Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K39/0005—Vertebrate antigens
  • A61K39/0011—Cancer antigens
  • A61K39/001102—Receptors, cell surface antigens or cell surface determinants
  • A61K39/001103—Receptors for growth factors
  • A61K39/001106—Her-2/neu/ErbB2, Her-3/ErbB3 or Her 4/ErbB4
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P37/00—Drugs for immunological or allergic disorders
  • A61P37/02—Immunomodulators
  • A61P37/04—Immunostimulants
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
  • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
  • A61K2039/522—Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
  • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
  • A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins

Definitions

• This invention provides compositions and methods for treating and vaccinating against an Her2/neu antigen-expressing tumor and inducing an immune response against dominant and several sub-dominant epitopes of the antigen.
• Her2/neu overexpression can be detected in 25-30% of all breast cancers and is associated with aggressive disease, hormone resistance and a poor prognosis.
• Her2/neu oncogene is a potential target for immunotherapy as it is overexpressed in tumors but has limited presence in other tissues, except for the heart.
• Her-2/neu (referred to henceforth as "Her- 2") is a 185 kDa glycoprotein that is a member of the epidermal growth factor receptor (EGFR) family of tyrosine kinases, and consists of an extracellular domain, a transmembrane domain, and an intracellular domain which is known to be involved in cellular signaling (Bargmann CI et al, Nature 319: 226, 1986; King CR et al, Science 229: 974, 1985). It is overexpressed in 25 to 40% of all breast cancers and is also overexpressed in many cancers of the ovaries, lung, pancreas, and gastrointestinal tract.
• EGFR epidermal growth factor receptor
• Her-2 The overexpression of Her-2 is associated with uncontrolled cell growth and signaling, both of which contribute to the development of tumors. Patients with cancers that overexpress Her-2 exhibit tolerance even with detectable humoral, CD8 + T cell, and CD4 + T cell responses directed against Her-2.
• Listeria monocytogenes is an intracellular pathogen that primarily infects antigen presenting cells and has adapted for life in the cytoplasm of these cells.
• Host cells such as macrophages, actively phagocytose L. monocytogenes and the majority of the bacteria are degraded in the phagolysosome.
• Some of the bacteria escape into the host cytosol by perforating the phagosomal membrane through the action of a hemolysin, listeriolysin O (LLO).
• LLO listeriolysin O
• L. monocytogenes can polymerize the host actin and pass directly from cell to cell further evading the host immune system and resulting in a negligible antibody response to L. monocytogenes.
• the invention provided herein relates to an immunogenic composition
• a fusion polypeptide wherein said fusion polypeptide comprises a Her2/neu chimeric antigen fused to an additional polypeptide, and wherein administering the fusion protein to a subject having an Her2/neu-expressing tumor prevents escape mutations within said tumor.
• the invention provided herein relates to a recombinant Listeria vaccine strain comprising a nucleic acid molecule, wherein and in another embodiment, the nucleic acid molecule comprises a first open reading frame encoding a polypeptide, wherein said polypeptide comprises a Her2/neu chimeric antigen, wherein the nucleic acid molecule further comprises a second open reading frame encoding a metabolic enzyme, and wherein the metabolic enzyme complements an endogenous gene that is lacking in the chromosome of the recombinant Listeria strain.
• FIG. 1 Construction of ADXS31-164.
• A Plasmid map of pAdvl64, which harbors bacillus sabtilis dal gene under the control of constitutive Listeria p60 promoter for complementation of the chromosomal dal-dat deletion in LmddA strain. It also contains the fusion of truncated LLO ( i_ 4 4i) to the chimeric human Her2/neu gene, which was constructed by the direct fusion of 3 fragments the Her2/neu: ECl (aa 40-170), EC2 (aa 359-518) and ICI (aa 679-808).
• FIG. 1 Immunogenic properties of ADXS31-164
• A Cytotoxic T cell responses elicited by Her2/neu Listeria-b&sed vaccines in splenocytes from immunized mice were tested using NT-2 cells as stimulators and 3T3/neu cells as targets. Lm-control was based on the LmddA background that was identical in all ways but expressed an irrelevant antigen (HPV16- E7).
• B IFN- ⁇ secreted by the splenocytes from immunized FVB/N mice into the cell culture medium, measured by ELISA, after 24 hours of in vitro stimulation with mitomycin C treated NT-2 cells.
• C IFN- ⁇ secretion by splenocytes from HLA-A2 transgenic mice immunized with the chimeric vaccine, in response to in vitro incubation with peptides from different regions of the protein.
• a recombinant ChHer2 protein was used as positive control and an irrelevant peptide or no peptide groups constituted the negative controls as listed in the figure legend.
• IFN- ⁇ secretion was detected by an ELISA assay using cell culture supernatants harvested after 72 hours of co-incubation. Each data point was an average of triplicate data +/- standard error. * P value ⁇ 0.001.
• FIG. 3 Tumor Prevention Studies for Listma-ChHer2/neu Vaccines
• FVB/N mice were inoculated s.c. with 1 x 10 6 NT-2 cells and immunized three times with each vaccine at one week intervals. Spleens were harvested 7 days after the second immunization. After isolation of the immune cells, they were stained for detection of Tregs by anti CD3, CD4, CD25 and FoxP3 antibodies, dot-plots of the Tregs from a representative experiment showing the frequency of CD25 + /FoxP3 + T cells, expressed as percentages of the total CD3 + or CD3 + CD4 + T cells across the different treatment groups.
• Figure 5 Effect of immunization with ADXS31-164 on the % of tumor infiltrating Tregs in NT-2 tumors.
• FVB/N mice were inoculated s.c. with 1 x 10 6 NT-2 cells and immunized three times with each vaccine at one week intervals. Tumors were harvested 7 days after the second immunization. After isolation of the immune cells, they were stained for detection of Tregs by anti CD3, CD4, CD25 and FoxP3 antibodies.
• A dot-plots of the Tregs from a representative experiment.
• B Frequency of CD25 + /FoxP3 + T cells, expressed as percentages of the total CD3 + or CD3 + CD4 + T cells (left panel) and intratumoral CD8/Tregs ratio (right panel) across the different treatment groups. Data is shown as mean+SEM obtained from 2 independent experiments.
• FIG. 6 Vaccination with ADXS31-164 can delay the growth of a breast cancer cell line in the brain.
• Balb/c mice were immunized thrice with ADXS31-164 or a control Listeria vaccine.
• EMT6-Luc cells (5,000) were injected intracranially in anesthetized mice.
• A Ex vivo imaging of the mice was performed on the indicated days using a Xenogen X-100 CCD camera.
• FIG. 6 Pixel intensity was graphed as number of photons per second per cm2 of surface area; this is shown as average radiance.
• provided herein are methods and compositions for preventing, treating and vaccinating against a Her2-neu antigen-expressing tumor and inducing an immune response against sub-dominant epitopes of the Her2-neu antigen, while preventing an escape mutation of the tumor.
• an immunogenic composition comprising a fusion polypeptide, wherein said fusion polypeptide comprises a Her2/neu chimeric antigen fused to an additional polypeptide, and wherein administering the fusion protein to a subject having an Her2/neu-expressing tumor prevents escape mutations within said tumor.
• a recombinant Listeria vaccine strain comprising the immunogenic composition.
• a recombinant Listeria vaccine strain comprising a nucleic acid molecule, wherein the nucleic acid molecule comprises a first open reading frame encoding a polypeptide, wherein the polypeptide comprises a Her2/neu chimeric antigen, wherein the nucleic acid molecule further comprises a second open reading frame encoding a metabolic enzyme, and wherein the metabolic enzyme complements an endogenous gene that is lacking in the chromosome of the recombinant Listeria strain.
• the recombinant Listeria vaccine strain further comprises a third open reading frame encoding a metabolic enzyme, and wherein the metabolic enzyme complements an endogenous gene that is lacking in the chromosome of the recombinant Listeria strain.
• a recombinant Listeria vaccine strain comprising a nucleic acid molecule, wherein the nucleic acid molecule comprises a first open reading frame encoding a polypeptide, wherein the polypeptide comprises a Her2/neu chimeric antigen, wherein the nucleic acid molecule further comprises a second and a third open reading frame each encoding a metabolic enzyme, and wherein the metabolic enzyme complements an endogenous gene that is lacking in the chromosome of said recombinant Listeria strain.
• the nucleic acid molecule is integrated into the Listeria genome.
• the nucleic acid molecule is in a plasmid in the recombinant Listeria vaccine strain.
• the plasmid is stably maintained in the recombinant Listeria vaccine strain in the absence of antibiotic selection. In another embodiment, the plasmid does not confer antibiotic resistance upon the recombinant Listeria. In another embodiment, the recombinant Listeria strain is attenuated. In another embodiment, the recombinant Listeria is an attenuated auxotrophic strain. In another embodiment, the high metabolic burden that the expression of a foreign antigen exerts on a bacterium such as one of the present invention is also an important mechanism of attenuation.
• the attenuated strain is Lmdda.
• this strain exerts a strong adjuvant effect which is an inherent property of Listeria-b&sed vaccines.
• One manifestation of this adjuvant effect is the 5 -fold decrease in the number of the intratumoral Tregs caused by either the irrelevant Listeria or the ADXS-31-164 vaccines (see Figure 5 herein).
• the LmddA vector expressing an irrelevant antigen HPV16 E7 is also associated with a significant decrease in the frequency of Tregs in the tumors, likely as a consequence of innate immunity responses.
• the attenuated auxotrophic Listeria vaccine strain is the ADXS- 31-164 strain.
• ADXS-31-164 is based on a Listeria vaccine vector which is attenuated due to the deletion of virulence gene actA and retains the plasmid for Her2/neu expression in vivo and in vitro by complementation of dal gene.
• ADXS31-164 expresses and secretes the chimeric Her2/neu protein fused to the first 441 amino acids of listeriolysin O (LLO).
• LLO listeriolysin O
• ADXS31-164 exerts strong and antigen specific anti-tumor responses with ability to break tolerance toward HER2/neu in transgenic animals (see Examples).
• the ADXS31-164 strain is highly attenuated and has a better safety profile than previous Listeria vaccine generation, as it is more rapidly cleared from the spleens of the immunized mice. In another embodiment, the ADXS31-164 results in a longer delay of tumor onset in transgenic animals than Lm-LLO-ChHer2, the antibiotic resistant and more virulent version of this vaccine (see Figure 3). In another embodiment, ADXS31-164 strain is highly immunogenic, able to break tolerance toward the HER2/neu self-antigen and prevent tumor formation in Her2/neu transgenic animals. In another embodiment, ADXS31-164 causes a significant decrease in intra-tumoral T regulatory cells (Tregs).
• the lower frequency of Tregs in tumors treated with LmddA vaccines resulted in an increased intratumoral CD8/Tregs ratio, suggesting that a more favorable tumor microenvironment can be obtained after immunization with LmddA vaccines.
• the use of this chimeric antigen does not result in escape mutations indicating that tumors do not mutate away from a therapeutic efficacious response to treatment with this novel antigen (see example 6).
• peripheral immunization with ADXS31-164 delays the growth of a metastatic breast cancer cell line in the brain (see Example 7).
• the Lm-LLO-ChHer2 strain is Lm-LLO-138.
• recombinant attenuated, antibiotic-free Zisien ' a-expressing chimeric antigens are useful for preventing, and treating a cancer or solid tumors, as exemplified herein.
• recombinant Listeria expressing a chimeric Her2/neu are useful as a therapeutic vaccine for the treatment of Her2/neu overexpressing solid tumors.
• the Her2/neu chimeric antigen provided herein is useful for treating Her2/neu-expressing tumors and preventing escape mutations of the same.
• the term "escape mutation" refers to a tumor mutating away from a therapeutic efficacious response to treatment.
• nucleic acid molecule comprising a first open reading frame encoding the immunogenic composition, wherein the nucleic molecule resides within the recombinant Listeria vaccine strain.
• nucleic acid molecule provided herein is used to transform the Listeria in order to arrive at a recombinant Listeria.
• nucleic acid provided herein lacks a virulence gene.
• nucleic acid molecule integrated into the Listeria genome carries a non-functional virulence gene.
• the virulence gene is mutated in the recombinant Listeria.
• the nucleic acid molecule is used to inactivate the endogenous gene present in the Listeria genome.
• the virulence gene is an ActA gene.
• the virulence gene is a Prf A gene.
• the virulence gene can be any gene known in the art to be associated with virulence in the recombinant Listeria.
• the metabolic gene, the virulence gene, etc. is lacking in a chromosome of the Listeria strain. In another embodiment, the metabolic gene, virulence gene, etc. is lacking in the chromosome and in any episomal genetic element of the Listeria strain. In another embodiment, the metabolic gene, virulence gene, etc. is lacking in the genome of the virulence strain. In one embodiment, the virulence gene is mutated in the chromosome. In another embodiment, the virulence gene is deleted from the chromosome. Each possibility represents a separate embodiment of the present invention.
• the metabolic gene, the virulence gene, etc. is lacking in a chromosome of the Listeria strain. In another embodiment, the metabolic gene, virulence gene, etc. is lacking in the chromosome and in any episomal genetic element of the Listeria strain. In another embodiment, the metabolic gene, virulence gene, etc. is lacking in the genome of the virulence strain. In one embodiment, the virulence gene is mutated in the chromosome. In another embodiment, the virulence gene is deleted from the chromosome. Each possibility represents a separate embodiment of the present invention.
• nucleic acids and plasmids provided herein do not confer antibiotic resistance upon the recombinant Listeria.
• Nucleic acid molecule refers, in another embodiment, to a plasmid.
• the term refers to an integration vector.
• the term refers to a plasmid comprising an integration vector.
• the integration vector is a site- specific integration vector.
• a nucleic acid molecule of methods and compositions of the present invention are composed of any type of nucleotide known in the art. Each possibility represents a separate embodiment of the present invention.
• Metal enzyme refers, in another embodiment, to an enzyme involved in synthesis of a nutrient required by the host bacteria. In another embodiment, the term refers to an enzyme required for synthesis of a nutrient required by the host bacteria. In another embodiment, the term refers to an enzyme involved in synthesis of a nutrient utilized by the host bacteria. In another embodiment, the term refers to an enzyme involved in synthesis of a nutrient required for sustained growth of the host bacteria. In another embodiment, the enzyme is required for synthesis of the nutrient. Each possibility represents a separate embodiment of the present invention. [00030] "Stably maintained” refers, in another embodiment, to maintenance of a nucleic acid molecule or plasmid in the absence of selection (e.g.
• the period is 15 generations. In another embodiment, the period is 20 generations. In another embodiment, the period is 25 generations. In another embodiment, the period is 30 generations. In another embodiment, the period is 40 generations. In another embodiment, the period is 50 generations. In another embodiment, the period is 60 generations. In another embodiment, the period is 80 generations. In another embodiment, the period is 100 generations. In another embodiment, the period is 150 generations. In another embodiment, the period is 200 generations. In another embodiment, the period is 300 generations. In another embodiment, the period is 500 generations. In another embodiment, the period is more than generations. In another embodiment, the nucleic acid molecule or plasmid is maintained stably in vitro (e.g. in culture).
• nucleic acid molecule or plasmid is maintained stably in vivo. In another embodiment, the nucleic acid molecule or plasmid is maintained stably both in vitro and in vitro.
• each possibility represents a separate embodiment of the present invention.
• the present invention provides a recombinant Listeria strain expressing the antigen.
• the present invention also provides recombinant peptides comprising a listeriolysin (LLO) protein fragment fused to a Her-2 chimeric protein or fragment thereof, vaccines and immunogenic compositions comprising same, and methods of inducing an anti- Her-2 immune response and treating and vaccinating against a Her-2-expressing tumor, comprising the same.
• LLO listeriolysin
• a recombinant Listeria strain of the present invention has been passaged through an animal host.
• the passaging maximizes efficacy of the strain as a vaccine vector.
• the passaging stabilizes the immunogenicity of the Listeria strain.
• the passaging stabilizes the virulence of the Listeria strain.
• the passaging increases the immunogenicity of the Listeria strain.
• the passaging increases the virulence of the Listeria strain.
• the passaging removes unstable substrains of the Listeria strain.
• the passaging reduces the prevalence of unstable sub-strains of the Listeria strain.
• the Listeria strain contains a genomic insertion of the gene encoding the antigen-containing recombinant peptide.
• the Listeria strain carries a plasmid comprising the gene encoding the antigen-containing recombinant peptide.
• the passaging is performed by any other method known in the art.
• the polypeptide provided herein is a fusion protein comprising an additional polypeptide selected from the group consisting of: a) non-hemolytic LLO protein or N-terminal fragment, b) a PEST sequence, or c) an ActA fragment, and further wherein said additional polypeptide is fused to said Her2/neu chimeric antigen.
• the additional polypeptide is functional.
• a fragment of the additional polypeptide is immunogenic.
• the additional polypeptide is immunogenic.
• the polypeptide provided herein is a fusion protein comprising a non-hemolytic LLO protein or N-terminal fragment fused to the Her2/neu chimeric antigen.
• a fusion protein of methods and compositions of the present invention comprises an ActA sequence from a Listeria organism. ActA proteins and fragments thereof augment antigen presentation and immunity in a similar fashion to LLO.
• the fusion protein comprises the Her2/neu antigen and an additional polypeptide.
• the additional polypeptide is a non-hemolytic LLO protein or fragment thereof (Examples herein).
• the additional polypeptide is a PEST sequence.
• the additional polypeptide is an ActA protein or a fragment thereof. ActA proteins and fragments thereof augment antigen presentation and immunity in a similar fashion to LLO.
• the additional polypeptide of methods and compositions of the present invention is, in another embodiment, a listeriolysin (LLO) peptide.
• the additional polypeptide is an ActA peptide.
• the additional polypeptide is a PEST-like sequence peptide.
• the additional polypeptide is any other peptide capable of enhancing the immunogenicity of an antigen peptide.
• Fusion proteins comprising the Her2/neu chimeric antigen may be prepared by any suitable method, including, for example, cloning and restriction of appropriate sequences or direct chemical synthesis by methods discussed below. Alternatively, subsequences may be cloned and the appropriate subsequences cleaved using appropriate restriction enzymes. The fragments may then be ligated to produce the desired DNA sequence.
• DNA encoding the antigen can be produced using DNA amplification methods, for example polymerase chain reaction (PCR). First, the segments of the native DNA on either side of the new terminus are amplified separately.
• the 5' end of the one amplified sequence encodes the peptide linker, while the 3' end of the other amplified sequence also encodes the peptide linker. Since the 5' end of the first fragment is complementary to the 3' end of the second fragment, the two fragments (after partial purification, e.g. on LMP agarose) can be used as an overlapping template in a third PCR reaction.
• the amplified sequence will contain codons, the segment on the carboxy side of the opening site (now forming the amino sequence), the linker, and the sequence on the amino side of the opening site (now forming the carboxyl sequence).
• the antigen is ligated into a plasmid. Each method represents a separate embodiment of the present invention.
• the results of the present invention demonstrate that administration of compositions of the present invention has utility for inducing formation of antigen-specific T cells (e.g. cytotoxic T cells) that recognize and kill tumor cells (Examples herein).
• the present invention provides a recombinant polypeptide comprising an N-terminal fragment of an LLO protein fused to a Her-2 chimeric protein or fused to a fragment thereof. In one embodiment, the present invention provides a recombinant polypeptide consisting of an N-terminal fragment of an LLO protein fused to a Her-2 chimeric protein or fused to a fragment thereof.
• the Her-2 chimeric protein of the methods and compositions of the present invention is a human Her-2 chimeric protein.
• the Her-2 protein is a mouse Her-2 chimeric protein.
• the Her-2 protein is a rat Her-2 chimeric protein.
• the Her-2 protein is a primate Her-2 chimeric protein.
• the Her-2 protein is a Her-2 chimeric protein of any other animal species or combinations thereof known in the art. Each possibility represents a separate embodiment of the present invention.
• a Her-2 protein is a protein referred to as "HER-2/neu,” “Erbb2,” “v-erb-b2,” “c-erb-b2,” “neu,” or “cNeu.” Each possibility represents a separate embodiment of the present invention.
• the Her2-neu chimeric protein harbors two of the extracellular and one intracellular fragments of Her2/neu antigen showing clusters of MHC-class I epitopes of the oncogene, where, in another embodiment, the chimeric protein, harbors 3 H2Dq and at least 17 of the mapped human MHC-class I epitopes of the Her2/neu antigen (fragments ECl, EC2, and IC1) (See Fig. 1). In another embodiment, the chimeric protein harbors at least 13 of the mapped human MHC-class I epitopes (fragments EC2 and IC1).
• the chimeric protein harbors at least 14 of the mapped human MHC- class I epitopes (fragments ECl and IC1). In another embodiment, the chimeric protein harbors at least 9 of the mapped human MHC-class I epitopes (fragments ECl and IC2).
• the Her2-neu chimeric protein is fused to a non-hemolytic listeriolysin O (LLO). In another embodiment, the Her2-neu chimeric protein is fused to the first 441 amino acids of the Listeria-monocytogenes listeriolysin O (LLO) protein and expressed and secreted by the Listeria monocytogenes attenuated auxotrophic strain LmddA.
• the expression and secretion of the fusion protein tLLO-ChHer2 from the attenuated auxotrophic strain provided herein that expresses a chimeric Her2/neu antigen/LLO fusion protein is comparable to that of the Lm-LLO-ChHer2 in TCA precipitated cell culture supernatants after 8 hours of in vitro growth (See Figure IB).
• no CTL activity is detected in naive animals or mice injected with an irrelevant Listeria vaccine (See Figure 2A). While in another embodiment, the attenuated auxotrophic strain (ADXS31-164) provided herein is able to stimulate the secretion of IFN- ⁇ by the splenocytes from wild type FVB/N mice ( Figure 2B).
• the metabolic enzyme of the methods and compositions provided herein is an amino acid metabolism enzyme, where, in another embodiment, the metabolic enzyme is an alanine racemase enzyme. In another embodiment, the metabolic enzyme is a D-amino acid transferase enzyme. In another embodiment, the metabolic enzyme catalyzes a formation of an amino acid used for a cell wall synthesis in the recombinant Listeria strain, where in another embodiment, the metabolic enzyme is an alanine racemase enzyme. [00045] In another embodiment, the gene encoding the metabolic enzyme is expressed under the control of the Listeria p60 promoter. In another embodiment, the inlA (encodes internalin) promoter is used. In another embodiment, the hly promoter is used.
• the ActA promoter is used.
• the integrase gene is expressed under the control of any other gram positive promoter.
• the gene encoding the metabolic enzyme is expressed under the control of any other promoter that functions in Listeria.
• promoters or polycistronic expression cassettes may be used to drive the expression of the gene. Each possibility represents a separate embodiment of the present invention.
• the Her-2 chimeric protein is encoded by the following nucleic acid sequence set forth in SEQ ID NO: 1 gagacccacctggacatgctccgccacctctaccagggctgccaggtggtgcagggaaacctggaactcacctacctgcccaccaatg ccagcctgtccttcctgcaggatatccaggaggtgcagggctacgtgctcatcgctcaaccaagtgaggcaggtcccactgcagag gctgcggattgtgcgaggcacccagctctttgaggacaactatgccctggccgtgctagacaatggagacccgctgaacaataccacccctgaacaataccaccc ctgcccaggaggcctgcgcgcccaggaggcctgcgcgcccaggagg
• the Her-2 chimeric protein has the sequence:
• the Her2 chimeric protein or fragment thereof of the methods and compositions provided herein does not include a signal sequence thereof. In another embodiment, omission of the signal sequence enables the Her2 fragment to be successfully expressed in Listeria, due the high hydrophobicity of the signal sequence. Each possibility represents a separate embodiment of the present invention.
• the fragment of a Her2 chimeric protein of methods and compositions of the present invention does not include a transmembrane domain (TM) thereof. In one embodiment, omission of the TM enables the Her-2 fragment to be successfully expressed in Listeria, due the high hydrophobicity of the TM. Each possibility represents a separate embodiment of the present invention.
• the nucleic acid sequence of rat-Her2/neu gene is
• the nucleic acid sequence encoding the rat/her2/neu ECl fragment is
• nucleic acid sequence encoding the rat her2/neu EC2 fragment is:
• nucleic acid sequence encoding the rat her2/neu ICl fragment is:
• nucleic acid sequence of human- Her2/neu gene is:
• nucleic acid sequence encoding the human her2/neu ECl fragment implemented into the chimera spans from 120-510 bp of the human ECl region and is set forth in (SEQ ID NO: 50).
• the complete ECl human her2/neu fragment spans from (58-979 bp of the human her2/neu gene and is set forth in (SEQ ID NO:54).
• the nucleic acid sequence encoding the human her2/neu EC2 fragment implemented into the chimera spans from 1077-1554 bp of the human her2/neu EC2 fragment and includes a 50 bp extension, and is set forth in (SEQ ID NO:51).
• GGCCTGGCCTGCCACCAGCTGTGCGCCCGAGGG SEQ ID NO:51.
• complete EC2 human her2/neu fragment spans from 907-1504 bp of the human her2/neu gene and is set forth in (SEQ ID NO: 55).
• nucleic acid sequence encoding the complete human her2/neu ICl fragment spans from 2034-3243 of the human her2/neu gene and is set forth in (SEQ ID NO:56).
• the LLO utilized in the methods and compositions provided herein is, in one embodiment, a Listeria LLO.
• the Listeria from which the LLO is derived is Listeria monocytogenes (LM).
• the Listeria is Listeria ivanovii.
• the Listeria is Listeria welshimeri.
• the Listeria is Listeria seeligeri.
• the LLO protein is a non-Listerial LLO protein.
• the LLO protein is a synthetic LLO protein. In another embodiment it is a recombinant LLO protein.
• the LLO protein is encoded by the following nucleic acid sequence set forth in (SEQ ID NO:3) atgaaaaaaataatgctagttttattacacttatattagttagtctaccaattgcgcaacaaactgaagcaaaggatgcatctgcattcaataa agaaaattcaatttcatccatggcaccaccagcatctccgcctgcaagtcctaagacgccaatcgaaaagaaacacgcggatgaaatcg ataagtatatacaaggattggattacaataaaaacaatgtattagtataccacggagatgcagtgtgacaaatgtgccgccaagaaaaggtta caaagatggaaatgaaatgtgtgccgccaagaaaaggtta caaagatggaaatgaaatgttgccg
• the LLO protein has the sequence SEQ ID NO:4
• the first 25 amino acids of the proprotein corresponding to this sequence are the signal sequence and are cleaved from LLO when it is secreted by the bacterium.
• the full length active LLO protein is 504 residues long.
• the LLO protein has a sequence set forth in GenBank Accession No. DQ054588, DQ054589, AY878649, U25452, or U25452.
• the LLO protein is a variant of an LLO protein.
• the LLO protein is a homologue of an LLO protein. Each possibility represents a separate embodiment of the present invention.
• truncated LLO or “tLLO” refers to a fragment of LLO that comprises the PEST- like domain.
• the terms refer to an LLO fragment that does not contain the activation domain at the amino terminus and does not include cystine 484.
• the LLO fragment consists of a PEST sequence.
• the LLO fragment comprises a PEST sequence.
• the LLO fragment consists of about the first 400 to 441 amino acids of the 529 amino acid full-length LLO protein.
• the LLO fragment is a non-hemolytic form of the LLO protein.
• a polypeptide encoded by a nucleic acid sequence of methods and compositions of the present invention is a fusion protein comprising the chimeric Her-2/neu antigen and an additional polypeptide, where in another embodiment, the fusion protein comprises, inter alia, an LM non-hemolytic LLO protein (Examples herein).
• the LLO fragment consists of about residues 1-25. In another embodiment, the LLO fragment consists of about residues 1-50. In another embodiment, the LLO fragment consists of about residues 1-75. In another embodiment, the LLO fragment consists of about residues 1-100. In another embodiment, the LLO fragment consists of about residues 1-125. In another embodiment, the LLO fragment consists of about residues 1-150. In another embodiment, the LLO fragment consists of about residues 1175. In another embodiment, the LLO fragment consists of about residues 1-200. In another embodiment, the LLO fragment consists of about residues 1-225. In another embodiment, the LLO fragment consists of about residues 1-250.
• the LLO fragment consists of about residues 1-275. In another embodiment, the LLO fragment consists of about residues 1-300. In another embodiment, the LLO fragment consists of about residues 1-325. In another embodiment, the LLO fragment consists of about residues 1-350. In another embodiment, the LLO fragment consists of about residues 1-375. In another embodiment, the LLO fragment consists of about residues 1-400. In another embodiment, the LLO fragment consists of about residues 1-425. Each possibility represents a separate embodiment of the present invention.
• a fusion protein of methods and compositions of the present invention comprises a PEST sequence, either from an LLO protein or from another organism, e.g. a prokaryotic organism.
• the PEST-like AA sequence has, in another embodiment, a sequence selected from SEQ ID NO: 5-9.
• the PEST-like sequence is a PEST-like sequence from the LM ActA protein.
• the PEST-like sequence is KTEEQPSEVNTGPR (SEQ ID NO: 5), KASVTDTSEGDLDSSMQSADESTPQPLK (SEQ ID NO: 6), KNEEVNASDFPPPPTDEELR (SEQ ID NO: 7), or RGGIPTSEEFSSLNSGDFTDDENSETTEEEIDR (SEQ ID NO: 8).
• the PEST-like sequence is from Streptolysin O protein of Streptococcus sp.
• the PEST-like sequence is from Streptococcus pyogenes Streptolysin O, e.g. KQNTASTETTTTNEQPK (SEQ ID NO: 9) at AA 35-51.
• the PEST- like sequence is from Streptococcus equisimilis Streptolysin O, e.g. KQNTANTETTTTNEQPK (SEQ ID NO: 10) at AA 38-54.
• the PEST-like sequence is another PEST-like AA sequence derived from a prokaryotic organism.
• the PEST-like sequence is any other PEST-like sequence known in the art. Each possibility represents a separate embodiment of the present invention.
• fusion of an antigen to the PEST-like sequence of LM enhanced cell mediated and anti-tumor immunity of the antigen.
• fusion of an antigen to other PEST-like sequences derived from other prokaryotic organisms will also enhance immunogenicity of the antigen.
• PEST-like sequence of other prokaryotic organism can be identified in accordance with methods such as described by, for example Rechsteiner and Rogers (1996, Trends Biochem. Sci. 21 :267-271) for LM.
• PEST-like AA sequences from other prokaryotic organisms can also be identified based by this method.
• PEST-like AA sequences would be expected to include, but are not limited to, other Listeria species.
• the PEST-like sequence is embedded within the antigenic protein.
• "fusion" refers to an antigenic protein comprising both the antigen and the PEST-like amino acid sequence either linked at one end of the antigen or embedded within the antigen.
• a vaccine comprising a recombinant polypeptide of the present invention.
• a vaccine consisting of a recombinant polypeptide of the present invention.
• nucleotide molecule encoding a recombinant polypeptide of the present invention.
• a vaccine comprising the nucleotide molecule.
• nucleotide molecule encoding a recombinant polypeptide of the present invention.
• nucleotide molecule of the present invention in another embodiment, provided herein is a recombinant polypeptide encoded by the nucleotide molecule of the present invention.
• a vaccine comprising a nucleotide molecule or recombinant polypeptide of the present invention.
• an immunogenic composition comprising a nucleotide molecule or recombinant polypeptide of the present invention.
• provided herein is a vector comprising a nucleotide molecule or recombinant polypeptide of the present invention.
• a recombinant form of Listeria comprising a nucleotide molecule of the present invention.
• a vaccine comprising a recombinant form of Listeria of the present invention.
• the vaccine for use in the methods of the present invention comprises a recombinant Listeria monocytogenes, in any form or embodiment as described herein.
• the vaccine for use in the present invention consists of a recombinant Listeria monocytogenes of the present invention, in any form or embodiment as described herein.
• the vaccine for use in the methods of the present invention consists essentially of a recombinant Listeria monocytogenes of the present invention, in any form or embodiment as described herein.
• the term "comprise” refers to the inclusion of a recombinant Listeria monocytogenes in the vaccine, as well as inclusion of other vaccines or treatments that may be known in the art.
• the term "consisting essentially of refers to a vaccine, whose functional component is the recombinant Listeria monocytogenes, however, other components of the vaccine may be included that are not involved directly in the therapeutic effect of the vaccine and may, for example, refer to components which facilitate the effect of the recombinant Listeria monocytogenes (e.g. stabilizing, preserving, etc.).
• the term “consisting” refers to a vaccine, which contains the recombinant Listeria monocytogenes.
• the methods of the present invention comprise the step of administering a recombinant Listeria monocytogenes, in any form or embodiment as described herein.
• the methods of the present invention consist of the step of administering a recombinant Listeria monocytogenes of the present invention, in any form or embodiment as described herein.
• the methods of the present invention consist essentially of the step of administering a recombinant Listeria monocytogenes of the present invention, in any form or embodiment as described herein.
• the term “comprise” refers to the inclusion of the step of administering a recombinant Listeria monocytogenes in the methods, as well as inclusion of other methods or treatments that may be known in the art.
• the term “consisting essentially of” refers to a methods, whose functional component is the administration of recombinant Listeria monocytogenes, however, other steps of the methods may be included that are not involved directly in the therapeutic effect of the methods and may, for example, refer to steps which facilitate the effect of the administration of recombinant Listeria monocytogenes.
• the term “consisting” refers to a method of administering recombinant Listeria monocytogenes with no additional steps.
• the Listeria of methods and compositions of the present invention is Listeria monocytogenes.
• the Listeria is Listeria ivanovii.
• the Listeria is Listeria welshimeri.
• the Listeria is Listeria seeligeri.
• Each type of Listeria represents a separate embodiment of the present invention.
• the Listeria strain of the methods and compositions of the present invention is the ADXS31-164 strain.
• ADXS31-164 stimulates the secretion of IFN- ⁇ by the splenocytes from wild type FVB/N mice. Further, the data presented herein show that ADXS31-164 is able to elicit anti-Her2/neu specific immune responses to human epitopes that are located at different domains of the targeted antigen.
• the present invention provides a recombinant form of Listeria comprising a nucleotide molecule encoding a Her-2 chimeric protein or a fragment thereof.
• the present invention provides a method of inducing an anti-Her- 2 immune response in a subject, comprising administering to the subject a recombinant polypeptide comprising an N-terminal fragment of a LLO protein fused to a Her-2 chimeric protein or fused to a fragment thereof, thereby inducing an anti-Her-2 immune response in a subject.
• the fusion protein of methods and compositions of the present invention comprises an LLO signal sequence from LLO.
• the two molecules of the protein are joined directly.
• the two molecules are joined by a short spacer peptide, consisting of one or more amino acids.
• the spacer has no specific biological activity other than to join the proteins or to preserve some minimum distance or other spatial relationship between them.
• the constituent amino acids of the spacer are selected to influence some property of the molecule such as the folding, net charge, or hydrophobicity.
• the two molecules of the protein (the LLO fragment and the antigen) are synthesized separately or unfused.
• the two molecules of the protein are synthesized separately from the same nucleic acid. In yet another embodiment, the two molecules are individually synthesized from separate nucleic acids. Each possibility represents a separate embodiment of the present invention.
• a method of inducing an anti-Her-2 immune response in a subject comprising administering to the subject a recombinant nucleotide encoding a recombinant polypeptide comprising an N-terminal fragment of a LLO protein fused to a Her-2 chimeric protein or fused to a fragment thereof, thereby inducing an anti-Her-2 immune response in a subject.
• provided herein is a method of eliciting an enhanced immune response to a Her2/neu-expressing tumor in a subject, where in another embodiment the method comprises administering to the subject a composition comprising the recombinant Listeria vaccine strain provided herein.
• the immune response against the Her-2-expressing tumor comprises an immune response to a subdominant epitope of the Her-2 protein.
• the immune response against the Her-2-expressing tumor comprises an immune response to several subdominant epitopes of the Her-2 protein.
• the immune response against the Her-2-expressing tumor comprises an immune response to at least 1-5 subdominant epitopes of the Her-2 protein.
• the immune response against the Her-2-expressing tumor comprises an immune response to at least 1-10 subdominant epitopes of the Her-2 protein. In another embodiment, the immune response against the Her-2-expressing tumor comprises an immune response to at least 1-17 subdominant epitopes of the Her-2 protein. In another embodiment, the immune response against the Her-2-expressing tumor comprises an immune response to at least 17 subdominant epitopes of the Her-2 protein.
• Point mutations or amino-acid deletions in the oncogenic protein Her2/neu have been reported to mediate treatment of resistant tumor cells, when these tumors have been targeted by small fragment Listeria-b&sed vaccines or trastuzumab (a monoclonal antibody against an epitope located at the extracellular domain of the Her2/neu antigen).
• trastuzumab a monoclonal antibody against an epitope located at the extracellular domain of the Her2/neu antigen.
• Described herein is a chimeric Her2/neu based composition which harbors two of the extracellular and one intracellular fragments of Her2/neu antigen showing clusters of MHC-class I epitopes of the oncogene.
• This chimeric protein which harbors 3 H2Dq and at least 17 of the mapped human MHC-class I epitopes of the Her2/neu antigen was fused to the first 441 amino acids of the Listeria-monocytogenes listeriolysin O protein and expressed and secreted by the Listeria monocytogenes attenuated strain LmddA.
• a method of engineering a Listeria vaccine strain to express a Her-2 chimeric protein or recombinant polypeptide expressing the chimeric protein comprising transforming a Listeria strain with a nucleic acid molecule.
• the nucleic acid molecule comprises a first open reading frame encoding a polypeptide, wherein the polypeptide comprises a Her2/neu chimeric antigen.
• the nucleic acid molecule further comprises a second open reading frame encoding a metabolic enzyme, and wherein said metabolic enzyme complements an endogenous gene that is lacking in the chromosome of the recombinant Listeria strain, thereby engineering a Listeria vaccine strain to express a Her-2 chimeric protein.
• the methods and compositions provided herein further comprise an adjuvant, where in another embodiment, the adjuvant comprises a granulocyte/macrophage colony- stimulating factor (GM-CSF) protein, a nucleotide molecule encoding a GM-CSF protein, saponin QS21 , monophosphoryl lipid A, or an unmethylated CpG-containing oligonucleotide.
• GM-CSF granulocyte/macrophage colony- stimulating factor
• nucleotide molecule encoding a GM-CSF protein
• saponin QS21 saponin QS21
• monophosphoryl lipid A monophosphoryl lipid A
• unmethylated CpG-containing oligonucleotide unmethylated CpG-containing oligonucleotide.
• attenuated Listeria strains such as LM delta-actA mutant (Brundage et al, 1993, Proc. Natl. Acad.
• Attenuated Listeria strains are constructed by introducing one or more attenuating mutations, as will be understood by one of average skill in the art when equipped with the disclosure herein.
• strains include, but are not limited to Listeria strains auxotrophic for aromatic amino acids (Alexander et al, 1993, Infection and Immunity 10 61 :2245-2248) and mutant for the formation of lipoteichoic acids (Abachin et al, 2002, Mol. Microbiol. 43: 1-14) and those attenuated by a lack of a virulence gene (see examples herein).
• nucleic acid molecule of methods and compositions of the present invention is operably linked to a promoter/regulatory sequence.
• first open reading frame of methods and compositions of the present invention is operably linked to a promoter/regulatory sequence.
• second open reading frame of methods and compositions of the present invention is operably linked to a promoter/regulatory sequence.
• each of the open reading frames are operably linked to a promoter/regulatory sequence.
• Each possibility represents a separate embodiment of the present invention.
• those in commercially available cloning vectors can be used successfully in methods and compositions of the present invention.
• these functionalities are provided in, for example, the commercially available vectors known as the pUC series.
• nonessential DNA sequences e.g. antibiotic resistance genes
• plasmids are available from a variety of sources, for example, Invitrogen (La Jolla, CA), Stratagene (La Jolla, CA), Clontech (Palo Alto, CA), or can be constructed using methods well known in the art.
• plasmid such as pCR2.1 (Invitrogen, La Jolla, CA), which is a prokaryotic expression vector with a prokaryotic origin of replication and promoter/regulatory elements to facilitate expression in a prokaryotic organism.
• extraneous nucleotide sequences are removed to decrease the size of the plasmid and increase the size of the cassette that can be placed therein.
• Antibiotic resistance genes are used in the conventional selection and cloning processes commonly employed in molecular biology and vaccine preparation.
• Antibiotic resistance genes contemplated in the present invention include, but are not limited to, gene products that confer resistance to ampicillin, penicillin, methicillin, streptomycin, erythromycin, kanamycin, tetracycline, cloramphenicol (CAT), neomycin, hygromycin, gentamicin and others well known in the art. Each gene represents a separate embodiment of the present invention.
• Methods for transforming bacteria are well known in the art, and include calcium-chloride competent cell-based methods, electroporation methods, bacteriophage- mediated transduction, chemical, and physical transformation techniques (de Boer et al, 1989, Cell 56:641-649; Miller et al, 1995, FASEB J., 9: 190-199; Sambrook et al.
• the Listeria vaccine strain of the present invention is transformed by electroporation. Each method represents a separate embodiment of the present invention.
• conjugation is used to introduce genetic material and/or plasmids into bacteria.
• Methods for conjugation are well known in the art, and are described, for example, in Nikodinovic J et al. (A second generation snp-derived Escherichia coli- Streptomyces shuttle expression vector that is generally transferable by conjugation. Plasmid. 2006 Nov;56(3):223-7) and Auchtung JM et al (Regulation of a Bacillus subtilis mobile genetic element by intercellular signaling and the global DNA damage response. Proc Natl Acad Sci U S A. 2005 Aug 30;102 (35): 12554-9). Each method represents a separate embodiment of the present invention.
• Transforming in one embodiment, is used identically with the term “transfecting,” and refers to engineering a bacterial cell to take up a plasmid or other heterologous DNA molecule.
• transforming refers to engineering a bacterial cell to express a gene of a plasmid or other heterologous DNA molecule.
• Plasmids and other expression vectors useful in the present invention are described elsewhere herein, and can include such features as a promoter/regulatory sequence, an origin of replication for gram negative and gram positive bacteria, an isolated nucleic acid encoding a fusion protein and an isolated nucleic acid encoding an amino acid metabolism gene. Further, an isolated nucleic acid encoding a fusion protein and an amino acid metabolism gene will have a promoter suitable for driving expression of such an isolated nucleic acid.
• Promoters useful for driving expression in a bacterial system include bacteriophage lambda, the bla promoter of the beta-lactamase gene of pBR322, and the CAT promoter of the chloramphenicol acetyl transferase gene of pBR325.
• prokaryotic promoters include the major right and left promoters of 5 bacteriophage lambda (PL and PR), the trp, recA, lacZ, lad, and gal promoters of E. coli, the alpha-amylase (Ulmanen et al, 1985. J. Bacterid. 162: 176-182) and the S28-specific promoters of B.
• subtilis (Oilman et al, 1984 Gene 32: 11- 20), the promoters of the bacteriophages of Bacillus (Gryczan, 1982, In: The Molecular Biology of the Bacilli, Academic Press, Inc., New York), and Streptomyces promoters (Ward et al, 1986, Mol. Gen. Genet. 203:468-478). Additional prokaryotic promoters contemplated in the present invention are reviewed in, for example, Glick (1987, J. Ind. Microbiol. 1 :277-282); Cenatiempo, (1986, Biochimie, 68:505-516); and Gottesman, (1984, Ann. Rev. Genet. 18:415-442).
• promoter/regulatory elements contemplated in the present invention include, but are not limited to the Listeria ⁇ prfA promoter, the Listerial hly promoter, the Listeria ⁇ p60 promoter and the Listerial ActA promoter (GenBank Acc. No. NC_003210) or fragments thereof.
• a plasmid of methods and compositions of the present invention comprises a gene encoding a fusion protein.
• subsequences are cloned and the appropriate subsequences cleaved using appropriate restriction enzymes. The fragments are then, in another embodiment, ligated to produce the desired DNA sequence.
• DNA encoding the antigen is produced using DNA amplification methods, for example polymerase chain reaction (PCR).
• PCR polymerase chain reaction
• the segments of the native DNA on either side of the new terminus are amplified separately.
• the 5' end of the one amplified sequence encodes the peptide linker, while the 3' end of the other amplified sequence also encodes the peptide linker. Since the 5' end of the first fragment is complementary to the 3' end of the second fragment, the two fragments (after partial purification, e.g. on LMP agarose) can be used as an overlapping template in a third PCR reaction.
• the amplified sequence will contain codons, the segment on the carboxy side of the opening site (now forming the amino sequence), the linker, and the sequence on the amino side of the opening site (now forming the carboxyl sequence).
• the antigen is ligated into a plasmid. Each method represents a separate embodiment of the present invention.
• the present invention further comprises a phage based chromosomal integration system for clinical applications.
• a host strain that is auxotrophic for essential enzymes including, but not limited to, d-alanine racemase will be used, for example Lmdal(-)dat(-).
• a phage integration system based on PSA is used (Lauer, et al., 2002 J Bacteriol, 184:4177-4186). This requires, in another embodiment, continuous selection by antibiotics to maintain the integrated gene.
• the current invention enables the establishment of a phage based chromosomal integration system that does not require selection with antibiotics. Instead, an auxotrophic host strain will be complemented.
• the recombinant proteins of the present invention are synthesized, in another embodiment, using recombinant DNA methodology. This involves, in one embodiment, creating a DNA sequence that encodes the fusion protein, placing the DNA in an expression cassette, such as the plasmid of the present invention, under the control of a particular promoter/regulatory element, and expressing the protein.
• DNA encoding the fusion protein (e.g. non-hemolytic LLO/antigen) of the present invention is prepared, in another embodiment, by any suitable method, including, for example, cloning and restriction of appropriate sequences or direct chemical synthesis by methods such as the phosphotriester method of Narang et al. (1979, Meth. Enzymol.
• DNA encoding the fusion protein or the recombinant protein of the present invention is cloned using DNA amplification methods such as polymerase chain reaction (PCR).
• PCR polymerase chain reaction
• the molecules are separated by a peptide spacer consisting of one or more amino acids, generally the spacer will have no specific biological activity other than to join the proteins or to preserve some minimum distance or other spatial relationship between them.
• the constituent AA of the spacer are selected to influence some property of the molecule such as the folding, net charge, or hydrophobicity.
• the nucleic acid sequences encoding the fusion or recombinant proteins are transformed into a variety of host cells, including E. coli, other bacterial hosts, such as Listeria, yeast, and various higher eukaryotic cells such as the COS, CHO and HeLa cells lines and myeloma cell lines.
• the recombinant fusion protein gene will be operably linked to appropriate expression control sequences for each host.
• Promoter/ regulatory sequences are described in detail elsewhere herein.
• the plasmid further comprises additional promoter regulatory elements, as well as a ribosome binding site and a transcription termination signal.
• the control sequences will include a promoter and an enhancer derived from e.g. immunoglobulin genes, SV40, cytomegalovirus, etc., and a polyadenylation sequence.
• the sequences include splice donor and acceptor sequences.
• operably linked refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner.
• a control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.
• transformed auxotrophic bacteria are grown on a media that will select for expression of the amino acid metabolism gene.
• a bacteria auxotrophic for D-glutamic acid synthesis is transformed with a plasmid comprising a gene for D-glutamic acid synthesis, and the auxotrophic bacteria will grow in the absence of D- glutamic acid, whereas auxotrophic bacteria that have not been transformed with the plasmid, or are not expressing the plasmid encoding a protein for D-glutamic acid synthesis, will not grow.
• a bacterium auxotrophic for D-alanine synthesis will grow in the absence of D-alanine when transformed and expressing the plasmid of the present invention if the plasmid comprises an isolated nucleic acid encoding an amino acid metabolism enzyme for D-alanine synthesis.
• Such methods for making appropriate media comprising or lacking necessary growth factors, supplements, amino acids, vitamins, antibiotics, and the like are well known in the art, and are available commercially (Becton-
• the bacteria are propagated in the presence of a selective pressure. Such propagation comprises growing the bacteria in media without the auxotrophic factor.
• the presence of the plasmid expressing an amino acid metabolism enzyme in the auxotrophic bacteria ensures that the plasmid will replicate along with the bacteria, thus continually selecting for bacteria harboring the plasmid.
• the skilled artisan when equipped with the present disclosure and methods herein will be readily able to scale-up the production of the Listeria vaccine vector by adjusting the volume of the media in which the auxotrophic bacteria comprising the plasmid are growing.
• the skilled artisan will appreciate that, in another embodiment, other auxotroph strains and complementation systems are adopted for the use with this invention.
• provided herein is a method of impeding a growth of a Her-2- expressing tumor in a subject, wherein and in another embodiment, the method comprises the step of administering to the subject a composition comprising the recombinant Listeria vaccine strain described herein.
• a method of impeding a growth of a Her- 2-expressing tumor in a subject comprising the step of administering to the subject a composition comprising the recombinant Listeria vaccine strain described herein.
• a method of eliciting an enhanced immune response to a Her2/neu-expressing tumor in a subject comprises the step of administering to the subject a composition comprising the recombinant Listeria vaccine strain described herein.
• the immune response against the Her2/neu-expressing tumor comprises an immune response to at least one subdominant epitope of the Her2/neu protein.
• provided herein is a method of preventing an escape mutation in the treatment of Her2/neu over-expressing tumors, wherein and in another embodiment, the method comprises the step of administering to said subject a composition comprising the recombinant Listeria vaccine strain provided herein.
• provided herein is a method of preventing the onset of a Her2/neu antigen-expressing tumor in a subject, wherein and in another embodiment, the method comprises the step of administering to the subject a composition comprising the recombinant Listeria vaccine strain provided herein.
• the method comprises the step of administering to the subject a composition comprising the recombinant Listeria vaccine strain provided herein.
• provided herein is a method of decreasing the frequency of intra-tumoral T regulatory cells, wherein and in another embodiment, the method comprises the step of administering to the subject a composition comprising the recombinant Listeria vaccine strain provided herein.
• provided herein is a method of decreasing the frequency of intra-tumoral myeloid derived suppressor cells, wherein and in another embodiment, the method comprises the step of administering to the subject a composition comprising the recombinant Listeria vaccine strain provided herein.
• a method of decreasing the frequency of myeloid derived suppressor cells comprising the step of administering to the subject a composition comprising the recombinant Listeria vaccine strain provided herein.
• a method of preventing the formation of a Her2/neu-expressing tumor in a subject comprising the step of administering to the subject a composition comprising the recombinant Listeria vaccine strain provided herein.
• the method comprises the step of administering to the subject a composition comprising the recombinant Listeria vaccine strain the provided herein.
• provided herein is a method of treating a Her2/neu-expressing tumor in a subject, wherein and in another embodiment, the method comprises the step of administering to the subject a composition comprising the recombinant Listeria vaccine strain provided herein.
• provided herein is a method of administering the composition of the present invention. In another embodiment, provided herein is a method of administering the vaccine of the present invention. In another embodiment, provided herein is a method of administering the recombinant polypeptide or recombinant nucleotide of the present invention. In another embodiment, the step of administering the composition, vaccine, recombinant polypeptide or recombinant nucleotide of the present invention is performed with an attenuated recombinant form of Listeria comprising the composition, vaccine, recombinant nucleotide or expressing the recombinant polypeptide, each in its own discrete embodiment.
• the administering is performed with a different attenuated bacterial vector.
• the administering is performed with a DNA vaccine (e.g. a naked DNA vaccine).
• administration of a recombinant polypeptide of the present invention is performed by producing the protein recombinantly, then administering the recombinant protein to a subject. Each possibility represents a separate embodiment of the present invention.
• the immune response elicited by methods and compositions of the present invention comprises a CD8 + T cell-mediated response.
• the immune response consists primarily of a CD8 + T cell-mediated response.
• the only detectable component of the immune response is a CD8 + T cell- mediated response.
• the immune response elicited by methods and compositions provided herein comprises a CD4 + T cell-mediated response.
• the immune response consists primarily of a CD4 + T cell-mediated response.
• the only detectable component of the immune response is a CD4 + T cell- mediated response.
• the CD4 + T cell-mediated response is accompanied by a measurable antibody response against the antigen.
• the CD4 + T cell-mediated response is not accompanied by a measurable antibody response against the antigen.
• the present invention provides a method of inducing a CD8 + T cell-mediated immune response in a subject against a subdominant CD8 + T cell epitope of an antigen, comprising the steps of (a) fusing a nucleotide molecule encoding the Her2-neu chimeric antigen or a fragment thereof to a nucleotide molecule encoding an N-terminal fragment of a LLO protein, thereby creating a recombinant nucleotide encoding an LLO- antigen fusion protein; and (b) administering the recombinant nucleotide or the LLO-antigen fusion to the subject; thereby inducing a CD8 + T cell-mediated immune response against a subdominant CD8 + T cell epitope of an antigen.
• provided herein is a method of increasing intratumoral ratio of CD8+/T regulatory cells, wherein and in another embodiment, the method comprises the step of administering to the subject a composition comprising the recombinant polypeptide, recombinant Listeria, or recombinant vector of the present invention.
• the method comprises the step of administering to the subject a composition comprising the recombinant polypeptide, recombinant Listeria, or recombinant vector of the present invention.
• the immune response elicited by the methods and compositions provided herein comprises an immune response to at least one subdominant epitope of the antigen.
• the immune response does not comprise an immune response to a subdominant epitope.
• the immune response consists primarily of an immune response to at least one subdominant epitope.
• the only measurable component of the immune response is an immune response to at least one subdominant epitope.
• Each type of immune response represents a separate embodiment of the present invention.
• Methods of measuring immune responses include, e.g. measuring suppression of tumor growth, flow cytometry, target cell lysis assays (e.g. chromium release assay), the use of tetramers, and others. Each method represents a separate embodiment of the present invention.
• the present invention provides a method of impeding a growth of a Her-2-expressing tumor in a subject, wherein and in another embodiment, the method comprises administering to the subject a recombinant polypeptide comprising an N- terminal fragment of a LLO protein fused to the Her-2 chimeric protein or a fragment thereof or a recombinant nucleotide encoding the recombinant polypeptide, wherein the subject mounts an immune response against the Her-2-expressing tumor, thereby impeding a growth of a Her-2-expressing tumor in a subject.
• the present invention provides a method of improving an antigenicity of a Her-2 chimeric protein, wherein and in another embodiment, the method comprises the step of fusing a nucleotide encoding an N-terminal fragment of a LLO protein to a nucleotide encoding the Her-2 protein or a fragment thereof to create a recombinant nucleotide, thereby improving an antigenicity of a Her-2 chimeric protein.
• a method of improving an antigenicity of a Her-2 chimeric protein comprising engineering a Listeria strain to express the recombinant nucleotide.
• a different bacterial vector is used to express the recombinant nucleotide.
• the bacterial vector is attenuated.
• a DNA vaccine e.g. a naked DNA vaccine
• administration of the LLO-Her-2 chimera fusion peptide encoded by the nucleotide is performed by producing the protein recombinantly, then administering the recombinant protein to a subject.
• the present invention provides a method for "epitope spreading" of a tumor.
• the immunization using the compositions and methods provided herein induce epitope spreading onto other tumors bearing antigens other than the antigen carried in the vaccine of the present invention.
• the dominant epitope or subdominant epitope is dominant or subdominant, respectively, in the subject being treated. In another embodiment, the dominant epitope or subdominant epitope is dominant or subdominant in a population being treated.
• a method of treating, suppressing, or inhibiting a cancer or a tumor growth in a subject by epitope spreading wherein and in another embodiment, said cancer is associated with expression of an antigen or fragment thereof comprised in the composition of the present invention.
• the method comprises administering to said subject a composition comprising the recombinant polypeptide, recombinant Listeria, or recombinant vector of the present invention.
• the subject mounts an immune response against the antigen-expressing cancer or the antigen-expressing tumor, thereby treating, suppressing, or inhibiting a cancer or a tumor growth in a subject.
• Dominant CD8 + T cell epitope refers to an epitope that is recognized by over 30% of the antigen-specific CD8 + T cells that are elicited by vaccination, infection, or a malignant growth with a protein or a pathogen or cancer cell containing the protein.
• the term refers to an epitope recognized by over 35% of the antigen- specific CD8 + T cells that are elicited thereby.
• the term refers to an epitope recognized by over 40% of the antigen-specific CD8 + T cells.
• the term refers to an epitope recognized by over 45% of the antigen-specific CD8 + T cells.
• the term refers to an epitope recognized by over 50% of the antigen-specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by over 55% of the antigen-specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by over 60% of the antigen-specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by over 65% of the antigen- specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by over 70% of the antigen-specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by over 75% of the antigen-specific CD8 + T cells.
• the term refers to an epitope recognized by over 80% of the antigen-specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by over 85% of the antigen- specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by over 90% of the antigen-specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by over 95% of the antigen-specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by over 96% of the antigen-specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by over 97% of the antigen- specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by over 98% of the antigen-specific CD8 + T cells.
• Subdominant CD8 + T cell epitope refers to an epitope recognized by fewer than 30% of the antigen-specific CD8 + T cells that are elicited by vaccination, infection, or a malignant growth with a protein or a pathogen or cancer cell containing the protein.
• the term refers to an epitope recognized by fewer than 28% of the antigen-specific CD8 + T cells.
• the term refers to an epitope recognized by over 26% of the antigen-specific CD8 + T cells.
• the term refers to an epitope recognized by fewer than 24% of the antigen- specific CD8 + T cells.
• the term refers to an epitope recognized by over 22% of the antigen-specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by fewer than 20% of the antigen-specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by over 18% of the antigen-specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by fewer than 16% of the antigen-specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by over 14% of the antigen-specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by over 12% of the antigen-specific CD8 + T cells.
• the term refers to an epitope recognized by fewer than 10% of the antigen-specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by over 8% of the antigen-specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by fewer than 6% of the antigen-specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by fewer than 5% of the antigen- specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by over 4% of the antigen-specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by fewer than 3% of the antigen-specific CD8 + T cells.
• the term refers to an epitope recognized by fewer than 2% of the antigen- specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by fewer than 1% of the antigen- specific CD8 + T cells. In another embodiment, the term refers to an epitope recognized by fewer than 0.5% of the antigen- specific CD8 + T cells.
• Each type of the dominant epitope and subdominant epitope represents a separate embodiment of the present invention.
• the antigen in methods and compositions of the present invention is, in one embodiment, expressed at a detectable level on a non-tumor cell of the subject. In another embodiment, the antigen is expressed at a detectable level on at least a certain percentage (e.g. 0.01 %, 0.03%, 0.1%, 0.3%, 1%, 2%, 3%, or 5%) of non-tumor cells of the subject.
• “non-tumor cell” refers to a cell outside the body of the tumor.
• non-tumor cell refers to a non-malignant cell.
• non- tumor cell refers to a non-transformed cell.
• the non-tumor cell is a somatic cell.
• the non-tumor cell is a germ cell.
• Detectable level refers, in one embodiment, to a level detectable by a standard assay.
• the assay is an immunological assay.
• the assay is enzyme-linked immunoassay (ELISA).
• the assay is Western blot.
• the assay is FACS. It is to be understood by a skilled artisan that any other assay available in the art can be used in the methods provided herein.
• a detectable level is determined relative to the background level of a particular assay. Methods for performing each of these techniques are well known to those skilled in the art, and each technique represents a separate embodiment of the present invention.
• vaccination with recombinant antigen-expressing LM induces epitope spreading.
• vaccination with LLO-antigen fusions, even outside the context of Her2, induces epitope spreading as well.
• the present invention provides a method of impeding a growth of an Her-2-expressing tumor in a subject, comprising administering to the subject a recombinant polypeptide comprising an N-terminal fragment of a LLO protein fused to a Her-2 chimeric antigen, wherein the antigen has one or more subdominant CD8 + T cell epitopes, wherein the subject mounts an immune response against the antigen-expressing tumor, thereby impeding a growth of an Her-2-expressing tumor in a subject.
• the antigen does not contain any of the dominant CD8 + T cell epitopes.
• provided herein is a method of impeding a growth on a Her-2- expressing tumor in a subject, comprising administering to the subject a recombinant form of Listeria comprising a recombinant nucleotide encoding the recombinant polypeptide provided herein.
• the present invention provides a method for inducing formation of cytotoxic T cells in a host having cancer, comprising administering to the host a composition of the present invention, thereby inducing formation of cytotoxic T cells in a host having cancer.
• the present invention provides a method of reducing an incidence of cancer, comprising administering a composition of the present invention.
• the present invention provides a method of ameliorating cancer, comprising administering a composition of the present invention.
• Each possibility represents a separate embodiment of the present invention.
• the composition is administered to the cells of the subject ex vivo; in another embodiment, the composition is administered to the cells of a donor ex vivo; in another embodiment, the composition is administered to the cells of a donor in vivo, then is transferred to the subject.
• the composition is administered to the cells of the subject ex vivo; in another embodiment, the composition is administered to the cells of a donor ex vivo, then is transferred to the subject.
• the cancer treated by a method of the present invention is breast cancer.
• the cancer is an Her2 containing cancer.
• the cancer is a melanoma.
• the cancer is pancreatic cancer.
• the cancer is ovarian cancer.
• the cancer is gastric cancer.
• the cancer is a carcinomatous lesion of the pancreas.
• the cancer is pulmonary adenocarcinoma.
• the cancer is colorectal adenocarcinoma.
• the cancer is pulmonary squamous adenocarcinoma.
• the cancer is gastric adenocarcinoma.
• the cancer is an ovarian surface epithelial neoplasm (e.g. a benign, proliferative or malignant variety thereof).
• the cancer is an oral squamous cell carcinoma.
• the cancer is non small-cell lung carcinoma.
• the cancer is an endometrial carcinoma.
• the cancer is a bladder cancer.
• the cancer is a head and neck cancer.
• the cancer is a prostate carcinoma.
• the subject mounts an immune response against the antigen-expressing tumor or target antigen, thereby mediating the anti-tumor effects.
• the present invention provides an immunogenic composition for treating cancer, the composition comprising a fusion of a truncated LLO to a Her-2 chimeric protein.
• the immunogenic composition further comprises a Listeria strain expressing the fusion.
• Each possibility represents a separate embodiment of the present invention.
• the present invention provides an immunogenic composition for treating cancer, the composition comprising a Listeria strain expressing a Her-2 chimeric protein.
• a treatment protocol of the present invention is therapeutic.
• the protocol is prophylactic.
• the vaccines of the present invention are used to protect people at risk for cancer such as breast cancer or other types of Her2-containing tumors because of familial genetics or other circumstances that predispose them to these types of ailments as will be understood by a skilled artisan.
• the vaccines are used as a cancer immunotherapy after debulking of tumor growth by surgery, conventional chemotherapy or radiation treatment. Following such treatments, the vaccines of the present invention are administered so that the CTL response to the tumor antigen of the vaccine destroys remaining metastases and prolongs remission from the cancer.
• vaccines of the present invention are used to effect the growth of previously established tumors and to kill existing tumor cells. Each possibility represents a separate embodiment of the present invention.
• the vaccines and immunogenic compositions utilized in any of the methods described above have any of the characteristics of vaccines and immunogenic compositions of the present invention. Each characteristic represents a separate embodiment of the present invention.
• Various embodiments of dosage ranges are contemplated by this invention. In one embodiment, in the case of vaccine vectors, the dosage is in the range of 0.4 LDso/dose. In another embodiment, the dosage is from about 0.4-4.9 LDso/dose. In another embodiment the dosage is from about 0.5-0.59 LDso/dose.
• the dosage is from about 0.6-0.69 LDso/dose. In another embodiment the dosage is from about 0.7-0.79 LDso/dose. In another embodiment the dosage is about 0.8 LDso/dose. In another embodiment, the dosage is 0.4 LD 50 /dose to 0.8 of the LD 50 /dose.
• the dosage is 10 7 bacteria/dose. In another embodiment, the dosage is 1.5 x 10 7 bacteria/dose. In another embodiment, the dosage is 2 x 10 7 bacteria/dose. In another embodiment, the dosage is 3 x 10 7 bacteria/dose. In another embodiment, the dosage is 4 x 10 7 bacteria/dose. In another embodiment, the dosage is 6 x 10 7 bacteria/dose. In another embodiment, the dosage is 8 x 10 7 bacteria/dose. In another embodiment, the dosage is 1 x 10 8 bacteria/dose. In another embodiment, the dosage is 1.5 x 10 8 bacteria/dose. In another embodiment, the dosage is 2 x 10 8 bacteria/dose. In another embodiment, the dosage is 3 x 10 8 bacteria/dose.
• the dosage is 4 x 10 8 bacteria/dose. In another embodiment, the dosage is 6 x 10 8 bacteria/dose. In another embodiment, the dosage is 8 x 10 8 bacteria/dose. In another embodiment, the dosage is 1 x 10 9 bacteria/dose. In another embodiment, the dosage is 1.5 x 10 9 bacteria/dose. In another embodiment, the dosage is 2 x 10 9 bacteria/dose. In another embodiment, the dosage is 3 x 10 9 bacteria/dose. In another embodiment, the dosage is 5 x 10 9 bacteria/dose. In another embodiment, the dosage is 6 x 10 9 bacteria/dose. In another embodiment, the dosage is 8 x 10 9 bacteria/dose. In another embodiment, the dosage is 1 x 10 10 bacteria/dose. In another embodiment, the dosage is 1.5 x 10 10 bacteria/dose.
• the dosage is 2 x 10 10 bacteria/dose. In another embodiment, the dosage is 3 x 10 10 bacteria/dose. In another embodiment, the dosage is 5 x 10 10 bacteria/dose. In another embodiment, the dosage is 6 x 10 10 bacteria/dose. In another embodiment, the dosage is 8 x 10 10 bacteria/dose. In another embodiment, the dosage is 8 x 10 9 bacteria/dose. In another embodiment, the dosage is 1 x 10 11 bacteria/dose. In another embodiment, the dosage is 1.5 x 10 11 bacteria/dose. In another embodiment, the dosage is 2 x 10 11 bacteria/dose. In another embodiment, the dosage is 3 x 10 11 bacteria/dose. In another embodiment, the dosage is 5 x 10 11 bacteria/dose. In another embodiment, the dosage is 6 x 10 11 bacteria/dose. In another embodiment, the dosage is 8 x 10 11 bacteria/dose. Each possibility represents a separate embodiment of the present invention.
• a vaccine or immunogenic composition of the present invention is administered alone to a subject.
• the vaccine or immunogenic composition is administered together with another cancer therapy.
• Each possibility represents a separate embodiment of the present invention.
• the recombinant Listeria of methods and compositions of the present invention is, in one embodiment, stably transformed with a construct encoding an Her-2 chimeric antigen or an LLO-Her-2 chimeric antigen fusion.
• the construct contains a polylinker to facilitate further subcloning.
• the construct or nucleic acid molecule is integrated into the Listerial chromosome using homologous recombination.
• Techniques for homologous recombination are well known in the art, and are described, for example, in Baloglu S, Boyle SM, et al. (Immune responses of mice to vaccinia virus recombinants expressing either Listeria monocytogenes partial listeriolysin or Brucella abortus ribosomal L7/L12 protein. Vet Microbiol 2005, 109(1-2): 11-7); and Jiang LL, Song HH, et al., (Characterization of a mutant Listeria monocytogenes strain expressing green fluorescent protein.
• the construct or nucleic acid molecule is integrated into the Listerial chromosome using transposon insertion.
• Techniques for transposon insertion are well known in the art, and are described, inter alia, by Sun et al. (Infection and Immunity 1990, 58: 3770-3778) in the construction of DP-L967.
• Transposon mutagenesis has the advantage, in another embodiment, that a stable genomic insertion mutant can be formed but the disadvantage that the position in the genome where the foreign gene has been inserted is unknown.
• the construct or nucleic acid molecule is integrated into the Listeria ⁇ chromosome using phage integration sites (Lauer P, Chow MY et al, Construction, characterization, and use of two Listeria monocytogenes site- specific phage integration vectors. J Bacteriol 2002;184(15): 4177-86).
• an integrase gene and attachment site of a bacteriophage e.g. U153 or PSA listeriophage
• endogenous prophages are cured from the attachment site utilized prior to integration of the construct or heterologous gene.
• this method results in single-copy integrants. Each possibility represents a separate embodiment of the present invention.
• one of various promoters is used to express the antigen or fusion protein containing same.
• an LM promoter is used, e.g. promoters for the genes hly, actA, pica, plcB and mpl, which encode the Listerial proteins hemolysin, actA, phosphotidylinositol-specific phospholipase, phospholipase C, and metalloprotease, respectively.
• LM promoter e.g. promoters for the genes hly, actA, pica, plcB and mpl, which encode the Listerial proteins hemolysin, actA, phosphotidylinositol-specific phospholipase, phospholipase C, and metalloprotease, respectively.
• methods and compositions of the present invention utilize a homologue of a Her-2 chimeric protein or LLO sequence of the present invention.
• the methods and compositions of the present invention utilize a Her-2 chimeric protein from a non-human mammal.
• the terms "homology,” “homologous,” etc, when in reference to any protein or peptide, refer in one embodiment, to a percentage of amino acid residues in the candidate sequence that are identical with the residues of a corresponding native polypeptide, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology, and not considering any conservative substitutions as part of the sequence identity. Methods and computer programs for the alignment are well known in the art.
• Homology is, in one embodiment, determined by computer algorithm for sequence alignment, by methods well described in the art.
• computer algorithm analysis of nucleic acid sequence homology may include the utilization of any number of software packages available, such as, for example, the BLAST, DOMAIN, BEAUTY (BLAST Enhanced Alignment Utility), GENPEPT and TREMBL packages.
• "homology” refers to identity to a sequence selected from SEQ ID No: 1-4 of greater than 70%.
• homoology refers to identity to a sequence selected from SEQ ID No: 1-4 of greater than 72%.
• the identity is greater than 75%.
• the identity is greater than 78%.
• the identity is greater than 80%. In another embodiment, the identity is greater than 82%. In another embodiment, the identity is greater than 83%. In another embodiment, the identity is greater than 85%. In another embodiment, the identity is greater than 87%. In another embodiment, the identity is greater than 88%. In another embodiment, the identity is greater than 90%. In another embodiment, the identity is greater than 92%. In another embodiment, the identity is greater than 93%. In another embodiment, the identity is greater than 95%. In another embodiment, the identity is greater than 96%. In another embodiment, the identity is greater than 97%. In another embodiment, the identity is greater than 98%. In another embodiment, the identity is greater than 99%. In another embodiment, the identity is 100%. Each possibility represents a separate embodiment of the present invention.
• homology is determined via determination of candidate sequence hybridization, methods of which are well described in the art (See, for example, “Nucleic Acid Hybridization” Hames, B. D., and Higgins S. J., Eds. (1985); Sambrook et al., 2001 , Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; and Ausubel et al., 1989, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N. Y).
• methods of hybridization may be carried out under moderate to stringent conditions, to the complement of a DNA encoding a native caspase peptide.
• Hybridization conditions being, for example, overnight incubation at 42 °C in a solution comprising: 10-20 % formamide, 5 X SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7. 6), 5 X Denhardt's solution, 10 % dextran sulfate, and 20 ⁇ g/ml denatured, sheared salmon sperm DNA.
• nucleic acids refers to a string of at least two base-sugar-phosphate combinations.
• the term includes, in one embodiment, DNA and RNA.
• Nucleotides refers, in one embodiment, to the monomeric units of nucleic acid polymers.
• RNA may be, in one embodiment, in the form of a tRNA (transfer RNA), snRNA (small nuclear RNA), rRNA (ribosomal RNA), mRNA (messenger RNA), anti-sense RNA, small inhibitory RNA (siRNA), micro RNA (miRNA) and ribozymes.
• DNA may be in form of plasmid DNA, viral DNA, linear DNA, or chromosomal DNA or derivatives of these groups.
• these forms of DNA and RNA may be single, double, triple, or quadruple stranded.
• the term also includes, in another embodiment, artificial nucleic acids that may contain other types of backbones but the same bases.
• the artificial nucleic acid is a PNA (peptide nucleic acid).
• PNA contain peptide backbones and nucleotide bases and are able to bind, in one embodiment, to both DNA and RNA molecules.
• the nucleotide is oxetane modified. In another embodiment, the nucleotide is modified by replacement of one or more phosphodiester bonds with a phosphorothioate bond.
• the artificial nucleic acid contains any other variant of the phosphate backbone of native nucleic acids known in the art. The use of phosphothiorate nucleic acids and PNA are known to those skilled in the art, and are described in, for example, Neilsen PE, Curr Opin Struct Biol 9:353-57; and Raz NK et al Biochem Biophys Res Commun. 297: 1075-84.
• nucleic acid derivative represents a separate embodiment of the present invention.
• Protein and/or peptide homology for any amino acid sequence listed herein is determined, in one embodiment, by methods well described in the art, including immunoblot analysis, or via computer algorithm analysis of amino acid sequences, utilizing any of a number of software packages available, via established methods. Some of these packages may include the FASTA, BLAST, MPsrch or Scanps packages, and may employ the use of the Smith and Waterman algorithms, and/or global/local or BLOCKS alignments for analysis, for example. Each method of determining homology represents a separate embodiment of the present invention.
• the present invention provides a kit comprising a reagent utilized in performing a method of the present invention.
• the present invention provides a kit comprising a composition, tool, or instrument of the present invention.
• contacting refers to directly contacting the cancer cell or tumor with a composition of the present invention.
• the terms refer to indirectly contacting the cancer cell or tumor with a composition of the present invention.
• methods of the present invention include methods in which the subject is contacted with a composition of the present invention after which the composition is brought in contact with the cancer cell or tumor by diffusion or any other active transport or passive transport process known in the art by which compounds circulate within the body. Each possibility represents a separate embodiment of the present invention.
• the terms "gene” and “recombinant gene” refer to nucleic acid molecules comprising an open reading frame encoding a polypeptide of the invention.
• Such natural allelic variations can typically result in 1-5% variance in the nucleotide sequence of a given gene.
• Alternative alleles can be identified by sequencing the gene of interest in a number of different individuals or organisms. This can be readily carried out by using hybridization probes to identify the same genetic locus in a variety of individuals or organisms. Any and all such nucleotide variations and resulting amino acid polymorphisms or variations that are the result of natural allelic variation and that do not alter the functional activity are intended to be within the scope of the invention.
• compositions containing vaccines and compositions of the present invention are, in another embodiment, administered to a subject by any method known to a person skilled in the art, such as parenterally, paracancerally, transmucosally, transdermally, intramuscularly, intravenously, intra-dermally, subcutaneously, intra- peritonealy, intra- ventricularly, intra-cranially, intra-vaginally or intra-tumorally.
• the vaccines or compositions are administered orally, and are thus formulated in a form suitable for oral administration, i.e. as a solid or a liquid preparation.
• Suitable solid oral formulations include tablets, capsules, pills, granules, pellets and the like.
• Suitable liquid oral formulations include solutions, suspensions, dispersions, emulsions, oils and the like.
• the active ingredient is formulated in a capsule.
• the compositions of the present invention comprise, in addition to the active compound and the inert carrier or diluent, a hard gelating capsule.
• the vaccines or compositions are administered by intravenous, intra-arterial, or intra-muscular injection of a liquid preparation.
• suitable liquid formulations include solutions, suspensions, dispersions, emulsions, oils and the like.
• the pharmaceutical compositions are administered intravenously and are thus formulated in a form suitable for intravenous administration.
• the pharmaceutical compositions are administered intra- arterially and are thus formulated in a form suitable for intra-arterial administration.
• the pharmaceutical compositions are administered intra-muscularly and are thus formulated in a form suitable for intra-muscular administration.
• the term “treating” refers to curing a disease. In another embodiment, “treating” refers to preventing a disease. In another embodiment, “treating” refers to reducing the incidence of a disease. In another embodiment, “treating” refers to ameliorating symptoms of a disease. In another embodiment, “treating” refers to inducing remission. In another embodiment, “treating” refers to slowing the progression of a disease.
• the terms “reducing”, “suppressing” and “inhibiting” refer in another embodiment to lessening or decreasing. Each possibility represents a separate embodiment of the present invention. [000177]
• the term “about” as used herein means in quantitative terms plus or minus 5%, or in another embodiment plus or minus 10%, or in another embodiment plus or minus 15 , or in another embodiment plus or minus 20%.
• subject refers in one embodiment to a mammal including a human in need of therapy for, or susceptible to, a condition or its sequelae.
• the subject may include dogs, cats, pigs, cows, sheep, goats, horses, rats, and mice and humans.
• subject does not exclude an individual that is normal in all respects.
• Oligonucleotides were synthesized by Invitrogen (Carlsbad, CA) and DNA sequencing was done by Genewiz Inc, South Plainfield, NJ.
• Flow cytometry reagents were purchased from Becton Dickinson Biosciences (BD, San Diego, CA). Cell culture media, supplements and all other reagents, unless indicated, were from Sigma (St. Louise, MO).
• Her2/neu HLA-A2 peptides were synthesized by EZbiolabs (Westfield, IN).
• C-RPMI 1640 (C-RPMI) medium contained 2mM glutamine, 0.1 mM non-essential amino acids, and ImM sodium pyruvate, 10% fetal bovine serum, penicillin/streptomycin, Hepes (25mM).
• the polyclonal anti-LLO antibody was described previously and anti-Her2/neu antibody was purchased from Sigma.
• Her2/neu-pGEM7Z was kindly provided by Dr. Mark Greene at the University of Pennsylvania and contained the full-length human Her2/neu (hHer2) gene cloned into the pGEM7Z plasmid (Promega, Madison WI). This plasmid was used as a template to amplify three segments of hHer-2/neu, namely, ECl, EC2, and IC1 , by PCR using pfx DNA polymerase (Invitrogen) and the oligos indicated in Table 1. [000183] Table 1 : Primers for cloning of Human her-2-Chimera
• Her-2- TGATCTCGAGACCCACCTGGACATGCTC (SEO ID NO: ) 120-510 40-170 Chimera (F)
• Her-2/neu chimera construct was generated by direct fusion by the SOEing PCR method and each separate hHer-2/neu segment as templates. Primers are shown in Table 2. [000185] Sequence of primers for amplification of different segments human Her2 regions
• ChHer2 gene was excised from pAdvl38 using Xhol and Spel restriction enzymes, and cloned in frame with a truncated, non-hemolytic fragment of LLO in the Lmdd shuttle vector, pAdvl34.
• the sequences of the insert, LLO and hly promoter were confirmed by DNA sequencing analysis.
• This plasmid was electroporated into electro-competent act A, dal, dat mutant Listeria monocytogenes strain, LmddA and positive clones were selected on Brain Heart infusion (BHI) agar plates containing streptomycin (250 ⁇ g/ml).
• mice were immunized three times with one week intervals with 1 x 10 8 colony forming units (CFU) of Lm-LLO-ChHer2, ADXS31-164, Lm-hHer2 ICI or Lm-control (expressing an irrelevant antigen) or were left naive.
• CFU colony forming units
• NT-2 cells were grown in vitro, detached by trypsin and treated with mitomycin C (250 ⁇ g/ml in serum free C-RPMI medium) at 37°C for 45 minutes.
• splenocytes harvested from immunized or naive animals at a ratio of 1 :5 (Stimulator: Responder) for 5 days at 37°C and 5% C0 2 .
• a standard cytotoxicity assay was performed using europium labeled 3T3/neu (DHFR-G8) cells as targets according to the method previously described. Released europium from killed target cells was measured after 4 hour incubation using a spectrophotometer (Perkin Elmer, Victor 2 ) at 590 nm. Percent specific lysis was defined as (lysis in experimental group-spontaneous lysis)/(Maximum lysis-spontaneous lysis). Interferon- ⁇ secretion by splenocytes from immunized mice
• A2 transgenic mice were incubated in the presence of 1 ⁇ of HLA- A2 specific peptides or ⁇ g/ml of a recombinant His-tagged ChHer2 protein, produced in E. coli and purified by a nickel based affinity chromatography system. Samples from supernatants were obtained 24 or 72 hours later and tested for the presence of interferon- ⁇ (IFN- ⁇ ) using mouse IFN- ⁇ Enzyme- linked immunosorbent assay (ELIS A) kit according to manufacturer' s recommendations.
• IFN- ⁇ interferon- ⁇
• ELIS A mouse IFN- ⁇ Enzyme- linked immunosorbent assay
• ADXS31-164 Effect of ADXS31-164 on regulatory T cells in spleens and tumors
• mice were implanted subcutaneously (s.c.) with 1 x 10 6 NT-2 cells. On days 7, 14 and 21 , they were immunized with 1 x 10 8 CFUs of ADXS31-164, LmddA-control or left naive. Tumors and spleens were extracted on day 28 and tested for the presence of CD3 + /CD4 + /FoxP3 + Tregs by FACS analysis. Briefly, splenocytes were isolated by homogenizing the spleens between two glass slides in C-RPMI medium.
• Tumors were minced using a sterile razor blade and digested with a buffer containing DNase (12U/ml), and collagenase (2mg/ml) in PBS. After 60 min incubation at RT with agitation, cells were separated by vigorous pipetting. Red blood cells were lysed by RBC lysis buffer followed by several washes with complete RPMI-1640 medium containing 10% FBS. After filtration through a nylon mesh, tumor cells and splenocytes were resuspended in FACS buffer (2% FBS/PBS) and stained with anti-CD3-PerCP-Cy5.5, CD4-FITC, CD25-APC antibodies followed by permeabilization and staining with anti-Foxp3-PE. Flow cytometry analysis was performed using 4-color FACS calibur (BD) and data were analyzed using cell quest software (BD).
• BD 4-color FACS calibur
• ChHer2 gene was generated by direct fusion of two extracellular (aa 40-170 and aa 359-433) and one intracellular fragment (aa 678-808) of the Her2/neu protein by SOEing PCR method.
• the chimeric protein harbors most of the known human MHC class I epitopes of the protein.
• ChHer2 gene was excised from the plasmid, pAdvl38 (which was used to construct Lm-LLO-ChHer2) and cloned into LmddA shuttle plasmid, resulting in the plasmid pAdvl64 ( Figure 1A). There are two major differences between these two plasmid backbones.
• pAdvl38 uses the chloramphenicol resistance marker (cat) for in vitro selection of recombinant bacteria
• pAdvl64 harbors the D-alanine racemase gene (dal) from bacillus subtilis, which uses a metabolic complementation pathway for in vitro selection and in vivo plasmid retention in LmddA strain which lacks the dal-dat genes.
• This vaccine platform was designed and developed to address FDA concerns about the antibiotic resistance of the engineered Listeria vaccine strains.
• pAdvl64 does not harbor a copy of the prfA gene in the plasmid (see sequence below and Fig.
• LmddA vaccine strain also lacks the actA gene (responsible for the intracellular movement and cell-to-cell spread of Listeria) so the recombinant vaccine strains derived from this backbone are 100 times less virulent than those derived from the Lmdd, its parent strain.
• LmddA-b&sed vaccines are also cleared much faster (in less than 48 hours) than the Lmdd-b&sed vaccines from the spleens of the immunized mice.
• EXAMPLE 2 ADXS31-164 IS AS IMMUNOGENIC AS LM-LLO-ChHER2.
• ADXS31-164 was also able to stimulate the secretion of IFN-y by the splenocytes from wild type FVB/N mice ( Figure 2B). This was detected in the culture supernatants of these cells that were co-cultured with mitomycin C treated NT-2 cells, which express high levels of Her2/neu antigen (Figure 5C).
• EXAMPLE 3 ADXS31-164 WAS MORE EFFICACIOUS THAN LM-LLO-ChHER2
• ADXS31-164 Anti-tumor effects of ADXS31-164 were compared to those of Lm-LLO-ChHer2 in Her2/neu transgenic animals which develop slow growing, spontaneous mammary tumors at 20-25 weeks of age. All animals immunized with the irrelevant Listeria-control vaccine developed breast tumors within weeks 21-25 and were sacrificed before week 33. In contrast, Liseria-Her2/ne recombinant vaccines caused a significant delay in the formation of the mammary tumors. On week 45, more than 50% o ADXS31-164 vaccinated mice (5 out of 9) were still tumor free, as compared to 25% of mice immunized with Lm-LLO-ChHer2.
• EXAMPLE 5 ADXS31-164 CAUSES A SIGNIFICANT DECREASE IN INTRA- TUMORAL T REGULATORY CELLS.
• mice were implanted with NT-2 tumor cells.
• Splenocytes and intra- tumoral lymphocytes were isolated after three immunizations and stained for Tregs, which were defined as CD3 + /CD4 + /CD25 + /FoxP3 + cells, although comparable results were obtained with either FoxP3 or CD25 markers when analyzed separately.
• Tregs in the tumors ( Figure 5A). Whereas in average 19.0% of all CD3 + T cells in untreated tumors were Tregs, this frequency was reduced to 4.2% for the irrelevant vaccine and 3.4% for ADXS31-164, a 5-fold reduction in the frequency of intra-tumoral Tregs ( Figure 5B). The decrease in the frequency of intra-tumoral Tregs in mice treated with either of the LmddA vaccines could not be attributed to differences in the sizes of the tumors.
• the lower frequency of Tregs in tumors treated with LmddA vaccines resulted in an increased intratumoral CD8/Tregs ratio, suggesting that a more favorable tumor microenvironment can be obtained after immunization with LmddA vaccines.
• the vaccine expressing the target antigen HER2/neu was able to reduce tumor growth, indicating that the decrease in Tregs has an effect only in the presence on antigen- specific responses in the tumor.
• Tumor samples of the mice immunized with different vaccines such as Lm-LLO- 138, LmddA164 and irrelevant vaccine Lm-LLO-NY were harvested.
• the DNA was purified from these samples and the DNA fragments corresponding to Her-2/neu regions IC1 , ECl and
• EC2 were amplified and were sequenced to determine if there were any immune escape mutations.
• the alignment of sequence from each DNA was performed using CLUSTALW. The results of the analysis indicated that there were no mutations in the DNA sequences harvested from tumors. The detailed analysis of these sequences is shown below.
• EXAMPLE 7 PERIPHERAL IMMUNIZATION WITH ADXS31-164 CAN DELAY THE GROWTH OF A METASTATIC BREAST CANCER CELL LINE IN THE
• mice were immunized IP with ADXS31-164 or irrelevant Lm-control vaccines and then implanted intra-cranially with 5,000 EMT6-Luc tumor cells, expressing luciferase and low levels of Her2/neu (Figure 6C). Tumors were monitored at different times post- inoculation by ex vivo imaging of anesthetized mice. On day 8 post-tumor inoculation tumors were detected in all control animals, but none of the mice in ADXS31-164 group showed any detectable tumors ( Figure 6A and B).
• ADXS31-164 could clearly delay the onset of these tumors, as on day 11 post-tumor inoculation all mice in negative control group had already succumbed to their tumors, but all mice in ADXS31-164 group were still alive and only showed small signs of tumor growth.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Immunology (AREA)
• Pharmacology & Pharmacy (AREA)
• Veterinary Medicine (AREA)
• Chemical & Material Sciences (AREA)
• Public Health (AREA)
• General Health & Medical Sciences (AREA)
• Medicinal Chemistry (AREA)
• Animal Behavior & Ethology (AREA)
• Microbiology (AREA)
• Epidemiology (AREA)
• Mycology (AREA)
• Oncology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Cell Biology (AREA)
• General Chemical & Material Sciences (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Organic Chemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Engineering & Computer Science (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
• Peptides Or Proteins (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Priority Applications (2)

Applications Claiming Priority (2)

Publications (2)

Family

ID=43992418

Family Applications (1)

Country Status (4)

Cited By (22)

Families Citing this family (10)

Family Cites Families (28)

• 2010
  • 2010-11-12 EP EP10830785.1A patent/EP2498808A4/en not_active Ceased
  • 2010-11-12 JP JP2012539021A patent/JP5985397B2/ja not_active Expired - Fee Related
  • 2010-11-12 WO PCT/US2010/056534 patent/WO2011060260A2/en not_active Ceased
  • 2010-11-12 US US12/945,386 patent/US9084747B2/en active Active

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events