WO2022030840A1 - 면역글로불린 a 신병증 및 혈관염 진단용 snp 마커 및 이를 이용한 진단 방법 - Google Patents

면역글로불린 a 신병증 및 혈관염 진단용 snp 마커 및 이를 이용한 진단 방법 Download PDF

Info

Publication number
WO2022030840A1
WO2022030840A1 PCT/KR2021/009623 KR2021009623W WO2022030840A1 WO 2022030840 A1 WO2022030840 A1 WO 2022030840A1 KR 2021009623 W KR2021009623 W KR 2021009623W WO 2022030840 A1 WO2022030840 A1 WO 2022030840A1
Authority
WO
WIPO (PCT)
Prior art keywords
iga
vasculitis
group
nephropathy
iga nephropathy
Prior art date
Application number
PCT/KR2021/009623
Other languages
English (en)
French (fr)
Inventor
서진순
이민호
강희경
Original Assignee
가톨릭대학교 산학협력단
동국대학교 산학협력단
서울대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 가톨릭대학교 산학협력단, 동국대학교 산학협력단, 서울대학교 산학협력단 filed Critical 가톨릭대학교 산학협력단
Publication of WO2022030840A1 publication Critical patent/WO2022030840A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to a SNP for diagnosing IgA nephropathy and IgA vasculitis, and a method for diagnosing nephropathy and vasculitis using the same.
  • Immunoglobulin A nephropathy is a disease characterized by the deposition of immune complexes mainly composed of immunoglobulin A (IgA) in the glomeruli when a renal biopsy is performed, and is the most common among glomerular nephropathy. It is characterized by the presence of a predominantly IgA-containing immune complex in the glomerular mesangium upon renal biopsy.
  • Immunoglobulin A vasculitis is a vasculitis in which immunoglobulin A1 is deposited in small blood vessels.
  • the skin, gastrointestinal tract, and arthritis are the most common symptoms.
  • IgA vasculitis replaced the existing name of Henoch-Schenlein purpura because it was found that the etiology is the abnormal deposition of immunoglobulin A on the blood vessel wall. It is believed that glycosylation at the end of the immunoglobulin hinge is significantly reduced or abnormally glycosylated immunoglobulin A increases in the body's serum, and antibodies against it are generated to cause inflammation in blood vessels.
  • IgAV and IgAN not only appear in twins or the same patient, but also show similar histological characteristics and IgA abnormalities, and thus have been considered related diseases.
  • the serum level of galactose-deficient IgA is high in both groups of IgAN and IgAV nephropathy patients.
  • genetic background is considered to be an important part in the development or progression of the disease, and although the prevalence of both diseases varies according to race, it is particularly high in Asians.
  • GWAS genome-wide association study
  • SNP single nucleotide polymorphism
  • Whole genome association analysis refers to a method of statistically analyzing associations with diseases by searching for the genotypes of about 500,000 to 2 million SNPs.
  • various genetic mutations have been discovered worldwide by this method, and attempts have been made to identify susceptibility genes to diseases using GWAS, but the decisive factor has not yet been identified.
  • the present inventors performed GWAS analysis and Sanger sequence analysis in detecting a variant using the same sample size to confirm the genotype related to Korean-specific IgA nephropathy and IgA vasculitis. By confirming the SNPs, the present invention was completed.
  • IgA nephropathy IgA vasculitis and IgA vasculitis with IgA nephropathy comprising a detection agent for one or more SNPs selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353
  • a detection agent for one or more SNPs selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353
  • Another object of the present invention is to provide a kit for diagnosing a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy, comprising the composition.
  • Another object of the present invention is that when one or more single polymorphisms selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 exist in the nucleotide sequence of the SNP site in the sample obtained from the subject, the subject has IgA nephropathy , IgA vasculitis or IgA vasculitis with IgA nephropathy, IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy. to provide a way
  • Another object of the present invention is that when one or more single polymorphisms selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 exist in the nucleotide sequence of the SNP site in the sample obtained from the subject, the subject has IgA nephropathy , IgA vasculitis or IgA vasculitis with IgA nephropathy is necessary for predicting the onset of a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy It provides a way to provide information.
  • the present invention provides IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy comprising a detection agent for one or more SNPs selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 It provides a composition for diagnosing or predicting the onset of a disease selected from the group.
  • the disease may occur in infants or children, but is not limited thereto.
  • the disease may occur in Koreans, but is not limited thereto.
  • the detection agent may be a probe capable of detecting one or more SNPs selected from the group consisting of rs9428555, rs2502349, rs2491835 and rs2502353, but is not limited thereto.
  • the detection agent may be a primer capable of detecting one or more SNPs selected from the group consisting of rs9428555, rs2502349, rs2491835 and rs2502353, but is not limited thereto.
  • the primer may include a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 and 2, but is not limited thereto.
  • the present invention also provides a kit for diagnosing a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy, comprising the composition.
  • the kit may be an RT-PCR kit or a microarray chip kit, but is not limited thereto.
  • the subject when one or more single nucleotide polymorphisms selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 exist in the nucleotide sequence of the SNP site in the sample obtained from the subject, the subject has IgA nephropathy, IgA Necessary for diagnosis of a disease selected from the group consisting of IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy, comprising determining that the patient has a disease selected from the group consisting of vasculitis and IgA vasculitis with IgA nephropathy It provides a way to provide information.
  • the subject when one or more single nucleotide polymorphisms selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 exist in the nucleotide sequence of the SNP site in the sample obtained from the subject, the subject has IgA nephropathy, IgA A disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy, comprising determining a high risk of contracting a disease selected from the group consisting of vasculitis and IgA vasculitis with IgA nephropathy. It provides a method for providing information necessary for predicting an outbreak.
  • the subject when one or more single nucleotide polymorphisms selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 exist in the nucleotide sequence of the SNP site in the sample obtained from the subject, the subject has IgA nephropathy, IgA A method for diagnosing a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy, comprising determining that the patient has a disease selected from the group consisting of vasculitis and IgA vasculitis with IgA nephropathy. to provide.
  • the subject when one or more single nucleotide polymorphisms selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 exist in the nucleotide sequence of the SNP site in the sample obtained from the subject, the subject has IgA nephropathy, IgA A method for predicting the onset of a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy, comprising determining that the patient has a disease selected from the group consisting of vasculitis and IgA vasculitis with IgA nephropathy provides
  • the method includes sequencing, exome sequencing, microarray hybridization, allele specific PCR, dynamic allele hybridization technique ( dynamic allele-specific hybridization), PCR extension analysis, and Taqman technique may be performed by at least one method selected from the group consisting of, but not limited thereto.
  • the present invention provides a composition comprising a detection agent for one or more SNPs selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 selected from the group consisting of IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy.
  • a detection agent for one or more SNPs selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 selected from the group consisting of IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy.
  • the present invention provides a composition comprising a detection agent for one or more SNPs selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 selected from the group consisting of IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy.
  • a detection agent for one or more SNPs selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 selected from the group consisting of IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy.
  • the present invention relates to the diagnosis of a disease selected from the group consisting of IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy, or Provided is a use for the production of an agent for predicting an outbreak.
  • dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353, which are single nucleotide polymorphism (SNP) sites were found in nephropathy and vasculitis, particularly IgA nephropathy and IgA vasculitis. It has been identified that it is closely related to the patient, and it can be used to develop a genetic diagnostic reagent for diagnosing or predicting the onset of nephropathy and vasculitis.
  • SNPs single nucleotide polymorphisms
  • the present invention relates to the diagnosis of a disease selected from the group consisting of IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy comprising a detection agent for one or more SNPs selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353; It relates to a composition for predicting onset.
  • polynucleotide or “nucleic acid” refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) in the form of single or double strands. Unless otherwise limited, known analogs of natural nucleotides that hybridize to nucleic acids in a manner analogous to naturally occurring nucleotides are also included.
  • DNA consists of four bases: adenine (A), guanine (G), cytosine (C), and thymine (T), and RNA consists of uracil (U) instead of thymine (Uracil, U).
  • A forms a hydrogen bond with T or U
  • C forms a hydrogen bond with the base G, and the relationship between these bases is called 'complementary'.
  • polymorphism refers to the occurrence of two or more alternative sequences or alleles (or alleles) within a genetically determined population
  • SNP single nucleotide polymorphism
  • 'mRNA messenger RNA or messenger RNA
  • RNA messenger RNA or messenger RNA
  • 'mRNA is an RNA that serves as a blueprint for polypeptide synthesis (protein translation, translation) by transferring the genetic information of the base sequence of a specific gene to the ribosome during protein synthesis.
  • protein translation, translation protein translation, translation
  • 'protein' is used interchangeably with 'polypeptide' or 'peptide', and for example, refers to a polymer of amino acid residues as commonly found in proteins in a natural state.
  • the one letter (three letters) of an amino acid refers to the following amino acids according to standard abbreviation rules in the field of biochemistry: A(Ala): alanine; C(Cys): cysteine; D(Asp): aspartic acid; E(Glu): glutamic acid; F(Phe): phenylalanine; G(Gly): glycine; H(His): histidine; I(IIe): isoleucine; K(Lys): lysine; L(Leu): leucine; M(Met): methionine; N(Asn): asparagine; O(Ply): pyrrolysine; P(Pro): proline; Q(Gln): glutamine; R(Arg): arginine; S(Ser): serine; T(Thr): threonine; U(Sec):selenocysteine; V(Val): valine
  • amino acid single letter amino acid position (amino acid single letter) (amino acid single letter)
  • amino acid single letter amino acid single letter
  • the term "complementary" means that a targeting moiety in a nucleic acid molecule binds to a target (eg, a SNP of the present invention) under predetermined hybridization or annealing conditions, specifically physiological conditions (in a cell). It means that it is sufficiently complementary to selectively hybridize, it may have one or more mismatched nucleotide sequences, and it means that it is substantially complementary and that it is completely complementary. and, more specifically, means completely complementary.
  • the composition detects one or more SNPs selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 as a diagnostic marker.
  • SNP rs9428555 is one in which base 243071634 on chromosome 1 is substituted from A to G.
  • SNP rs2502349 is one in which base 243071698 on chromosome 1 is substituted from G to A.
  • SNP rs2491835 is one in which base 243071499 on chromosome 1 is substituted from A to T.
  • SNP rs2502353 is one in which base 243073112 on chromosome 1 is substituted from C to T.
  • the above-mentioned SNPs may be located on the base sequence of SEQ ID NO: 9 to SEQ ID NO: 12, respectively.
  • the base corresponding to the SNP position according to the present invention is represented by r, and the sequence 10 nt in the 5' direction, 3' direction based on the SNP position
  • the sequence 10 nt is indicated.
  • the nucleotide sequence of SEQ ID NO: 9 (rs_id, rs9428555) indicates the SNP position as r, and the nucleotide sequence of 10 nt in length is indicated on both sides based on this, and a sequence of a total length of 21 nt is indicated.
  • nucleotide sequence of SEQ ID NO: 9 to SEQ ID NO: 12 is used for the purpose of specifying the position of the SNP in an individual, particularly a human, and therefore, the length of the nucleotide sequence of SEQ ID NO: 9 to SEQ ID NO: 12 is in the indicated range.
  • the present invention is not limited by the
  • measuring the expression level of the SNP in the present invention means measuring the expression level (ie, measuring the expression presence or absence), or measuring the level of qualitative and quantitative change of the SNP.
  • the measurement may be performed without limitation, including both a qualitative method (analysis) and a quantitative method.
  • Qualitative and quantitative methods for measuring the presence or absence of SNPs are well known in the art, and the experimental methods described herein are included therein. A specific SNP level comparison method for each method is well known in the art.
  • IgA nephropathy is also called IgA nephropathy, and is the most common glomerulonephritis, a disease accompanied by deposition of polymeric IgA in mesangium and histological damage.
  • IgAN IgA nephropathy
  • IgA1 an abnormal antibody lacking galactosylation
  • IgA vasculitis is also called Henoch-Schoonrein purpura, and may occur rarely in adults or vasculitis commonly seen in children.
  • IgA vasculitis is a systemic vasculitis that invades small blood vessels due to the deposition of immune complexes including IgA.
  • Typical symptoms include purpura, arthralgia, abdominal pain and gastrointestinal bleeding, nephritis, and, rarely, central nervous system involvement and pulmonary hemorrhage. Renal involvement is a serious complication that can progress to end-stage renal failure and, depending on the severity, has a major impact on long-term prognosis.
  • the disease may be infant or childhood nephropathy and/or vasculitis, but is not limited thereto.
  • the infant or child may mean a person under the age of 18, but is not limited thereto.
  • diagnosis refers to determining the susceptibility of an object to a particular disease or disorder, determining whether an object currently has a particular disease or disorder, or having a particular disease or disorder. It is a concept that includes both determining the prognosis of an object, or therametrics (eg, monitoring the condition of an object to provide information on treatment efficacy).
  • the diagnosis may preferably mean an early diagnosis or an onset prediction, but is not limited thereto.
  • the diagnosis means diagnosis of a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy.
  • the disease in the present invention may preferably be hereditary IgA nephropathy and/or IgA vasculitis caused by a genetic factor, and the symptoms are aggravated by adding environmental influences to the genetic predisposition. it could be
  • a 'primer' is a short single-stranded oligonucleotide that serves as a starting point of DNA synthesis.
  • the primer specifically binds to a polynucleotide as a template under suitable buffer and temperature conditions, and DNA polymerase adds a nucleoside triphosphate having a base complementary to the template DNA to the primer to link it. is synthesized
  • a primer generally consists of a sequence of 15 to 30 bases, and the melting temperature (Tm) at which it binds to the template strand varies depending on the base composition and length.
  • the sequence of the primer does not need to have a completely complementary sequence to a partial nucleotide sequence of the template, and it is sufficient if it hybridizes with the template and has sufficient complementarity within a range capable of performing an intrinsic function of the primer. Therefore, in the present invention, the primer pair, which is the detection agent according to the present invention, can be easily designed with reference to the nucleotide sequence of the cDNA or genomic DNA of the SNP site.
  • a primer for detecting SNP does not need to have a sequence that is perfectly complementary to each gene sequence, and if it has a length and complementarity suitable for the purpose of measuring the amount of mRNA by amplifying a specific section of mRNA or cDNA through DNA synthesis Suffice.
  • the primers for the amplification reaction are composed of a set (pair) that complementarily binds to the template (or sense) and the opposite side (antisense) of both ends of a specific section of the mRNA to be amplified.
  • a 'probe' refers to RNA or DNA having a length of several to hundreds of base pairs that can specifically bind to mRNA, cDNA (complementary DNA), DNA of a specific gene, etc. It refers to a fragment of a polynucleotide, and is labeled so that the presence or absence of the target mRNA or cDNA to be bound to, the amount of expression, etc. can be checked. Probe selection and hybridization conditions can be appropriately selected according to techniques known in the art. The probe may be used in a diagnostic method for detecting an allele (or allele, allele).
  • the diagnostic methods include detection methods based on hybridization of nucleic acids, such as Southern blot, and may be provided in a form previously bound to a substrate of a DNA chip in a method using a DNA chip.
  • the primer or probe may be chemically synthesized using a phosphoramidite solid support synthesis method or other well-known methods.
  • primers or probes may be chemically synthesized using a phosphoramidite solid support synthesis method or other well-known methods.
  • primers or probes can be variously modified according to methods known in the art within a range that does not interfere with hybridization with a polynucleotide to be detected. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc. ) or charged linkages (eg, phosphorothioate, phosphorodithioate, etc.), and fluorescence or enzymatic binding of a labeling material.
  • the present invention also provides a kit for diagnosing a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy, comprising the composition.
  • the kit may be an RT-PCR kit or a microarray chip kit, but is not limited thereto.
  • the kit is IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy by amplifying the SNP marker, a diagnostic marker for a disease selected from the group consisting of, or by checking the expression level of the mRNA by checking the expression level of the SNP marker.
  • the onset of a disease selected from the group consisting of IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy can be predicted or diagnosed early.
  • the RT-PCR kit may include each pair of primers capable of amplifying a nucleic acid comprising the SNP site, other test tubes or other suitable containers, reaction buffers, deoxynucleotides (dNTPs), Taq-polymerization enzymes and enzymes such as reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like.
  • dNTPs deoxynucleotides
  • Taq-polymerization enzymes and enzymes such as reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like.
  • a primer pair specific for a gene used as a quantitative control may be included.
  • the microarray chip kit may include a microarray having a substrate on which a nucleic acid including the SNP site is immobilized.
  • the microarray may be composed of a conventional microarray except that the polynucleotide, primer, or probe of the present invention is included.
  • Hybridization of nucleic acids on microarrays and detection of hybridization results are well known in the art.
  • a nucleic acid sample is labeled with a fluorescent material, for example, a label capable of generating a detectable signal including a material such as Cy3 and Cy5, and then hybridized on a microarray and the labeling material
  • a hybridization result can be detected by detecting a signal generated from
  • the term “subject” or “subject” refers to a subject for predicting or diagnosing an onset.
  • the "sample” can be used without limitation as long as it is collected from a subject to predict or diagnose the onset, for example, cells or tissues obtained by biopsy, blood, whole blood, serum, plasma, saliva, cerebrospinal fluid, various secretions, It may be urine, feces, etc. Preferably, it may be selected from the group consisting of blood, plasma, serum, saliva, nasal fluid, sputum, ascites, vaginal secretion and urine, and preferably blood, plasma, serum, kidney tissue or renal glomerular tissue.
  • the sample may be pretreated prior to use for detection or diagnosis. For example, it may include homogenization, filtration, distillation, extraction, concentration, inactivation of interfering components, addition of reagents, and the like.
  • the subject when one or more single nucleotide polymorphisms selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 exist in the nucleotide sequence of the SNP site in the sample obtained from the subject, the subject has IgA nephropathy, IgA Necessary for diagnosis of a disease selected from the group consisting of IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy, comprising determining that the patient has a disease selected from the group consisting of vasculitis and IgA vasculitis with IgA nephropathy It provides a way to provide information.
  • the subject when one or more single nucleotide polymorphisms selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 exist in the nucleotide sequence of the SNP site in the sample obtained from the subject, the subject has IgA nephropathy, IgA A disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy, comprising determining a high risk of contracting a disease selected from the group consisting of vasculitis and IgA vasculitis with IgA nephropathy. It provides a method for providing information necessary for predicting an outbreak.
  • the method includes sequencing, exome sequencing, microarray hybridization, allele specific PCR, and dynamic allele-specific hybridization technique.
  • hybridization may be performed by one or more methods selected from the group consisting of, but not limited thereto.
  • stage 1 (discovery cohort) consisted of 101 cases, and stage 2 (validation cohort, validation cohort) performed replication analysis of the most significant SNPs identified in the discovery cohort in 26 additional cases .
  • Whole genome sequencing data (depth>30x) of 397 general Koreans evaluated in the Korean Standard Genome Database (KRGDB; http://coda.nih.go.kr/coda/KRGDB/) were used as a normal control set with approval.
  • KRGDB Korean Standard Genome Database
  • IgAV IgA Vasculitis
  • All IgAN patients were diagnosed by renal biopsy.
  • the diagnosis of IgAV was made clinically, according to the International Rheumatology/Children's Rheumatology Laboratory/European Society for Pediatric Rheumatology criteria: purpura or petechial with inferior vena cava predominance and one of the following four symptoms.
  • One or more acute onset abdominal pain; histopathology presenting leukocytoclastic vasculitis or proliferative glomerulonephritis with predominant IgA deposition; arthralgia or arthritis; and symptoms such as renal involvement).
  • Renal involvement also called IgA nephropathy
  • IgA nephropathy is defined when an IgAV patient has proteinuria or hematuria during the course of the disease.
  • IgAN or IgAV secondary to systemic lupus erythematosus, chronic hepatitis, diabetes or other conditions including cancer were excluded.
  • Phase 1 included 48 IgAN patients, 10 IgAV patients and 43 IgAV nephropathy (IgAVN) patients.
  • Phase 2 included 9 IgAN patients, 12 IgAV patients, and 5 IgAV nephropathy (IgAVN) patients.
  • the study procedure was performed according to the Declaration of Helsinki. This study was approved by the institutional review committees of the clergy of Korea Bucheon St. Mary's Hospital (IRB No. HC18TNDI0012) and Seoul National University Hospital (1808-157-967). Written informed consent was obtained from all participants and their guardians.
  • Genomic DNA of subjects was extracted from peripheral blood samples collected in EDTA coated tubes. Genomic DNA samples were genotyped in Korea Biobank Array (DNA Link Inc., Seoul, Korea).
  • genomic DNA of 14 samples already genotyped in the discovery stage and 26 samples not used in the discovery stage were separately prepared by Sanger sequencing (Cosmo GeneTech, Seoul, Korea). was genotyped.
  • ACTGAAAGCAATGGCTCAAAC SEQ ID NO: 1, rs9428555_F
  • GTGTCTGACTTACTTCACTTAATATGC SEQ ID NO: 2, rs9428555_R
  • TCArsCAGCCATA SEQ ID NO: 2, rs9428555_R
  • TCArsCAGCCATA SEQ ID NO: 2, rs9428555_R
  • GACCATCA GAGCCA 4 rs4926802_R
  • TTGGCAGCTGGACTTACTGTT SEQ ID NO:5, rs147294199_F
  • CTTGGGATTCCTTCCAGGCT SEQ ID NO:6, rs147294199_R
  • CATGGCCTTGATTCAATCCT SEQ ID NO:7, rs11660485_F
  • association tests were performed on 101 cases and 397 healthy controls based on more than 500 million SNP genotypes identified using the Korean Biobank Array.
  • Sample ID rs9428555 Sample ID rs9428555 VPE001 AA VPE014 AG VPE002 AA VPE015 AA VPE003 AA VPE016 AG VPE004 AA VPE017 AG VPE005 AG VPE018 AA VPE006 AA VPE019 AG VPE007 AG VPE020 AG VPE008 AG VPE021 AA VPE009 AG VPE022 AG VPE010 AA VPE023 AA VPE011 AG VPE024 AG VPE012 AG VPE025 AG VPE013 AA VPE026 AG
  • SNPs judged to have clinical significance in nephropathy, vasculitis, and vasculitis with nephropathy were selected according to the above embodiment. It is expected that it will be usefully used for predicting the outbreak.
  • dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353, which are single nucleotide polymorphism (SNP) sites were found to be nephropathy and vasculitis, particularly IgA nephropathy and IgA vasculitis. It has been identified that it is closely related to the patient, and it can be used to develop a genetic diagnostic reagent for diagnosing or predicting the onset of nephropathy and vasculitis using this, so the present invention has industrial applicability.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 신병증 및 혈관염 진단용 SNP 및 이를 이용한 신병증 및 혈관염 진단 방법 등에 관한 것으로, 본 발명자들은 신병증 및 혈관염 환자들의 유전체를 분석한 결과, 단일염기다형성(SNP) 부위인 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353이 신병증 및 혈관염, 특히 IgA 신병증 및 IgA 혈관염 환자와 밀접하게 연관되어 있는 것을 규명하였으며, 이를 이용하여 신병증 및 혈관염의 진단 또는 발병 예측을 위한 유전자 진단 시약을 개발하는데 이용할 수 있다.

Description

면역글로불린 A 신병증 및 혈관염 진단용 SNP 마커 및 이를 이용한 진단 방법
본 발명은 IgA 신병증 및 IgA 혈관염 진단용 SNP 및 이를 이용한 신병증 및 혈관염 진단 방법 등에 관한 것이다.
본 출원은 2020년 8월 5일에 출원된 한국특허출원 제10-2020-0098087호에 기초한 우선권을 주장하며, 해당 출원의 명세서 및 도면에 개시된 모든 내용은 본 출원에 원용된다.
면역글로불린 A 신병증(IgAN)은 신장 조직 검사를 했을 때 사구체에 면역글로불린(Immunoglobulin) A(IgA)를 주로 하는 면역 복합체의 침착이 특징적으로 나타나는 질환으로, 사구체 신병증 중에서 가장 흔하게 발생한다. 신장 생검시 사구체 메산지움(mesangium)에 우세한 IgA-함유 면역 복합체가 존재하는 것이 특징이다.
면역글로불린 A 혈관염(IgAV)은 면역글로불린 A1이 소혈관에 침착되는 혈관염으로 피부, 위장관계, 관절염이 호발증상이다. 사구체신염이 있는 경우 신장 조직검사에서 병리 소견이 유사하여 IgA 신병증과 구분이 불가능하다. 기존의 헤노흐 쉔라인 자반증이라는 이름을 IgA 혈관염으로 대체한 것은, 혈관벽에 비정상적인 면역글로불린 A가 침착되어 있는 것이 병인임이 밝혀졌기 때문이다. 면역글로불린 경첩부 말단부위의 당질화가 현저히 줄어있거나 비정상적으로 당화된 면역글로불린 A가 체내 혈청 내 증가하고, 이에 대한 항체가 생겨 혈관 내 염증을 유발한다고 여겨지고 있다.
IgAV 및 IgAN은 쌍둥이 또는 동일 환자에서 나타날 뿐만 아니라, 유사한 조직학적 특성 및 IgA 이상을 나타내어 관련 질환으로 간주되어 왔다. 특히, 갈락토오스 결핍 IgA의 혈청 수준은 IgAN 및 IgAV 신병증 환자 두 그룹 모두에서 높게 나타나는 것으로 알려져 있다. 또한, 유전적 배경은 질병의 발달 또는 진행에 중요한 부분으로 간주되는데, 양 질환의 유병률은 인종에 따라 다르지만, 특히 아시아인에서 높게 나타난다.
한편, 유전체연구 기술 발달에 힘입어 한 사람에 존재하는 단일염기다형성(Single Nucleotide Polymorphism; SNP)과 질병발생과의 관련성을 동시에 살펴보는 전장 유전체 연관 분석(Genome-wide association study; GWAS) 방법이 대세를 이루게 되었다. 전장 유전체 연관 분석은 약 50만-200만 개 SNP의 유전자형을 탐색하여 질병과의 연관성을 통계적으로 분석하는 방법을 일컫는다. 현재까지 이 방법으로 다양한 유전변이들이 전 세계적으로 발굴되었으며, GWAS를 이용한 질환에 대한 감수성 유전자들을 동정하고자 하는 시도가 이루어지고 있으나 아직까지 결정적 인자는 확인되지 않은 상태이다.
이에 본 발명자들은 한국인 특이적인 IgA 신병증 및 IgA 혈관염과 관련된 유전자형을 확인하기 위해 동일한 표본 크기를 이용하여 변이(variant)를 검출하는 데에 있어, GWAS 분석 및 Sanger 서열 분석을 수행한 결과, 유의한 SNP들을 확인하여, 본 발명을 완성하였다.
이에, 본 발명의 목적은 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 SNP의 검출 제제를 포함하는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단 또는 발병 예측용 조성물을 제공하는 것이다.
본 발명의 다른 목적은 상기 조성물을 포함하는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단용 키트를 제공하는 것이다.
본 발명의 또 다른 목적은 피검체로부터 수득한 시료 중의 SNP 부위의 염기서열에 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 단일염기다형성이 존재하는 경우, 피검체가 IgA 신병증, IgA 혈관염 또는 IgA 신병증을 동반한 IgA 혈관염에 걸린 것으로 판정하는 단계를 포함하는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단에 필요한 정보를 제공하는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 피검체로부터 수득한 시료 중의 SNP 부위의 염기서열에 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 단일염기다형성이 존재하는 경우, 피검체가 IgA 신병증, IgA 혈관염 또는 IgA 신병증을 동반한 IgA 혈관염에 걸릴 위험이 높은 것으로 판정하는 단계를 포함하는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 발병 예측에 필요한 정보를 제공하는 방법을 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당해 기술분야의 통상의 기술자에게 명확하게 이해될 수 있을 것이다.
상기 과제를 해결하기 위하여, 본 발명은 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 SNP의 검출 제제를 포함하는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단 또는 발병 예측용 조성물을 제공한다.
본 발명의 일 실시예에서, 상기 질환은 유아 또는 소아에서 발병된 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 실시예에서, 상기 질환은 한국인에서 발병된 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 실시예에서, 상기 검출 제제는 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 SNP를 검출할 수 있는 프로브일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 실시예에서, 상기 검출 제제는 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 SNP를 검출할 수 있는 프라이머일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 실시예에서 상기 프라이머는 서열번호 1 및 2로 이루어진 군으로부터 선택된 염기서열을 포함할 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명은 상기 조성물을 포함하는, IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단용 키트를 제공한다.
본 발명의 일 실시예에서, 상기 키트는 RT-PCR 키트 또는 마이크로어레이 칩 키트일 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명은 피검체로부터 수득한 시료 중의 SNP 부위의 염기서열에 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 단일염기다형성이 존재하는 경우, 피검체가 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환에 걸린 것으로 판정하는 단계를 포함하는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단에 필요한 정보를 제공하는 방법을 제공한다.
또한, 본 발명은 피검체로부터 수득한 시료 중의 SNP 부위의 염기서열에 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 단일염기다형성이 존재하는 경우, 피검체가 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환에 걸릴 위험이 높은 것으로 판정하는 단계를 포함하는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 발병 예측에 필요한 정보를 제공하는 방법을 제공한다.
또한, 본 발명은 피검체로부터 수득한 시료 중의 SNP 부위의 염기서열에 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 단일염기다형성이 존재하는 경우, 피검체가 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환에 걸린 것으로 판정하는 단계를 포함하는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단 방법을 제공한다.
또한, 본 발명은 피검체로부터 수득한 시료 중의 SNP 부위의 염기서열에 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 단일염기다형성이 존재하는 경우, 피검체가 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환에 걸린 것으로 판정하는 단계를 포함하는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 발병 예측 방법을 제공한다.
본 발명의 일 실시예에서, 상기 방법은 시퀀싱(sequencing), 엑솜 시퀀싱(exome sequencing), 마이크로어레이에 의한 혼성화(microarray hybridization), 대립유전자 특이적인 PCR(allele specific PCR), 다이나믹대립유전자 혼성화 기법(dynamic allele-specific hybridization), PCR 연장 분석 및 Taqman 기법으로 이루어진 군으로부터 선택되는 하나 이상의 방법으로 수행될 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명은 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 SNP의 검출 제제를 포함하는 조성물의 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단 용도를 제공한다.
또한, 본 발명은 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 SNP의 검출 제제를 포함하는 조성물의 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 발병 예측 용도를 제공한다.
또한, 본 발명은 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 SNP의 검출 제제의 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단 또는 발병 예측용 제제의 생산을 위한 용도를 제공한다.
본 발명자들은 신병증 및 혈관염 환자들의 유전체 DNA의 단백질 코딩 부위를 분석한 결과, 단일염기다형성(SNP) 부위인 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353이 신병증 및 혈관염, 특히 IgA 신병증 및 IgA 혈관염 환자와 밀접하게 연관되어 있는 것을 규명하였으며, 이를 이용하여 신병증 및 혈관염의 진단 또는 발병 예측을 위한 유전자 진단 시약을 개발하는데 이용할 수 있다.
도 1은 본 발명의 일 실시예에 따른 단일염기다형성(SNP)을 선별하는 과정을 모식화한 도이다.
본 발명은 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 SNP의 검출 제제를 포함하는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단 또는 발병 예측용 조성물에 관한 것이다.
이하, 본 발명을 상세히 설명한다.
본 명세서에서, "폴리뉴클레오티드(polynucleotide)" 또는 "핵산"은 단일 또는 이중 가닥의 형태로 된 데옥시리보핵산(deoxyribonucleic acid, DNA) 또는 리보핵산(ribonucleic acid, RNA)를 말한다. 다른 제한이 없는한, 자연적으로 생성되는 뉴클레오티드와 비슷한 방법으로 핵산에 혼성화되는 자연적 뉴클레오티드의 공지된 아날로그도 포함된다. 일반적으로 DNA는 아데닌(adenine, A), 구아닌(guanine, G), 시토신(cytosine, C), 티민(thymine, T) 등 네 가지 염기로 구성되어 있으며, RNA는 티민 대신 우라실(Uracil, U)을 가지고 있다. 핵산 이중 가닥에서 A는 T 또는 U, C는 G 염기와 수소결합을 이루는데, 이러한 염기의 관계를 '상보적(complementary)'이라고 한다.
본 명세서에서, 유전자의 변이를 표기할 때 'c.'은 단백질 코딩 부위의 변이를 의미하며, "(염기 위치)(염기일문자)(기호 >)(염기일문자)"는 해당 염기 위치에서 선행 표기된 염기가 후행 표기된 염기로 치환된다는 것을 의미한다.
본 명세서에서, "다형성(polymorphism)"이란 유전적으로 결정된 집단 내에서 2 이상의 대체적 서열 또는 대립형질(또는 대립유전자)의 발생을 의미하며, "단일염기다형성(single nucleotide polymorphism, SNP)'은 하나의 염기의 다형성을 의미한다. 구체적으로 유전체에서 단일염기(A, T, C 또는 G)가 종의 멤버들 간 또는 한 개체(individual)의 쌍 염색체 간에 발생하는 DNA 서열의 다양성을 의미한다. 예를 들어, 서로 다른 개체의 세 개의 DNA 단편들(예를 들어 AAGT[A/A]AG, AAGT[A/G]AG, AAGT[G/G]AG)처럼 단일염기에서 차이를 포함하는 경우, 두 개의 대립유전자(A 또는 G)라고 부르며, 일반적으로 거의 모든 SNP는 두 개의 대립 유전자를 가진다. 또한 SNP가 특정 질환과 유전적으로 밀접하게 연관되어 있는 경우에는, SNP는 확인된 정상인(normal) 또는 야생형(wild-type, WT) 개체 또는 대립유전자와 비교하여 특정 위치의 하나의 염기에 변이가 발생한 것을 의미하기도 한다.
한편, 'mRNA(messenger RNA 또는 전령 RNA)'는 단백질 합성 과정에서 특정 유전자의 염기서열의 유전 정보를 리보솜(ribosome)으로 전달하여 폴리펩티드 합성(단백질 번역, translation)의 청사진 역할을 하는 RNA이다. 유전자를 주형(template)으로 하여 단일 가닥의 mRNA가 전사(transcription) 과정을 통하여 합성된다.
본 명세서에서 '단백질'은 '폴리펩타이드(polypeptide)' 또는 '펩타이드(peptide)'와 호환성 있게 사용되며, 예컨대, 자연 상태의 단백질에서 일반적으로 발견되는 바와 같이 아미노산 잔기의 중합체를 말한다.
본 명세서에 사용된 아미노산의 일문자(삼문자)는 생화학 분야에서의 표준 약어 규정에 따라 다음의 아미노산을 의미한다: A(Ala): 알라닌; C(Cys): 시스테인; D(Asp): 아스파르트산; E(Glu): 글루탐산; F(Phe): 페닐알라닌; G(Gly): 글라이신; H(His): 히스티딘; I(IIe): 이소류신; K(Lys): 라이신; L(Leu): 류신; M(Met): 메티오닌; N(Asn): 아스파라진; O(Ply): 피롤라이신; P(Pro): 프롤린; Q(Gln): 글루타민; R(Arg): 아르지닌; S(Ser): 세린; T(Thr): 쓰레오닌; U(Sec):셀레노시스테인; V(Val): 발린; W(Trp): 트립토판; Y(Tyr): 타이로신.
본 명세서에 표기되는 "(아미노산 일문자)(아미노산 위치)(아미노산 일문자)"는 천연형 단백질(wild-type protein)의 해당 아미노산 위치에서 선행 표기된 아미노산이 후행 표기된 아미노산으로 치환된다는 것을 의미한다.
본 명세서에서 사용되는 용어 "상보적(complementary)"은 소정의 혼성화 또는 어닐링 조건, 구체적으로는 생리학적 조건 하(세포 내)에서 핵산 분자 내 타겟팅 모이어티가 타겟(예컨대, 본 발명의 SNP)에 선택적으로 혼성화할 정도로 충분히 상보적인 것을 의미하는 것으로 하나 또는 그 이상의 미스매치(mismatch) 염기서열을 가질 수 있으며, 실질적으로 상보적(substantially complementary) 및 완전히 상보적(perfectly complementary)인 것을 모두 포괄하는 의미를 가지며, 보다 구체적으로는 완전히 상보적인 것을 의미한다.
본 명세서에서 상기 조성물은 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 SNP를 진단 마커로 검출한다.
본 명세서에서 SNP rs9428555은 염색체 1 상의 243071634번째 염기가 A에서 G로 치환된 것이다.
본 명세서에서 SNP rs2502349은 염색체 1 상의 243071698번째 염기가 G에서 A로 치환된 것이다.
본 명세서에서 SNP rs2491835은 염색체 1 상의 243071499번째 염기가 A에서 T로 치환된 것이다.
본 명세서에서 SNP rs2502353은 염색체 1 상의 243073112번째 염기가 C에서 T로 치환된 것이다.
상기 언급된 SNP는 각각 서열번호 9 내지 서열번호 12의 염기서열 상에 위치할 수 있다. 상기 언급된 서열번호 9 내지 서열번호 12의 염기서열은 본 발명에 따른 SNP 위치에 해당하는 염기를 r로 표시하고, 상기 SNP 위치를 기준으로 하여, 5' 방향의 서열 10 nt, 3' 방향의 서열 10 nt를 표시한 것이다. 예를 들어, 서열번호 9(rs_id, rs9428555)의 염기서열은 SNP 위치를 r로 표시하고 이를 기준으로 각각 10 nt 길이의 염기서열을 양쪽으로 표시한 것으로서, 총 길이 21 nt의 서열이 표시된 것이다. 또한, r로 표시한 염기가 예를 들어, 다수 대립유전자인 T 또는 소수 대립유전자인 C로 확인된 경우 서열목록의 식별번호 <223> 항목에 r = t or c로 표시하였다. 상기 서열번호 9 내지 서열번호 12의 염기서열은 개체, 특히 인간에서 SNP의 위치를 특정하기 위한 목적으로 사용되는 것이며, 따라서 상기 서열번호 9 내지 서열번호 12의 염기서열이 갖는 길이나 표시한 범위에 의해 본 발명이 제한되는 것은 아니다.
본 명세서에서, 용어 "검출"은 목적하는 물질의 존재(발현) 여부를 측정 및 확인하는 것, 또는 목적하는 물질의 존재 수준(발현 수준)의 변화를 측정 및 확인하는 것을 모두 포함하는 의미이다. 같은 맥락에서, 본 발명에서 상기 SNP의 발현수준을 측정하는 것은 발현 여부를 측정하는 것(즉, 발현 유무를 측정하는 것), 또는 상기 SNP의 질적, 양적 변화 수준을 측정하는 것을 의미한다. 상기 측정은 정성적인 방법(분석)과 정량적인 방법을 모두 포함하여 제한 없이 수행될 수 있다. SNP 존재 여부 측정에 있어서 정성적 방법과 정량적 방법의 종류는 당업계에 잘 알려져 있으며, 본 명세서에서 기술한 실험법들이 이에 포함된다. 각 방법 별로 구체적 SNP 수준 비교 방식은 당업계에 잘 알려져 있다.
본 명세서에서, 용어 "IgA 신병증(IgAN)"은 IgA 신증으로도 명명되며, 가장 흔한 사구체 신염으로서 메산지움에 polymeric IgA의 침착과 이로 인한 조직학적 손상을 동반하는 질환이다. 핵심적인 병인은 B세포로부터 galactosylation이 결핍된 이상 항체인 IgA1이 생성되는데, 이러한 이상 IgA1의 경첩부위(hinge)가 항원으로 작용하여서 자가항체와 면역복합체를 형성하는 것으로 알려져 있다.
본 명세서에서, 용어 "IgA 혈관염(IgAV)"은 헤노흐-쇤라인 자반증으로도 명명되며, 소아에서 흔하게 나타나는 혈관염이나 성인에서도 드물게 나타날 수 있다. IgA 혈관염은 IgA를 포함한 면역 복합체의 침착으로 작은 혈관을 침범하는 전신적 혈관염이다. 전형적인 증상으로는 자반증, 관절통, 복통 및 위장관 출혈, 신염 등이 있으며, 드물게 중추신경계 침범, 폐출혈 등을 보이기도 한다. 신장 침범은 말기 신부전으로 진행할 수 있는 심각한 합병증으로, 정도에 따라 장기적인 예후에 주요한 영향을 미친다.
본 명세서에서, 상기 질환은 유아 또는 소아 신병증 및/또는 혈관염일 수 있으나, 이에 제한되는 것은 아니다. 상기 유아 또는 소아는 만 18세 이하인 사람을 의미하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 명세서에서, 용어 "진단"은 특정 질병 또는 질환에 대한 한 객체의 감수성(susceptibility)을 판정하는 것, 한 객체가 특정 질병 또는 질환을 현재 가지고 있는지 여부를 판정하는 것, 특정 질병 또는 질환에 걸린 한 객체의 예후(prognosis)를 판정하는 것, 또는 테라메트릭스(therametrics)(예컨대, 치료 효능에 대한 정보를 제공하기 위하여 객체의 상태를 모니터링 하는 것)를 모두 포함하는 개념이다. 본 명세서에서, 상기 진단은 바람직하게는 조기 진단 또는 발병 예측을 의미할 수 있으나, 이에 제한되는 것은 아니다.
본 명세서에서, 상기 진단은 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단을 의미한다. 본 발명에서의 질환은 바람직하게는 유전적 소인(genetic factor)에 의하여 유발되는 유전성(hereditary) IgA 신병증 및/또는 IgA 혈관염일 수 있으며, 유전적 소인에 환경적인 영향이 더해져서 증상이 심화된 것일 수 있다.
본 명세서에서, '프라이머(primer)'는 DNA 합성의 개시점(starting point)으로 작용하는 짧은 단일가닥 올리고뉴클레오티드(single strand oligonucleotide)이다. 프라이머는 적합한 완충액(buffer)와 온도 조건에서 주형(template)인 폴리뉴클레오티드에 특이적으로 결합하고, DNA 중합효소가 프라이머에 주형 DNA에 상보적인 염기를 갖는 뉴클레오사이드 트리포스페이트를 추가하여 연결함으로써 DNA가 합성된다. 프라이머는 일반적으로 15 내지 30개의 염기서열로 이루어져 있으며, 염기 구성과 길이에 따라 주형 가닥에 결합하는 온도(melting temperature, Tm)가 달라진다. 프라이머의 서열은 주형의 일부 염기 서열과 완전하게 상보적인 서열을 가질 필요는 없으며, 주형과 혼성화되어 프라이머 고유의 작용을 할 수 있는 범위 내에서의 충분한 상보성을 가지면 충분하다. 따라서 본 발명에서 상기 SNP 부위의 cDNA 또는 genomic DNA의 염기서열을 참조하여 본 발명에 따른 검출 제제인 프라이머쌍을 용이하게 디자인할 수 있다. SNP를 검출하기 위한 프라이머는 각 유전자 서열에 완벽하게 상보적인 서열을 가질 필요는 없으며, DNA 합성을 통해 mRNA 또는 cDNA의 특정 구간을 증폭하여 mRNA의 양을 측정하려는 목적에 맞는 길이와 상보성을 갖는 것이면 충분하다. 상기 증폭 반응을 위한 프라이머는 증폭하고자 하는 mRNA의 특정 구간의 양쪽 끝부분의 주형(또는 센스, sense)과 반대편(안티센스, antisense)에 각각 상보적으로 결합하는 한 세트(쌍)으로 구성된다.
본 명세서에서, '프로브(probe)'는 특정 유전자의 mRNA나 cDNA(complementary DNA), DNA 등에 특이적으로 결합할 수 있는 짧게는 수개 내지 길게는 수백 개의 염기(base pair) 길이의 RNA 또는 DNA 등 폴리뉴클레오티드의 단편을 의미하며, 표지(labeling)되어 있어서 결합하는 대상 mRNA나 cDNA의 존재 유무, 발현양 등을 확인할 수 있다. 프로브의 선택 및 혼성화 조건은 당업계에 공지된 기술에 따라 적절하게 선택할 수 있다. 상기 프로브는 대립형질(또는 대립유전자, allele)을 검출하기 위한 진단 방법 등에 사용될 수 있다. 상기 진단 방법에는 서던 블롯 등과 같은 핵산의 혼성화에 근거한 검출 방법들이 포함되며, DNA 칩을 이용한 방법에서 DNA 칩의 기판에 미리 결합된 형태로 제공될 수도 있다. 본 발명에서 상기 프라이머 또는 프로브는 포스포아미다이트(phosphoramidite) 고체지지체 합성법이나 기타 널리 공지된 방법을 이용하여 화학적으로 합성할 수 있다.
본 명세서에서, 프라이머 또는 프로브는 포스포아미다이트(phosphoramidite) 고체지지체 합성법이나 기타 널리 공지된 방법을 이용하여 화학적으로 합성할 수 있다. 또한 프라이머 또는 프로브는 검출하고자 하는 표적이 되는 폴리뉴클레오티드와의 혼성화를 방해하지 않는 범위에서 당해 기술분야에 공지된 방법에 따라 다양하게 변형시킬 수 있다. 이러한 변형의 예로는 메틸화, 캡화, 천연 뉴클레오티드 하나 이상의 동족체로의 치환 및 뉴클레오티드 간의 변형, 예를 들면 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등), 그리고 형광 또는 효소를 이용한 표지물질(labeling material)의 결합 등이 있다.
또한, 본 발명은 상기 조성물을 포함하는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단용 키트를 제공한다.
본 명세서에서, 상기 키트는 RT-PCR 키트 또는 마이크로어레이 칩 키트일 수 있으나, 이에 제한되는 것은 아니다.
상기 키트는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단용 마커인 SNP 마커를 증폭을 통해 확인하거나, SNP 마커의 발현 수준을 mRNA의 발현 수준을 확인함으로써 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 발병을 예측 또는 조기 진단할 수 있다.
상기 RT-PCR 키트는 상기 SNP 부위를 포함하는 핵산을 증폭할 수 있는 각각의 프라이머 쌍을 포함할 수 있으며, 그 외 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액, 데옥시뉴클레오타이드(dNTPs), Taq-중합효소 및 역전사효소와 같은 효소, DNase, RNAse 억제제, DEPC-물(DEPC-water), 멸균수 등을 포함할 수 있다. 또한 정량대조군으로 사용되는 유전자에 특이적인 프라이머 쌍을 포함할 수 있다.
상기 마이크로어레이 칩 키트는 상기 SNP 부위를 포함하는 핵산이 고정화되어 있는 기판을 갖는 마이크로어레이를 포함할 수 있다. 상기 마이크로어레이는 본 발명의 폴리뉴클레오티드, 프라이머 또는 프로브를 포함하는 것을 제외하고는 통상적인 마이크로어레이로 이루어질 수 있다. 마이크로어레이 상에서의 핵산의 혼성화 및 혼성화 결과의 검출은 당업계에 잘 알려져 있다. 상기 검출은 예를 들면, 핵산 시료를 형광 물질, 예를 들면, Cy3 및 Cy5와 같은 물질을 포함하는 검출 가능한 신호를 발생시킬 수 있는 표지 물질로 표지한 다음, 마이크로어레이 상에 혼성화하고 상기 표지 물질로부터 발생하는 신호를 검출함으로써 혼성화 결과를 검출할 수 있다.
본 발명에서 용어 "개체" 또는 "대상체"는 발병 예측 또는 진단을 하기 위한 피험자를 의미한다.
본 발명에서 "시료"는 발병 예측 또는 진단하고자 하는 대상체로부터 채취된 것이라면 제한없이 사용할 수 있으며, 예를 들어 생검 등으로 얻어진 세포나 조직, 혈액, 전혈, 혈청, 혈장, 타액, 뇌척수액, 각종 분비물, 소변, 대변 등일 수 있다. 바람직하게는 혈액, 혈장, 혈청, 타액, 비액, 객담, 복수, 질 분비물 및 소변으로 이루어진 군에서 선택될 수 있으며, 바람직하게는 혈액, 혈장, 혈청, 신장 조직 또는 신장 사구체 조직일 수 있다. 상기 시료는 검출 또는 진단에 사용하기 전에 전처리할 수 있다. 예를 들어, 균질화(homogenization), 여과, 증류, 추출, 농축, 방해 성분의 불활성화, 시약의 첨가 등을 포함할 수 있다.
또한, 본 발명은 피검체로부터 수득한 시료 중의 SNP 부위의 염기서열에 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 단일염기다형성이 존재하는 경우, 피검체가 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환에 걸린 것으로 판정하는 단계를 포함하는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단에 필요한 정보를 제공하는 방법을 제공한다.
또한, 본 발명은 피검체로부터 수득한 시료 중의 SNP 부위의 염기서열에 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 단일염기다형성이 존재하는 경우, 피검체가 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환에 걸릴 위험이 높은 것으로 판정하는 단계를 포함하는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 발병 예측에 필요한 정보를 제공하는 방법을 제공한다.
본 명세서에서, 상기 방법은 시퀀싱(sequencing), 엑솜 시퀀싱(exome sequencing), 마이크로어레이에 의한 혼성화(microarray hybridization), 대립유전자 특이적인 PCR(allele specific PCR), 다이나믹대립유전자 혼성화 기법(dynamic allele-specific hybridization), PCR 연장 분석 및 Taqman 기법으로 이루어진 군으로부터 선택되는 하나 이상의 방법으로 수행될 수 있으나, 이에 제한되는 것은 아니다.
본 발명은 다양한 변환을 가할 수 있고 여러 가지 실시예를 가질 수 있는 바, 특정 실시예들을 도면에 예시하고 상세한 설명에 상세하게 설명하고자 한다. 그러나 이는 본 발명을 특정한 실시 형태에 대해 한정하려는 것이 아니며, 본 발명의 사상 및 기술 범위에 포함되는 모든 변환, 균등물 내지 대체물을 포함하는 것으로 이해되어야 한다. 본 발명을 설명함에 있어서 관련된 공지 기술에 대한 구체적인 설명이 본 발명의 요지를 흐릴 수 있다고 판단되는 경우 그 상세한 설명을 생략한다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1. 실험 방법
1.1 대상
사전 동의한 총 127명이 본 연구에 등록되었다. 총 2단계 분석을 수행하였다. 1단계(발견 코호트, discovery cohort)는 101 케이스로 구성되었고, 2단계(유효성 코호트, validation cohort)는 26가지의 추가 케이스에서 발견코호트에서 식별된 가장 유의한 SNP의 복제 분석을 수행하였다. 한국 표준 게놈 데이터베이스(KRGDB; http://coda.nih.go.kr/coda/KRGDB/)에서 평가한 397명의 일반 한국인에 대한 전체 게놈 시퀀싱 데이터(depth>30x)를 승인 하에 정상 대조군 세트로 사용하였다. 127명 케이스는 18세 이전에 진단을 받고, 소아 신장 센터 2곳(서울대학교 어린이 병원 및 부천 성모병원)에서 진단된 IgAN(IgA Nephropathy) 환자(n=57) 또는 신염이 있거나 없는 IgAV(IgA Vasculitis) 환자(n=70)를 포함하였다. 모든 IgAN 환자는 신장 생검을 통해 진단되었다. IgAV의 진단은 임상적으로, 류마티스/소아 류마티스 국제 시험 기관/소아 류마티스 유럽 사회 기준에 따라 임상적으로 이루어졌다 : 자반증(purpura) 또는 하대정맥 우세를 동반한 출혈점(petechial) 및 다음 네가지 증상 중 하나 이상(급성 발병 복통; 백혈구파괴혈관염(leukocytoclastic vasculitis)을 나타내는 조직병리학 또는 우세한 IgA 침착을 동반한 증식성 사구체신염; 관절통 또는 관절염; 및 신장 침범(renal involvement) 등의 증상). IgA 신병증이라고도 불리는 신장 침범은 질병 과정 중 IgAV 환자가 단백뇨 또는 혈뇨가 있을 때로 정의된다. 전신 홍반성 루푸스, 만성 간염, 당뇨병 또는 암을 포함하는 다른 상태에의 이차적인 IgAN 또는 IgAV는 제외하였다. 1단계에는 IgAN 환자 48명, IgAV 환자 10명 및 IgAV 신병증(IgAVN) 환자 43명이 포함되었고, 2단계에는 IgAN 환자 9명, IgAV 환자 12명, IgAV 신병증(IgAVN) 환자 5명이 포함되었다. 연구 절차는 헬싱키 선언에 따라 수행하였다. 가톨릭대학교 부천 성모 병원(IRB No. HC18TNDI0012)과 서울대학교 병원(1808-157-967)의 기관 심사위원회로부터 본 연구를 승인받았다. 모든 참가자 및 보호자로부터 서면 동의서를 받았다.
1.2 유전자형 분석
EDTA로 코팅된 튜브에서 수집된 말초 혈액 샘플로부터 대상체의 게놈 DNA를 추출하였다. 한국 바이오 뱅크 어레이(DNA Link Inc., Seoul, Korea)에서 게놈 DNA 샘플을 유전자형으로 만들었다.
4개의 SNP 마커 검증을 위해, 발견 단계에서 이미 유전자형화(genotyped)된 14개의 샘플 및 발견 단계에서 사용되지 않은 26개의 샘플의 게놈 DNA를 생어시퀀싱(Cosmo GeneTech, Seoul, Korea)에 의해 별도로 준비하고 유전자형화하였다.
rs4926802, rs147294199, rs9428555 및 rs11660485의 생어시퀀싱에 4개의 프라이머쌍을 사용하였다: ACTGAAAGCAATGGCTCAAAC(서열번호 1, rs9428555_F), GTGTCTGACTTACTTCACTTAATATGC(서열번호 2, rs9428555_R), GAGCCAGATGCCTTACACCA(서열번호 3, rs4926802_F), TAAGACATTTCAATCCAGCACAGC(서열번호 4, rs4926802_R), TTGGCAGCTGGACTTACTGTT(서열번호 5, rs147294199_F), CTTGGGATTCCTTCCAGGCT(서열번호 6, rs147294199_R), 및 CATGGCCTTGATTCAATCCT(서열번호 7, rs11660485_F), TTGGAACTTGGTGTAAATGAGA(서열번호 8, rs11660485_R).
1.3 후보 SNP 마커 식별 및 통계 분석
한국 바이오 뱅크 어레이의 827,783개의 SNP 마커 중 SNPolisher 패키지(Affymetrix)에서 '권장'에 할당된 상염색체 SNP만 선택하였다. 또한, 유전자형 호출 속도(genotype call rates)<0.05, HWE(Hardy-Weinberg Equilibrium) p-값>10-6, 마이너 대립 유전자 빈도(MAF)<0.001인 SNP를 선택하였다. 이들 필터를 적용한 후, PLINK 1.919를 사용하여 509,500개의 SNP 마커에 대해 결합 테스트를 수행하였다. 연관성 시험의 p-값이 5 × 10-8 미만인 SNP를 후보 SNP로 판단하였다.
실시예 2. 발견 단계에서 4개의 SNP 식별 확인
발견 단계에서, 한국 바이오 뱅크 어레이를 사용하여 확인된 5억개 이상의 SNP 유전자형에 기초한 101건의 케이스와 397건의 건강한 대조군에 대해 연관성 테스트를 수행하였다.
환자의 인구 통계 및 임상 정보는 표 1에 요약하였다.
또한, 표 2에 나타난 바와 같이, p-값<5 × 10-8을 적용함으로써, 4개의 SNP 마커를 선택하였고, 추가 검증을 위한 후보 마커로 간주하였다.

Total
(n=127)		 Discovery stage(n=101) Validation stage(n=26)
IgAN
(n=48)		 IgAVN
(n=43)		 IgAV
(n=10)		 IgAN
(n=9)		 IgAVN
(n=5)		 IgAV
(n=12)
Demographics
Sex(n, M/F) 76/51 32/16 26/17 4/6 5/4 2/3 7/5
Age at diagnosis(year)* 9.2
(6.4, 13.2)		 12.5
(8.8, 15.3)		 8.1
(6, 10.6)		 5.8
(4.4, 7.9)		 10.9
(6.3, 14)		 7.9
(6.3, 16.4)		 7.3
(5.4, 8.8)
Age at sampling(year)* 10.1
(7, 14.2)		 13.6
(9.9, 16.4)		 9.3
(6.5, 12.3)		 6.4
(4.5, 8.3)		 13.5
(6.3, 16.4)		 7.9
(6.3, 16.3)		 7.4
(5.4, 8.8)
Family history(n) 5 3 0 1 0 1 0
Laboratory findings
Serum creatinine(mg/dL)* 0.48
(0.4, 0.64)		 0.6
(0.5, 0.81)		 0.45
(0.39, 0.51)		 0.39
(0.33, 0.46)		 0.46
(0.35, 0.59)		 0.48
(0.45, 0.55)		 0.44
(0.37, 0.55)
Serum albumin(g/dL)* 3.9
(3.3, 4.3)		 3.9
(3.43, 4.2)		 3.6
(3.15, 4.15)		 4.55
(4.18, 4.83)		 3.5
(3.25, 4.05)		 4.05
(3.43, 4.43)		 4.85
(4.73, 4.9)
Urine protein to creatinine ratio* 1.49
(0.31, 3.39)		 1.35
(0.36, 2.8)		 2.67
(0.59, 5.11)		 0.18
(0.15, 0.22)		 1.74
(0.84, 2.52)		 4.16
(1.3, 8.08)		 0.24
(0.12, 0.32)
Pathologic findings n=48 n=20 n=9 n=4
Glomerulosclerosis (n, %) 26, 54.2% 12, 60% NA 4, 44.4% 1, 25% NA
Diffuse mesangial hypercellularity(n,%) 32, 66.7% 14, 70% 7, 77.8% 2, 50%
Tubular atrophy(n,%) 11, 22.9% 2, 10% 4, 44.4% 1, 25%
Chr Position dbSNP ID Gene Major allele Minor allele MAF
(Case) 		MAF
(Control)
1 47571902 rs4926802 CYP4Z1 T C 0.198 0.01511
1 55085605 rs147294199 FAM151A C T 0.2857 0.001259
1 243071634 rs9428555 intergenic A G 0.325 0.03526
18 42866471 rs11660485 SLC14A2 A C 0.2526 0.01008
실시예 3. 생어시퀀싱을 통한 SNP rs9428555의 검증 확인
어레이에 의해 식별된 유전자형이 올바른지 여부를 확인하기 위해, 발견 단계에서 이미 사용된 게놈 DNA 샘플을 사용하여 4개의 SNP에 대한 생어시퀀싱을 수행 하였다. 마이너 대립 유전자 변이체(들)를 갖는 8개의 샘플이 각각의 SNP에 대해 사용되었고, 총 14개의 샘플을 사용하였다.
그 결과, 표 3에 나타난 바와 같이, SNP rs9428555가 유의미한 마커인 것으로 검증되었다.
Sample ID rs4926802 rs147294199 rs9428555 rs11660485
Array Sanger Array Sanger Array Sanger Array Sanger
PE008 TC TT TT CC AG AG - -
PE021 TC TC - - - - AC AA
PE025 TC TT CT CC AG AG - -
PE030 - - TT CC - - - -
PE034 - - CT CC AG AG AC AA
PE035 - - - - GG AG CC AA
PE039 TC TT - - - - - -
PE040 - - TT CC - - - -
PE045 - - CT CC AG AG AC AA
PE057 - - - - AG AG CC AA
PE071 TC TT - - - - CC AA
PE088 TC TC CT CC AG AG AC AA
PE101 TC TT CT CC AG AG AC AA
PE109 TC TT - - - - - -
실시예 4. 독립 샘플에 대한 생어시퀀싱 검증 확인
추가 검증 단계에서는 발견 단계에 포함되지 않은 26명의 환자의 혈액 샘플을 사용하였다. 수(n = 26)는 비교적 작지만 동아시아에서는 변형(rs9428555)이 매우 드물기 때문에, 상기 수의 케이스를 사용한 검증이 적절하다고 판단하였다.
그 결과, 발견 단계의 MAF는 0.2885로 아프리카인을 제외한 모든 인구의 MAF보다 유의하게 높은 것으로 나타났다(동아시아 MAF= 0.0278).
뿐만 아니라, IgAN(n=9)의 MAF는 0.278, IgAVN(n=5)의 MAF는 0.2, IgAV(n=12)의 MAF는 0.33으로 결과값이 유사함을 확인하였다.
또한, 표 5에 나타난 바와 같이, 26명 중 15명의 환자가 SNP 마커의 마이너 대립 유전자(G)를 가지고 있음을 확인하였다.
또한, 표 6에 나타난 바와 같이, 1000개 게놈 전세계 인구 기반으로 한 rs9428555의 LD(linkage disequilibrium) proxy 결과 rs2502349, rs2491835, rs2502353이 rs9428555와 강한 linkage 관계에 있는 것을 확인하였다.
인종 1000 게놈 gnomAD 게놈
전세계 0.1855 0.146
아프리카 0.4887 0.4095
동아시아 0.0278 0.02191
유럽 0.0398 0.04778
남아시아 0.168 0
아메리카 0.073 -
라틴 - 0.06383
아슈케나즈 유대인 - 0.04514
기타 - 0.08564
Sample ID rs9428555 Sample ID rs9428555
VPE001 AA VPE014 AG
VPE002 AA VPE015 AA
VPE003 AA VPE016 AG
VPE004 AA VPE017 AG
VPE005 AG VPE018 AA
VPE006 AA VPE019 AG
VPE007 AG VPE020 AG
VPE008 AG VPE021 AA
VPE009 AG VPE022 AG
VPE010 AA VPE023 AA
VPE011 AG VPE024 AG
VPE012 AG VPE025 AG
VPE013 AA VPE026 AG
dbSNP ID Coordinate
in Chr 1		 MAF Distance D′ R2 Correlated
Alleles
rs9428555
(query)		 243071634 0.1855 0 1 1 A=A,G=G
rs2502349 243071698 0.1859 64 1 0.9974 A=G,G=A
rs2491835 243071499 0.1859 -135 1 0.9974 A=A,G=T
rs2502353 243073112 0.1865 1478 1 0.9934 A=C,G=T
상기 실시예에 따라 신병증, 혈관염 및 신병증이 동반된 혈관염에서 임상적 유의성이 있다고 판단되는 SNP들이 선별되었는 바, 본 발명의 SNP는 신병증, 혈관염 및 신병증이 동반된 혈관염의 조기 진단 및 발병 예측에 유용하게 이용할 수 있을 것으로 기대된다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가지는 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명자들은 신병증 및 혈관염 환자들의 유전체 DNA의 단백질 코딩 부위를 분석한 결과, 단일염기다형성(SNP) 부위인 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353이 신병증 및 혈관염, 특히 IgA 신병증 및 IgA 혈관염 환자와 밀접하게 연관되어 있는 것을 규명하였으며, 이를 이용하여 신병증 및 혈관염의 진단 또는 발병 예측을 위한 유전자 진단 시약을 개발하는데 이용할 수 있으므로, 본 발명은 산업상 이용가능성이 있다.

Claims (14)

  1. dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 SNP의 검출 제제를 포함하는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단 또는 발병 예측용 조성물.
  2. 제1항에 있어서,
    상기 질환은 유아 또는 소아에서 발병된 것을 특징으로 하는, 진단 또는 발병 예측용 조성물.
  3. 제1항에 있어서,
    상기 질환은 한국인에서 발병된 것을 특징으로 하는, 진단 또는 발병 예측용 조성물.
  4. 제1항에 있어서,
    상기 검출 제제는 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 SNP를 검출할 수 있는 프로브인 것을 특징으로 하는, 진단 또는 발병 예측용 조성물.
  5. 제1항에 있어서,
    상기 검출 제제는 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 SNP를 검출할 수 있는 프라이머인 것을 특징으로 하는, 진단 또는 발병 예측용 조성물.
  6. 제5항에 있어서,
    상기 프라이머는 서열번호 1 및 2로 이루어진 군으로부터 선택된 염기서열을 포함하는 것을 특징으로 하는, 진단 또는 발병 예측용 조성물.
  7. 제1항의 조성물을 포함하는, IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단용 키트.
  8. 제7항에 있어서,
    상기 키트는 RT-PCR 키트 또는 마이크로어레이 칩 키트인 것을 특징으로 하는, 키트.
  9. 피검체로부터 수득한 시료 중의 SNP 부위의 염기서열에 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 단일염기다형성이 존재하는 경우, 피검체가 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환에 걸린 것으로 판정하는 단계를 포함하는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단에 필요한 정보를 제공하는 방법.
  10. 피검체로부터 수득한 시료 중의 SNP 부위의 염기서열에 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 단일염기다형성이 존재하는 경우, 피검체가 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환에 걸릴 위험이 높은 것으로 판정하는 단계를 포함하는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 발병 예측에 필요한 정보를 제공하는 방법.
  11. 제9항 또는 제10항에 있어서,
    상기 방법은 시퀀싱(sequencing), 엑솜 시퀀싱(exome sequencing), 마이크로어레이에 의한 혼성화(microarray hybridization), 대립유전자 특이적인 PCR(allele specific PCR), 다이나믹대립유전자 혼성화 기법(dynamic allele-specific hybridization), PCR 연장 분석 및 Taqman 기법으로 이루어진 군으로부터 선택되는 하나 이상의 방법으로 수행되는 것을 특징으로 하는, 방법.
  12. dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 SNP의 검출 제제를 포함하는 조성물의 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단 또는 발병 예측 용도.
  13. 피검체로부터 수득한 시료 중의 SNP 부위의 염기서열에 dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 단일염기다형성이 존재하는 경우, 피검체가 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환에 걸린 것으로 판정하는 단계를 포함하는 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단 또는 발병 예측 방법.
  14. dbSNP 데이터베이스 rs9428555, rs2502349, rs2491835 및 rs2502353으로 이루어진 군으로부터 선택된 하나 이상의 SNP의 검출 제제의 IgA 신병증, IgA 혈관염 및 IgA 신병증을 동반한 IgA 혈관염으로 이루어진 군으로부터 선택된 질환의 진단 또는 발병 예측용 제제의 생산을 위한 용도.
PCT/KR2021/009623 2020-08-05 2021-07-26 면역글로불린 a 신병증 및 혈관염 진단용 snp 마커 및 이를 이용한 진단 방법 WO2022030840A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200098087A KR102409336B1 (ko) 2020-08-05 2020-08-05 면역글로불린 a 신병증 및 혈관염 진단용 snp 마커 및 이를 이용한 진단 방법
KR10-2020-0098087 2020-08-05

Publications (1)

Publication Number Publication Date
WO2022030840A1 true WO2022030840A1 (ko) 2022-02-10

Family

ID=80117421

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/009623 WO2022030840A1 (ko) 2020-08-05 2021-07-26 면역글로불린 a 신병증 및 혈관염 진단용 snp 마커 및 이를 이용한 진단 방법

Country Status (2)

Country Link
KR (1) KR102409336B1 (ko)
WO (1) WO2022030840A1 (ko)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170226586A1 (en) * 2011-02-17 2017-08-10 The Trustees Of Columbia University In The City Of New York Methods for Identifying Subjects with a Genetic Risk for Developing IgA Nephropathy

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170226586A1 (en) * 2011-02-17 2017-08-10 The Trustees Of Columbia University In The City Of New York Methods for Identifying Subjects with a Genetic Risk for Developing IgA Nephropathy

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
JEONG KYUNG HWAN, KIM JIN SUG, LEE YU HO, KIM YANG GYUN, MOON JU-YOUNG, KIM SU KANG, KANG SUN WOO, KIM TAE HEE, LEE SANG HO, KIM Y: "Genome-wide association study identifies new susceptible loci of IgA nephropathy in Koreans", BMC MEDICAL GENOMICS, vol. 12, no. 1, 1 December 2019 (2019-12-01), XP055894474, DOI: 10.1186/s12920-019-0568-6 *
QIN XIAOSONG; WANG CHEN; LU GUANTING; PENG MENGLE; CHENG GUIXUE; ZHU HONGQUAN; CAO YUN; LIU JIANHUA; LI YUZHONG; CAI HONG; YANG FU: "Risk alleles for IgA nephropathy-associated SNPs conferred completely opposite effects to idiopathic membranous nephropathy in Chinese Han", IMMUNOLOGIC RESEARCH., HUMANA PRESS, INC, US, vol. 65, no. 5, 19 September 2017 (2017-09-19), US , pages 1059 - 1064, XP036328541, ISSN: 0257-277X, DOI: 10.1007/s12026-017-8947-6 *
SEO, JINSUN: "A study on Single Nucleotide Polymorphism Analysis and Renal Expression of Intrinsic Immunity-Related Protein Specific for the Occurrence of IgA Nephritis in Korean children and adolescents for customized treatment", BASIC RESEARCH PROJECT FINAL (RESULT) REPORT. HOST RESEARCH INSTITUTE: CATHOLIC UNIVERSITY. HOST DEPARTMENT: MINISTRY OF SCIENCE AND ICT, 29 July 2020 (2020-07-29), pages 1 - 15 *
SHI MANMAN, OUYANG YAN, YANG MINGXIN, YANG MENG, ZHANG XIAOYAN, HUANG WEI, WANG WEIMING, WANG ZHAOHUI, ZHANG WEN, CHEN XIAONONG, P: "IgA Nephropathy Susceptibility Loci and Disease Progression", CLINICAL JOURNAL OF THE AMERICAN SOCIETY OF NEPHROLOGY, vol. 13, no. 9, 7 September 2018 (2018-09-07), pages 1330 - 1338, XP055894472, ISSN: 1555-9041, DOI: 10.2215/CJN.13701217 *

Also Published As

Publication number Publication date
KR102409336B1 (ko) 2022-06-16
KR20220018130A (ko) 2022-02-15

Similar Documents

Publication Publication Date Title
US9994898B2 (en) Materials and methods for identifying spinal muscular atrophy carriers
KR101157526B1 (ko) 주의력결핍 과잉행동장애의 진단용 ｓｎｐ와 그를 포함하는 마이크로어레이 및 키트
CN111676283B (zh) 与高原肺水肿发生相关的线粒体dna单核苷酸多态性的应用
US20110118135A1 (en) Mutations in Contaction Associated Protein 2 (CNTNAP2) are Associated with Increased Risk for Ideopathic Autism
CN111560428B (zh) 检测线粒体DNA rs3937033单核苷酸多态性的物质的用途
EP2041304B1 (en) Rgs2 genotypes associated with extrapyramidal symptoms induced by antipsychotic medication
WO2020060170A1 (ko) 아토피 피부염 진단을 위한 마커 조성물 및 이를 이용한 아토피 피부염 예측 또는 진단 방법
WO2017007275A1 (ko) 코 표현형 판단용 조성물
WO2022030840A1 (ko) 면역글로불린 a 신병증 및 혈관염 진단용 snp 마커 및 이를 이용한 진단 방법
US20110245492A1 (en) Novel allelic variant of cyp2c19 associated with drug metabolism
JP2009501541A (ja) システインジオキシゲナーゼにおける多型
WO2021107713A1 (ko) Lats1 유전자 변이 마커 기반의 근위축성 측삭경화증의 진단방법
KR101023194B1 (ko) 아토피 피부염 진단용 마커 및 그의 용도
KR101724130B1 (ko) 장 베체트병 진단용 바이오마커 및 이의 용도
EP3545102B1 (en) Determination of the genotype underlying the s-s-u- phenotype of the mnss blood group system
WO2020204313A1 (ko) Gba 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커
WO2019225803A1 (ko) Rnf213 단일염기다형성과 한국인 모야모야병 발병 위험도의 연관성
WO2023018312A1 (ko) 약물 과민반응 진단용 snp 및 이를 이용한 진단 방법
WO2022080882A1 (ko) 만성신장질환의 악화 예측 마커로서의 snp 및 이의 이용
CN115927354B (zh) 一种sh3tc2基因致病突变体及其在制备腓骨肌萎缩症4c型诊断试剂盒中的应用
KR100908125B1 (ko) 심근 경색에 관련된 유전자 다형성 및 그의 용도
KR101092580B1 (ko) 위암 감수성 예측용 ｖｃａｎ 다형성 마커 및 이를 이용한위암 감수성 예측 방법
WO2009070764A1 (en) Variation in the chi3l1 gene influences serum ykl-40 levels, asthma risk, and lung function
KR20100137907A (ko) 개인식별용 단일염기다형성 마커 및 그의 용도
WO2017222247A2 (ko) 혈우병 치료제의 효능 예측 마커 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21853072

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21853072

Country of ref document: EP

Kind code of ref document: A1