라이머 세트를 추가로 포함할 수 있다. 상기 적절한 프라이머 세트는 본 발명의 서열을 참조하여 당업자는 용이하게 설계할 수 있을 것이다.
또한, 본 발명의 일 실시예는 SNP를 지노타이핑하기 위해서 단일 염기 연장(single-base extension, SBE) 반응을 이용하는 간세포암종의 예후 진단용 키트를 제공한다. 이 경우 증폭(정방향 및 역방향) 및 연장(지노타이핑) 프라이머들을 단일 염기 연장(single-base extension, SBE) 용으로 설계해야 한다.
상기 단일 염기 연장 반응을 이용하는 간세포암종의 예후 진단용 키트는 SNaPshot 방법의 유전형 분석용 키트일 수 있다.
상기 단일 염기 연장 반응을 이용하는 간세포암종의 예후 진단용 키트는 MTA1 유전자의 IVS4-81(DL1002505)[서열번호 1]에서 GA 또는 AA 유전자형; 및 FGF2 유전자의 24684C/G(rs11938826)[서열번호 2]의 GG 유전자형, -989C/G(rs308395)[서열번호 3]의 GG 유전자형, 또는 16578A/G(rs308428)[서열번호 4]의 GG 유전자형 여부를 확인할 수 있도록 설계된 것이다.
본 발명의 일 실시예는 FGF2 유전자의 16578A/G(rs308428) 부위 증폭용 정방향 프라이머; FGF2 유전자의 16578A/G(rs308428) 부위 증폭용 역방향 프라이머; FGF2 유전자의 16578A/G(rs308428) 부위 지노타이핑용 프라이머; MTA1 유전자의 IVS4-81(DL1002505) 부위 증폭용 정방향 프라이머; MTA1 유전자의 IVS4-81(DL1002505) 부위 증폭용 역방향 프라이머; MTA1 유전자의 IVS4-81(DL1002505) 부위 지노타이핑용 프라이머; FGF2 유전자의 -989C/G(rs308395) 부위 증폭용 정방향 프라이머; FGF2 유전자의 -989C/G(rs308395) 부위 증폭용 역방향 프라이머; FGF2 유전자의 -989C/G(rs308395) 부위 지노타이핑용 프라이머; FGF2 유전자의 24684C/G(rs11938826) 부위 증폭용 정방향 프라이머; FGF2 유전자의 24684C/G(rs11938826) 부위 증폭용 역방향 프라이머; 및 FGF2 유전자의 24684C/G(rs11938826) 부위 지노타이핑용 프라이머를 포함하고 단일 염기 연장 반응을 이용하는 간세포암종의 예후 진단용 키트를 제공한다.
일 실시예에 따르면, 상기 간세포암종의 예후 진단용 키트에서 상기 FGF2 유전자의 16578A/G(rs308428) 부위 증폭용 정방향 프라이머는 서열번호 12의 프라이머; 상기 FGF2 유전자의 16578A/G(rs308428) 부위 증폭용 역방향 프라이머는 서열번호 13의 프라이머; 상기 FGF2 유전자의 16578A/G(rs308428) 부위 지노타이핑용 프라이머는 서열번호 33의 프라이머; 상기 MTA1 유전자의 IVS4-81(DL1002505) 부위 증폭용 정방향 프라이머는 서열번호 21의 프라이머; 상기 MTA1 유전자의 IVS4-81(DL1002505) 부위 증폭용 역방향 프라이머는 서열번호 22의 프라이머; 상기 MTA1 유전자의 IVS4-81(DL1002505) 부위 지노타이핑용 프라이머는 서열번호 23의 프라이머; 상기 FGF2 유전자의 -989C/G(rs308395) 부위 증폭용 정방향 프라이머는 서열번호 34의 프라이머; 상기 FGF2 유전자의 -989C/G(rs308395) 부위 증폭용 역방향 프라이머는 서열번호 35의 프라이머; 상기 FGF2 유전자의 -989C/G(rs308395) 부위 지노타이핑용 프라이머는 서열번호 36의 프라이머; 상기 FGF2 유전자의 24684C/G(rs11938826) 부위 증폭용 정방향 프라이머는 서열번호 37의 프라이머; 상기 FGF2 유전자의 24684C/G(rs11938826) 부위 증폭용 역방향 프라이머는 서열번호 38의 프라이머; 및 상기 FGF2 유전자의 24684C/G(rs11938826) 부위 지노타이핑용 프라이머는 서열번호 38의 프라이머일 수 있다.
또한, 본 발명은 검체로부터 핵산 시료를 얻는 단계; 및 MTA1 유전자의 IVS4-81(DL1002505)에서 GA 또는 AA 유전자형; FGF2 유전자의 24684C/G(rs11938826)의 GG 유전자형, -989C/G(rs308395)의 GG 유전자형, 또는 16578A/G(rs308428)의 GG 유전자형; 및 IGF2 유전자의 -13021C/T(rs3741208)의 CC 또는 CT 유전자형으로 이루어진 군에서 선택된 폴리뉴클레오타이드 또는 그의 상보적 뉴클레오타이드 중 어느 하나 이상의 다형성 부위의 뉴클레오타이드 서열을 결정하는 단계를 포함하는 것을 특징으로 하는 간세포암종의 예후 진단방법을 제공한다. 상기 핵산은 DNA, mRNA 또는 mRNA로부터 합성되는 cDNA를 포함할 수 있다.
상기 다형성 부위의 뉴클레오티드 서열을 결정하는 단계는 상기 폴리뉴클레오티드 또는 그의 상보적 뉴클레오티드가 고정된 마이크로어레이에 상기 핵산 시료를 혼성화하는 단계 및 얻어진 혼성화 결과를 검출하는 단계를 포함할 수 있다.
예를 들어 대상자의 조직, 체액 또는 세포로부터 DNA를 분리해 낸 후 PCR을 통해 DNA를 증폭시킨 후 SNP 분석을 실시한다. SNP 분석은 당업계에 공지된 통상적인 방법에 의해 수행될 수 있다. 예를 들면, 실시간 PCR 시스템을 이용하여 SNP 분석을 수행하거나, 디데옥시법에 의해 직접적인 핵산의 뉴클레오타이드 서열의 결정을 통하여 수행할 수 있으며, 또는 SNP 부위의 서열을 포함하는 프로브 또는 그에 상보적인 프로브를 상기 DNA와 혼성화시키고 그로부터 얻어지는 혼성화 정도를 측정함으로써 다형성 부위의 뉴클레오티드 서열을 결정하거나, 대립형질 특이적 프로브 혼성화 방법(allele-specific probe ybridization), 대립형질 특이적 증폭 방법(allele-specific amplification), 서열분석법(sequencing), 5' 뉴클레아제 분해법(5' nuclease digestion), 분자 비콘 어세이법(molecular beacon assay), 올리고뉴클레오티드 결합 어세이법(oligonucleotide ligation assay), 크기 분석법(size analysis) 및 단일 가닥 배좌 다형성법(single-stranded conformation polymorphism) 등을 이용하여 수행될 수 있다.
또한, 본 발명은 상기 간세포암종의 예후 진단용 단일 염기 다형성(SNP)의 폴리뉴클레오타이드 또는 그의 상보적 뉴클레오타이드에 의해 인코딩되는 폴리펩티드를 후보물질과 접촉시키는 단계; 및 후보물질이 상기 폴리펩티드의 기능을 증진시키는 활성 또는 억제하는 활성을 나타내는지를 결정하는 단계를 포함하는 것을 특징으로 하는 간세포암종의 예후 개선용 약물의 스크리닝 방법을 제공한다.
본 발명의 스크리닝 방법에서 상기 폴리펩티드와 후보물질 간의 반응 확인은, 단백질-단백질, 단백질-화합물 간의 반응 여부를 확인하는데 사용되는 통상적인 방법들을 사용할 수 있다. 예를 들면, 상기 단백질과 후보물질을 반응시킨 후 활성을 측정하는 방법, 효모 이중 혼성법(yeast two-hybrid), 상기 단백질에 결합하는 파지 디스플레이 펩티드 클론(phage-displayed peptide clone)의 검색, 천연물 및 화학물질 라이브러리(chemical library) 등을 이용한 HTS(high throughput screening), 드럭 히트 HTS(drug hit HTS), 세포 기반 스크리닝(cell-based screening), 또는 DNA 어레이(DNA array)를 이용하는 스크리닝법 등을 사용할 수 있다.
본 발명의 스크리닝 방법에서, 후보물질은 통상적인 선정방식에 따라 간세포암종의 예후 진단제로서의 가능성을 지닌 것으로 추정되거나 또는 무작위적으로 선정된 개별적인 핵산, 단백질, 기타 추출물 또는 천연물, 화합물 등이 될 수 있다.
이하, 하기 실시 예를 통해 본 발명을 보다 상세하게 설명한다. 다만, 이러한 실시예에 의해 본 발명이 한정되는 것은 아니다.
<실시예 1> SNP 선별
혈관신생과 관련 유전자, 즉 VEGF, HIF1a, IGF2, FGF2, MTA1의 ± 2kb 구간 내에 포함되는 쌍대립인자(biallelic) SNP를 대상으로 하였다. 이러한 유전자의 SNPs 위치는 이미 알려져 있는 유전자 정보(http://www.ncbi.nlm.nih.gov/project/SNP)를 참고로 하여 주로 5'비번역, 프로모터, 엑손 및 유전자좌 부위를 선택하였다.
대상 SNPs ID는 다음과 같다.
rs699947, rs25648, rs3025000, rs3025010, rs3025035, rs3025040, rs10434, rs998584, rs45533131/ rs1957757, rs2301113, rs2057482/ rs2585, rs3802971, rs3213221, rs3741212, rs2239681, rs3741208, rs1004446, rs7924316, rs3842748, rs2070762/ rs308395, rs308428, rs11938826, rs17472986, rs308442, rs308379, rs308381, rs6534367, rs1048201, rs3747676/ rs4983413, DL1002505.
상기 SNPs 중에서 반수체형(haplotype) 빈도가 5% 이상을 나타내는 SNPs을 선택하여 PHASE software v2.1.을 이용하여 반수체형의 빈도를 분석하였으며, 또한 Haploview program v3.2(http://www.broad.mit.edu/mpg/haploview/index.php)를 이용하여 linkage disequilibrium을 분석하였다.
<실시예 2> SNP 유전자형 분석
1.SNP 유전자형 분석
실시예 1의 SNP을 포함하는 부위를 증폭할 수 있는 프라이머 세트와 SNP 부위를 포함하는 TaqMan 프로브를 primer express software를 이용하여 제작하였다. TaqMan 프로브는 SNP의 서열에 따라 야생형과 돌연변이 대립유전자에 맞는 각각의 프로브를 제작하였다.
TaqMan 프로브의 한 쪽은 형광 염료를 태킹하였고 다른 한 쪽에는 형광 염료의 색을 억제할 수 있는 퀀처를 태깅하여 프로브를 제작하였다. 이때 야생형과 돌연변이 대립유전자에 각각 다른 색의 형광 염료를 태깅하였다.
하기 표 1에 기재된 세 종류의 프라이머를 함께 섞은 후 PCR 반응을 실행하면 Taq 폴리머라아제의 엑소뉴클리아제(exonuclease) 활성 성질에 따라 단일염기쌍 미스매치를 구분할 수 있었다.
표 1
rs No. Strand 프라이머 서열
rs1048201 Forward 정방향 ATGATATACATATCTGACTTCCCAA (서열번호 6)
역방향 AAGAGACTGGTATAAAATCAGAATTCA (서열번호 7)
지노타이핑 CGTGCCGCTCGTGATAGAATAGCTCCAGGATTTGTGTGCTGTTGC (서열번호 8)
rs6534367 Forward 정방향 TTCTTCTATTATGCARTTGTTTGAAG (서열번호 9)
역방향 TTACATTCTCAACTAGTGTTCTACATTG (서열번호 10)
지노타이핑 ACGCACGTCCACGGTGATTTATAAATRTATACAATTTTGATTATT (서열번호 11)
rs308428 Forward 정방향 GCATGTTTTGGGAACCAA (서열번호 12)
역방향 ATTAAAACCCTCCATTGACTCC (서열번호 13)
지노타이핑 CGTGCCGCTCGTGATAGAATGAAGTTTGGAATGGCAAGAAGTAAG (서열번호 14)
rs3741208 Reverse 정방향 acaggtaaagcttccttcc (서열번호 15)
역방향 gccatcaggaggagaga (서열번호 16)
지노타이핑 CgACTgTAggTgCgTAACTCgagggcVgttgttgcctctcccggY (서열번호 17)
rs2585 Forward 정방향 AATGTCACCTGTGCCTGC (서열번호 18)
역방향 TTAAAGACAAAACCCAAGCATG (서열번호 19)
지노타이핑 TGCGGCCCGTGTTTGACTYAACTCA (서열번호 20)
DL1002505 Forward 정방향 TGTCCGGCAGCAGGAGGA (서열번호 21)
역방향 ACGCACACTGCCAGACCA (서열번호 22)
지노타이핑 aggactgggcctcctgcgtgctggc (서열번호 23)
rs308395 Forward 정방향 gaggcacgtccatacttg (서열번호 24)
역방향 cagcgtctcacacactga (서열번호 25)
지노타이핑 ctcttctatggcctactttctactg (서열번호 26)
rs11938826 Forward 정방향 TTGGGGAAGGCTGATAAT (서열번호 27)
역방향 GCCATATTTCGGCTAACA (서열번호 28)
지노타이핑 CCCAGAAAAGAGGGTACTTCACACCAG (서열번호 29)
rs3213221 Reverse 정방향 taggacggaggccaggtc (서열번호 30)
역방향 aggtgcccctcccaaac (서열번호 31)
지노타이핑 aattttacacgagggKtgaccatct (서열번호 32)
SNP 마커 분석 결과는 2명 이상의 연구자가 독립적으로 call하여 읽은 결과의 일치성을 검증하여 최종 결과로 판정하였다. 개인의 SNP 마커 결과는 단일 염기 다형성 대립인자에 따라 주대립인자 동형체 (major allele homozygote), 이형체(heterozygote), 소수 대립인자 동형체 (minor allele homozygote)로 나타내었다. 전체 대상자에 대한 결과는 주대립인자와 소수대립이자의 비율 및 세 가지 유전자형의 빈도로 표시하고 Hardy-Weinberg equilibrium을 검증하였다.
MTA1의 간세포암종 조직내 발현과 SNPs 사이의 연관관계 및 상대적 위험도는 오즈비(odds ratio)를 산출하였으며, student's t 검정과 카이제곱 검정 등을 이용하였다.
2. 결과
MTA1 유전자의 IVS4-81(DL1002505)에서 GA 또는 AA 유전자형이 MTA1 양성과 유의한 연관성을 보였다(P=0.003). FGF2 유전자에서는 24684C/G(rs11938826)의 GG 유전자형(P=0.027), -989C/G(rs308395)의 GG 유전자형(P=0.007), 또는 16578A/G(rs308428)의 GG 유전자형(P=0.007)을 보이는 경우들에서 MTA1 양성률이 각각 유의하게 높았다. IGF2 유전자는 -13021C/T(rs3741208)의 CC 또는 CT 유전자형이 MTA1 과발현과 유의한 관련성을 보였다(P=0.03). 한편, 그 밖의 다른 SNPs와 반수체형들은 MTA1 발현 정도와 유의한 연관성을 나타내지 않았다.
<실시예 3> 환자의 특징
1998년부터 2003년까지 아산병원에서 간세포암종 재발로 고통받고 있는 환자 506명을 대상으로 실험하였다. 환자 506명의 임상적 특징은 하기 표 2와 같다. 환자들은 간절제술 후 평균주기 43개월(1-96개월) 동안 추적조사되었다.
표 2
항목 특성치
연령 (년, 평균±SD) 56±10
성별 (M:F) 412:94
질환 정도 (CH:LC) 138:368
간기능 평가 (Child-Pugh class, A/B/C) 383/73/50
HCC 발병원인 (HBV/HCV/Both/NBNC) 397/29/8/72
HCC 크기 (cm) 4 (0.7-21)
간절제 후 추적조사 기간 (월) 43 (1-96)
간암 재발 및 생존은 추적조사 마지막 날에 의학기록을 이용하여 결정하였다. 3개월 이상 동안 추적조사를 하지 못한 환자의 경우에는 환자의 거주지 근처까지 방문하여 평가하였다.
<실시예 4> MTA1의 면역조직화학적 염색 평가
1. 인간 간세포암종 조직에서 MTA1의 면역조직화학적 염색
간세포암종 조직에 대한 MTA1 면역화학 염색은 아비딘 바이오틴 퍼옥시다아제 복합체 방법을 이용하여 수행하였으며, 3, 3'-디아미노벤지딘과 LSAB kit(DAKO, Carpentaria, CA, USA)로 발색 반응을 확인하였다.
간세포암종과 주위의 비종양 부위에서 채취한 파라핀 봉매된 조직 미세 절편을 크실렌으로 처리해 파라핀을 제거하고, 점진적 농도의 알코올로 재수화(rehydration)시켰다. 준비된 간조직 슬라이드를 3% 과산화수소에서 10분간 처리하여 내인성 퍼옥시다아제의 활성을 차단하였다.
면역화학 염색 시에 반응을 증폭시키기 위해 항원 추출(antigen retrieval)은 증기 오븐에서 구연산 완충액(pH 6.0)을 이용해 10분간 수행하였다. MTA1에 대한 1차 항체(Santa Cruz Biochemistry, Santa Cruz, CA, USA)는 1:200으로 희석하여 사용하였고, 바이오틴이 부착된 2차 항체(biotinylated antibody)와 아비딘 바이오틴 복합체 시약을 이용하여 염색하였으며, 해리스 헤마톡실린(Harris hematoxylin)으로 대조 염색을 수행하였다.
조직 절편을 2% 염소 혈청이 함유된 트리스 완충 생리식염수에 담구었고, 1차 항체 대신 1% 소혈청 알부민을 이용한 후, 이를 음성 대조군으로 사용하였다. 각 면역화학 염색 슬라이드에서, 가장 강한 염색 반응을 보이면서 전체 조직 소견을 가장 잘 대표하는 부위를 선택하여 판정하였다.
MTA1의 염색 강도는 전체 세포 중 면역 염색 양성을 보이는 세포의 비율로 결정하는데, 1) 모든 세포가 전혀 염색되지 않는 경우를 none, 2) 일부의 세포가 양성 소견을 보이지만, 그 비율이 50%를 넘지 않는 경우를 1+(+), 3) 전체의 50% 이상의 세포가 면역 화학 염색에서 양성 소견을 보이는 경우를 2+(++)로 정의하였다.
두 명 이상의 관찰자가 서로의 결과를 모르는 상태에서 염색 강도를 판정하며, 관찰자 간 판정이 서로 상이할 경우 재판정을 통해 점수를 조정하였다.
누적 재발 및 누적 생존율 분석을 위하여 Kaplan-Meier 방법과 log-rank 검정을 이용하였다.
2. 결과
도 1에 도시된 바와 같이, MTA1 양성 간세포암종의 1년, 3년 및 5년 누적 재발율은 MTA1 음성 간세포암종의 그것보다 훨씬 높았다. 1년 및 3년에서 높은 MTA1 발현 수준(++)을 지닌 환자의 누적 재발율은 각각 41% 및 71%이며, MTA1 발현 수준이 +인 환자(39%, 54%)와 음성 MTA1 발현 환자(25%, 39%)보다도 훨씬 높은 수준이었다.
도 2에 도시된 바와 같이, MTA1 양성 간세포암종을 지닌 환자의 1년 및 3년 누적 생존율(54%, 39%)은 MTA1 음성 간세포암종을 지닌 환자의 그것(89%, 72%)보다 유의성 있게 짧았다.
<실시예 5> 간세포암종 예후 진단용 키트 및 간세포암종 예후 진단용 단일 염기 다형성 분석 방법
MTA1 양성과 유의한 연관성을 나타내는 단일 염기 다형성 부위 rs308428, DL1002505, rs308395 및 rs11938826의 단일 염기 다형성의 지노타이핑을 위한 증폭(정방향 및 역방향) 및 연장(지노타이핑)용 프라이머 서열은 하기 표 3과 같다. 하기 서열번호 35의 경우(5′-AACACATAWTGTTGAGTGTGTGG-3′), 서열번호 40(5′-AACACATAATGTTGAGTGTGTGG-3′)와 서열번호 41(5′-AACACATATTGTTGAGTGTGTGG-3′)가 약 1:1을 포함하는 프라이머 세트일 수 있다.
표 3
rs No. Strand 프라이머 서열
rs308428 Forward 정방향 5′-GCATGTTTTGGGAACCAA-3′ (서열번호 12)
역방향 5′-ATTAAAACCCTCCATTGACTCC-3′ (서열번호 13)
지노타이핑 5′-GGGAACCAAAAGAAGTTTGGAATGGCAAGAAGTAAG-3′ (서열번호 33)
DL1002505 Forward 정방향 5′-TGTCCGGCAGCAGGAGGA-3′ (서열번호 21)
역방향 5′-ACGCACACTGCCAGACCA-3′ (서열번호 22)
지노타이핑 5′-AGGACTGGGCCTCCTGCGTGCTGGC-3′ (서열번호 23)
rs308395 Forward 정방향 5′-ATGTCTGAAATGTCACAGCACT-3′ (서열번호 34)
역방향 5′-AACACATAWTGTTGAGTGTGTGG-3′ (서열번호 35)
지노타이핑 5′-CACAGCACTTAGTCTTACTCTTCTATGGCCTACTTTCTACTG-3′ (서열번호 36)
rs11938826 Forward 정방향 5′-TATGGCCAATAGAAAAGAGTATAATC-3′ (서열번호 37)
역방향 5′-ATCAAAGGGTTGTTAAACAGTCTC-3′ (서열번호 38)
지노타이핑 5′-tcccagaaaagagggtacttcacaccag-3′ (서열번호 39)
1) PCR 증폭
단일 염기 다형성을 포함하는 부위를 먼저 다중 PCR로 증폭하였다. 상기 PCR 반응 시 이용되는 PCR 반응 용액의 조성 및 PCR 반응 조건은 각각 하기 표 4 및 표 5와 같다. 보다 상세하게는, 검체시료로부터 DNA를 분리하여 상기 PCR 반응의 주형 DNA로 이용하였다. PCR 반응은 95℃에서 약 15분간 전변성(predenaturion)시키고(1 cycle), 약 94℃에서 약 30초 변성(denaturation), 약 55℃에서 약 1분 30초 어닐링(annealing), 약 72℃에서 약 1분 30초 연장(elongation)의 조건을 1사이클로 35사이클, 약 72℃에서 약 10분간 최종 연장(final elongation)시켰다. 상기 반응물은 약 4℃에서 최종 홀드(final hold) 시켰다. 상기 PCR 반응에는 상기 표 3의 각각의 단일 염기 다형성에 대한 정방향 및 역방향 프라이머를 PCR 반응을 위한 프라이머가 이용되었다.
표 4
시약(Reagent) 부피(1 웰 당 분량) (㎕)
10X buffer 1
MgCl2 (25mM) 1.4
dNTP (10mM) 0.3
primer pool(100pmol/㎕) 0.24
Taq (5U/㎕) 0.2
증류수(DW) 5.86
DNA 1
총합계(Total) 10
표 5
온도 시간 사이클(cycle)
95℃ 15분 1
94℃ 30초 35
55℃ 1분 30초
72℃ 1분 30초
72℃ 10분 1
4℃ ∞ -
2) PCR 생성물 정제(PCR product purification): SAP & Exo I 처리 (10㎕)
프라이머 확장을 위한 PCR 반응(SNaPshot 반응)을 완성하기 위하여, 상기 PCR 생성물의 정제를 수행하였다. 다시 말해, 상기 PCR 생성물에 하기 SAP & Exo I를 처리하였다. 상기 생성물의 정제의 반응 물질의 조성 및 반응 조건은 각각 하기 표 6 및 표 7과 같다.
표 6
물질(Material) 부피 (㎕)
SAP (1 unit/㎕) 5
Exo I (10 unit/㎕) 0.2
PCR 생성물 4
증류수 0.8
총합계(Total) 10
표 7
반응 온도 반응 시간
37℃ 1시간
72℃ 15분
3) SNaPshot 반응: 단일 염기 연장(one base extension)을 위한 PCR 반응
상기 정제된 PCR 생성물에 SNaPshot Reaction Premix 및 상기 표 3의 각각의 단일 염기 다형성에 대한 지노타이핑 프라이머를 혼합하여 준 후, PCR 반응을 수행하였다. SNaPshot 반응 물질의 조성 및 반응 조건은 각각 하기 표 8 및 표 9와 같다. PCR 반응은 약 96℃에서 약 10초 변성(denaturation), 약 50℃에서 약 5초 어닐링(annealing), 약 60℃에서 약 30초 연장(elongation)의 조건을 1사이클로 25사이클 수행하였다.
표 8
물질(Material) 부피 (㎕)
SNaPshot Ready Reaction Premix 5
Genotyping primer pool (0.15pmol/㎕) 1
정제된 PCR 생성물 2
증류수 2
총합계(Total) 10
표 9
반응 온도 반응 시간
96℃ 10초
50℃ 5초
60℃ 30초
25 사이클(cycle) -
4) SAP 처리: 반응하고 남은 올리고뉴클레오타이드 제거 과정
반응하고 남은 올리고뉴클레오타이드를 제거하기 위하여, 상기 SNaPshot 반응 산물에 SAP를 첨가 처리하였다. 상기 SAP 처리 반응 물질의 조성 및 반응 조건은 각각 하기 표 10 및 표 11과 같다.
표 10
물질(Material) 부피 (㎕)
SAP (1 unit/㎕) 1
증류수 1
표 11
반응 온도 반응 시간
37℃ 1시간
72℃ 15분
5) 러닝(running)
ABI 3730XL(Applied Biosystems, CA, USA)과 같은 자동 염기서열분석기(automatic sequencer)로 분석하였다. 이때, 분석 결과의 형광색으로 단일 염기 다형성(SNP) 위치에 어떤 뉴클레오타이드 서열(nucleotide sequence)이 있는지를 확인하였다.
6) 데이터 분석
단일 염기 연장이 끝난 생성물을 자동 염기서열분석기인 ABI 3730XL을 통해 분석하면 표지(labeling)된 부분만을 검출하여 도 3 내지 5와 같이 피크로 나타나게 된다. 상기 피크로 나타낸 형광색을 분석(각 염기별로 서로 다른 색의 형광 다이(dye)로 표지된 ddNTP를 사용함)하여 단일 염기 다형성 부위의 서열을 확인할 수 있었다.
본 발명의 일 실시예(실시예 5)에 따른 간세포암종의 예후 진단용 키트 및 간세포암종의 예후 진단용 단일 염기 다형성 분석 방법을 사용할 때, 간세포암종의 예후에 유의한 연관성을 나타내는 단일 염기 다형성 부위 중 rs308428, rs308395 및 rs11938826의 단일 염기 다형성은 다중으로 분석 가능하였으나, 간세포암종의 예후에 유의한 연관성을 나타내는 단일 염기 다형성 부위인 DL1002505의 경우 다중으로 분석할 수 없었고, 단일 분석이 필요한 것으로 나타났다.
본 발명에 따르면, 간세포암종 수술후 재발 및 불량한 생존을 예측하는 데에 유용한 예후인자인 MTA1의 과발현과 유의성있는 상관관계를 나타내는 단일 염기 다형성(SNP)을 제공함으로써 이러한 SNP를 이용하여 간세포암종의 예후 진단용 마이크로어레이 또는 진단키트를 개발할 수 있으며, 간세포암종의 예후 개선용 약물을 스크리닝함으로써 간세포암종의 수술후 나쁜 예후를 개선할 수 있다.
서열목록 1은 인간 MTA1 유전자의 IVS4-81(DL1002505)의 서열을 나타낸 것이고,
서열목록 2는 인간 FGF2 유전자의 24684C/G(rs11938826)의 서열을 나타낸 것이고,
서열목록 3은 인간 FGF2 유전자의 -989C/G(rs308395)의 서열을 나타낸 것이고,
서열목록 4는 인간 FGF2 유전자의 16578A/G(rs308428)의 서열을 나타낸 것이고,
서열목록 5는 인간 IGF2 유전자의 -13021C/T(rs3741208)의 서열을 나타낸 것이고,
서열목록 6은 rs1048201의 정방향 프라이머의 서열을 나타낸 것이고,
서열목록 7은 rs1048201의 역방향 프라이머의 서열을 나타낸 것이고,
서열목록 8은 rs1048201의 지노타이핑 프라이머의 서열을 나타낸 것이고,
서열목록 9는 rs6534367의 정방향 프라이머의 서열을 나타낸 것이고,
서열목록 10은 rs6534367의 역방향 프라이머의 서열을 나타낸 것이고,
서열목록 11은 rs6534367의 지노타이핑 프라이머의 서열을 나타낸 것이고,
서열목록 12는 rs308428의 정방향 프라이머의 서열을 나타낸 것이고,
서열목록 13은 rs308428의 역방향 프라이머의 서열을 나타낸 것이고,
서열목록 14는 rs308428의 지노타이핑 프라이머의 서열을 나타낸 것이고,
서열목록 15는 rs3741208의 정방향 프라이머의 서열을 나타낸 것이고,
서열목록 16은 rs3741208의 역방향 프라이머의 서열을 나타낸 것이고,
서열목록 17은 rs3741208의 지노타이핑 프라이머의 서열을 나타낸 것이고,
서열목록 18은 rs2585의 정방향 프라이머의 서열을 나타낸 것이고,
서열목록 19는 rs2585의 역방향 프라이머의 서열을 나타낸 것이고,
서열목록 20은 rs2585의 지노타이핑 프라이머의 서열을 나타낸 것이고,
서열목록 21은 DL1002505의 정방향 프라이머의 서열을 나타낸 것이고,
서열목록 22는 DL1002505의 역방향 프라이머의 서열을 나타낸 것이고,
서열목록 23은 DL1002505의 지노타이핑 프라이머의 서열을 나타낸 것이고,
서열목록 24는 rs308395의 정방향 프라이머의 서열을 나타낸 것이고,
서열목록 25는 rs308395의 역방향 프라이머의 서열을 나타낸 것이고,
서열목록 26은 rs308395의 지노타이핑 프라이머의 서열을 나타낸 것이고,
서열목록 27은 rs11938826의 정방향 프라이머의 서열을 나타낸 것이고,
서열목록 28은 rs11938826의 역방향 프라이머의 서열을 나타낸 것이고,
서열목록 29는 rs11938826의 지노타이핑 프라이머의 서열을 나타낸 것이고,
서열목록 30은 rs3213221의 정방향 프라이머의 서열을 나타낸 것이고,
서열목록 31은 rs3213221의 역방향 프라이머의 서열을 나타낸 것이고,
서열목록 32는 rs3213221의 지노타이핑 프라이머의 서열을 나타낸 것이고,
서열목록 33은 rs308428의 지노타이핑 프라이머의 서열을 나타낸 것이고,
서열목록 34는 rs308395의 정방향 프라이머의 서열을 나타낸 것이고,
서열목록 35는 rs308395의 역방향 프라이머의 서열을 나타낸 것이고,
서열목록 36은 rs308395의 지노타이핑 프라이머의 서열을 나타낸 것이고,
서열목록 37은 rs11938826의 정방향 프라이머의 서열을 나타낸 것이고,
서열목록 38은 rs11938826의 역방향 프라이머의 서열을 나타낸 것이고,
서열목록 39는 rs11938826의 지노타이핑 프라이머의 서열을 나타낸 것이고,
서열목록 40은 rs308395의 역방향 프라이머의 서열을 나타낸 것이고,
서열목록 41은 rs308395의 역방향 프라이머의 서열을 나타낸 것이다.

Claims (8)

  1. MTA1 유전자의 IVS4-81(DL1002505)에서 GA 또는 AA 유전자형; FGF2 유전자의 24684C/G(rs11938826)의 GG 유전자형, -989C/G(rs308395)의 GG 유전자형, 또는 16578A/G(rs308428)의 GG 유전자형; 및 IGF2 유전자의 -13021C/T(rs3741208)의 CC 또는 CT 유전자형으로 이루어진 군에서 하나 이상 선택된 폴리뉴클레오타이드 또는 그의 상보적 뉴클레오타이드를 포함하는 것을 특징으로 하는 간세포암종의 예후 진단용 단일 염기 다형성(SNP).
  2. 제 1항에 있어서, 상기 단일 염기 다형성(SNP)은 전이성 종양 항원1(metastatic tumor antigen 1; MTA1)의 과발현과 유의성있는 상관관계를 나타내는 것을 특징으로 하는 간세포암종의 예후 진단용 단일 염기 다형성(SNP).
  3. 제 1항 또는 제 2항에 있어서, 상기 간세포암종의 예후는 간세포암종으로 근치적 간절제술을 시행한 환자에서의 예후에 관한 것으로, 간세포암종의 종양 형성율, 재발 위험율 또는 생존율에서 선택된 어느 하나의 지표를 평가하는 것을 특징으로 하는 간세포암종의 예후 진단용 단일 염기 다형성(SNP).
  4. FGF2 유전자의 16578A/G(rs308428) 부위 증폭용 정방향 프라이머;
    FGF2 유전자의 16578A/G(rs308428) 부위 증폭용 역방향 프라이머;
    FGF2 유전자의 16578A/G(rs308428) 부위 지노타이핑용 프라이머;
    MTA1 유전자의 IVS4-81(DL1002505) 부위 증폭용 정방향 프라이머;
    MTA1 유전자의 IVS4-81(DL1002505) 부위 증폭용 역방향 프라이머;
    MTA1 유전자의 IVS4-81(DL1002505) 부위 지노타이핑용 프라이머;
    FGF2 유전자의 -989C/G(rs308395) 부위 증폭용 정방향 프라이머;
    FGF2 유전자의 -989C/G(rs308395) 부위 증폭용 역방향 프라이머;
    FGF2 유전자의 -989C/G(rs308395) 부위 지노타이핑용 프라이머;
    FGF2 유전자의 24684C/G(rs11938826) 부위 증폭용 정방향 프라이머;
    FGF2 유전자의 24684C/G(rs11938826) 부위 증폭용 역방향 프라이머; 및
    FGF2 유전자의 24684C/G(rs11938826) 부위 지노타이핑용 프라이머를 포함하고 단일 염기 연장 반응을 이용하는 간세포암종의 예후 진단용 키트.
  5. 제 4항에 있어서, 상기 FGF2 유전자의 16578A/G(rs308428) 부위 증폭용 정방향 프라이머는 서열번호 12의 프라이머;
    상기 FGF2 유전자의 16578A/G(rs308428) 부위 증폭용 역방향 프라이머는 서열번호 13의 프라이머;
    상기 FGF2 유전자의 16578A/G(rs308428) 부위 지노타이핑용 프라이머는 서열번호 33의 프라이머;
    상기 MTA1 유전자의 IVS4-81(DL1002505) 부위 증폭용 정방향 프라이머는 서열번호 21의 프라이머;
    상기 MTA1 유전자의 IVS4-81(DL1002505) 부위 증폭용 역방향 프라이머는 서열번호 22의 프라이머;
    상기 MTA1 유전자의 IVS4-81(DL1002505) 부위 지노타이핑용 프라이머는 서열번호 23의 프라이머;
    상기 FGF2 유전자의 -989C/G(rs308395) 부위 증폭용 정방향 프라이머는 서열번호 34의 프라이머;
    상기 FGF2 유전자의 -989C/G(rs308395) 부위 증폭용 역방향 프라이머는 서열번호 35의 프라이머;
    상기 FGF2 유전자의 -989C/G(rs308395) 부위 지노타이핑용 프라이머는 서열번호 36의 프라이머;
    상기 FGF2 유전자의 24684C/G(rs11938826) 부위 증폭용 정방향 프라이머는 서열번호 37의 프라이머;
    상기 FGF2 유전자의 24684C/G(rs11938826) 부위 증폭용 역방향 프라이머는 서열번호 38의 프라이머; 및
    상기 FGF2 유전자의 24684C/G(rs11938826) 부위 지노타이핑용 프라이머는 서열번호 38의 프라이머인 것을 특징으로 하는 간세포암종의 예후 진단용 키트.
  6. 검체로부터 핵산 시료를 얻는 단계; 및 MTA1 유전자의 IVS4-81(DL1002505)에서 GA 또는 AA 유전자형; FGF2 유전자의 24684C/G(rs11938826)의 GG 유전자형, -989C/G(rs308395)의 GG 유전자형, 또는 16578A/G(rs308428)의 GG 유전자형; 및 IGF2 유전자의 -13021C/T(rs3741208)의 CC 또는 CT 유전자형으로 이루어진 군에서 선택된 폴리뉴클레오타이드 또는 그의 상보적 뉴클레오타이드 중 어느 하나 이상의 다형성 부위의 뉴클레오타이드 서열을 결정하는 단계를 포함하는 것을 특징으로 하는 간세포암종의 예후 진단방법.
  7. 제 6항에 있어서, 상기 다형성 부위의 뉴클레오티드 서열을 결정하는 단계는 상기 폴리뉴클레오티드 또는 그의 상보적 뉴클레오티드가 고정된 마이크로어레이에 상기 핵산 시료를 혼성화하는 단계 및 얻어진 혼성화 결과를 검출하는 단계를 포함하는 것을 특징으로 하는 간세포암종의 예후 진단방법.
  8. 제1항 또는 제2항에 따른 간세포암종의 예후 진단용 단일 염기 다형성(SNP)의 폴리뉴클레오타이드 또는 그의 상보적 뉴클레오타이드에 의해 인코딩되는 폴리펩티드를 후보물질과 접촉시키는 단계; 및 후보물질이 상기 폴리펩티드의 기능을 증진시키는 활성 또는 억제하는 활성을 나타내는지를 결정하는 단계를 포함하는 것을 특징으로 하는 간세포암종의 예후 개선용 약물의 스크리닝 방법.
PCT/KR2011/001964 2010-03-22 2011-03-22 간세포암종의 예후 진단용 단일 염기 다형성 WO2011118967A2 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US13/636,782 US20130017975A1 (en) 2010-03-22 2011-03-22 Single nucleotide polymorphism for predicting prognosis of hepatocellular carcinoma
CN201180025466.1A CN102906277B (zh) 2010-03-22 2011-03-22 用于对肝细胞癌预后进行预测的单核苷酸多态性

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2010-0025371 2010-03-22
KR20100025371 2010-03-22
KR10-2011-0025174 2011-03-22
KR1020110025174A KR101359851B1 (ko) 2010-03-22 2011-03-22 간세포암종의 예후 진단용 단일 염기 다형성

Publications (2)

Publication Number Publication Date
WO2011118967A2 true WO2011118967A2 (ko) 2011-09-29
WO2011118967A3 WO2011118967A3 (ko) 2012-03-08

Family

ID=44673749

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/001964 WO2011118967A2 (ko) 2010-03-22 2011-03-22 간세포암종의 예후 진단용 단일 염기 다형성

Country Status (1)

Country Link
WO (1) WO2011118967A2 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104745710A (zh) * 2015-04-16 2015-07-01 上海洛施生物科技有限公司 一种与原发性肝细胞癌辅助诊断相关的snp标志物及其应用

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
DATABASE DBSNP [Online] 04 October 2000 Database accession no. rs308428 *
DATABASE DBSNP [Online] 19 July 2005 Database accession no. rs11938826 *
DATABASE DBSNP [Online] 19 July 2005 Database accession no. rs308395 *
DATABASE DBSNP [Online] 30 November 2007 Database accession no. rs3741208 *
KIM, Y. J. ET AL.: 'IGF2 polymorphisms are associated with hepatitis B virus clearance and hepatocellular carcinoma' BIOCHEM. BIOPHYS. RES. COMMUN. vol. 346, no. 1, 21 July 2006, pages 38 - 44 *
TAKEDA, S.: 'Allelic-expression imbalance of the insulin-like growth factor 2 gene in hepatocellular carcinoma and underlying disease' ONCOGENE vol. 12, no. 7, 04 April 1996, pages 1589 - 1592 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104745710A (zh) * 2015-04-16 2015-07-01 上海洛施生物科技有限公司 一种与原发性肝细胞癌辅助诊断相关的snp标志物及其应用
CN104745710B (zh) * 2015-04-16 2017-10-20 上海洛施生物科技有限公司 一种与原发性肝细胞癌辅助诊断相关的snp标志物及其应用

Also Published As

Publication number Publication date
WO2011118967A3 (ko) 2012-03-08

Similar Documents

Publication Publication Date Title
WO2015156519A1 (ko) 유전자 다형성을 이용한 소라페닙 치료에 대한 반응성 예측방법
JP5091163B2 (ja) 癌またはその素因の早期検出のための方法およびキット
WO2010120143A2 (ko) 간암 예후 마커
WO2021029473A1 (ko) 암 및 만성질환 관련 다처방 약물에 대한 약물 부작용 예측 및 개인맞춤 약물치료를 위한 다중고속 약물유전자 진단용 키트
KR101359851B1 (ko) 간세포암종의 예후 진단용 단일 염기 다형성
KR101359782B1 (ko) 간세포암종의 재발 진단용 단일 염기 다형성
EP1186672A2 (en) Polymorphisms in the human organic anion transporter C (OATP-C) gene
WO2019132581A1 (ko) 유방암 및 난소암 등 암 진단용 조성물 및 이의 용도
WO2011159004A1 (ko) 항암 표적치료제제 감수성 예측용 ｓｎｐ
WO2011118967A2 (ko) 간세포암종의 예후 진단용 단일 염기 다형성
WO2021107713A1 (ko) Lats1 유전자 변이 마커 기반의 근위축성 측삭경화증의 진단방법
KR100754398B1 (ko) 심혈관 질환 진단용 다중 ｓｎｐ, 그를 포함하는마이크로어레이 및 키트 및 그를 이용한 심혈관 질환 진단방법
WO2015111852A1 (ko) Nudt15 유전자 내의 단일염기다형성 마커를 포함하는 티오퓨린 유도 백혈구 감소증 발병 위험 예측용 조성물
WO2012060636A2 (ko) 위암 진단 방법
WO2017164436A1 (ko) 고형암 환자의 항암제 치료 반응성 예측용 마커
WO2020204313A1 (ko) Gba 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커
WO2011078495A2 (ko) 항암제 감수성 예측용 ｓｎｐ
WO2011118968A2 (ko) 간세포암종의 재발 진단용 단일 염기 다형성
WO2019225803A1 (ko) Rnf213 단일염기다형성과 한국인 모야모야병 발병 위험도의 연관성
WO2018155948A1 (ko) 폐암 환자의 생존 예후 예측용 마커
WO2019045431A1 (ko) 헬리코박터 파이로리의 마크롤라이드계 항생제 반응성 마커
WO2016200120A1 (ko) 교모세포종 환자에서 이브루티닙 감수성과 관련된 유전자 및 그 용도
WO2023149608A1 (ko) 흑색종 치료 내성 예측용 trim51 바이오마커 및 이의 용도
WO2023132626A1 (ko) 특정 유전자의 cpg 메틸화 변화를 이용한 전립선암 진단용 조성물 및 이의 용도
WO2022030840A1 (ko) 면역글로불린 a 신병증 및 혈관염 진단용 snp 마커 및 이를 이용한 진단 방법

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201180025466.1

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11759716

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 13636782

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 11759716

Country of ref document: EP

Kind code of ref document: A2