WO2007061848A2 - Methods for producing, growing, and preserving listeria vaccine vectors - Google Patents

Methods for producing, growing, and preserving listeria vaccine vectors Download PDF

Info

Publication number
WO2007061848A2
WO2007061848A2 PCT/US2006/044681 US2006044681W WO2007061848A2 WO 2007061848 A2 WO2007061848 A2 WO 2007061848A2 US 2006044681 W US2006044681 W US 2006044681W WO 2007061848 A2 WO2007061848 A2 WO 2007061848A2
Authority
WO
WIPO (PCT)
Prior art keywords
another embodiment
media
present
component selected
listeria
Prior art date
Application number
PCT/US2006/044681
Other languages
French (fr)
Other versions
WO2007061848A3 (en
Inventor
John Rothman
Yvonne Paterson
Thorsten Verch
Amanda Weiss
Philip Bassett
Original Assignee
The Trustees Of The University Of Pennsylvania
Advaxis
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Trustees Of The University Of Pennsylvania, Advaxis filed Critical The Trustees Of The University Of Pennsylvania
Publication of WO2007061848A2 publication Critical patent/WO2007061848A2/en
Publication of WO2007061848A3 publication Critical patent/WO2007061848A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/04—Preserving or maintaining viable microorganisms
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/0208—Specific bacteria not otherwise provided for
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
    • C12Q1/045—Culture media therefor
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
    • G01N2333/24—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • G01N2333/245—Escherichia (G)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
    • G01N2333/305—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Micrococcaceae (F)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
    • G01N2333/32—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Bacillus (G)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/37—Assays involving biological materials from specific organisms or of a specific nature from fungi
    • G01N2333/39—Assays involving biological materials from specific organisms or of a specific nature from fungi from yeasts
    • G01N2333/40—Assays involving biological materials from specific organisms or of a specific nature from fungi from yeasts from Candida

Definitions

  • the present invention provides methods for cryopreservation and lyophilization of a Listeria strain, methods for producing a cell bank or a batch of vaccine doses of same, methods of characterizing same, and defined microbiological media.
  • Vaccines represent the most beneficial and cost effective public health measure currently known. However, as the understanding of neoplasias and infectious diseases grows, it has become apparent that traditional vaccine strategies may not be completely effective. Recently, Listeria monocytogenes (LM), typically expressing a heterologous antigen, has been used as a vaccine vector. Methods of growing vaccine Listeria strains, preparing frozen stocks of same, and characterizing the purity of same, are thus needed to advance this technology.
  • LM Listeria monocytogenes
  • the present invention provides methods for cryopreservation and lyophilization of a Listeria strain, methods for producing a cell bank or a batch of vaccine doses of same, methods of characterizing same, and defined microbiological media.
  • the present invention provides a method for cryopreservation of a Listeria strain, comprising growing a culture of the Listeria strain in a nutrient media, and freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees Celsius.
  • the temperature is about -70 degrees Celsius. In another embodiment, the temperature is about 70 - ' 80 degrees Celsius.
  • the present invention provides a method for producing a cell bank of a Listeria strain, comprising growing a culture of the Listeria strain in a nutrient media, and freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees Celsius.
  • the temperature is about -70 degrees Celsius. In another embodiment, the temperature is about " 70 - " 80 degrees Celsius.
  • the present invention provides a method for producing a batch of Listeria vaccine doses, comprising growing a culture of a Listeria vaccine strain in a nutrient media, and freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees Celsius.
  • iiiitemperature is about -70 degrees Celsius. In another embodiment, the temperature is about " 70 - " 80 degrees Celsius.
  • the present invention provides a method for preservation of a Listeria strain, comprising the steps of growing an inoculum of the Listeria strain in a nutrient media, thereby producing a culture; and lyophilizing the culture, thereby preserving a Listeria strain.
  • the present invention provides a method for producing a cell bank of a Listeria strain, comprising growing an inoculum of the Listeria strain in a nutrient media, thereby producing a culture; and lyophilizing the culture, thereby producing a cell bank of a Listeria strain.
  • the present invention provides a method for producing a batch of Listeria vaccine doses, comprising growing an inoculum of a Listeria vaccine strain in a nutrient media, thereby producing a culture; and lyophilizing the culture, thereby producing a batch of Listeria vaccine doses.
  • the present invention provides a cell bank of a Listeria strain having substantial viability upon thawing, wherein the cell bank is produced by the method of the present invention.
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L of methionine; and (2) effective amounts of: (a) cysteine; (b) a pH buffer; (c) a carbohydrate; (d) a divalent cation; (e) ferric or ferrous ions; (f) glutamine or another nitrogen source; (g) riboflavin; (h) thioctic acid; (i) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) one or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and cit
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L of cysteine; and (2) effective amounts of: (a) methionine; (b) a pH buffer; (c) a carbohydrate; (d) a divalent cation; (e) ferric or ferrous ions; (f) glutamine or another nitrogen source; (g) riboflavin; (h) thioctic acid; (i) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) one or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and cit
  • the present invention provides a defined microbiological media, comprising: ( 1 ) between about 0.00123 - 0.00246 moles of ferric or ferrous ions per liter; and (2) effective a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) glutamine or another nitrogen source; (g) riboflavin; (h) thioctic acid; (i) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) one or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and
  • the present invention provides a defined microbiological media, comprising: (1) between about 1.8 - 3.6 g/L of glutamine or another nitrogen source; and (2) effective amounts of: (a) a pH buffer; (b) a carbohydrate: (c) a divalent cation; (d) methionine (e) cysteine; (f) ferric 0 or ferrous ions (g) riboflavin (h); thioctic acid; (i) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) one or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate
  • the present invention provides a defined microbiological media, comprising: (1) between about 15 and about 30 mg/L of riboflavin; and (2) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) thioctic acid; (i) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) one or more components selected 0 from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and
  • (k) one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L of thioctic acid; and (2) effective amounts of: (a) a pH 5 buffer; (b) a carbohydrate (c) a divalent cation; (d) methionine (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) one or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, 0 and
  • biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide and (f) one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; and (2) effective amounts of: 0 (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) one or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.2 and about 0.75 mg/L each of one or more components selected from biotin and adenine; and (2) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) one or more components selected from leucine, isoleucine, valine, arginine, 0 histidine, tryptophan, and phenylalanine; (k) one or more components selected from thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (1) one or more components selected from cobalt, copper, boron, manganese, moly
  • the present invention provides a defined microbiological media, comprising: (1) between about 3 and about 6 mg/L each of one or more components selected from 5 thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (2) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (k) biotin; (1) adenine; and (m) one or more components selected from cobalt, copper, boron, manganese, 0 molybdenum, zinc
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.2 and about 0.75 mg/L each of one or more components selected from biotin and adenine; (2) between about 3 and about 6 mg/L each of one or more components selected from Ip liriftj ⁇ Mf b l&WSd ⁇ x ⁇ 'i ⁇ aS ⁇ nobenzoic acid, pantothenate, and nicotinamide; and (3) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; 5 and (k)
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.005 and about 0.02 g/L each of one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, and calcium; and (2) effective amounts of: (a) apH 0 buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; and (k) one or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nico
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.4 and about 1 g/L of citrate; and (2) effective amounts of: (a) apHbuffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (k) one or more
  • components selected from cobalt, copper, boron, manganese, molybdenum, zinc, and calcium and (1) one or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide.
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of methionine and cysteine; (2) between about
  • adenine between about 3 and about 6 mg/L each of one or more components selected from thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; (9) between about 0.005 and about 0.02 g/L each of one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, and calcium; (10) between about 0.4 and about 1 g/L of citrate; and (11) and effective amounts of: (a) a pH buffer; (b) a carbohydrate; and (c) a divalent cation.
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of methionine and cysteine; (2) between about 0.00123 and 0.00246 moles of ferric or ferrous ions per liter; (3) between about 1.8 and about 3.6 g/L of glutamine or another nitrogen source; (4) between about 0.3 and about 0.6 g/L of thioctic acid; (5) between 5 about 15 and about 30 mg/L of riboflavin; (6) between about 0.3 and about 0.6 g/L each of leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (7) between about 0.2 and about 0.75 mg/L each of biotin and adenine; (8) between about 3 and about 6 mg/L each of thiamine, pyridoxal, para- aminobenzoic acid, pantothenate, and nicot
  • the present invention provides a method of determining a presence of a suspected contaminant in a stock of a Listeria strain, comprising testing an aliquot of the stock for growth of the suspected contaminant on a minimal media containing a minimal salts solution, a carbohydrate, a 5 divalent cation, and thiamine, thereby determining a presence of a suspected contaminant in a stock of a
  • the present invention provides a method of determining a presence of a suspected contaminant in a stock of a Listeria strain, comprising testing an aliquot of the stock for growth of the suspected contaminant on a mannitol salt agar plate, thereby determining a presence of a suspected 0 contaminant in a stock of a Listeria strain.
  • the present invention provides a method for hemolysis testing of a bacterial stock containing a Listeria strain, comprising adding the strain to a plate comprising a lower layer of solid or semi-solid media and an upper layer of solid or semi-solid media, wherein the lower layer comprises a growth media and the upper layer comprises about 5% blood and a bacterial growth media, 5 thereby testing a hemolysis of a bacterial stock containing a Listeria strain.
  • the bacterial growth media is a defined media.
  • FIG. 1 Schematic map of pGG55.
  • Figure 2 Plasmid isolation throughout LB stability study.
  • B Plasmid isolation throughout TB 0 stability study.
  • C Quantitation of TB stability study.
  • Figure 3 Numbers of viable bacteria chloramphenicol (CAP)-resistant and CAP-sensitive colony- forming units (CFU) from bacteria grown in LB. Dark bars: CAP+; white bars: CAP. The two dark bars P* C "land If SNgMII >' ⁇ *i ' ⁇ M « ⁇ !ila,]lme point represent duplicate samples.
  • CAP chloramphenicol
  • CFU colony- forming units
  • Figure 4 Numbers of viable bacteria CAP-resistant and CAP-sensitive CFU from bacteria grown in TB. Labeling of bars is the same as for Figure 4.
  • Figure 8 Growth curve of 200 mL LB and TB cultures of Lm-LLO-E7.
  • Figure 9 Growth of Lm-LLO-E7 in four defined media with and without amino acids, vitamins and trace elements, at the 50 mL stage.
  • AA + Vits + TE + denotes bulk medium, essential components, 0 amino acids, vitamins and trace elements
  • AA + Vits + TE - denotes bulk medium, essential components, amino acids, and vitamins
  • AA + Vits - TE - denotes Bulk medium, essential components, and amino acids
  • “AA - Vits - TE -” denotes Bulk medium and essential components.
  • Figure 10 Growth of Lm-LLO-E7 in four defined media with and without amino acids, vitamins and trace elements, at the 200 mL stage. Groups are labeled as for Figure 10.
  • Figure 12 Growth of Lm-LLO-E7 in 200 mL cultures of defined media supplemented with different concentrations of supplements, with and without glutamine and iron.
  • FIG. 13 A. Growth curves of Lm-LLO-E7 in 5 L fermenters in TB and defined media. B. 20 Viability of Lm-LLO-E7 grown in 5 L fermenters in TB to different densities. C. Viability of Lm-LLO-E7 grown in 5 L fermenters in defined media to different densities.
  • Figure 14 Percentage of viable cells remaining after storage at -20 0 C for 3 days.
  • Figure 15 Percentage of viable cells remaining after storage at -70 0 C for 3 days
  • Figure 16 A. Percentage of viable cells remaining following snap freezing in liquid nitrogen and 25 storage at -70 0 C for 3 days. B. Summary of viability studies for several conditions. C. Growth kinetics of cryopreserved samples after thawing.
  • FIG 17 is a schematic map of E. coli-Listeria shuttle plasmids pGG55 (left side) and pTV3 (right side).
  • CAT(-) E. coli chloramphenicol transferase
  • CAT(+) Listeria chloramphenicol transferase
  • Ori Lm l ;::ir C ''PptiyiSClbEigin 11
  • Ii-EtHaI Ori Ec pl5 origin of replication for E.
  • prfA Listeria pathogenicity regulating factor A
  • LLO C-terminally truncated listeriolysin O including its promoter
  • E7 HPV E7
  • p60- dal expression cassette of p60 promoter and Listeria dal gene. Selected restriction sites are also depicted.
  • FIG. 18 Plasmid preparation of pTV3 from E. coli strain MB2159. Qiagen® midi-preparation of 5 nucleic acids was following the manufacturer's protocol. Lanes from left to right: Lanes 1 and 7: Molecular Weight Marker, lOOBp ladder (Invitrogen). Lane 2: pTV3, clone #15. Lane 3: pTV3, clone #16. Lane 4: pTV3C, clone #22. Lane 5: pTV3C, clone #24. Lane 6: pGG55 control.
  • FIG. 19 Plasmid maintenance in vitro (A) and in vivo (B).
  • strains were cultured Brain-Heart Infusion (BHI) media with (GG55-CM) and without (GG55-no ChI) 0 chloramphenicol (LM-LLO-E7) or with and without D-alanine [Lmdd(pTV3)] .
  • the cultures were diluted 1 : 1000 daily into fresh LB .
  • the CFU of the cultures were determined daily on BHI (BHI) and on BHI with chloramphenicol (BHI-ChI) for LM-LLO-E7 or on BHI alone or with D-alanine (BHI-AIa) for Lmdd(pTV3).
  • AU liquid medium and plates contained an additional 50 ⁇ g of streptomycin per ml, to which LM strain 10403S is naturally resistant.
  • LM was 5 injected intraperitoneally at a dose of 1/10 of the LD 50 in C57BL/6 mice. Spleens were harvested at different time points post-injection and homogenized in phosphate-buffered saline (PBS). CFU counts were determined on BHI plates with and without D-alanine for Lmdd(pTV3), on BHI plates with and without chloramphenicol for LM-LLO-E7, and on BHI plates only for wild-type 10403 S.
  • PBS phosphate-buffered saline
  • Figure 20 depicts growth on LB-agar plates of LM strain Lmdd(-) transformed with the pTV3 0 vector.
  • Bacteria were plated on different media: Top: agar with streptomycin, no added alanine.
  • Lmdd- pTV3 grow (the host strain 10403s is streptomycin resistant).
  • Figure 21 depicts growth on LB-agar plates of LM strain Lmdd(-) without the pTV3 vector.
  • Upper 5 left agar with streptomycin.
  • Lmdd (-) cannot grow in the absence of d-alanine.
  • Upper right agar with alanine.
  • Lmdd (-) grows.
  • Figure 22 depicts bacterial growth as measured by optical density (600 nanometers [nm]) plotted vs. time.
  • +AIa media contains D-alanine
  • +ChI media contains chloramphenicol.
  • the present invention provides methods for cryopreservation and lyophilization of a Listeria strain, methods for producing a cell bank or a batch of vaccine doses of same, methods of characterizing same, and defined microbiological media.
  • the present invention provides a method for cryopreservation of a Listeria strain, comprising growing a culture of the Listeria strain in a nutrient media, freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees Celsius.
  • the temperature is about -70 degrees Celsius. In another embodiment, the temperature is about " 70 - " 80 degrees Celsius.
  • the present invention provides a method for cryopreservation of a Listeria strain, comprising growing a culture of the Listeria strain in a defined media of the present invention, freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees Celsius.
  • the temperature is about -70 degrees Celsius.
  • the temperature is about " 70 - " 80 degrees Celsius.
  • any defined microbiological media comprising growing a culture of the Listeria strain in a defined media of the present invention, freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees Celsius.
  • the temperature is about -70 degrees Celsius.
  • the temperature is about " 70 - " 80 degrees Celsius.
  • any defined microbiological media comprising growing a culture of the Listeria strain in a defined media of the present invention, freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees Celsius.
  • the temperature is about -70 degrees Celsius.
  • Each defined microbiological media represents a separate embodiment of the present invention.
  • results of the present invention identify effective methods for cryopreservation of Listeria strains and methods for producing a cell bank or a batch of vaccine doses of same.
  • cryopreserved Listeria are used to generate a Listeria cell bank. In another embodiment, the cryopreserved Listeria are used for medical purposes. In another embodiment, the cryopreserved Listeria are used for research purposes. In another embodiment, the cryopreserved Listeria axe used for quality control purposes. In another embodiment, the cryopreserved Listeria are used for any other purpose known in the art. Each possibility represents a separate embodiment of the present invention.
  • the present invention provides a method for producing a cell bank of a
  • Listeria strain comprising growing a culture of the Listeria strain in a nutrient media, and freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees Celsius.
  • the temperature is about -70 degrees Celsius. In another embodiment, the temperature is about " 70 - " 80 degrees Celsius.
  • the present invention provides a method for producing a cell bank of a
  • the temperature is about -70 degrees Celsius. In another embodiment, the temperature is about " 70 - " 80 degrees Celsius. In another embodiment, any defined microbiological media of the present invention may be used in this method. Each defined microbiological media represents a separate embodiment of the present invention.
  • the present invention provides a method for producing a stock of a Listeria strain, comprising growing the Listeria strain in a nutrient media, freezing the culture in a solution comprising glycerol, and storing the Listeria strain at about -70 degrees Celsius.
  • the present invention provides a method for preservation of a Listeria strain, comprising the steps of growing an inoculum of the Listeria strain in a nutrient media, thereby 10 producing a culture; and lyophilizing the culture, thereby preserving a Listeria strain.
  • the present invention provides a method for producing a cell bank of a Listeria strain, comprising growing an inoculum of the Listeria strain in a nutrient media, thereby producing a culture; and lyophilizing the culture, thereby producing a cell bank of a Listeria strain.
  • the present invention provides a method for producing a batch of Listeria 15 vaccine doses, comprising growing an inoculum of a Listeria vaccine strain in a nutrient media, thereby producing a culture; and lyophilizing the culture, thereby producing a batch of Listeria vaccine doses.
  • the present invention provides a method for producing a stock of a Listeria strain, comprising growing the Listeria strain in a defined microbiological media of the present invention, freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees 20 Celsius.
  • the temperature is about -70 degrees Celsius.
  • the temperature is about " 70 - " 80 degrees Celsius.
  • any defined microbiological media of the present invention may be used in this method. Each defined microbiological media represents a separate embodiment of the present invention.
  • the present invention provides a method for producing a stock of a Listeria
  • 25 strain comprising growing the Listeria strain in a defined microbiological media of the present invention, and lyophilizing the culture.
  • any defined microbiological media of the present invention may be used in this method.
  • Each defined microbiological media represents a separate embodiment of the present invention.
  • the cell bank of methods and compositions of the present invention is a
  • the cell bank is a working cell bank.
  • the cell bank is Good Manufacturing Practice (GMP) cell bank.
  • the cell bank is intended for production of clinical-grade material.
  • the cell bank is suitable for 'p ⁇ tj
  • the cell bank is suitable for production of Listeria vaccine doses that can be safely administered to human subjects.
  • the cell bank is suitable for production of Listeria vaccine doses that are suitable for vaccination of human subjects.
  • the cell bank conforms to regulatory practices for human use.
  • the cell bank is any other type of cell bank known in the art. Each possibility represents a separate embodiment of the present invention.
  • the present invention provides a method for producing a batch of Listeria vaccine doses, comprising growing a culture of a Listeria vaccine strain in a nutrient media, and freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees Celsius.
  • the temperature is about -70 degrees Celsius. In another embodiment, the temperature is about " 70 - " 80 degrees Celsius.
  • the present invention provides a method for cryopreservation of a. Listeria strain, comprising the steps of growing an inoculum of the Listeria strain in a defined media of the present invention, thereby producing a culture; freezing the culture in a solution comprising glycerol, and storing the Listeria strain in a frozen state, thereby cryopreserving a Listeria strain.
  • the present invention provides a method for preservation of a Listeria strain, comprising the steps of growing an inoculum of the Listeria strain in a defined media of the present invention, thereby producing a culture; and lyophilizing the culture, thereby preserving a Listeria strain.
  • any defined microbiological media of the present invention may be used in this method. Each method and each defined microbiological media represents a separate embodiment of the present invention.
  • the present invention provides a method for producing a cell bank of a Listeria strain, comprising growing an inoculum of the Listeria strain in a defined media of the present invention, thereby producing a culture; freezing the culture in a solution comprising glycerol, and storing the Listeria strain in a frozen state, thereby producing a cell bank of a Listeria strain.
  • the present invention provides a method for producing a cell bank of a Listeria strain, comprising growing an inoculum of the Listeria strain in a defined media of the present invention, thereby producing a culture; and lyophilizing the culture, thereby producing a cell bank of a Listeria strain.
  • any defined microbiological media of the present invention may be used in this ⁇ >
  • the present invention provides a method for producing a batch of Listeria vaccine doses, comprising growing a culture of a Listeria vaccine strain in a defined media of the present
  • the present invention provides a method for producing a batch of Listeria vaccine doses, comprising growing a culture of a Listeria vaccine strain in a defined media of the present invention, and lyophilizing the culture.
  • any defined microbiological media of the present invention may be used in this method.
  • Each defined microbiological media represents a separate embodiment of the present invention.
  • the Listeria vaccine doses of methods and compositions of the present invention are intended for administration to human subjects.
  • the Listeria vaccine doses are suitable for administration to human subject.
  • the Listeria vaccine doses 15 are intended for administration to animal subjects.
  • the Listeria vaccine doses are intended for research purposes.
  • the Listeria vaccine doses are intended for any other purpose known in the art. Each possibility represents a separate embodiment of the present invention.
  • the culture e.g. the culture of a Listeria vaccine strain that is used to produce a batch of Listeria vaccine doses
  • the culture is inoculated 20 from a cell bank.
  • the culture is inoculated from a frozen stock.
  • the culture is inoculated from a starter culture.
  • the culture is inoculated from a colony.
  • the culture is inoculated at mid-log growth phase.
  • the culture is inoculated at approximately mid-log growth phase.
  • the culture is inoculated at another growth phase.
  • the solution used for freezing has a glycerol content of 2-20%.
  • the content is 2%.
  • the content is 20%.
  • the content is 1%.
  • the content is 1.5%.
  • the content is 3%.
  • the content is 4%.
  • the content is 5%. In another embodiment, the content is 2%. In another embodiment, the content is 2%. In another embodiment, the content is 7%. In another embodiment, the content is 9%. In another embodiment, the content is 10%. In another embodiment, the content is 12%. In another embodiment, the content is 14%. In another embodiment, the content is 16%. In another content is 25%. In another embodiment, the content is 30%. In another embodiment, the content is 35%. In another embodiment, the content is 40%. Each possibility represents a separate embodiment of the present invention.
  • the solution used for freezing contains another colligative additive or additive with anti-freeze properties, in place of glycerol.
  • the solution used for freezing contains another colligative additive or additive with anti-freeze properties, in addition to glycerol.
  • the additive is mannitol.
  • the additive is DMSO.
  • the additive is sucrose.
  • the additive is any other colligative additive or additive with anti-freeze properties that is known in the art. Each possibility represents a separate embodiment of the present invention.
  • the nutrient media utilized for growing a culture of a Listeria strain is LB.
  • the nutrient media is TB.
  • the nutrient media is a defined media (e.g. a defined media of the present invention).
  • the nutrient media is any other type of nutrient media known in the art. Each possibility represents a separate embodiment of the present invention.
  • the step of growing is performed with a shake flask (e.g. a baffled shake flask).
  • the growing is performed with a batch f ermenter.
  • the growing is performed with a stirred tank or flask.
  • the growing is performed with an airflit fermenter.
  • the growing is performed with a fed batch.
  • the growing is performed with a continuous cell reactor.
  • the growing is performed with an immobilized cell reactor.
  • the growing is performed with any other means of growing bacteria that is known in the art. Each possibility represents a separate embodiment of the present invention.
  • a constant pH is maintained during growth of the culture (e.g. in a batch fermenter).
  • the pH is maintained at about 7.0.
  • the pH is about 6.
  • the pH is about 6.5.
  • the pH is about 7.5.
  • the pH is about 8.
  • the pH is 6.5-7.5.
  • the pH is 6-8.
  • the pH is 6-7.
  • the pH is 7-8.
  • a constant temperature is maintained during growth of the culture.
  • the temperature is maintained at about 37 0 C.
  • the temperature is 37 0 C.
  • the temperature is 25 0 C.
  • .®yi lhd!her embodiment the temperature is 28 0 C.
  • the temperature is 30 0 C.
  • the temperature is 32 0 C.
  • the temperature is 34 0 C.
  • the temperature is 35 0 C.
  • the temperature is 36 0 C.
  • the temperature is 38 0 C.
  • a constant dissolved oxygen concentration is maintained during growth of the culture.
  • the dissolved oxygen concentration is maintained at 20% of saturation.
  • the concentration is 15% of saturation.
  • the concentration is 16% of saturation.
  • the concentration is 18% of saturation.
  • the concentration is 22% of saturation. In another embodiment, the concentration is 25% of saturation. In another embodiment, the concentration is 30% of saturation. In another embodiment, the concentration is 35% of saturation. In another embodiment, the concentration is 40% of saturation. In another embodiment, the concentration is 45% of saturation. In another embodiment, the concentration is 50% of saturation. In another embodiment, the concentration is 55% of saturation. In another embodiment, the concentration is
  • the concentration is 65% of saturation. In another embodiment, the concentration is 70% of saturation. In another embodiment, the concentration is 75% of saturation. In another embodiment, the concentration is 80% of saturation. In another embodiment, the concentration is 85% of saturation. In another embodiment, the concentration is 90% of saturation. In another embodiment, the concentration is 95% of saturation. In another embodiment, the concentration is 100% of saturation. In another embodiment, the concentration is 65% of saturation. In another embodiment, the concentration is 70% of saturation. In another embodiment, the concentration is 75% of saturation. In another embodiment, the concentration is 80% of saturation. In another embodiment, the concentration is 85% of saturation. In another embodiment, the concentration is 90% of saturation. In another embodiment, the concentration is 95% of saturation. In another embodiment, the concentration is 100% of saturation. In
  • the concentration is near 100% of saturation.
  • the culture is grown in media having a maximum volume of 2 liters (L) per vessel.
  • the media has a maximum volume of 200 ml per ves sel .
  • the media has a maximum volume of 300 25 ml per vessel.
  • the media has a maximum volume of 500 ml per vessel.
  • the media has a maximum volume of 750 ml per vessel.
  • the media has a maximum volume of 1 L per vessel.
  • the media has a maximum volume of 1.5 L per vessel.
  • the media has a maximum volume of 2.5 L per vessel.
  • the media has a maximum volume of 3 L per vessel.
  • the media has a minimum volume of 2 L per vessel. In another embodiment, the media has a minimum volume of 500 ml per vessel. In another embodiment, the media has a minimum volume of 750 ml per vessel. In another embodiment, the media has a minimum volume of 1 L per vessel. In another embodiment, the media has a minimum volume of 1.5 L per vessel. In another embodiment, the media has a minimum volume of 2.5 L per vessel. In another embodiment, the media has ih u C In another embodiment, the media has a minimum volume of 4 L per vessel. In another embodiment, the media has a minimum volume of 5 L per vessel. In another embodiment, the media has a minimum volume of 6 L per vessel. In another embodiment, the media has a minimum volume of 8 L per vessel. In another embodiment, the media has a minimum volume of 10 L per
  • Each volume represents a separate embodiment of the present invention.
  • the step of freezing or lyophilizing is performed when the culture has an OD 6O0 of 0.7 units.
  • the culture has an OD 60O of 0.8 units.
  • the OD 60O is about 0.7 units.
  • the OD 6O o is about 0.8 units. In another embodiment, the OD 6O0 is 0.6 units. In another embodiment, the OD 6O0 is 0.65 units. In another embodiment, the OD 6O0 is 0.75 units. In another embodiment, the OD 6 oo is 0.85 units. In another embodiment, the OD 6 oo is 0.9 units. In another embodiment, the OD 6 oo is 1 unit. In another embodiment, the OD 6 oo is 0.6-0.9 units. In another embodiment, the OD 6 oo is 0.65-0.9 units. In another embodiment, the OD 600 is 0.7-0.9 units. In another
  • the OD 600 is 0.75-0.9 units. In another embodiment, the OD 6 oo is 0.8-0.9 units. In another embodiment, the OD 6O0 is 0.75-1 units. In another embodiment, the OD 6 oo is 0.9-1 units. In another embodiment, the OD 600 is greater than 1 unit.
  • the OD 6 oo is significantly greater than 1 unit (e.g. when the culture is produced in a batch fermenter). In another embodiment, the OD 6 oo is 7.5-8.5 units. In another embodiment, 20 the OD 6O0 is 1.2 units. In another embodiment, the OD 6 O 0 is 1.5 units. In another embodiment, the OD 6 oo is 2 units. In another embodiment, the OD 6 O 0 is 2.5 units. In another embodiment, the OD 6O o is 3 units. In another embodiment, the OD 60O is 3.5 units. In another embodiment, the OD 6 oo is 4 units. In another embodiment, the OD 6 oo is 4.5 units. In another embodiment, the OD 6 oo is 5 units. In another embodiment, the OD 6O0 is 5.5 units. In another embodiment, the OD 6 oo is 6 units. In another embodiment, the OD 60O is 7.5-8.5 units. In another embodiment, 20 the OD 6O0 is 1.2 units. In another embodiment, the OD 6
  • the OD 600 is 7 units. In another embodiment, the OD 60O is 7.5 units. In another embodiment, the OD 60O is 8 units. In another embodiment, the OD 60O is 8.5 units. In another embodiment, the OD 6 oo is 9 units. In another embodiment, the OD 600 is 9.5 units. In another embodiment, the OD 6 Oo is 10 units. In another embodiment, the OD 6 oo is more than 10 units.
  • the OD 6 oo is 1-2 units. In another embodiment, the OD 6 oo is 1.5-2.5 units.
  • the OD 60O is 2-3 units. In another embodiment, the OD 600 is 2.5-3.5 units. In another embodiment, the OD 60O is 3-4 units. In another embodiment, the OD 600 is 3.5-4.5 units. In another embodiment, the OD 60 O is 4-5 units. In another embodiment, the OD 600 is 4.5-5.5 units. In another embodiment, the OD 60 O is 5-6 units. In another embodiment, the OD 6O0 is 5.5-6.5 units. In another P units. In another embodiment, the OD 600 is 1.5-3.5 units. In another embodiment, the OD 600 is 2-4 units. In another embodiment, the OD ⁇ oo is 2.5-4.5 units. In another embodiment, the OD 600 is 3-5 units. In another embodiment, the OD 60O is 4-6 units.
  • the OD 6O0 is 5-7 units. In another embodiment, the OD 60O is 2-5 units. In another 5 embodiment, the OD 6 oo is 3-6 units. In another embodiment, the OD 6O0 is 4-7 units. In another embodiment, the OD 6 oo is 5-8 units. In another embodiment, the OD 600 is 1.2-7.5 units. In another embodiment, the OD 6 oo is 1.5-7.5 units. In another embodiment, the OD 6 oo is 2-7.5 units. In another embodiment, the OD 600 is 2.5-7.5 units. In another embodiment, the OD 6 oo is 3-7.5 units. In another embodiment, the OD 6 oo is 3.5-7.5 units. In another embodiment, the OD 6 oo is 4-7.5 units.
  • the OD 6O0 is 4.5-7.5 units. In another embodiment, the OD 60O is 5-7.5 units. In another embodiment, the OD 6 oo is 5.5-7.5 units. In another embodiment, the OD 600 is 6-7.5 units. In another embodiment, the OD 60O is 6.5-7.5 units. In another embodiment, the OD 600 is 7-7.5 units. In another embodiment, the OD 6 oo is more than 10 units. In another embodiment, the OD 6O0 is 1.2-8.5 units. In another embodiment, the OD 6 oo is 1.5-8.5 units. In another embodiment, the ODgoo is 2-8.5 units. In 5 another embodiment, the OD ⁇ oo is 2.5-8.5 units. In another embodiment, the OD 6 oo is 3-8.5 units.
  • the OD 6 oo is 3.5-8.5 units. In another embodiment, the OD 6 oo is 4-8.5 units. In another embodiment, the OD 600 is 4.5-8.5 units. In another embodiment, the OD 6 oo is 5-8.5 units. In another embodiment, the OD 600 is 5.5-8.5 units. In another embodiment, the OD 60O is 6-8.5 units. In another embodiment, the OD 600 is 6.5-8.5 units. In ⁇ another embodiment, the ODeoo is 7-8.5 units. In 0 another embodiment, the OD 600 is 7.5-8.5 units. In another embodiment, the OD 600 is 8-8.5 units. In another embodiment, the OD 600 is 9.5-8.5 units. In another embodiment, the OD 600 is 10 units.
  • the step of freezing or lyophilizing is performed when the culture has a biomass of about 1 x 10 9 colony-forming units (CFU)/ml.
  • the biomass is about 1.5 x 10 9 CFR/ml.
  • the biomass is about 1.5 x 10 9 CFR/ml.
  • the 5 biomass is about 2 x 10 9 CFR/ml.
  • the biomass is about 3 x 10 9 CFR/ml.
  • the biomass is about 4 x 10 9 CFR/ml.
  • the biomass is about 5 x 10 9 CFR/ml.
  • the biomass is about 7 x 10 9 CFR/ml.
  • the biomass is about 9 x 10 9 CFR/ml.
  • the biomass is about 10 x 10 9 CFR/ml. In another embodiment, the biomass is about 12 x 10 9 CFR/ml. In another embodiment, the biomass is about 0 15 x 10 9 CFR/ml. In another embodiment, the biomass is about 20 x 10 9 CFR/ml. In another embodiment, the biomass is about 25 x 10 9 CFR/ml. In another embodiment, the biomass is about 30 x 10 9 CFR/ml. In another embodiment, the biomass is about 33 x 10 9 CFR/ml. In another embodiment, the biomass is about 40 x 10 9 CFR/ml. In another embodiment, the biomass is about 5O x IO 9 CFR/ml. In another embodiment, the biomass is about more than 50 x 10 9 CFR/ml. OfOD 600 readings and culture biomass measurements represents a separate embodiment of the present invention.
  • the Listeria culture is flash-frozen in liquid nitrogen, followed by storage at the final freezing temperature.
  • the culture is frozen in a more gradual manner; e.g. by placing in a vial of the culture in the final storage temperature.
  • the culture is frozen by any other method known in the art for freezing a bacterial culture. Each possibility represents a separate embodiment of the present invention.
  • the storage 10 temperature of the culture is between -20 and -80 degrees Celsius ( 0 C). In another embodiment, the temperature is significantly below -20 0 C. In another embodiment, the temperature is not warmer than -70 0 C. In another embodiment, the temperature is -70 0 C. In another embodiment, the temperature is about - 70 0 C. In another embodiment, the temperature is -20 0 C. In another embodiment, the temperature is about -20 0 C. In another embodiment, the temperature is -30 0 C. In another embodiment, the temperature is -40 15 0 C. In another embodiment, the temperature is -50 0 C. In another embodiment, the temperature is -60 0 C.
  • the temperature is -80 0 C. In another embodiment, the temperature is -30 - -70 0 C. In another embodiment, the temperature is -40 - -70 0 C. In another embodiment, the temperature is -50 - - 70 0 C. In another embodiment, the temperature is -60 - -70 0 C. In another embodiment, the temperature is -30 - -80 0 C. In another embodiment, the temperature is -40 - -80 0 C. In another embodiment, the
  • the temperature is -50 - -80 0 C. In another embodiment, the temperature is -60 - -80 0 C. In another embodiment, the temperature is -70 - -80 0 C. In another embodiment, the temperature is colder than -70 0 C. In another embodiment, the temperature is colder than -80 0 C. Each possibility represents a separate embodiment of the present invention.
  • the cryopreservation 25 or frozen storage is for a maximum of 24 hours. In another embodiment, the cryopreservation or storage is for maximum of 2 days. In another embodiment, the cryopreservation or storage is for maximum of 3 days. In another embodiment, the cryopreservation or storage is for maximum of 4 days. In another embodiment, the cryopreservation or storage is for maximum of 1 week. In another embodiment, the cryopreservation or storage is for maximum of 2 weeks. In another embodiment, the cryopreservation or storage is for
  • cryopreservation or storage is for maximum of 1 month.
  • cryopreservation or storage is for maximum of 2 months. In another embodiment, the cryopreservation or storage is for maximum of 3 months. In another embodiment, the cryopreservation or storage is for maximum of 5 months. In another embodiment, the cryopreservation or P C "P ⁇ £>ife ⁇ QfB j ⁇ stiiWiialt ⁇ Efe months. In another embodiment, the cryopreservation or storage is for maximum of 9 months. In another embodiment, the cryopreservation or storage is for maximum of 1 year.
  • the cryopreservation or storage is for a minimum of 1 week. In another embodiment, the cryopreservation or storage is for minimum of 2 weeks. In another embodiment, the 5 cryopreservation or storage is for minimum of 3 weeks. In another embodiment, the cryopreservation or storage is for minimum of 1 month. In another embodiment, the cryopreservation or storage is for minimum of 2 months. In another embodiment, the cryopreservation or storage is for minimum of 3 months. In another embodiment, the cryopreservation or storage is for minimum of 5 months. In another embodiment, the cryopreservation or storage is for minimum of 6 months. In another embodiment, the
  • cryopreservation or storage is for minimum of 9 months. In another embodiment, the cryopreservation or storage is for minimum of 1 year. In another embodiment, the cryopreservation or storage is for minimum of 1.5 years. In another embodiment, the cryopreservation or storage is for minimum of 2 years. In another embodiment, the cryopreservation or storage is for minimum of 3 years. In another embodiment, the cryopreservation or storage is for minimum of 5 years. In another embodiment, the cryopreservation or
  • cryopreservation or storage is for minimum of 7 years . In another embodiment, the cryopreservation or storage is for minimum of 10 years. In another embodiment, the cryopreservation or storage is for longer than 10 years.
  • Each length of storage or cryopreservation represents a separate embodiment of the present invention.
  • the Listeria bacteria in another embodiment of methods and compositions of the present invention, the Listeria bacteria
  • Example 20 exhibit exponential growth es sentially immediately after thawing or reconstitution following an extended period of cryopreservation, frozen storage, or lyophilization (Example 2).
  • "essentially immediately” refers to within about 1 hour after inoculating fresh media with cells from the cell bank or starter culture.
  • the bacteria exhibit exponential growth shortly after (e.g. in various embodiments, after 10 minutes (min), 20 min, 30 min, 40 min, 50 min, 1 hour, 75 min, 90 25 min, 105 min, or 2 hours) (a) thawing and dilution or (b) reconstitution following the period of cryopreservation or storage.
  • Each possibility represents a separate embodiment of the present invention.
  • the "extended period of cryopreservation or frozen storage” is, in another embodiment, 1 month. In another embodiment, the period is 2 months. In another embodiment, the period is 3 months. In another embodiment, the period is 5 months. In another embodiment, the period is 6 months. In another
  • the period is 9 months. In another embodiment, the period is 1 year. In another embodiment, the period is 1.5 years. In another embodiment, the period is 2 years.
  • Exponential growth refers to a doubling time that is close to the maximum observed for the conditions (e.g. media type, temperature, etc.) in which the culture is growing. In another embodiment, “exponential growth” refers to a doubling time that is reasonable constant several hours (e.g. 1 hour, 1.5 hours, 2 hours, or 2.5 hours) after dilution of the culture; optionally following a brief recovery period.
  • Exponential growth refers to a doubling time that is reasonable constant several hours (e.g. 1 hour, 1.5 hours, 2 hours, or 2.5 hours) after dilution of the culture; optionally following a brief recovery period.
  • the Listeria vaccine strain of methods and compositions of the present invention retains a viability of over 90% after (a) thawing and dilution or (b) reconstitution, following 14 days of cryopreservation (Example 2).
  • the viability upon thawing or reconstitution is close to 100% following the period of cryopreservation or lyophilization.
  • the viability upon thawing or reconstitution is about 90%.
  • the viability upon thawing or reconstitution is close to 90%.
  • the viability upon thawing or reconstitution is at least 90%.
  • the viability upon thawing or reconstitution is over 80%.
  • Viability refers, in another embodiment, to the number of live bacteria, relative to the number that were frozen or lyophilized. In another embodiment, the term refers to the number of bacteria capable of multiplication, relative to the number that were frozen. Each possibility represents a separate embodiment of the present invention.
  • the Listeria strain that is subject to cryopreservation, freezing, or lyophilizing is, in another embodiment, a Listeria vaccine strain; e.g. Lm-LLO-E7 or Lmdd-pTV3.
  • the vaccine strain expresses a heterologous antigen (Ag).
  • the heterologous Ag is a tumor Ag.
  • the heterologous Ag is an infectious disease Ag.
  • the heterologous Ag is E7 protein.
  • the heterologous Ag is fused to an immunogenic protein.
  • the immunogenic protein is LLO.
  • the heterologous antigen is a fusion of LLO and E7.
  • the Listeria strain is any Listeria strain that is enumerated or disclosed herein. In another embodiment, the Listeria strain is any Listeria strain of the present invention. Each strain may be used for each method of the present invention, and each method-strain combination represents a separate embodiment of the present invention.
  • the present invention provides a cell bank of ⁇ Listeria strain, wherein the cell bank is produced by the method of the present invention.
  • each of the above methods may be utilized, and each method represents a separate embodiment of the present invention. wherein the stock is produced by the method of the present invention.
  • each of the above methods may be utilized, and each method represents a separate embodiment of the present invention.
  • the present invention provides a batch of vaccine doses of a Listeria strain, 5 wherein the batch is produced by the method of the present invention.
  • each of the above methods may be utilized, and each method represents a separate embodiment of the present invention.
  • the above cell bank, frozen stock or batch of vaccine doses has a substantial viability upon thawing or reconstitution.
  • the cell bank, frozen stock or 10 batch of vaccine doses exhibits superior one or more properties (e.g. immunogenicity, consistency, quality, portability, etc).
  • properties e.g. immunogenicity, consistency, quality, portability, etc.
  • lyophilization comprises 2 steps: freezing the product, and decreasing the pressure above the ice surface.
  • formation of ice crystals results in a separation of the solutes and the solvent.
  • concentration of the solvent is generally greater than that of the solutes, the formation of ice forces the solutes into a region between the crystals known as the "interstitial.”
  • the second step (decreasing the pressure) causes sublimation of
  • lyophilization comprises a third step: secondary drying (desorption).
  • desorption removes moisture contained within the cake is ("absorbed" water).
  • desorption removes water on the surface of the cake is defined as “adsorbed” water.
  • desorption removes both absorbed and adsorbed water.
  • an aseptic filling room is used for filling the vials prior to lyophilization
  • cryopreservation an art-known lyophilizer is used (e.g. a Edwards, 1M2 Steam Sterilizable Lyophilizer).
  • a freeze-dryer is used that is equipped with a mechanical pumping system that removes the non-condensable gases.
  • a mechanical pumping system that removes the non-condensable gases.
  • the present invention provides a defined microbiological media
  • the results of the present invention identify defined microbiological media mat 5 are efficacious in supporting growth of Listeria and cryopreservation and preparation of cell banks, frozen stocks, and vaccine doses of same.
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L of cysteine; and (2) effective amounts of: (a) methionine; (b) a pH buffer; (c) a carbohydrate; (d) a divalent cation; (e) ferric or ferrous ions; (f) 0 glutamine or another nitrogen source; (g) riboflavin; (h) thioctic acid; (i) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) 1 or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium,
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.00123 - 0.00246 moles of ferric or ferrous ions per liter; and (2) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) glutamine or another nitrogen source; (g) riboflavin; (h) thioctic acid; (i) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) 1 or more
  • the present invention provides a defined microbiological media, comprising: (1) between about 1.8 - 3.6 g/L of glutamine or another nitrogen source; and (2) effective
  • the present invention provides a defined microbiological media, comprising: (1) between about 15 and about 30 mg/L of riboflavin; and (2) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) thioctic acid; (i) 1 or more components selected from leucine, IF :!t 1C "pprdyib ⁇ EC ⁇ Blt ⁇ 'e ⁇ Myt'iSuiniil ⁇ stidine,- tryptophan, and phenylalanine; (j) 1 or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) 1 or more components selected from cobalt, copper
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L of thioctic acid; and (2) effective amounts of: (a) apH buffer; (b) a carbohydrate (c) a divalent cation; (d) methionine (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) 1 or more components selected 0 from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of methionine and cysteine; (2) between about 5 0.00123 and 0.00246 moles of ferric or ferrous ions per liter; (3) between about 1.8 and about 3.6 g/L of glutamine or another nitrogen source; (4) between about 0.3 and about 0.6 g/L of thioctic acid; (5) between about 15 and about 30 mg/L of riboflavin; and (6) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (e) 1 or more components selected from adenine, biotin, 0 thiamine, pyridoxal, para-aminobenzoic acid, pan
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of methionine and cysteine; (2) between about 0.00123 and 0.00246 moles of ferric or ferrous ions per liter; (3) between about 1.8 and about 3.6 g/L of
  • thioctic acid between about 15 and about 30 mg/L of riboflavin; and (6) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) leucine; (e) isoleucine; (f) valine; (g) arginine; (h) histidine; (i) tryptophan; (j) phenylalanine; (k) 1 or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (1) 1 or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (1) 1 or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, panto
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; and (2) effective amounts of: (a) a IP CpB ⁇ t ⁇ MS ⁇ liiiCdrfelRf ⁇ &St' ⁇
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; and (2) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen 0 source; (h) riboflavin; (i) thioctic acid; (j) 1 or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.2 and about 0.75 of 1 or more components selected from biotin and 5 adenine; and (2) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (k) 1 or more components selected from thiamine, pyridoxal, para- aminobenzoic acid, pantothenate, and nicotinamide; and (1) 1 or more components selected from cobalt, 0 copper, boron, manganese, molybdenum, zinc,
  • the present invention provides a defined microbiological media, comprising: (1) between about 3 and about 6 mg/L each of 1 or more components selected from thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (2) effective amounts of: (a) apH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) 5 glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (k) biotin; (1) adenine; and (1) 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium,
  • the present invention provides a defined microbiological media, 0 comprising: (1) between about 0.2 and about 0.75 mg/L each of 1 or more components selected from biotin and adenine; (2) between about 3 and about 6 mg/L each of 1 or more components selected from thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (3) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or "f ⁇ WlWJi ⁇ fey ⁇ Kiitt Jar another nitrogen source; (h) riboflavin; (i) thioctic acid; (J) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; and (k) 1 or more components
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.005 and about 0.02 g/L each of 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, and calcium; and (2) effective amounts of: (a) apH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (T) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; and (k) 1 or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotin
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.4 and about 1 g/L of citrate; and (2) effective amounts of: (a) apH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (k) 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, and calcium; and (1) 1 or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nico
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of methionine and cysteine; (2) between about 0.00123 and 0.00246 moles of ferric or ferrous ions per liter; (3) between about 1.8 and about 3.6 g/L of glutamine or another nitrogen source; (4) between about 0.3 and about 0.6 g/L of thioctic acid; (5) between about 15 and about 30 mg/L of riboflavin; (6) between about 0.3 and about 0.6 g/L each of 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (7) between about 0.2 and about 0.75 mg/L each of 1 or more components selected from biotin and adenine; (8) between about 3 and about 6 mg/L each of 1 or more components selected from thiamine, pyridoxal, para-amino
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of methionine and cysteine; (2) between about 0.00123 and 0.00246 moles of ferric or ferrous ions per liter; (3) between about 1.8 and about 3.6 g/L of glutamine or another nitrogen source; (4) between about 0.3 and about 0.6 g/L of thioctic acid; (5) between 5 about 15 and about 30 mg/L of riboflavin; (6) between about 0.3 and about 0.6 g/L each of leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (7) between about 0.2 and about 0.75 mg/L each of 1 or more components selected from biotin and adenine; (8) between about 0.2 and about 0.75 mg/L each of 1 or more components selected from biotin and adenine; (8) between
  • the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of methionine and cysteine; (2) between about 5 0.00123 and 0.00246 moles of ferric or ferrous ions per liter; (3) between about 1.8 and about 3.6 g/L of glutamine or another nitrogen source; (4) between about 0.3 and about 0.6 g/L of thioctic acid; (5) between about 15 and about 30 mg/L of riboflavin; (6) between about 0.3 and about 0.6 g/L each of leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (7) between about 0.2 and about 0.75 mg/L each of biotin and adenine; (8) between about 3 and about 6 mg/L each of thiamine, pyridoxal, para- 0 aminobenzoic acid, pantothenate, and nicotinamide
  • a defined microbiological media of methods and compositions of the 5 present invention is suitable for growth of a Listeria strain.
  • the Listeria strain is a
  • the Listeria vaccine strain is a LM strain. In another embodiment, the Listeria strain is any other Listeria strain of the present invention. In another embodiment, the Listeria strain is any other Listeria strain enumerated herein. In another embodiment, the Listeria strain is any other Listeria strain known in the art. In another embodiment, the defined microbiological media is suitable for 0 growth of any other bacterial strain known in the art. Each possibility represents a separate embodiment of the present invention.
  • a defined microbiological media of the present invention further comprises an aqueous solvent.
  • the aqueous solvent is water.
  • another lPlC ⁇ P ⁇ fe ⁇ t ⁇ iSfipitli ⁇ I ⁇ eiaiaiilscllVent is any other aqueous solvent known in the art. Each possibility represents a separate embodiment of the present invention.
  • the carbohydrate utilized in methods and compositions of the present invention is, in another embodiment, glucose. In another embodiment, the carbohydrate is lactose. In another embodiment, the
  • carbohydrate is fructose.
  • the carbohydrate is mannose.
  • the carbohydrate is cellobiose.
  • the carbohydrate is trehalose.
  • the carbohydrate is maltose.
  • the carbohydrate is glycerol.
  • the carbohydrate is glucosamine.
  • the carbohydrate is N-acetylglucosamine.
  • the carbohydrate is N-acetylmuramic acid.
  • the carbohydrate 0 is any other carbohydrate that can be utilized by Listeria. Each possibility represents a separate embodiment of the present invention.
  • the amount of a carbohydrate present in a defined microbiological media of methods and compositions of the present invention is between about 12-18 grams/liter (g/L). In another embodiment, the amount is 15 g/L. In another embodiment, the amount is 10 g/L. In another embodiment, 15 the amount is 9 g/L. In another embodiment, the amount is 11 g/L. In another embodiment, the amount is 12 g/L. In another embodiment, the amount is 13 g/L. In another embodiment, the amount is 14 g/L. In another embodiment, the amount is 16 g/L. In another embodiment, the amount is 17 g/L. In another embodiment, the amount is 18 g/L. In another embodiment, the amount is 19 g/L. In another embodiment, the amount is 20 g/L. In another embodiment, the amount is more than 20 g/L.
  • the amount is 9-15 g/L. In another embodiment, the amount is 10-15 g/L.
  • the amount is 11-15 g/L. In another embodiment, the amount is 12-16 g/L. In another embodiment, the amount is 13-17 g/L. In another embodiment, the amount is 14-18 g/L. In another embodiment, the amount is 16-19 g/L. In another embodiment, the amount is 17-20 g/L. In another embodiment, the amount is 10-20 g/L. In another embodiment, the amount is 12-20 g/L. In another 25 embodiment, the amount is 15-20 g/L.
  • the total amount of carbohydrate in the media is one of the above amounts .
  • the amount of one of the carbohydrates in the media is one of the above amounts.
  • the amount of each of the carbohydrates in the media is one of the above amounts.
  • the cobalt present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present as a cobalt ion.
  • the cobalt is present W .r' ⁇ b'BtiiMS M ⁇ idHhG 8hf odiment
  • the salt is cobalt chloride.
  • the salt is any other cobalt salt known in the art.
  • the cobalt is present as any other form of cobalt known in the art.
  • the cobalt salt is a hydrate (e.g. cobalt chloride hexahydrate). In another embodiment, the cobalt salt is anhydrous. In another embodiment, the cobalt salt is any other form of a cobalt salt known in the art. Each of the above forms of cobalt represents a separate embodiment of the present invention.
  • a hydrate of a component of a defined media of methods and compositions of the present invention is, in another embodiment, a monohydrate.
  • the hydrate is a dihydrate.
  • the hydrate is a trihydrate.
  • the hydrate is a tetrahydrate.
  • the hydrate is a pentahydrate.
  • the hydrate is a hexahydrate.
  • the hydrate is a heptahydrate.
  • the hydrate is any other hydrate known in the art. Each possibility represents a separate embodiment of the present invention.
  • the copper present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present as a copper ion.
  • the copper ion is a copper (I) ion.
  • the copper ion is a copper (II) ion.
  • the copper ion is a copper (DI) ion.
  • the copper is present as a copper salt.
  • the salt is copper chloride.
  • the salt is any other copper salt known in the art.
  • the copper is present as any other form of copper known in the art.
  • the copper salt is a hydrate (e.g. copper chloride dihydrate). In another embodiment, the copper salt is anhydrous. In another embodiment, the copper salt is any other form of a copper salt known in the art. Each of the above forms of copper represents a separate embodiment of the present invention.
  • the boron present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present as a borate ion.
  • the boron is present as a borate acid (e.g. boric acid, H 3 BO 3 ).
  • the boron is present as any other form of boron known in the art.
  • the borate salt or borate acid is a hydrate. In another embodiment, the borate salt or borate acid is anhydrous. In another embodiment, the borate salt or borate acid is any other form of a borate salt or borate acid known in the art.
  • Each of the above forms of boron represents a separate embodiment of the present invention. in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present as a manganese ion. In another embodiment, the manganese is present as a manganese salt. In another embodiment, the salt is manganese sulfate. In another embodiment, the salt is any other manganese salt known in the art. In another embodiment, the manganese 5 is present as any other form of manganese known in the art.
  • the manganese salt is a hydrate (e.g. manganese sulfate monohydrate). In another embodiment, the manganese salt is anhydrous. In another embodiment, the manganese salt is any other form of a manganese salt known in the art. Each of the above forms of manganese represents a separate embodiment of the present invention.
  • the molybdenum present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present as a molybdate ion.
  • the molybdenum is present as a molybdate salt.
  • the salt is sodium molybdate.
  • the salt is any other molybdate salt known in the art.
  • the molybdenum is present as any other form of molybdenum known in the art.
  • the molybdate salt is a hydrate (e.g. sodium molybdate dihydrate). In another embodiment, the molybdate salt is anhydrous. In another embodiment, the molybdate salt is any other form of a molybdate salt known in the art. Each of the above forms of molybdenum represents a separate embodiment of the present invention.
  • the 20 invention is, in another embodiment, present as a zinc ion.
  • the zinc is present as a zinc salt.
  • the salt is zinc chloride.
  • the salt is any other zinc salt known in the art.
  • the zinc is present as any other form of zinc known in the art.
  • the zinc salt is a hydrate (e.g. zinc chloride heptahydrate).
  • a hydrate e.g. zinc chloride heptahydrate.
  • the zinc salt is anhydrous.
  • the zinc salt is any other form of a zinc salt known in the art.
  • Each of the above forms of zinc represents a separate embodiment of the present invention.
  • the iron present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present as a ferric ion. In another embodiment, the iron is present as a
  • the iron is present as a ferric salt. In another embodiment, the iron is present as a ferrous salt. In another embodiment, the salt is ferric sulfate. In another embodiment, the salt is ferric citrate. In another embodiment, the salt is any other ferric salt known in the art. In another in the art. In another embodiment, the iron is present as any other form of iron known in the art.
  • the ferric or ferrous salt is a hydrate (e.g. ferric sulfate monohydrate).
  • the ferric or ferrous salt is anhydrous.
  • the ferric or ferrous 5 salt is any other form of a ferric or ferrous salt known in the art. Each of the above forms of iron represents a separate embodiment of the present invention.
  • the calcium present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present as a calcium ion.
  • the calcium is present as a calcium salt.
  • the salt is calcium chloride.
  • the 0 salt is any other calcium salt known in the art.
  • the calcium is present as any other form of calcium known in the art.
  • the calcium salt is a hydrate (e.g. calcium chloride dihydrate).
  • the calcium salt is anhydrous.
  • the calcium salt is any other form of a calcium salt known in the art. Each of the above forms of calcium represents a separate embodiment of the 5 present invention.
  • the citrate present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present as a citrate ion.
  • the citrate is present as a citrate salt.
  • the citrate is present as a citrate acid (e.g. citric acid).
  • the citrate is present as both ferric citrate and citric acid (Examples), m another embodiment, 0 the citrate is present as any other form of citrate known in the art.
  • the citrate salt or citrate acid is a hydrate. In another embodiment, the citrate salt or citrate acid is anhydrous. In another embodiment, the citrate salt or citrate acid is any other form of a citrate salt or citrate acid known in the art. Each of the above forms of citrate represents a separate embodiment of the present invention.
  • the cobalt present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in an amount of 0.02 g/L (Examples). In another embodiment, the amount is about 0.02 g/L. In another embodiment, the amount is 0.003 g/L. In another embodiment, the amount is 0.005 g/L. In another embodiment, the amount is 0.007 g/L. In another embodiment, the amount is 0.01 g/L. In another embodiment, the amount is 0.015 g/L. In another embodiment, the amount is 0.025
  • the amount is 0.03 g/L. In another embodiment, the amount is 0.003-0.006 g/L. In another embodiment, the amount is 0.005-0.01 g/L. In another embodiment, the amount is 0.01-0.02 g/L. In another embodiment, the amount is 0.02-0.04 g/L. In another embodiment, the amount is 0.03-0.06 /USD B /4-M-BS-.!- .-
  • the cobalt is present in an amount that is the molar equivalent of 0.02 g/L of cobalt chloride hexahydrate. In another embodiment, the amount of cobalt present is the molar equivalent of about 0.02 g/L of cobalt chloride hexahydrate. In another embodiment, the amount of cobalt present is the molar equivalent of another of the above amounts or ranges of cobalt chloride hexahydrate.
  • the copper present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in an amount of 0.019 g/L (Examples). In another embodiment, the amount is about 0.019 g/L. In other embodiments, the amount is any of the amounts or ranges listed above for cobalt.
  • the copper is present in an amount that is the molar equivalent of 0.019 g/L of copper chloride dihydrate. In another embodiment, the amount of copper present is the molar equivalent of about 0.019 g/L of copper chloride dihydrate. In another embodiment, the amount of copper present is the molar equivalent of copper chloride dihydrate in any of the amounts or ranges listed above for cobalt. Each of the above amounts or ranges of copper represents a separate embodiment of the present invention.
  • the borate present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in an amount of 0.016 g/L (Examples). In another embodiment, the amount is about 0.016 g/L. In other embodiments, the amount is any of the amounts or ranges listed above for cobalt.
  • the borate is present in an amount that is the molar equivalent of 0.016 g/L of boric acid. In another embodiment, the amount of borate present is the molar equivalent of about 0.016 g/L of boric acid. In another embodiment, the amount of borate present is the molar equivalent of boric acid in any of the amounts or ranges listed above for cobalt. Each of the above amounts or ranges of borate represents a separate embodiment of the present invention.
  • the manganese present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in an amount of 0.016 g/L (Examples). In another embodiment, the amount is about 0.016 g/L. In other embodiments, the amount is any of the amounts or ranges listed above for cobalt.
  • the manganese is present in an amount that is the molar equivalent of 0.016 g/L of manganese sulfate monohydrate. In another embodiment, the amount of manganese present is the molar equivalent of about 0.016 g/L of manganese sulfate monohydrate. In another embodiment, the amount of manganese present is the molar equivalent of manganese sulfate monohydrate in any of the iP* C 'i ⁇ lril €MMg.e ⁇ ' l'jisf4dSlSv:I.f or cobalt. Each of the above amounts or ranges of manganese represents a separate embodiment of the present invention.
  • the molybdenum present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in an amount of 0.02 g/L (Examples). In another 5 embodiment, the amount is about 0.02 g/L. In other embodiments, the amount is any of the amounts or ranges listed above for cobalt.
  • the molybdenum is present in an amount that is the molar equivalent of 0.2 g/L of sodium molybdate dihydrate. In another embodiment, the amount of molybdenum present is the molar equivalent of about 0.02 g/L of sodium molybdate dihydrate. In another embodiment, the amount of 0 molybdenum present is the molar equivalent of sodium molybdate dihydrate in any of the amounts or ranges listed above for cobalt. Each of the above amounts or ranges of molybdenum represents a separate embodiment of the present invention.
  • the zinc present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in an amount of 0.02 g/L (Examples). In another embodiment, 5 the amount is about 0.02 g/L. In other embodiments, the amount is any of the amounts or ranges listed above for cobalt.
  • the zinc is present in an amount that is the molar equivalent of 0.02 g/L of zinc chloride heptahydrate. In another embodiment, the amount of zinc present is the molar equivalent of about 0.02 g/L of zinc chloride heptahydrate. In another embodiment, the amount of zinc present is the 0 molar equivalent of zinc chloride heptahydrate in any of the amounts or ranges listed above for cobalt. Each of the above amounts or ranges of zinc represents a separate embodiment of the present invention.
  • ferric sulfate or a related compound is present in defined microbiological media of methods and compositions of the present invention.
  • the ferric sulfate or related compound is present in an amount of 0.01 g/L (Examples). In another embodiment, the amount is 5 about 0.01 g/L. In other embodiments, the amount is any of the amounts or ranges listed above for cobalt.
  • the iron is present in an amount that is the molar equivalent of 0.01 g/L of ferric sulfate. In another embodiment, the amount of iron present is the molar equivalent of about 0.01 g/L of ferric sulfate. In another embodiment, the amount of iron present is the molar equivalent of ferric sulfate in any of the amounts or ranges listed above for cobalt. Each of the above amounts or ranges of iron 0 represents a separate embodiment of the present invention.
  • the calcium present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in an amount of 0.01 g/L (Examples).
  • F" C pLiLln other embodiments, the amount is any of the amounts or ranges listed above for cobalt.
  • the calcium is present in an amount that is the molar equivalent of 0.01 g/L of calcium chloride dihydrate. In another embodiment, the amount of calcium present is the molar 5 equivalent of about 0.01 g/L of calcium chloride dihydrate. In another embodiment, the amount of calcium present is the molar equivalent of calcium chloride dihydrate in any of the amounts or ranges listed above for cobalt. Each of the above amounts or ranges of calcium represents a separate embodiment of the present invention.
  • the citrate present in defined microbiological media of methods and compositions of the present 0 invention is, in another embodiment, present in an amount of 0.9 g/L (Examples).
  • the amount is 0.6 g/L in the form of citric acid (Examples).
  • the amount is 0.4 g/L in the form of ferric citrate (Examples).
  • the amount is 0.6 g/L in the form of citric acid and 0.4 g/L in the form of ferric citrate (Examples).
  • the amount is about 0.6 g/L.
  • the amount is 0.1 g/L.
  • the amount is 0.2 g/L.
  • the amount is 0.3 g/L. In another embodiment, the amount is 0.4 g/L. In another embodiment, the amount is 0.5 g/L. In another embodiment, the amount is 0.7 g/L. In another embodiment, the amount is 0.8 g/L. In another embodiment, the amount is 1 g/L. In another embodiment, the amount is more than 1 g/L.
  • the citrate is present in an amount that is the molar equivalent of 0.6 g/L of 20 citric acid. In another embodiment, the amount of citrate present is the molar equivalent of about 0.6 g/L of citric acid. In another embodiment, the amount of citrate present is the molar equivalent of about 0.4 g/L of ferric citrate. In another embodiment, the amount of citrate present is the molar equivalent of 0.4 g/L of ferric citrate. In another embodiment, the amount of citrate present is the molar equivalent of 0.6 g/L of citric acid and 0.4 g/L of ferric citrate. In another embodiment, the amount of citrate present is the about
  • the amount of citrate present is the molar equivalent of citric acid in any of the amounts or ranges listed above for citrate.
  • Each of the above amounts or ranges of citrate represents a separate embodiment of the present invention.
  • One or more of the adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide present in defined microbiological media of methods and compositions of the present
  • the salt, derivative, or hydrate can be any salt, derivative, or hydrate known P Cl n / ⁇ £ ⁇ h i " ' M'#lbliti8w3-fo ⁇ ns of adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide represents a separate embodiment of the present invention.
  • the thiamine (vitamin B 1) present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in the form of thiamine HCl. In another
  • the thiamine is present as any other salt, derivative, or hydrate of thiamine known in the art.
  • vitamin B 1 is substituted for thiamine.
  • Another possibility represents a separate embodiment of the present invention.
  • the thiamine is present in an amount of 4 mg/L (Examples). In another embodiment, the amount is about 0.5 mg/L. In another embodiment, the amount is 0.7 mg/L. In another 0 embodiment, the amount is 1 mg/L. In another embodiment, the amount is 1.5 mg/L. In another embodiment, the amount is 2 mg/L. In another embodiment, the amount is 3 mg/L. In another embodiment, the amount is 5 mg/L. In another embodiment, the amount is 6 mg/L. In another embodiment, the amount is 8 mg/L. In another embodiment, the amount is more than 8 mg/L. In another embodiment, the thiamine is present in an amount that is the molar equivalent of 4 mg/L of thiamine HCl. In another embodiment, the 5 thiamine is present in an amount that is the molar equivalent of thiamine HCl in one of the above amounts. Each possibility represents a separate embodiment of the present invention.
  • the pyridoxal (vitamin B6) present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in the form of pyridoxal HCl.
  • the pyridoxal is present as any other salt, derivative, or hydrate of pyridoxal known in the art.
  • another form of vitamin B6 is substituted for pyridoxal.
  • the pyridoxal is present in an amount of 4 mg/L (Examples). In another embodiment, the amount is any of the amounts or ranges listed above for thiamine. In another embodiment, the amount of pyridoxal present is the molar equivalent of about 4 mg/L of pyridoxal HCl. In another
  • the amount of pyridoxal present is the molar equivalent of pyridoxal HCl in any of the amounts or ranges listed above for thiamine. Each possibility represents a separate embodiment of the present invention.
  • adenine (vitamin B4) present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in the form of free adenine.
  • vitamin B4 adenine present in defined microbiological media of methods and compositions of the present invention
  • the adenine is present as any other salt, derivative, or hydrate of adenine known in the art. In another embodiment, another form of vitamin B4 is substituted for adenine. Each possibility represents a separate embodiment of the present invention.
  • adenine is present in an amount of 0.25 mg/L (Examples). In another embodiment, the amount is any of the amounts or ranges listed above for cobalt. In another embodiment, the amount of adenine present is the molar equivalent of about 0.25 mg/L of free adenine. In another embodiment, the amount of adenine present is the molar equivalent of free adenine in any of the amounts or
  • biotin (vitamin B7) present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in the form of free biotin.
  • the biotin is present as any other salt, derivative, or hydrate of biotin known in the art.
  • another form of vitamin B7 is substituted for biotin.
  • Each possibility represents a separate 0 embodiment of the present invention.
  • the biotin is present in an amount of 2 mg/L (Examples). In another embodiment, the biotin is present in an amount of 2 mg/L (Examples). In another
  • the amount is any of the amounts or ranges listed above for thiamine.
  • the amount of biotin present is the molar equivalent of about 2 mg/L of free biotin.
  • the amount of biotin present is the molar equivalent of free biotin in any of the amounts or ranges listed 5 above for thiamine. Each possibility represents a separate embodiment of the present invention.
  • the para-aminobenzoic acid (vitamin B-x) present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in the form of free para- aminobenzoic acid.
  • the para-aminobenzoic acid is present as any other salt, derivative, or hydrate of para-aminobenzoic acid known in the art.
  • another form of 0 vitamin B-x is substituted for para-aminobenzoic acid.
  • the para-aminobenzoic acid is present in an amount of 4 mg/L (Examples). In another embodiment, the amount is any of the amounts or ranges listed above for thiamine. In another embodiment, the amount of para-aminobenzoic acid present is the molar equivalent of about 4 mg/L of free 5 para-aminobenzoic acid. In another embodiment, the amount of para-aminobenzoic acid present is the molar equivalent of free para-aminobenzoic acid in any of the amounts or ranges listed above for thiamine. Each possibility represents a separate embodiment of the present invention.
  • the pantothenate (vitamin B5) present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in the form of calcium 0 pantothenate.
  • the pantothenate is present as any other salt, derivative, or hydrate of pantothenate known in the art.
  • another form of vitamin B5 is substituted for pantothenate.
  • B fflllfcef ⁇ ritiWffiiil ⁇ l the pantothenate is present in an amount of 4 mg/L (Examples).
  • the amount is any of the amounts or ranges listed above for thiamine.
  • the amount of pantothenate present is the molar equivalent of about 4 mg/L of calcium pantothenate.
  • the amount of pantothenate present is the molar equivalent of calcium pantothenate in
  • the nicotinamide (vitamin B3) present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in the form of free nicotinamide.
  • the nicotinamide is present as any other salt, derivative, or hydrate of nicotinamide 0 known in the art.
  • another form of vitamin B3 is substituted for nicotinamide.
  • the nicotinamide is present in an amount of 4 mg/L (Examples). In another embodiment, the amount is any of the amounts or ranges listed above for thiamine. In another embodiment, the amount of nicotinamide present is the molar equivalent of about 4 mg/L of free nicotinamide. In 5 another embodiment, the amount of nicotinamide present is the molar equivalent of free nicotinamide in any of the amounts or ranges listed above for thiamine. Each possibility represents a separate embodiment of the present invention.
  • 1 or more of the leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine present in defined microbiological media of methods and compositions of the present invention are, in 0 another embodiment, present as free AA.
  • one of the above compounds is present as a salt thereof.
  • one of the above compounds is present as a derivative thereof.
  • one of the above compounds is present as a hydrate thereof.
  • the salt, derivative, or hydrate can be any salt, derivative, or hydrate known in the art. Each possibility represents a separate embodiment of the present invention.
  • 1 or more of the leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine is present in an amount of 0.4 g/L (Examples).
  • the amount is about 0.05 g/L.
  • the amount is 0.07 g/L.
  • the amount is 0.1 g/L.
  • the amount is 0.15 g/L.
  • the amount is 0.2 g/L.
  • the amount is 0.3 g/L.
  • the amount is 0.5 g/L.
  • the amount is 0.6 g/L.
  • the amount is 0.8 g/L. In another embodiment, the amount is more than 0.8 g/L. In another embodiment, one or more of these AA is present in an amount that is the molar equivalent of 0.4 g/L of the free AA. In another embodiment, the amount is the molar equivalent of thiamine the free AA in one of the above amounts.
  • Each possibility represents a separate lipbM ⁇ Sl@t
  • a defined media of methods and compositions of the present invention contains 2 of the amino acids (AA) listed in the second section of Table IB, e.g. leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine.
  • the defined media contains 1 of these AA.
  • the defined media contains 3 of these AA.
  • the media contains 4 of these AA.
  • the media contains 5 of these AA.
  • the media contains 6 of these AA.
  • the defined media contains at least 1 of these AA.
  • the defined media contains at least 2 of these AA.
  • the defined media contains at least 3 of these AA. In another embodiment, the media contains at least 4 of these AA. In another embodiment, the media contains at least 5 of these AA. In another embodiment, the media contains at least 6 of these AA. In another embodiment, the media contains all of these AA. In another embodiment, the media comprises 1 of these AA (i.e. contains at least 1, but may contain more, of these AA). In another embodiment, the media comprises 2 of these AA. In another embodiment, the media comprises 3 of these AA. In another embodiment, the media comprises 4 of these AA. In another embodiment, the media comprises 5 of these AA. In another embodiment, the media comprises 6 of these AA. Each possibility represents a separate embodiment of the present invention.
  • a defined media of methods and compositions of the present invention contains 2 of the vitamins listed in the third section of Table IB, e.g. adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide.
  • the defined media contains 1 of these vitamins.
  • the defined media contains 3 of these vitamins.
  • the media contains 4 of these vitamins.
  • the media contains 3 of these vitamins.
  • the media contains 5 of these vitamins.
  • the media contains 6 of these vitamins.
  • the defined media contains at least 1 of these vitamins.
  • the defined media contains at least 2 of these vitamins.
  • the defined media contains at least 3 of these vitamins. In another embodiment, the media contains at least 4 of these vitamins. In another embodiment, the media contains at least 3 of these vitamins. In another embodiment, the media contains at least 5 of these vitamins. In another embodiment, the media contains at least 6 of these vitamins. In another embodiment, the media contains all of these vitamins. In another embodiment, the media comprises 1 of these vitamins (i.e. contains at least 1, but may contain more, of these vitamins). In another embodiment, the media comprises 2 of these vitamins. In another embodiment, the media comprises 3 of these vitamins. In another embodiment, the media comprises 4 of these vitamins. In another embodiment, the media comprises 5 of these vitamins. In another embodiment, the media comprises 6 of these vitamins. Each possibility represents a separate embodiment of the present invention.
  • a defined media of methods and compositions of the present invention contains 2 of the trace elements listed in the fourth section of Table IB, e.g. cobalt, copper, boron, manganese, molybdenum, zinc, iron, calcium, and citrate.
  • the defined media contains 1 of these trace elements.
  • the defined media contains 3 of these trace 5 elements.
  • the media contains 4 of these trace elements.
  • the media contains 3 of these trace elements.
  • the media contains 5 of these trace elements.
  • the media contains 6 of these trace elements.
  • the media contains 7 of these trace elements.
  • the media contains 8 of these trace elements.
  • the defined media contains at least 1 of these trace elements. In another 0 embodiment, the defined media contains at least 2 of these trace elements. In another embodiment, the defined media contains at least 3 of these trace elements. In another embodiment, the media contains at least 4 of these trace elements. In another embodiment, the media contains at least 3 of these trace elements. In another embodiment, the media contains at least 5 of these trace elements. In another embodiment, the media contains at least 6 of these trace elements. In another embodiment, the media 5 contains at least 7 of these trace elements. In another embodiment, the media contains at least 8 of these trace elements. In another embodiment, the media contains all of these trace elements. In another embodiment, the media comprises 1 of these trace elements (i.e.
  • the media contains at least 1, but may contain more, of these trace elements).
  • the media comprises 2 of these trace elements.
  • the media comprises 3 of these trace elements.
  • the media comprises 4 0 of these trace elements.
  • the media comprises 5 of these trace elements.
  • the media comprises 6 of these trace elements.
  • the media comprises 7 of these trace elements.
  • the media comprises 8 of these trace elements.
  • a defined media of methods and compositions of the present invention 5 contains more than 1 component from 2 of the above classes of components; e.g more than 1 of the AA listed in the second section of Table IB, and more than 1 of the vitamins listed in the third section.
  • the media contains more than 2 components from 2 of the above classes of components; e.g more than 2 of the AA listed in the second section of Table IB, and more than 2 of the trace elements listed in the fourth section.
  • the media contains more than 3 0 components from 2 of the above classes.
  • the media contains more than 4 components from 2 of the above classes.
  • the media contains more than 5 components from 2 of the above classes.
  • the media contains more than 6 components from 2 of the above classes. In another embodiment, the media contains all of the components from 2 of the above classes.
  • jt ⁇ WAjb&iiSeit a defined media of methods and compositions of the present invention contains more than 1 component from all of the above classes of components (e.g. more than 1 component each from AA, vitamins and trace elements).
  • the media contains more than 2 components from all of the above classes of components. In another embodiment, the media contains more than 3 components from all of the above classes. In another embodiment, the media contains more than 4 components from all of the above classes. In another embodiment, the media contains more than all components from 2 of the above classes. In another embodiment, the media contains more than 6 components from all of the above classes. In another embodiment, the media contains all of the components from all of the above classes.
  • the media contains any other combination of numbers of components from each of the above classes; e.g. 2 AA, 2 vitamins, and 3 trace elements; 3 AA, 3 vitamins, and 2 trace elements; 2 AA, 3 vitamins, and all of the trace elements, etc.
  • a defined media of methods and compositions of the present invention consists of 1 of the above recipes, mixtures of components, lists of components in specified amounts, or combinations of numbers of components from each of the above classes. Each possibility represents a separate embodiment of the present invention.
  • the divalent cation present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, Mg.
  • the divalent cation is Ca.
  • the divalent cation is any other divalent cation known in the art.
  • Mg can, in other embodiments, be present in any form of Mg known in the art, e.g. MgSO 4 (Examples).
  • the divalent cation is present in an amount that is the molar equivalent of about 0.41 g/mL. In other embodiments, the divalent cation is present in an other effective amount, as known to those skilled in the art.
  • the pH buffer present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, 3-(N-Morpholino)-propanesulfonic acid (MOPS).
  • MOPS 3-(N-Morpholino)-propanesulfonic acid
  • the pH buffer is phosphate buffer.
  • the pH buffer is potassium phosphate (e.g. KH 2 PO 4 , and/or K 2 HPO 4 )-based or sodium phosphate (e.g. Na 2 HPO 4 and/or NaH 2 PO 4 )- based, or is a mixture thereof.
  • the pH buffer comprises different phosphate salts.
  • the pH buffer is any other compound known in the art that has pH buffer capacity.
  • Mg can, in other embodiments, be present in any form of Mg known in the art, e.g. MgSO 4 (Examples).
  • the pH buffer is present in an amount that is the molar equivalent of about 0.41 g/mL. IP" £;]tol ⁇ !th ⁇ lfcSlWitoe ⁇ i*lil:pH'bIffer is present in another effective amount, as known to those skilled in the art.
  • IP £;]tol ⁇ !th ⁇ lfcSlWitoe ⁇ i*lil:pH'bIffer is present in another effective amount, as known to those skilled in the art.
  • a nitrogen source other than glutamine is utilized in defined media of the present invention.
  • the nitrogen source is another amino acid.
  • the nitrogen source is another source of peptides or proteins (e.g. casitone or casamino acids).
  • the nitrogen source is ammonium chloride. In another embodiment, the nitrogen source is ammonium nitrate. In another embodiment, the nitrogen source is ammonium sulfate. In another embodiment, the nitrogen source is another ammonium salt. In another embodiment, the nitrogen source is any other nitrogen source known in the art. Each possibility represents a separate embodiment of the present invention.
  • a defined microbiological media of methods and compositions of the present invention does not contain a component derived from an animal source.
  • the media does not contain an animal-derived component of incompletely defined composition (e.g. yeast extract, bacto-tryptone, etc.).
  • the media does not contain an animal-derived protein.
  • the media does not contain an animal-derived carbohydrate.
  • the media does not contain an animal-derived protein source.
  • the media does not contain an animal-derived carbohydrate source.
  • Each possibility represents a separate embodiment of the present invention.
  • defined microbiological media refers to a media whose components are known.
  • the term refers to a media that does not contain a component derived from an animal source.
  • the term refers to a media whose components have been chemically characterized. Each possibility represents a separate embodiment of the present invention.
  • a defined media of methods and compositions of the present invention is prepared by dissolving the iron and magnesium salts separately in water and heating the solutions to 60° C. In another embodiment, this preparation method prevents iron precipitation. In another embodiment, the solutions are subsequently filter-sterilized and simultaneously added to the fermenter culture medium. In another embodiment, the defined media is prepared by any other method disclosed in the Examples herein. In another embodiment, the defined media is prepared by any other method known in the art. Each possibility represents a separate embodiment of the present invention.
  • a defined media of methods and compositions of the present invention is capable of supporting growth of the Listeria strain to about 1.1 x 10 10 CFU/mL (e.g. when grown in flasks; Examples).
  • the defined media supports growth to about 1.1 x 10 10 CFU/mL (e.g. when grown in fermenters; Examples).
  • the defined media supports growth to about P C in fermenters; Examples).
  • the defined media supports growth of viable bacteria (e.g. bacteria that can be cryopreserved without significant loss of viability) to about 3 x 10 10 CFU/mL (e.g. when grown in fermenters; Examples).
  • the defined media supports growth to an ODeoo of about 4.5 (Examples). In other embodiments, the defined 5 media supports growth to another OD 6O0 value enumerated herein. In other embodiments, the defined media supports growth to another CFU/mL value enumerated herein. In another embodiment, the defined media supports growth to a density approximately equivalent to that obtained with TB. In another embodiment, the defined media supports growth to a density approximately equivalent to that obtained with LB. Each possibility represents a separate embodiment of the present invention.
  • a defined media of methods and compositions of the present invention is capable of supporting a growth rate of the Listeria strain of about 0.25 h "1 . (Examples). In another embodiment, the growth rate is about 0.15 h "1 . In another embodiment, the growth rate is about 0.2 h “1 . In another embodiment, the growth rate is about 0.3 h "1 . In another embodiment, the growth rate is about 0.4 h "1 . In another embodiment, the growth rate is about 0.5 h "1 . In another embodiment, the growth rate is 5 about 0.6 h " . In another embodiment, the defined media supports a growth rate approximately equivalent to that obtained with TB. In another embodiment, the defined media supports a growth rate approximately equivalent to that obtained with LB. Each possibility represents a separate embodiment of the present invention.
  • the present invention provides a method of determining a presence of a 0 suspected contaminant in a stock of a Listeria strain, comprising testing an aliquot of the stock for growth of the suspected contaminant on a minimal media containing a minimal salts solution, a carbohydrate, a divalent cation, and thiamine, thereby determining a presence of a suspected contaminant in a stock of a Listeria strain (Example 6).
  • results of the present invention identify effective methods for 5 characterizing Listeria strains in various ways. Such methods have utility in determining the purity of
  • the minimal media utilized in the above method is, in another embodiment, a liquid media.
  • the minimal media is a soft agar.
  • the minimal media is an agar of regular consistency (e.g. not especially soft).
  • the minimal media does not 0 contain a source of nitrogen other than thiamine.
  • the minimal media does not contain an energy source other than glucose (or another carbohydrate) and thiamine.
  • the thiamine is thiamine hydrochloride.
  • the thiamine is any other form or salt of thiamine known in the art. Each possibility represents a separate embodiment of the present invention.
  • the present invention provides a method of determining a presence of a 5 suspected contaminant in a stock of a Listeria strain, comprising testing an aliquot of the stock for growth of the suspected contaminant on a mannitol salt agar plate, thereby determining a presence of a suspected contaminant in a stock of a Listeria strain (Example 6).
  • the mannitol salt agar is obtained as poured plates (e.g. from bioMerieux (Durham, NC).
  • the mannitol salt agar is obtained as a mixture, ready to be heated 0 and poured.
  • the mannitol salt agar is obtained as a powder.
  • the contaminant whose presence is tested for is B subtilis. In another embodiment, the contaminant is a micrococcus. In another embodiment, the contaminant is E. coli. In another embodiment, the contaminant is C. albicans. In another embodiment, the contaminant is 5 Staphylococcus. In another embodiment, the contaminant is any other contaminant known in the art. In another embodiment, the contaminant or contaminants whose presence is tested for are contaminants previously identified in the production facility used to grow or produce the Listeria strain. In another embodiment, the contaminant or contaminants whose presence is tested for are environmental isolates from the production facility used to grow or produce the Listeria strain or the local environment. Each 0 possibility represents a separate embodiment of the present invention.
  • the Staphylococci whose presence is tested for is 5. aureus.
  • the Staphylococci is any other type of Staphylococci known in the art. Each possibility represents a separate embodiment of the present invention.
  • B subtilis is 5 identified by its gram-positive sporing rod.
  • S. aureus is identified by its gram-positive coccus (GPC).
  • E. coli is identified by its gram-negative rod, etc. These methods are well known in the art.
  • methods of the present invention that test for the presence of a potential contaminant utilize counter selection.
  • Counter selection refers, in another embodiment, to inhibiting the growth of the desired Listeria strain while allowing potential contaminant organisms to grow.
  • counter selection utilizes combinations of various media and supplements.
  • the use of such combinations enables testing for several potential contaminants. Each possibility represents a separate embodiment of the present invention.
  • the present invention provides a method for hemolysis testing of a bacterial stock containing a Listeria strain, comprising adding the strain to a plate comprising a lower layer of solid or semi-solid media and an upper layer of solid or semi-solid media, wherein the lower layer comprises a growth media and the upper layer comprises about 5% blood and a bacterial growth media,
  • the bacterial growth media is a defined media.
  • the bacterial growth media is any defined media of the present invention.
  • the bacterial growth media is any defined media known in the art. Each possibility represents a separate embodiment of the present invention.
  • the blood is sheep' s blood.
  • the blood is any other 0 type of blood known in the art. Each possibility represents a separate embodiment of the present invention.
  • the upper layer of the plate is, in another embodiment, a maximum of 5 millimeters (mm) in thickness.
  • the thickness is a maximum of 4 mm.
  • the thickness is a maximum of 3 mm.
  • the thickness is a maximum of 6 mm.
  • the thickness is 5 mm.
  • the thickness is 6 mm.
  • the thickness is 4 mm.
  • the thickness is 3 mm.
  • the lower layer of the plate is, in another embodiment, a maximum of 5 millimeters (mm) in thickness.
  • the thickness is a maximum of 4 mm.
  • the thickness is a maximum of 3 mm.
  • the thickness is a maximum of 6 mm.
  • the thickness is 5 mm.
  • the thickness is 6 mm.
  • the thickness is 4 mm.
  • the thickness is 3 mm.
  • the overall thickness of agar in the plate is, in other embodiments, any of the thicknesses enumerated above.
  • the plate has a single layer of agar (e.g. containing blood mixed with a bacterial growth media).
  • the thickness of the layer agar is, in other embodiments, any of the thicknesses 5 enumerated above.
  • the present invention provides a method of characterizing a Listeria strain, comprising performing a method of the present invention.
  • the present invention provides a method of testing a Listeria culture, stock or cell bank for contamination, comprising 0 performing a method of the present invention.
  • the method of characterizing a Listeria strain or testing a Listeria culture, P 1 C Stb ⁇ JSIl3f ftjafl ⁇ W'lbiftSHlnation comprises testing the growth performance using some or all of the growth media in Table 2.
  • the method of characterizing a Listeria strain or testing a. Listeria culture, stock or cell bank for contamination comprises performing a catalase test on the Listeria culture, stock or 5 cell bank (Example 6).
  • the method of characterizing a Listeria strain or testing a Listeria culture, stock or cell bank for contamination comprises performing mast-ring testing on the Listeria culture, stock or cell bank (Example 6).
  • the method of characterizing a Listeria strain or testing a Listeria culture, 0 stock or cell bank for contamination comprises testing the Listeria culture, stock or cell bank with a test strip or kit (e.g. an API test strip) (Example 6).
  • a test strip or kit e.g. an API test strip
  • the method of the present invention of characterizing a Listeria strain or testing a Listeria culture, stock or cell bank for contamination further comprises testing the antibiotic resistance (e.g. resistance to CAP, streptomycin, and/or a combination thereof) of the Listeria culture, stock 5 or cell bank (Example 6).
  • antibiotic resistance e.g. resistance to CAP, streptomycin, and/or a combination thereof
  • the method of the present invention of characterizing a Listeria strain or testing a Listeria culture, stock or cell bank for contamination further comprises testing or observing the motility of the Listeria culture, stock or cell bank (Example 6).
  • the method of the present invention of characterizing a Listeria strain or 0 testing a Listeria culture, stock or cell bank for contamination further comprises testing the auxotrophic growth requirements of the Listeria culture, stock or cell bank (Example 6).
  • the method of the present invention of characterizing a Listeria strain or testing a Listeria culture, stock or cell bank for contamination comprises a combination of 2 of the above methods.
  • the method comprises a combination of 3 of the above methods.
  • the method comprises a combination of 4 of the above methods.
  • the method comprises a combination of 5 of the above methods.
  • the method comprises a combination of 6 of the above methods.
  • the method comprises a combination of 7 of the above methods.
  • the method comprises a combination of more than 7 of the above methods.
  • Each possibility represents a separate embodiment of the present 0 invention.
  • the present invention provides a method of plasmid extraction from P" C performing a method of the present invention.
  • the present invention provides a method of testing the antibiotic resistance of a Listeria strain, comprising replica plating as described in Example 1.
  • the present invention provides a method of determining the presence of a
  • the present invention provides a method of determining the presence of a potential contaminant in a Listeria stock, comprising testing the growth of the Listeria stock on a minimal media lacking methionine, as described in Example 6.
  • the media concentration of CAP in methods of the present invention is 0 about 34 ⁇ g/ml.
  • the concentration of CAP is about 5 ⁇ g/ml.
  • the concentration is about 7 ⁇ g/ml.
  • the concentration is about 9 ⁇ g/ml.
  • the concentration is about 11 ⁇ g/ml.
  • the concentration is about 14 ⁇ g/ml.
  • the concentration is about 17 ⁇ g/ml.
  • the concentration is about 20 ⁇ g/ml.
  • the concentration is about 25 5 ⁇ g/ml.
  • the concentration is about 30 ⁇ g/ml.
  • the concentration is about 40 ⁇ g/ml. In another embodiment, the concentration is about 45 ⁇ g/ml. In another embodiment, the concentration is about 50 ⁇ g/ml. In another embodiment, the concentration is about 60 ⁇ g/ml.
  • the CAP concentration is about 5-10 ⁇ g/ml. In another embodiment, the 0 concentration is about 10-15 ⁇ g/ml. In another embodiment, the concentration is about 15-20 ⁇ g/ml. In another embodiment, the concentration is about 20-25 ⁇ g/ml. In another embodiment, the concentration is about 25-30 ⁇ g/ml. In another embodiment, the concentration is about 30-35 ⁇ g/ml. In another embodiment, the concentration is about 35-40 ⁇ g/ml. In another embodiment, the concentration is about
  • the concentration is about 45-50 ⁇ g/ml.
  • the 5 concentration is about 5-15 ⁇ g/ml.
  • the concentration is about 10-20 ⁇ g/ml.
  • the concentration is about 15-25 ⁇ g/ml.
  • the concentration is about 20-30 ⁇ g/ml.
  • the concentration is about 30-40 ⁇ g/ml.
  • the concentration is about 40-50 ⁇ g/ml.
  • the concentration is about
  • the concentration is about 10-25 ⁇ g/ml. In another embodiment, the 0 concentration is about 20-35 ⁇ g/ml. In another embodiment, the concentration is about 25-40 ⁇ g/ml. In another embodiment, the concentration is about 10-30 ⁇ g/ml. In another embodiment, the concentration is about 20-40 ⁇ g/ml. In another embodiment, the concentration is about 20-50 ⁇ g/ml. Each possibility of the present invention.
  • the concentration of streptomycin in media utilized in methods of the present invention is, in another embodiment, about 25 ⁇ g/ml. In other embodiments, the streptomycin concentration is any of the
  • the streptomycin concentration is any streptomycin concentration known in the art. Each possibility represents a separate embodiment of the present invention.
  • the concentration of alanine in media utilized in methods of the present invention is, in another embodiment, about 100 ⁇ g/ml (Examples). In another embodiment, the concentration is about 50 ⁇ g/ml. In another embodiment, the concentration is about 60 ⁇ g/ml. In another embodiment, the concentration is about 80 ⁇ g/ml. In another embodiment, the concentration is about 120 ⁇ g/ml. In another embodiment, the concentration is about 150 ⁇ g/ml. In another embodiment, the concentration is about 200 ⁇ g/ml. In another embodiment, the concentration is about 250 ⁇ g/ml. In another embodiment, the concentration is about 300 ⁇ g/ml. In another embodiment, the concentration is 60-100 ⁇ g/ml.
  • the concentration is 80-120 ⁇ g/ml. In another embodiment, the concentration is 100-150 ⁇ g/ml. In another embodiment, the concentration is 150-200 ⁇ g/ml. In another embodiment, the concentration is 200-300 ⁇ g/ml. In other embodiments, the alanine concentration is any of the concentrations enumerated above for CAP. In another embodiment, the alanine concentration is any alanine concentration known in the art. Each possibility represents a separate embodiment of the present invention.
  • the Listeria strain of methods and compositions of the present invention has a mutation in a chromosomal copy of a gene essential for growth, viability or virulence thereof and an exogenous copy of said gene, a fragment thereof, a homologue of said gene, or a fragment thereof.
  • the gene is a transcription factor.
  • the gene is necessary for synthesis of a metabolite essential for growth or viability of the Listeria strain.
  • the gene is prfA. prfA regulates the expression of a number of L. monocytogenes virulence factors.
  • the gene is an alanine racemase (dal) gene.
  • the gene is a D-amino acid aminotransferase gene (dat) gene.
  • a vector contained in the Listeria strain expresses a fragment of one of the above proteins.
  • the vector expresses a homologue of one of the above proteins.
  • the vector expresses a variant of one of the above proteins.
  • the vector comprises a nucleic acid molecule, according to one of the definitions below or one of the definitions in the art. Each possibility represents a M ⁇ sent invention. - «
  • nucleic acids refers to a string of at least two base-sugar-phosphate combinations.
  • the term includes, in another embodiment, DNA and RNA.
  • Nucleotides refers, in another embodiment, to the monomeric units of nucleic acid polymers.
  • RNA may be, in another embodiment, in the form of a tRNA (transfer RNA), snRNA (small nuclear RNA), rRNA (ribosomal RNA), mRNA (messenger RNA), anti-sense RNA, small inhibitory RNA (siRNA), micro RNA (miRNA) and ribozymes.
  • DNA may be in form of plasmid DNA, viral DNA, linear DNA, or chromosomal DNA or derivatives of these groups.
  • these forms of DNA and RNA may be single, double, triple, or quadruple stranded.
  • the term also includes, in another embodiment, artificial nucleic acids that may contain other types of backbones but the same bases.
  • the artificial nucleic acid is a PNA (peptide nucleic acid). PNA contain peptide backbones and nucleotide bases and are able to bind, in another embodiment, to both DNA and RNA molecules.
  • the nucleotide is oxetane modified. In another embodiment, the nucleotide is modified by replacement of one or more phosphodiester bonds with a phosphorothioate bond.
  • the artificial nucleic acid contains any other variant of the phosphate backbone of native nucleic acids known in the art.
  • the use of phosphothiorate nucleic acids and PNA are known to those skilled in the art, and are described in, for example, Neilsen PE, Curr Opin Struct Biol 9:353-57; and Raz NK et al Biochem Biophys Res Commun. 297:1075-84.
  • the production and use of nucleic acids is known to those skilled in art and is described, for example, in Molecular Cloning, (2001), Sambrook and Russell, eds. and Methods in
  • the mutation in the chromosomal copy of the gene is a deletion mutation.
  • the mutation reduces an expression or activity of a product of said gene.
  • the exogenous copy of the gene is, in another embodiment, contained in a vector.
  • the vector is a plasmid.
  • the vector does not integrate into the genome of the Listeria strain.
  • the vector contains a Listeria origin of replication.
  • the vector further comprises a gene encoding a heterologous antigen.
  • the vector further comprises an antibiotic resistance gene.
  • the vector does not contain an antibiotic resistance gene.
  • the plasmid carried by the Listeria strain of methods and compositions of the present invention is retained in the absence of antibiotic selection pressure for an extended period of time.
  • the extended period is 40 generations.
  • the period is P C !D.getolSt ⁇ i ⁇ In * Mdftfi6&&diment, the period is 25 generations.
  • the period is 30 generations.
  • the period is 35 generations.
  • the period is 50 generations.
  • the period is 60 generations.
  • the period is 80 generations.
  • the period is 100 generations.
  • 5 is 150 generations. In another embodiment, the period is 200 generations. In another embodiment, the period is 300 generations. In another embodiment, the period is 400 generations. In another embodiment, the period is 500 generations. In another embodiment, the period is more than 500 generations.
  • Each type of Listeria strains represents a separate embodiment of the present invention.
  • Each of the above methods may be combined with each of the above types of Listeria strains, and each 0 combination represents a separate embodiment of the present invention.
  • the present invention provides a kit comprising a reagent utilized in performing a method of the present invention.
  • the present invention provides a kit comprising a composition, tool, or instrument of the present invention.
  • a method of the present invention utilizes an analog of 1 of the media 5 components listed above.
  • the method utilizes a derivative of 1 of the above media components.
  • the method utilizes an isomer of 1 of the above media components.
  • the method utilizes a metabolite of 1 of the above media components.
  • the method utilizes a salt of 1 of the above media components.
  • the method utilizes a hydrate of 1 of the above media components.
  • the method utilizes 0 an N-oxide of 1 of the above media components.
  • EXAMPLE 1 A Prf A-CONT AINING PLASMID IS STABLE IN A L. MONOCYTOGENES STRAIN WITH A PrfA DELETION IN THE ABSENCE OF ANTIBIOTICS
  • pGG55 is a 12876 bp plasmid containing a CAP resistance gene, Listeria origin of replication, the prfA gene, and a haemolysin A/E7 fusion protein ( Figure 1).
  • L. monocytogenes (LM) strain XFL7 contains a 300 base pair deletion in the prfA gene. XFL7 carries pGG55, which partially restores virulence and confers CAP resistance, and is described in United P C ⁇ te' ⁇ f Ir ⁇ fippliyM ⁇ ljifflbllcation No. 200500118184, which is incorporated herein by reference.
  • Plasmid DNA was resuspended in 30 ⁇ L rather than 50 ⁇ L to increase the concentration.
  • Plasmid stability was also monitored during the stability study by replica plating on agar plates at each stage of the subculture. Consistent with results from the agarose gel electrophoresis, there was no overall change in the number of plasmid-containing cells throughout the study in either LB or TB liquid 5 culture ( Figures 3 and 4, respectively).
  • prfA-encoding plasmids exhibit are stable in the absence of antibiotic in Listeria strains containing prfA mutations.
  • RWCB Research Working Cell Bank
  • OD 6O0 (0.8 for LB and 1.1 for TB) were determined to be optimum for short-term cryopreservation.
  • an LB Research Working Cell Bank (RWCB) was produced by adding 20% v/v glycerol to an 0.8 OD 6 O 0 culture and storing below -7O 0 C (see Materials and Experimental Methods section). Viability of the RWCB was determined before freezing by replica plating, as described for Example 1 , after defined storage intervals. As depicted in Figure 6, the viability in the first LB cell bank appeared to drop from 1 x
  • a second and a third LB RWCB were generated, this time at OD 600 of 0.72 and 0.74, respectively. These 2 RWCB exhibited viabilities ranging between 8 and 12 x 10 8 CFU/mL, with no decrease in viability throughout the course of the study. The difference between these RWCB and the first one is the difference in the OD 600 at the time of cryopreservation. Thus, an OD of 0.8 corresponds to the end of exponential growth and the beginning of stationary phase of Lm-LLO-E7. Consequently, an OD 600 of 0.7 was used subsequently.
  • the second RWCB was assigned the number 2003#0933A and was utilized to inoculate the cultures used in subsequent experiments. was generated from cultures at an OD 60O of 1.1. The number of viable cells remained stable at 1 x 10 9 CFU/mL ( Figure 7).
  • methods of the present invention e.g. conditions of 20% glycerol and OD 600 of 0.7
  • methods of the present invention are efficacious for generating cryopreserved Listeria vaccine strains and stocks with stable long-term viability.
  • Table IA Original defined media composition.
  • Table IA (referred to henceforth as "4X media") supported optimal growth of Lm-LLO-E7 in 50 mL and 0 200 mL shake flask cultures. Iron was required for optimal growth. Increasing the glucose from 10 to 15 g/L increased the total biomass achieved. The resulting optimized defined media recipe is depicted in
  • Example 3 as they are not controlled in shake flasks. Consistent with this possibility, the pH of the cultures in the shake flasks had decreased to approximately 5.5 units . In a batch fermenter, by contrast, pH and dissolved oxygen levels are continuously monitored and controlled. Thus, separate experiments were performed to optimize media used for batch fermentations.
  • iron and magnesium salts could be dissolved separately in water and heated to 60° C, then filter-sterilized and simultaneously added to the fermenter culture medium.
  • a shake flask containing 200 mL of the 4X media from Table IB was grown to an OD 600 of 1.6. Fifteen 10 mL samples were pelleted by centrifugation, the supernatants removed, and the cells resuspended in 10 mL of PBS containing 2% w/v of the appropriate cryoprotectant. One mL aliquots of each resuspended sample were transferred into vials and stored using the appropriate method. Viability was measured by replica plating (with and without CAP) before storage and after 3-28 days or storage, and the percentage of viable cells remaining was calculated.
  • Lm-LLO-E7 The pGG55 plasmid in Lm-LLO-E7 showed no signs of structural or segregational instability after 35 or 42 cell generations. A RWCB was produced, and the viability of the cells preserved in the RWCB remained constant at approximately 1 x 10 9 CFU/mL after freezing and thawing. The ability of 2 complex media to support the growth of Lm-LLO-E7 was determined. LB and TB supported growth to maximum cell densities of approximately 9 x 10 8 and 1 x 10 10 CFU/mL, corresponding to OD 6O0 of 0.8 and 4.0 units, respectively. A defined media that supported growth to an extent similar to TB was developed and optimized for shake flask cultivations. Lm-LLO-E7 reached a higher biomass concentration in 5L batch fermenters compared to shake flask cultivation, likely due to the ability to control the pH in fermenters.
  • Lm-LLO-E7 cryopreserved in PBS containing 2% w/v glycerol exhibited approximately 100% viability following storage at less than - 70 0 C for 3 days.
  • Mannitol salt agar media was prepared using the components in Table 4B below. Components were individually prepared and sterilized at 121 0 C for 15 min.
  • Lm-LLO-E7 was tested using API test strips (Bio-Merieux, Inc).
  • the bacteria exhibited API Listeria-Profile 6510, identified as L. monocytogenes.
  • NCTC 11994 also exhibited 5 profile 6510, while NCTC 10357 exhibited a different profile: 6550, also identified as LM.
  • Table 4B Composition of the minimal media.
  • Viable count results indicated the absence of viable bacteria on the agar with 50 ⁇ g/mL CAP.
  • the replica plated 50 ⁇ g/mL plates were re-plated onto a second set of 50 ⁇ g/mL plates; in addition, colonies were streaked directly from the replica-plated growth onto a second 50 ⁇ g/mL agar plate. After 72 hours, weak growth was observed for the streaked and replica plated plates.
  • the lack of immediate growth on LB- 50 ⁇ g/mL CAP plates was likely due to the inability of the acetyl transferase to destroy the high concentration of CAP. Supporting this conclusion, no colonies grew when bacteria were plated directly from Ringer's solution to LB plates containing 50 ⁇ g/mL CAP.
  • Lm-LLO-E7 (approximately 200 CFU/plate) was replica-plated onto plates containing 34 ⁇ g/mL CAP, 25 ⁇ g/mL streptomycin, and the two antibiotics combined, and incubated for 48 hours. 0 The Lm-LLO-E7 colonies did replica plate well and were quite distinct. Colonies on the streptomycin plate were not as large as those on the CAP or combination plates (Table 7).
  • replica plating is an efficacious method for testing the antibiotic resistance of the Lm-LLO-E7 RWCB.
  • the thin-poured, home-mixed plates were compared to layered plates for hemolysis testing of Lm-LLO-E7, the two control strains, and PBFT43c, using altered blood plates and layered plates.
  • layered plates a thin layer of LB was poured and allowed to set, followed by a thin layer of the blood agar. After inoculation, plates were incubated for 48 hours at 37° C.
  • Table 10 Additional hemolysis testing using altered blood plates and layered plates.
  • Auxotrophic requirements testing EDQP3-2 ⁇ JE&fi ⁇ jnMtMMl prepared using the recipe depicted in Table 11 , with the addition of 6 g/litre bacteriological agar. All vitamins and AA were prepared as individual solutions and sterile filtered. The MOPS, Glucose and salt solutions were combined and autoclaved (except magnesium sulfate, which was autoclaved separately and added before the plates were poured). Plates were prepared from the defined media, and from defined media lacking methionine and cysteine.
  • Table 11 Defined media used in auxotrophy testing.
  • medium lacking cysteine and/or methionine can be used as a test for auxotrophy.
  • approximately 1000 colonies per test are plated from a serial dilution and the medium is observed for any growth that may be due to either a contaminant or a revertant.
  • yeast Candida albicans is plated onto minimal medium, with and without thiamine and/or proline supplementation, as described in Example 6. These tests provide additional contamination tests for the Lm-LLO-E7 RWCB and other Listeria strains, e.g. Listeria vaccine strains.
  • EXAMPLE 8 DEVELOPMENT OF ADDITIONAL MAST-RING TESTING FOR LISTERIA
  • a morphological description is compiled of the Lm-LLO-E7 RWCB grown on LB or blood.
  • Methods for obtaining total cell counts utilize methods for direct cell counting and/or discriminatory techniques to enable independent quantitation of viable and non- viable cells.
  • cells are labeled using membrane filtration and/or stained with epifluorescence vital stain, after which live cells fluoresce with green color and dead cells to fluoresce with orange color, then cells are counted under a fluorescence microscope.
  • a Chemscan® machine is utilized.
  • a hemocytometer is used to directly count the cells.
  • flow cytometry is utilized.
  • Construction of antibiotic resistance factor free plasmid pTV3 [000332] Construction of p60-dal cassette. The first step in the construction of the antibiotic resistance gene-free vector was construction of a fusion of a truncated p60 promoter to the dal gene.
  • reverse primer 5'-GCT AGC CTA ATG GAT GTA TTT TCT AGG-3'
  • a minimal p60 promoter sequence forward primer: 5'-TTA ATT AAC AAA TAG TTG GTA TAG TCC
  • the sequence of the truncated p60 promoter was: caaatagttggtatagtcctctttagcctttggagtattatctcatcatttgttttttaggtgaaaactgggtaaacttagtattatcaatataaaattaattctcaaata cttaattacgtactgggattttctgaaaaagagaggagttttcc (SEQ ID NO: 5, Kohler et al, J Bacteriol 173: 4668-74, 1991).
  • SOE-PCR the p60 and dal PCR products were fused and cloned into cloning vector pCR2.1 (Invitrogen, La Jolla, CA).
  • the oriRep was PCR- amplif ⁇ ed from pGG55, using a 5 '-primer that added a Narl/Ehel site upstream of the sequence
  • GGCGCCACTAACTCAACGCTAGTAG SEQ ID NO: 6
  • a 3'-primer that added a Nhel site downstream of the sequence GCTAGCCAGCAAAGAAAAACAAACACG, SEQ ID NO: 7
  • the PCR product was cloned into cloning vector pCR2.1 and sequence verified.
  • the p60-dal expression cassette was excised from pCR-p60dal by Pacl/Nhel double digestion.
  • the replication region for gram-positive bacteria in pGG55 was amplified from pCR-oriRep by PCR (primer 1, 5'-GTC GAC GGT CAC CGG CGC CAC TAA CTC AAC GCT AGT AG-3'; SEQ ID No: 8); (primer 2, 5'-TTA ATT AAG CTA GCC AGC AAA GAA AAA CAA ACA CG-3'; SEQ ID No: 9), to introduce additional Ehel and Nhel restriction sites.
  • the PCR product was ligated into pCR2.1-TOPO (Invitrogen, Carlsbad, Calif.), and the sequence was verified.
  • the replication region was excised by Ehel/Nhel digestion, and vector pGG55 was double digested with Ehel and Nhel, removing both CAT genes from the plasmid simultaneously.
  • the two inserts, p60-dal and oriRep, and the pGG55 fragment were ligated together, yielding pTV3.
  • Total Listeria DNA was prepared using the Masterpure Total DNA kit (Epicentre, Madison, WI). Briefly, Listeria were cultured for 24 hours at 37° C and shaken at 250 rpm in 25 ml of Luria-Bertoni broth (LB). Bacterial cells were pelleted by centrifugation, resuspended in PBS supplemented with 5 mg/ml of lysozyme and incubated for 20 minutes at 37° C, after which DNA was isolated.
  • LB Luria-Bertoni broth
  • the LLO-E7 gene was PCR amplified from pGG55 (S'-ATGAAAAAAATAATGCTAGTTTTTATTAC-S' (SEQ ID NO: 10); 5'- GCGGCCGCTTAATGATGATGATGATGATGTGGTTTCTG AGAACAGATG-3' (SEQ ID NO: 11)) P C ind'HrfriidSibS yelttpSlSuil (Novagen, San Diego, CA).
  • the plcA amplicon was cloned into pCR2.1. E. coli were transformed with pET-LLOE7 and pCR-plcA, respectively, and purified plasmid DNA was prepared for use in real-time PCR.
  • Taqman primer-probe sets (Applied Biosystems, Foster City, CA) were designed using the ABI PrimerExpress software (Applied Biosystems) with E7 as a plasmid target, using the following primers: 5'-GCAAGTGTGACTCTACGCTTCG-S' (SEQ ID NO: 12); 5'-TGCCCATTAAC AGGTCTTCC A-3 1 (SEQ ID NO: 13); 5'-FAM-TGCGTA CAAAGCACACACGTAGACATTCGTAC-TAMRA-3' (SEQ ID NO: 14) and the one-copy gene plcA (TGACATCGTTTGTGTTTGAGCTAG -3' (SEQ ID NO: 15), 5'- 0 GCAGCGCTCTCTATACCAGGTAC-S' (SEQ ID NO: 16); 5'-TET-TTAATGTCCATGTTA TGTCTCCGTTATAGCTCATCGTA-TAMRA-S'; SEQ ID NO: 17) as a Listeria genome target.
  • Bacteria were grown at 37°C, 250 rpm shaking in Luria Bertani (LB) Medium +/- 100 micrograms ( ⁇ g)/ml D-alanine and/or 37 ⁇ g/ml CAP. The starting inoculum was adjusted based on OD 6 oo ran measurements to be the same for all strains.
  • LM-LLO-E7 and Lmdd(pTV3) were cultured for 70 IP' i?igiher4iitlfi ⁇ !:te' " pr
  • CFU were determined daily on selective and nonselective plates for each culture.
  • plasmid loss results in a greater number of colonies growing on nonselective plates (BHI plus D-alanine for Lmdd(pTV3), BHI only (no CAP) for LM-LLO- E7) versus selective plates (BHI only (no alanine) for Lmdd(pTV3), BHI plus CAP for LM-LLO-E7).
  • No 5 difference in CFU was detected between nonselective and selective plates (Figure 19A), indicating stable maintenance of the plasmid throughout the culture for at least 70 generations, when the experiment was terminated.
  • Lm-LLOE7 expresses the LLO/E7 fusion protein from pGG55. Plasmid copy numbers of Lmdd-TV3 and Lm- LLOE7 did not significantly differ from one another, showing stable retention of plasmid pTV3 in both 0 Listeria and E. coli.
  • TCI is a C57BL/6 epithelial cell line that was i1nj ⁇ 'MffiIM:;iwittHi*f:ii?fife-ind E7 and transformed with activated ras, which forms tumors upon subcutaneous implantation.
  • Mice were immunized with the appropriate Listeria strain on days 7 and 14 following implantation of tumor cells.
  • a non-immunized control group (na ⁇ ve) was also included. Tumor growth was measured with electronic calipers.
  • mice were implanted with TC-I tumors, then vaccinated with Listeria- ⁇ l vectors grown in Brain- Heart Infusion media, Terrific Broth, or the defined media of Example 3.
  • the Listeria vectors grown in defined media protected mice from tumor growth, in some cases inducing tumor regression, as did the vectors grown in the other media. This was evidence by suppression of tumor growth and/or tumor regression in all mice in the three vaccinated groups. By contrast, several mice from the control group had to be sacrificed because their tumor growth reached 2 cm ( Figure 23).
  • defined media of the present invention are efficacious in growing immunogenic vaccine vectors.
  • Lmdd-TV3 The optimum conditions for the growth and cryopreservation of Lmdd-TV3 are determined as described in Examples 1-5. Optimal conditions for Lmdd-TV3 are similar to those of Lm-LLOE7. A master cell bank and working cell bank of Lmdd-TV3 are generated as described in Examples 1-5.
  • Lmdd-TV3 is further characterized by a catalase test, mast-ring testing, API strip testing, monosepsis testing, antibiotic resistance testing, motility testing, hemolysis testing, and auxotrophy testing, as described in Examples 6-9. Characteristics of Lmdd-TV3 are similar to those of Lm-LLOE7.
  • a culture of an LM vaccine strain is grown as described above in Examples 1-5, 10, and 12. 100 ml of the culture is aliquoted to each of two 250-ml centrifuge bottles. Cells are recovered by centrifugation at 7,000 rpm, 4°C, for 15 minutes, washed by resuspension and centrifugation in sterile Ix PBS, resuspended again in sterile Ix PBS, and combined into a 50-ml conical bottom, polypropylene centrifuge tube. Contents of the tube are frozen at -70 0 C for 1 hour, or until frozen solid, in an inclined position to maximize surface area and facilitate lyophilization. The tube is placed, with the cap loosened, in a glass lyophilization vessel, which is attached to the lyophilizer, and desiccated under vacuum until dry.
  • Dessicated bacteria are stored in an airtight container containing dessicant.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Mycology (AREA)
  • Public Health (AREA)
  • Toxicology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides methods for cryopreservation and lyophilization of a Listeria strain, methods for producing a cell bank or a batch of vaccine doses of same, methods of characterizing same, and defined microbiological media.

Description

Figure imgf000002_0001
VECTORS
FIELD OF INVENTION
[0001] The present invention provides methods for cryopreservation and lyophilization of a Listeria strain, methods for producing a cell bank or a batch of vaccine doses of same, methods of characterizing same, and defined microbiological media.
BACKGROUND OF THE INVENTION
[0002] Vaccines represent the most beneficial and cost effective public health measure currently known. However, as the understanding of neoplasias and infectious diseases grows, it has become apparent that traditional vaccine strategies may not be completely effective. Recently, Listeria monocytogenes (LM), typically expressing a heterologous antigen, has been used as a vaccine vector. Methods of growing vaccine Listeria strains, preparing frozen stocks of same, and characterizing the purity of same, are thus needed to advance this technology.
SUMMARY OF THE INVENTION
[0003] The present invention provides methods for cryopreservation and lyophilization of a Listeria strain, methods for producing a cell bank or a batch of vaccine doses of same, methods of characterizing same, and defined microbiological media.
[0004] In one embodiment, the present invention provides a method for cryopreservation of a Listeria strain, comprising growing a culture of the Listeria strain in a nutrient media, and freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees Celsius. In another embodiment, the temperature is about -70 degrees Celsius. In another embodiment, the temperature is about 70 - '80 degrees Celsius.
[0005] In another embodiment, the present invention provides a method for producing a cell bank of a Listeria strain, comprising growing a culture of the Listeria strain in a nutrient media, and freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees Celsius. In another embodiment, the temperature is about -70 degrees Celsius. In another embodiment, the temperature is about "70 - "80 degrees Celsius.
[0006] In another embodiment, the present invention provides a method for producing a batch of Listeria vaccine doses, comprising growing a culture of a Listeria vaccine strain in a nutrient media, and freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees Celsius.
Figure imgf000003_0001
iiiitemperature is about -70 degrees Celsius. In another embodiment, the temperature is about "70 - "80 degrees Celsius.
[0007] In another embodiment, the present invention provides a method for preservation of a Listeria strain, comprising the steps of growing an inoculum of the Listeria strain in a nutrient media, thereby producing a culture; and lyophilizing the culture, thereby preserving a Listeria strain.
[0008] In another embodiment, the present invention provides a method for producing a cell bank of a Listeria strain, comprising growing an inoculum of the Listeria strain in a nutrient media, thereby producing a culture; and lyophilizing the culture, thereby producing a cell bank of a Listeria strain.
[0009] In another embodiment, the present invention provides a method for producing a batch of Listeria vaccine doses, comprising growing an inoculum of a Listeria vaccine strain in a nutrient media, thereby producing a culture; and lyophilizing the culture, thereby producing a batch of Listeria vaccine doses.
[00010] In another embodiment, the present invention provides a cell bank of a Listeria strain having substantial viability upon thawing, wherein the cell bank is produced by the method of the present invention.
[00011] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L of methionine; and (2) effective amounts of: (a) cysteine; (b) a pH buffer; (c) a carbohydrate; (d) a divalent cation; (e) ferric or ferrous ions; (f) glutamine or another nitrogen source; (g) riboflavin; (h) thioctic acid; (i) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) one or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
[00012] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L of cysteine; and (2) effective amounts of: (a) methionine; (b) a pH buffer; (c) a carbohydrate; (d) a divalent cation; (e) ferric or ferrous ions; (f) glutamine or another nitrogen source; (g) riboflavin; (h) thioctic acid; (i) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) one or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
[00013] In another embodiment, the present invention provides a defined microbiological media, comprising: ( 1 ) between about 0.00123 - 0.00246 moles of ferric or ferrous ions per liter; and (2) effective
Figure imgf000004_0001
a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) glutamine or another nitrogen source; (g) riboflavin; (h) thioctic acid; (i) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) one or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and
5 nicotinamide; and (k) one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
[00014] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 1.8 - 3.6 g/L of glutamine or another nitrogen source; and (2) effective amounts of: (a) a pH buffer; (b) a carbohydrate: (c) a divalent cation; (d) methionine (e) cysteine; (f) ferric 0 or ferrous ions (g) riboflavin (h); thioctic acid; (i) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) one or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
5 [00015] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 15 and about 30 mg/L of riboflavin; and (2) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) thioctic acid; (i) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) one or more components selected 0 from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and
(k) one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
[00016] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L of thioctic acid; and (2) effective amounts of: (a) a pH 5 buffer; (b) a carbohydrate (c) a divalent cation; (d) methionine (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) one or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, 0 and citrate.
[00017] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of methionine and cysteine; (2) between about 0.00123 and 0.00246 moles of ferric or ferrous ions per liter; (3) between about 1.8 and about 3.6 g/L of P C 'ItytatøiS iyϋt iBiøttiΦtt€iPnikource; (4) between about 0.3 and about 0.6 g/L of thioctic acid; (5) between about 15 and about 30 mg/L of riboflavin; and (6) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (e) one or more components selected from adenine,
5 biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (f) one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
[00018] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; and (2) effective amounts of: 0 (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) one or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
5 [00019] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.2 and about 0.75 mg/L each of one or more components selected from biotin and adenine; and (2) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) one or more components selected from leucine, isoleucine, valine, arginine, 0 histidine, tryptophan, and phenylalanine; (k) one or more components selected from thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (1) one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
[00020] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 3 and about 6 mg/L each of one or more components selected from 5 thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (2) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (k) biotin; (1) adenine; and (m) one or more components selected from cobalt, copper, boron, manganese, 0 molybdenum, zinc, calcium, and citrate.
[00021] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.2 and about 0.75 mg/L each of one or more components selected from biotin and adenine; (2) between about 3 and about 6 mg/L each of one or more components selected from Ip liriftj^Mfbl&WSd^x^'i^aS^^nobenzoic acid, pantothenate, and nicotinamide; and (3) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; 5 and (k) one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
[00022] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.005 and about 0.02 g/L each of one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, and calcium; and (2) effective amounts of: (a) apH 0 buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; and (k) one or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide.
15 [00023] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.4 and about 1 g/L of citrate; and (2) effective amounts of: (a) apHbuffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (k) one or more
20 components selected from cobalt, copper, boron, manganese, molybdenum, zinc, and calcium; and (1) one or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide.
[00024] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of methionine and cysteine; (2) between about
25 0.00123 and 0.00246 moles of ferric or ferrous ions per liter; (3) between about 1.8 and about 3.6 g/L of glutamine or another nitrogen source; (4) between about 0.3 and about 0.6 g/L of thioctic acid; (5) between about 15 and about 30 mg/L of riboflavin; (6) between about 0.3 and about 0.6 g/L each of one or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (7) between about 0.2 and about 0.75 mg/L each of one or more components selected from biotin and
30 adenine; (8) between about 3 and about 6 mg/L each of one or more components selected from thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; (9) between about 0.005 and about 0.02 g/L each of one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, and calcium; (10) between about 0.4 and about 1 g/L of citrate; and (11) and effective amounts of: (a) a pH buffer; (b) a carbohydrate; and (c) a divalent cation. p |;;|;0pQ2fliBllPilW!"iMffidslhint, the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of methionine and cysteine; (2) between about 0.00123 and 0.00246 moles of ferric or ferrous ions per liter; (3) between about 1.8 and about 3.6 g/L of glutamine or another nitrogen source; (4) between about 0.3 and about 0.6 g/L of thioctic acid; (5) between 5 about 15 and about 30 mg/L of riboflavin; (6) between about 0.3 and about 0.6 g/L each of leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (7) between about 0.2 and about 0.75 mg/L each of biotin and adenine; (8) between about 3 and about 6 mg/L each of thiamine, pyridoxal, para- aminobenzoic acid, pantothenate, and nicotinamide; (9) between about 0.005 and about 0.02 g/L each of one or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, and calcium; 0 (10) between about 0.4 and about 1 g/L of citrate; and (11) and effective amounts of: (a) apH buffer; (b) a carbohydrate; and (c) a divalent cation.
[00026] In another embodiment, the present invention provides a method of determining a presence of a suspected contaminant in a stock of a Listeria strain, comprising testing an aliquot of the stock for growth of the suspected contaminant on a minimal media containing a minimal salts solution, a carbohydrate, a 5 divalent cation, and thiamine, thereby determining a presence of a suspected contaminant in a stock of a
Listeria strain.
[00027] In another embodiment, the present invention provides a method of determining a presence of a suspected contaminant in a stock of a Listeria strain, comprising testing an aliquot of the stock for growth of the suspected contaminant on a mannitol salt agar plate, thereby determining a presence of a suspected 0 contaminant in a stock of a Listeria strain.
[00028] In another embodiment, the present invention provides a method for hemolysis testing of a bacterial stock containing a Listeria strain, comprising adding the strain to a plate comprising a lower layer of solid or semi-solid media and an upper layer of solid or semi-solid media, wherein the lower layer comprises a growth media and the upper layer comprises about 5% blood and a bacterial growth media, 5 thereby testing a hemolysis of a bacterial stock containing a Listeria strain. In one embodiment, the bacterial growth media is a defined media.
BRIEF DESCRIPTION OF THE FIGURES
[00029] Figure 1. Schematic map of pGG55.
[00030] Figure 2. A. Plasmid isolation throughout LB stability study. B. Plasmid isolation throughout TB 0 stability study. C. Quantitation of TB stability study.
[00031 ] Figure 3. Numbers of viable bacteria chloramphenicol (CAP)-resistant and CAP-sensitive colony- forming units (CFU) from bacteria grown in LB. Dark bars: CAP+; white bars: CAP. The two dark bars P* C "land If SNgMII >'έ*i'ϊM«ø!ila,]lme point represent duplicate samples.
[00032] Figure 4. Numbers of viable bacteria CAP-resistant and CAP-sensitive CFU from bacteria grown in TB. Labeling of bars is the same as for Figure 4.
[00033] Figure 5. Growth of L. monocytogenes following short-term cryopreservation.
5 [00034] Figure 6. Viability of LB RWCB following storage at -7O0C.
[00035] Figure 7. Viability of TB RWCB following storage at -7O0C.
[00036] Figure 8. Growth curve of 200 mL LB and TB cultures of Lm-LLO-E7.
[00037] Figure 9. Growth of Lm-LLO-E7 in four defined media with and without amino acids, vitamins and trace elements, at the 50 mL stage. "AA + Vits + TE +" denotes bulk medium, essential components, 0 amino acids, vitamins and trace elements; "AA + Vits + TE -" denotes bulk medium, essential components, amino acids, and vitamins; "AA + Vits - TE -" denotes Bulk medium, essential components, and amino acids; "AA - Vits - TE -" denotes Bulk medium and essential components.
[00038] Figure 10. Growth of Lm-LLO-E7 in four defined media with and without amino acids, vitamins and trace elements, at the 200 mL stage. Groups are labeled as for Figure 10.
15 [00039] Figure 11. Growth of Lm-LLO-E7 in 200 mL cultures of defined media with different concentrations of supplements, with and without inorganic nitrogen.
[00040] Figure 12. Growth of Lm-LLO-E7 in 200 mL cultures of defined media supplemented with different concentrations of supplements, with and without glutamine and iron.
[00041] Figure 13. A. Growth curves of Lm-LLO-E7 in 5 L fermenters in TB and defined media. B. 20 Viability of Lm-LLO-E7 grown in 5 L fermenters in TB to different densities. C. Viability of Lm-LLO-E7 grown in 5 L fermenters in defined media to different densities.
[00042] Figure 14. Percentage of viable cells remaining after storage at -20 0C for 3 days.
[00043] Figure 15. Percentage of viable cells remaining after storage at -70 0C for 3 days
[00044] Figure 16. A. Percentage of viable cells remaining following snap freezing in liquid nitrogen and 25 storage at -700C for 3 days. B. Summary of viability studies for several conditions. C. Growth kinetics of cryopreserved samples after thawing.
[00045] Figure 17 is a schematic map of E. coli-Listeria shuttle plasmids pGG55 (left side) and pTV3 (right side). CAT(-): E. coli chloramphenicol transferase; CAT(+): Listeria chloramphenicol transferase; Ori Lm: l;::irC ''PptiyiSClbEigin 11M1Ii-EtHaI Ori Ec: pl5 origin of replication for E. coli, prfA: Listeria pathogenicity regulating factor A, LLO: C-terminally truncated listeriolysin O including its promoter; E7: HPV E7; p60- dal; expression cassette of p60 promoter and Listeria dal gene. Selected restriction sites are also depicted.
[00046] Figure 18. Plasmid preparation of pTV3 from E. coli strain MB2159. Qiagen® midi-preparation of 5 nucleic acids was following the manufacturer's protocol. Lanes from left to right: Lanes 1 and 7: Molecular Weight Marker, lOOBp ladder (Invitrogen). Lane 2: pTV3, clone #15. Lane 3: pTV3, clone #16. Lane 4: pTV3C, clone #22. Lane 5: pTV3C, clone #24. Lane 6: pGG55 control.
[00047] Figure 19. Plasmid maintenance in vitro (A) and in vivo (B). To determine in vitro stability, strains were cultured Brain-Heart Infusion (BHI) media with (GG55-CM) and without (GG55-no ChI) 0 chloramphenicol (LM-LLO-E7) or with and without D-alanine [Lmdd(pTV3)] . The cultures were diluted 1 : 1000 daily into fresh LB . The CFU of the cultures were determined daily on BHI (BHI) and on BHI with chloramphenicol (BHI-ChI) for LM-LLO-E7 or on BHI alone or with D-alanine (BHI-AIa) for Lmdd(pTV3). AU liquid medium and plates contained an additional 50 μg of streptomycin per ml, to which LM strain 10403S is naturally resistant. To determine in vivo plasmid maintenance, LM was 5 injected intraperitoneally at a dose of 1/10 of the LD50 in C57BL/6 mice. Spleens were harvested at different time points post-injection and homogenized in phosphate-buffered saline (PBS). CFU counts were determined on BHI plates with and without D-alanine for Lmdd(pTV3), on BHI plates with and without chloramphenicol for LM-LLO-E7, and on BHI plates only for wild-type 10403 S.
[00048] Figure 20 depicts growth on LB-agar plates of LM strain Lmdd(-) transformed with the pTV3 0 vector. Bacteria were plated on different media: Top: agar with streptomycin, no added alanine. Lmdd- pTV3 grow (the host strain 10403s is streptomycin resistant). Lower left (agar with chloramphenicol) and lower right (agar with chloramphenicol and alanine): Lmdd-pTV3 do not grow because the CAT gene is not present in pTV3.
[00049] Figure 21 depicts growth on LB-agar plates of LM strain Lmdd(-) without the pTV3 vector. Upper 5 left: agar with streptomycin. Lmdd (-) cannot grow in the absence of d-alanine. Upper right: agar with alanine. Lmdd (-) grows. Lower left (agar with chloramphenicol and alanine) and lower right (agar with chloramphenicol): Lmdd(-) is sensitve to chloramphenicol and does not grow.
[00050] Figure 22 depicts bacterial growth as measured by optical density (600 nanometers [nm]) plotted vs. time. +AIa: media contains D-alanine; +ChI: media contains chloramphenicol.
0 [00051 ] Figure 23. Listeria vaccine vectors grown in defined media effectively protect mice against growth of established tumors. "BHI cultured"- vectors cultured in Brain-Heart Infusion media "Terrific Broth cultured" and "defined media cultured"- vectors cultured in indicated media. p c T /" u s Q & / Nt- Nt ariBackiLEP DESCRIPTION OF THE INVENTION
[00052] The present invention provides methods for cryopreservation and lyophilization of a Listeria strain, methods for producing a cell bank or a batch of vaccine doses of same, methods of characterizing same, and defined microbiological media.
5 [00053] In one embodiment, the present invention provides a method for cryopreservation of a Listeria strain, comprising growing a culture of the Listeria strain in a nutrient media, freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees Celsius. In another embodiment, the temperature is about -70 degrees Celsius. In another embodiment, the temperature is about "70 - "80 degrees Celsius. Each possibility represents a separate embodiment of the present invention.
10 [00054] In another embodiment, the present invention provides a method for cryopreservation of a Listeria strain, comprising growing a culture of the Listeria strain in a defined media of the present invention, freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees Celsius. In another embodiment, the temperature is about -70 degrees Celsius. In another embodiment, the temperature is about "70 - "80 degrees Celsius. In another embodiment, any defined microbiological media
15 of the present invention may be used in this method. Each defined microbiological media represents a separate embodiment of the present invention.
[00055] As provided herein, the results of the present invention identify effective methods for cryopreservation of Listeria strains and methods for producing a cell bank or a batch of vaccine doses of same.
20 [00056] In another embodiment, the cryopreserved Listeria are used to generate a Listeria cell bank. In another embodiment, the cryopreserved Listeria are used for medical purposes. In another embodiment, the cryopreserved Listeria are used for research purposes. In another embodiment, the cryopreserved Listeria axe used for quality control purposes. In another embodiment, the cryopreserved Listeria are used for any other purpose known in the art. Each possibility represents a separate embodiment of the present invention.
25 [00057] In another embodiment, the present invention provides a method for producing a cell bank of a
Listeria strain, comprising growing a culture of the Listeria strain in a nutrient media, and freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees Celsius. In another embodiment, the temperature is about -70 degrees Celsius. In another embodiment, the temperature is about "70 - "80 degrees Celsius.
30 [00058] In another embodiment, the present invention provides a method for producing a cell bank of a
Listeria strain, comprising growing a culture of the Listeria strain in a defined media of the present invention, and freezing the culture in a solution comprising glycerol, and storing the Listeria strain at f'^ C 'ilbFΪ€fE^Q€igrefei^'Cl'ΛiS^ϊn another embodiment, the temperature is about -70 degrees Celsius. In another embodiment, the temperature is about "70 - "80 degrees Celsius. In another embodiment, any defined microbiological media of the present invention may be used in this method. Each defined microbiological media represents a separate embodiment of the present invention.
5 [00059] In another embodiment, the present invention provides a method for producing a stock of a Listeria strain, comprising growing the Listeria strain in a nutrient media, freezing the culture in a solution comprising glycerol, and storing the Listeria strain at about -70 degrees Celsius.
[00060] In another embodiment, the present invention provides a method for preservation of a Listeria strain, comprising the steps of growing an inoculum of the Listeria strain in a nutrient media, thereby 10 producing a culture; and lyophilizing the culture, thereby preserving a Listeria strain.
[00061] In another embodiment, the present invention provides a method for producing a cell bank of a Listeria strain, comprising growing an inoculum of the Listeria strain in a nutrient media, thereby producing a culture; and lyophilizing the culture, thereby producing a cell bank of a Listeria strain.
[00062] In another embodiment, the present invention provides a method for producing a batch of Listeria 15 vaccine doses, comprising growing an inoculum of a Listeria vaccine strain in a nutrient media, thereby producing a culture; and lyophilizing the culture, thereby producing a batch of Listeria vaccine doses.
[00063] In another embodiment, the present invention provides a method for producing a stock of a Listeria strain, comprising growing the Listeria strain in a defined microbiological media of the present invention, freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees 20 Celsius. In another embodiment, the temperature is about -70 degrees Celsius. In another embodiment, the temperature is about "70 - "80 degrees Celsius. In another embodiment, any defined microbiological media of the present invention may be used in this method. Each defined microbiological media represents a separate embodiment of the present invention.
[00064] In another embodiment, the present invention provides a method for producing a stock of a Listeria
25 strain, comprising growing the Listeria strain in a defined microbiological media of the present invention, and lyophilizing the culture. In another embodiment, any defined microbiological media of the present invention may be used in this method. Each defined microbiological media represents a separate embodiment of the present invention.
[00065] In another embodiment, the cell bank of methods and compositions of the present invention is a
30 master cell bank. In another embodiment, the cell bank is a working cell bank. In another embodiment, the cell bank is Good Manufacturing Practice (GMP) cell bank. In another embodiment, the cell bank is intended for production of clinical-grade material. In another embodiment, the cell bank is suitable for 'pϊΘtj|(|:i|)ft,!ftEfilMi?Λ'|iiiail-ϊliaterial. In another embodiment, the cell bank is suitable for production of Listeria vaccine doses that can be safely administered to human subjects. In another embodiment, the cell bank is suitable for production of Listeria vaccine doses that are suitable for vaccination of human subjects. In another embodiment, the cell bank conforms to regulatory practices for human use. In another embodiment, the cell bank is any other type of cell bank known in the art. Each possibility represents a separate embodiment of the present invention.
[00066] "Good Manufacturing Practices" are defined, in another embodiment, by (21 CFR 210-211) of the
United States Code of Federal Regulations. In another embodiment, "Good Manufacturing Practices" are defined by other standards for production of clinical-grade material or for human consumption; e.g. standards of a country other than the United States. Each possibility represents a separate embodiment of the present invention.
[00067] In another embodiment, the present invention provides a method for producing a batch of Listeria vaccine doses, comprising growing a culture of a Listeria vaccine strain in a nutrient media, and freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -20 degrees Celsius. In another embodiment, the temperature is about -70 degrees Celsius. In another embodiment, the temperature is about "70 - "80 degrees Celsius.
[00068] In another embodiment, the present invention provides a method for cryopreservation of a. Listeria strain, comprising the steps of growing an inoculum of the Listeria strain in a defined media of the present invention, thereby producing a culture; freezing the culture in a solution comprising glycerol, and storing the Listeria strain in a frozen state, thereby cryopreserving a Listeria strain. In another embodiment, the present invention provides a method for preservation of a Listeria strain, comprising the steps of growing an inoculum of the Listeria strain in a defined media of the present invention, thereby producing a culture; and lyophilizing the culture, thereby preserving a Listeria strain. In another embodiment, any defined microbiological media of the present invention may be used in this method. Each method and each defined microbiological media represents a separate embodiment of the present invention.
[00069] In another embodiment, the present invention provides a method for producing a cell bank of a Listeria strain, comprising growing an inoculum of the Listeria strain in a defined media of the present invention, thereby producing a culture; freezing the culture in a solution comprising glycerol, and storing the Listeria strain in a frozen state, thereby producing a cell bank of a Listeria strain. In another embodiment, the present invention provides a method for producing a cell bank of a Listeria strain, comprising growing an inoculum of the Listeria strain in a defined media of the present invention, thereby producing a culture; and lyophilizing the culture, thereby producing a cell bank of a Listeria strain. In another embodiment, any defined microbiological media of the present invention may be used in this §> |;;;; -ftμetfϊi;
Figure imgf000013_0001
defined microbiological media represents a separate embodiment of the present invention.
[00070] In another embodiment, the present invention provides a method for producing a batch of Listeria vaccine doses, comprising growing a culture of a Listeria vaccine strain in a defined media of the present
5 invention, freezing the culture in a solution comprising glycerol, and storing the Listeria strain at below -
20 degrees Celsius. In another embodiment, the temperature is about -70 degrees Celsius. In another embodiment, the temperature is about "70 - "80 degrees Celsius. In another embodiment, the present invention provides a method for producing a batch of Listeria vaccine doses, comprising growing a culture of a Listeria vaccine strain in a defined media of the present invention, and lyophilizing the culture. In
10 another embodiment, any defined microbiological media of the present invention may be used in this method. Each defined microbiological media represents a separate embodiment of the present invention.
[00071] In another embodiment, the Listeria vaccine doses of methods and compositions of the present invention are intended for administration to human subjects. In another embodiment, the Listeria vaccine doses are suitable for administration to human subject. In another embodiment, the Listeria vaccine doses 15 are intended for administration to animal subjects. In another embodiment, the Listeria vaccine doses are intended for research purposes. In another embodiment, the Listeria vaccine doses are intended for any other purpose known in the art. Each possibility represents a separate embodiment of the present invention.
[00072] In another embodiment of methods and compositions of the present invention, the culture (e.g. the culture of a Listeria vaccine strain that is used to produce a batch of Listeria vaccine doses) is inoculated 20 from a cell bank. In another embodiment, the culture is inoculated from a frozen stock. In another embodiment, the culture is inoculated from a starter culture. In another embodiment, the culture is inoculated from a colony. In another embodiment, the culture is inoculated at mid-log growth phase. In another embodiment, the culture is inoculated at approximately mid-log growth phase. In another embodiment, the culture is inoculated at another growth phase. Each possibility represents a separate
25 embodiment of the present invention.
[00073] In another embodiment of methods and compositions of the present invention, the solution used for freezing has a glycerol content of 2-20%. In another embodiment, the content is 2%. In another embodiment, the content is 20%. In another embodiment, the content is 1%. In another embodiment, the content is 1.5%. In another embodiment, the content is 3%. In another embodiment, the content is 4%. In
30 another embodiment, the content is 5%. In another embodiment, the content is 2%. In another embodiment, the content is 2%. In another embodiment, the content is 7%. In another embodiment, the content is 9%. In another embodiment, the content is 10%. In another embodiment, the content is 12%. In another embodiment, the content is 14%. In another embodiment, the content is 16%. In another
Figure imgf000014_0001
content is 25%. In another embodiment, the content is 30%. In another embodiment, the content is 35%. In another embodiment, the content is 40%. Each possibility represents a separate embodiment of the present invention.
[00074] In another embodiment, the solution used for freezing contains another colligative additive or additive with anti-freeze properties, in place of glycerol. In another embodiment, the solution used for freezing contains another colligative additive or additive with anti-freeze properties, in addition to glycerol. In another embodiment, the additive is mannitol. In another embodiment, the additive is DMSO. In another embodiment, the additive is sucrose. In another embodiment, the additive is any other colligative additive or additive with anti-freeze properties that is known in the art. Each possibility represents a separate embodiment of the present invention.
[00075] In another embodiment, the nutrient media utilized for growing a culture of a Listeria strain is LB.
In another embodiment, the nutrient media is TB. In another embodiment, the nutrient media is a defined media (e.g. a defined media of the present invention). In another embodiment, the nutrient media is any other type of nutrient media known in the art. Each possibility represents a separate embodiment of the present invention.
[00076] In another embodiment of methods and compositions of the present invention, the step of growing is performed with a shake flask (e.g. a baffled shake flask). In another embodiment, the growing is performed with a batch f ermenter. In another embodiment, the growing is performed with a stirred tank or flask. In another embodiment, the growing is performed with an airflit fermenter. In another embodiment, the growing is performed with a fed batch. In another embodiment, the growing is performed with a continuous cell reactor. In another embodiment, the growing is performed with an immobilized cell reactor. In another embodiment, the growing is performed with any other means of growing bacteria that is known in the art. Each possibility represents a separate embodiment of the present invention.
[00077] In another embodiment, a constant pH is maintained during growth of the culture (e.g. in a batch fermenter). In another embodiment, the pH is maintained at about 7.0. In another embodiment, the pH is about 6. In another embodiment, the pH is about 6.5. In another embodiment, the pH is about 7.5. In another embodiment, the pH is about 8. In another embodiment, the pH is 6.5-7.5. In another embodiment, the pH is 6-8. In another embodiment, the pH is 6-7. In another embodiment, the pH is 7-8. Each possibility represents a separate embodiment of the present invention.
[00078] In another embodiment, a constant temperature is maintained during growth of the culture. In another embodiment, the temperature is maintained at about 37 0C. In another embodiment, the temperature is 37 0C. In another embodiment, the temperature is 25 0C. In another embodiment, the jp |;;;;^n^§:ajμ|r|]||,,2^|.®yi lhd!her embodiment, the temperature is 28 0C. In another embodiment, the temperature is 30 0C. In another embodiment, the temperature is 32 0C. In another embodiment, the temperature is 34 0C. In another embodiment, the temperature is 35 0C. In another embodiment, the temperature is 36 0C. In another embodiment, the temperature is 38 0C. In another embodiment, the
5 temperature is 39 0C. Each possibility represents a separate embodiment of the present invention.
[00079] In another embodiment, a constant dissolved oxygen concentration is maintained during growth of the culture. In another embodiment, the dissolved oxygen concentration is maintained at 20% of saturation. In another embodiment, the concentration is 15% of saturation. In another embodiment, the concentration is 16% of saturation. In another embodiment, the concentration is 18% of saturation. In another embodiment,
10 the concentration is 22% of saturation. In another embodiment, the concentration is 25% of saturation. In another embodiment, the concentration is 30% of saturation. In another embodiment, the concentration is 35% of saturation. In another embodiment, the concentration is 40% of saturation. In another embodiment, the concentration is 45% of saturation. In another embodiment, the concentration is 50% of saturation. In another embodiment, the concentration is 55% of saturation. In another embodiment, the concentration is
15 60% of saturation. In another embodiment, the concentration is 65% of saturation. In another embodiment, the concentration is 70% of saturation. In another embodiment, the concentration is 75% of saturation. In another embodiment, the concentration is 80% of saturation. In another embodiment, the concentration is 85% of saturation. In another embodiment, the concentration is 90% of saturation. In another embodiment, the concentration is 95% of saturation. In another embodiment, the concentration is 100% of saturation. In
20 another embodiment, the concentration is near 100% of saturation. Each possibility represents a separate embodiment of the present invention.
[00080] In another embodiment of methods and compositions of the present invention, the culture is grown in media having a maximum volume of 2 liters (L) per vessel. In another embodiment, the media has a maximum volume of 200 ml per ves sel . In another embodiment, the media has a maximum volume of 300 25 ml per vessel. In another embodiment, the media has a maximum volume of 500 ml per vessel. In another embodiment, the media has a maximum volume of 750 ml per vessel. In another embodiment, the media has a maximum volume of 1 L per vessel. In another embodiment, the media has a maximum volume of 1.5 L per vessel. In another embodiment, the media has a maximum volume of 2.5 L per vessel. In another embodiment, the media has a maximum volume of 3 L per vessel.
30 [00081] In another embodiment, the media has a minimum volume of 2 L per vessel. In another embodiment, the media has a minimum volume of 500 ml per vessel. In another embodiment, the media has a minimum volume of 750 ml per vessel. In another embodiment, the media has a minimum volume of 1 L per vessel. In another embodiment, the media has a minimum volume of 1.5 L per vessel. In another embodiment, the media has a minimum volume of 2.5 L per vessel. In another embodiment, the media has ihu C
Figure imgf000016_0001
In another embodiment, the media has a minimum volume of 4 L per vessel. In another embodiment, the media has a minimum volume of 5 L per vessel. In another embodiment, the media has a minimum volume of 6 L per vessel. In another embodiment, the media has a minimum volume of 8 L per vessel. In another embodiment, the media has a minimum volume of 10 L per
5 vessel.
[00082] Each volume represents a separate embodiment of the present invention.
[00083] In another embodiment of methods and compositions of the present invention, the step of freezing or lyophilizing is performed when the culture has an OD6O0 of 0.7 units. In another embodiment, the culture has an OD60O of 0.8 units. In another embodiment, the OD60O is about 0.7 units. In another
10 embodiment, the OD6Oo is about 0.8 units. In another embodiment, the OD6O0 is 0.6 units. In another embodiment, the OD6O0 is 0.65 units. In another embodiment, the OD6O0 is 0.75 units. In another embodiment, the OD6oo is 0.85 units. In another embodiment, the OD6oo is 0.9 units. In another embodiment, the OD6oo is 1 unit. In another embodiment, the OD6oo is 0.6-0.9 units. In another embodiment, the OD6oo is 0.65-0.9 units. In another embodiment, the OD600 is 0.7-0.9 units. In another
15 embodiment, the OD600 is 0.75-0.9 units. In another embodiment, the OD6oo is 0.8-0.9 units. In another embodiment, the OD6O0 is 0.75-1 units. In another embodiment, the OD6oo is 0.9-1 units. In another embodiment, the OD600 is greater than 1 unit.
[00084] In another embodiment, the OD6oo is significantly greater than 1 unit (e.g. when the culture is produced in a batch fermenter). In another embodiment, the OD6oo is 7.5-8.5 units. In another embodiment, 20 the OD6O0 is 1.2 units. In another embodiment, the OD6O0 is 1.5 units. In another embodiment, the OD6oo is 2 units. In another embodiment, the OD6O0 is 2.5 units. In another embodiment, the OD6Oo is 3 units. In another embodiment, the OD60O is 3.5 units. In another embodiment, the OD6oo is 4 units. In another embodiment, the OD6oo is 4.5 units. In another embodiment, the OD6oo is 5 units. In another embodiment, the OD6O0 is 5.5 units. In another embodiment, the OD6oo is 6 units. In another embodiment, the OD60O is
25 6.5 units. In another embodiment, the OD600 is 7 units. In another embodiment, the OD60O is 7.5 units. In another embodiment, the OD60O is 8 units. In another embodiment, the OD60O is 8.5 units. In another embodiment, the OD6oo is 9 units. In another embodiment, the OD600 is 9.5 units. In another embodiment, the OD6Oo is 10 units. In another embodiment, the OD6oo is more than 10 units.
[00085] In another embodiment, the OD6oo is 1-2 units. In another embodiment, the OD6oo is 1.5-2.5 units.
30 In another embodiment, the OD60O is 2-3 units. In another embodiment, the OD600 is 2.5-3.5 units. In another embodiment, the OD60O is 3-4 units. In another embodiment, the OD600 is 3.5-4.5 units. In another embodiment, the OD60O is 4-5 units. In another embodiment, the OD600 is 4.5-5.5 units. In another embodiment, the OD60O is 5-6 units. In another embodiment, the OD6O0 is 5.5-6.5 units. In another P
Figure imgf000017_0001
units. In another embodiment, the OD600 is 1.5-3.5 units. In another embodiment, the OD600 is 2-4 units. In another embodiment, the ODβoo is 2.5-4.5 units. In another embodiment, the OD600 is 3-5 units. In another embodiment, the OD60O is 4-6 units. In another embodiment, the OD6O0 is 5-7 units. In another embodiment, the OD60O is 2-5 units. In another 5 embodiment, the OD6oo is 3-6 units. In another embodiment, the OD6O0 is 4-7 units. In another embodiment, the OD6oo is 5-8 units. In another embodiment, the OD600 is 1.2-7.5 units. In another embodiment, the OD6oo is 1.5-7.5 units. In another embodiment, the OD6oo is 2-7.5 units. In another embodiment, the OD600 is 2.5-7.5 units. In another embodiment, the OD6oo is 3-7.5 units. In another embodiment, the OD6oo is 3.5-7.5 units. In another embodiment, the OD6oo is 4-7.5 units. In another 0 embodiment, the OD6O0 is 4.5-7.5 units. In another embodiment, the OD60O is 5-7.5 units. In another embodiment, the OD6oo is 5.5-7.5 units. In another embodiment, the OD600 is 6-7.5 units. In another embodiment, the OD60O is 6.5-7.5 units. In another embodiment, the OD600 is 7-7.5 units. In another embodiment, the OD6oo is more than 10 units. In another embodiment, the OD6O0 is 1.2-8.5 units. In another embodiment, the OD6oo is 1.5-8.5 units. In another embodiment, the ODgoo is 2-8.5 units. In 5 another embodiment, the ODβoo is 2.5-8.5 units. In another embodiment, the OD6oo is 3-8.5 units. In another embodiment, the OD6oo is 3.5-8.5 units. In another embodiment, the OD6oo is 4-8.5 units. In another embodiment, the OD600 is 4.5-8.5 units. In another embodiment, the OD6oo is 5-8.5 units. In another embodiment, the OD600 is 5.5-8.5 units. In another embodiment, the OD60O is 6-8.5 units. In another embodiment, the OD600 is 6.5-8.5 units. In^ another embodiment, the ODeoo is 7-8.5 units. In 0 another embodiment, the OD600 is 7.5-8.5 units. In another embodiment, the OD600 is 8-8.5 units. In another embodiment, the OD600 is 9.5-8.5 units. In another embodiment, the OD600 is 10 units.
[00086] In another embodiment, the step of freezing or lyophilizing is performed when the culture has a biomass of about 1 x 109 colony-forming units (CFU)/ml. In another embodiment, the biomass is about 1.5 x 109 CFR/ml. In another embodiment, the biomass is about 1.5 x 109 CFR/ml. In another embodiment, the 5 biomass is about 2 x 109 CFR/ml. In another embodiment, the biomass is about 3 x 109 CFR/ml. In another embodiment, the biomass is about 4 x 109 CFR/ml. In another embodiment, the biomass is about 5 x 109 CFR/ml. In another embodiment, the biomass is about 7 x 109 CFR/ml. In another embodiment, the biomass is about 9 x 109 CFR/ml. In another embodiment, the biomass is about 10 x 109 CFR/ml. In another embodiment, the biomass is about 12 x 109 CFR/ml. In another embodiment, the biomass is about 0 15 x 109 CFR/ml. In another embodiment, the biomass is about 20 x 109 CFR/ml. In another embodiment, the biomass is about 25 x 109 CFR/ml. In another embodiment, the biomass is about 30 x 109 CFR/ml. In another embodiment, the biomass is about 33 x 109 CFR/ml. In another embodiment, the biomass is about 40 x 109 CFR/ml. In another embodiment, the biomass is about 5O x IO9 CFR/ml. In another embodiment, the biomass is about more than 50 x 109 CFR/ml.
Figure imgf000018_0001
OfOD600 readings and culture biomass measurements represents a separate embodiment of the present invention.
[00088] In another embodiment of methods and compositions of the present invention, the Listeria culture is flash-frozen in liquid nitrogen, followed by storage at the final freezing temperature. In another 5 embodiment, the culture is frozen in a more gradual manner; e.g. by placing in a vial of the culture in the final storage temperature. In another embodiment, the culture is frozen by any other method known in the art for freezing a bacterial culture. Each possibility represents a separate embodiment of the present invention.
[00089] In another embodiment of methods and compositions of the present invention, the storage 10 temperature of the culture is between -20 and -80 degrees Celsius (0C). In another embodiment, the temperature is significantly below -200C. In another embodiment, the temperature is not warmer than -70 0C. In another embodiment, the temperature is -700C. In another embodiment, the temperature is about - 700C. In another embodiment, the temperature is -200C. In another embodiment, the temperature is about -20 0C. In another embodiment, the temperature is -300C. In another embodiment, the temperature is -40 15 0C. In another embodiment, the temperature is -500C. In another embodiment, the temperature is -600C. In another embodiment, the temperature is -800C. In another embodiment, the temperature is -30 - -700C. In another embodiment, the temperature is -40 - -700C. In another embodiment, the temperature is -50 - - 700C. In another embodiment, the temperature is -60 - -700C. In another embodiment, the temperature is -30 - -80 0C. In another embodiment, the temperature is -40 - -80 0C. In another embodiment, the
20 temperature is -50 - -80 0C. In another embodiment, the temperature is -60 - -80 0C. In another embodiment, the temperature is -70 - -80 0C. In another embodiment, the temperature is colder than -70 0C. In another embodiment, the temperature is colder than -80 0C. Each possibility represents a separate embodiment of the present invention.
[00090] In another embodiment of methods and compositions of the present invention, the cryopreservation 25 or frozen storage is for a maximum of 24 hours. In another embodiment, the cryopreservation or storage is for maximum of 2 days. In another embodiment, the cryopreservation or storage is for maximum of 3 days. In another embodiment, the cryopreservation or storage is for maximum of 4 days. In another embodiment, the cryopreservation or storage is for maximum of 1 week. In another embodiment, the cryopreservation or storage is for maximum of 2 weeks. In another embodiment, the cryopreservation or storage is for
30 maximum of 3 weeks. In another embodiment, the cryopreservation or storage is for maximum of 1 month.
In another embodiment, the cryopreservation or storage is for maximum of 2 months. In another embodiment, the cryopreservation or storage is for maximum of 3 months. In another embodiment, the cryopreservation or storage is for maximum of 5 months. In another embodiment, the cryopreservation or P C "Pϊ£>ifeέ©QfB jώstiiWiialtϋEfe months. In another embodiment, the cryopreservation or storage is for maximum of 9 months. In another embodiment, the cryopreservation or storage is for maximum of 1 year.
[00091] In another embodiment, the cryopreservation or storage is for a minimum of 1 week. In another embodiment, the cryopreservation or storage is for minimum of 2 weeks. In another embodiment, the 5 cryopreservation or storage is for minimum of 3 weeks. In another embodiment, the cryopreservation or storage is for minimum of 1 month. In another embodiment, the cryopreservation or storage is for minimum of 2 months. In another embodiment, the cryopreservation or storage is for minimum of 3 months. In another embodiment, the cryopreservation or storage is for minimum of 5 months. In another embodiment, the cryopreservation or storage is for minimum of 6 months. In another embodiment, the
10 cryopreservation or storage is for minimum of 9 months. In another embodiment, the cryopreservation or storage is for minimum of 1 year. In another embodiment, the cryopreservation or storage is for minimum of 1.5 years. In another embodiment, the cryopreservation or storage is for minimum of 2 years. In another embodiment, the cryopreservation or storage is for minimum of 3 years. In another embodiment, the cryopreservation or storage is for minimum of 5 years. In another embodiment, the cryopreservation or
15 storage is for minimum of 7 years . In another embodiment, the cryopreservation or storage is for minimum of 10 years. In another embodiment, the cryopreservation or storage is for longer than 10 years.
[00092] Each length of storage or cryopreservation represents a separate embodiment of the present invention.
[00093 ] In another embodiment of methods and compositions of the present invention, the Listeria bacteria
20 exhibit exponential growth es sentially immediately after thawing or reconstitution following an extended period of cryopreservation, frozen storage, or lyophilization (Example 2). In another embodiment, "essentially immediately" refers to within about 1 hour after inoculating fresh media with cells from the cell bank or starter culture. In another embodiment, the bacteria exhibit exponential growth shortly after (e.g. in various embodiments, after 10 minutes (min), 20 min, 30 min, 40 min, 50 min, 1 hour, 75 min, 90 25 min, 105 min, or 2 hours) (a) thawing and dilution or (b) reconstitution following the period of cryopreservation or storage. Each possibility represents a separate embodiment of the present invention.
[00094] The "extended period of cryopreservation or frozen storage" is, in another embodiment, 1 month. In another embodiment, the period is 2 months. In another embodiment, the period is 3 months. In another embodiment, the period is 5 months. In another embodiment, the period is 6 months. In another
30 embodiment, the period is 9 months. In another embodiment, the period is 1 year. In another embodiment, the period is 1.5 years. In another embodiment, the period is 2 years. Each possibility represents a separate embodiment of the present invention. lQP9g|!!Ml#Φfeil©l||id!laSnt, "exponential growth" refers to a doubling time that is close to the maximum observed for the conditions (e.g. media type, temperature, etc.) in which the culture is growing. In another embodiment, "exponential growth" refers to a doubling time that is reasonable constant several hours (e.g. 1 hour, 1.5 hours, 2 hours, or 2.5 hours) after dilution of the culture; optionally following a brief recovery period. Each possibility represents a separate embodiment of the present invention.
[00096] In another embodiment, the Listeria vaccine strain of methods and compositions of the present invention retains a viability of over 90% after (a) thawing and dilution or (b) reconstitution, following 14 days of cryopreservation (Example 2). In another embodiment, the viability upon thawing or reconstitution is close to 100% following the period of cryopreservation or lyophilization. In another embodiment, the viability upon thawing or reconstitution is about 90%. In another embodiment, the viability upon thawing or reconstitution is close to 90%. In another embodiment, the viability upon thawing or reconstitution is at least 90%. In another embodiment, the viability upon thawing or reconstitution is over 80%. Each possibility represents a separate embodiment of the present invention.
[00097] "Viability" refers, in another embodiment, to the number of live bacteria, relative to the number that were frozen or lyophilized. In another embodiment, the term refers to the number of bacteria capable of multiplication, relative to the number that were frozen. Each possibility represents a separate embodiment of the present invention.
[00098] The Listeria strain that is subject to cryopreservation, freezing, or lyophilizing is, in another embodiment, a Listeria vaccine strain; e.g. Lm-LLO-E7 or Lmdd-pTV3. In another embodiment, the vaccine strain expresses a heterologous antigen (Ag). In another embodiment, the heterologous Ag is a tumor Ag. In another embodiment, the heterologous Ag is an infectious disease Ag. In another embodiment, the heterologous Ag is E7 protein. In another embodiment, the heterologous Ag is fused to an immunogenic protein. In another embodiment, the immunogenic protein is LLO. In another embodiment, the heterologous antigen is a fusion of LLO and E7. In another embodiment, the Listeria strain is any Listeria strain that is enumerated or disclosed herein. In another embodiment, the Listeria strain is any Listeria strain of the present invention. Each strain may be used for each method of the present invention, and each method-strain combination represents a separate embodiment of the present invention.
[00099] In another embodiment, the present invention provides a cell bank of Ά Listeria strain, wherein the cell bank is produced by the method of the present invention. In other embodiments, each of the above methods may be utilized, and each method represents a separate embodiment of the present invention.
Figure imgf000021_0001
wherein the stock is produced by the method of the present invention. In other embodiments, each of the above methods may be utilized, and each method represents a separate embodiment of the present invention.
[000101 ] In another embodiment, the present invention provides a batch of vaccine doses of a Listeria strain, 5 wherein the batch is produced by the method of the present invention. In other embodiments, each of the above methods may be utilized, and each method represents a separate embodiment of the present invention.
[000102] In another embodiment, the above cell bank, frozen stock or batch of vaccine doses has a substantial viability upon thawing or reconstitution. In another embodiment, the cell bank, frozen stock or 10 batch of vaccine doses exhibits superior one or more properties (e.g. immunogenicity, consistency, quality, portability, etc). Each possibility represents a separate embodiment of the present invention.
[000103] Methods for lyophilization and reconstitution of biological samples (e.g. bacteria), while substantially maintaining viability, are well known in the art, and are described, for example, in Snowman, John W. Downstream Processes: Equipment and Techniques, pages 315-351, 1988 Alan R. Liss, Inc. In
15 another embodiment, lyophilization comprises 2 steps: freezing the product, and decreasing the pressure above the ice surface. In another embodiment, formation of ice crystals results in a separation of the solutes and the solvent. In another embodiment, since the concentration of the solvent is generally greater than that of the solutes, the formation of ice forces the solutes into a region between the crystals known as the "interstitial." In another embodiment, the second step (decreasing the pressure) causes sublimation of
20 ice crystals from the surface of the product. In another embodiment, lyophilization comprises a third step: secondary drying (desorption). In another embodiment, desorption removes moisture contained within the cake is ("absorbed" water). In another embodiment, desorption removes water on the surface of the cake is defined as "adsorbed" water. In another embodiment, desorption removes both absorbed and adsorbed water. Each possibility represents a separate embodiment of the present invention.
25 [000104] In another embodiment, an aseptic filling room is used for filling the vials prior to lyophilization
(or cryopreservation). In another embodiment, an art-known lyophilizer is used (e.g. a Edwards, 1M2 Steam Sterilizable Lyophilizer). In another embodiment, a freeze-dryer is used that is equipped with a mechanical pumping system that removes the non-condensable gases. In another embodiment,
[000105] In another embodiment, the present invention provides a defined microbiological media,
30 comprising: (1) between about 0.3 and about 0.6-g/L of methionine; and (2) effective amounts of: (a) cysteine; (b) a pH buffer; (c) a carbohydrate; (d) a divalent cation; (e) ferric or ferrous ions; (f) glutamine or another nitrogen source; (g) riboflavin; (h) thioctic acid (also known as lipoic acid); (i) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) p £;; "f \(©it^c|-|;røfnpδp4tiϊiιs|teited from adenine, biotin, thiamine, pyiidoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
[000106] As provided herein, the results of the present invention identify defined microbiological media mat 5 are efficacious in supporting growth of Listeria and cryopreservation and preparation of cell banks, frozen stocks, and vaccine doses of same.
[000107] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L of cysteine; and (2) effective amounts of: (a) methionine; (b) a pH buffer; (c) a carbohydrate; (d) a divalent cation; (e) ferric or ferrous ions; (f) 0 glutamine or another nitrogen source; (g) riboflavin; (h) thioctic acid; (i) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) 1 or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
15 [000108] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.00123 - 0.00246 moles of ferric or ferrous ions per liter; and (2) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) glutamine or another nitrogen source; (g) riboflavin; (h) thioctic acid; (i) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) 1 or more
20 components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
[000109] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 1.8 - 3.6 g/L of glutamine or another nitrogen source; and (2) effective
25 amounts of: (a) a pH buffer; (b) a carbohydrate: (c) a divalent cation; (d) methionine (e) cysteine; (f) ferric or ferrous ions (g) riboflavin (h); thioctic acid; (i) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) 1 or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
30 [00011O] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 15 and about 30 mg/L of riboflavin; and (2) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) thioctic acid; (i) 1 or more components selected from leucine, IF:!t 1C "pprdyibϊEC^Bltø'e^Myt'iSuiniil^ϊstidine,- tryptophan, and phenylalanine; (j) 1 or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
5 [00011I] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L of thioctic acid; and (2) effective amounts of: (a) apH buffer; (b) a carbohydrate (c) a divalent cation; (d) methionine (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (j) 1 or more components selected 0 from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
[000112] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of methionine and cysteine; (2) between about 5 0.00123 and 0.00246 moles of ferric or ferrous ions per liter; (3) between about 1.8 and about 3.6 g/L of glutamine or another nitrogen source; (4) between about 0.3 and about 0.6 g/L of thioctic acid; (5) between about 15 and about 30 mg/L of riboflavin; and (6) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (e) 1 or more components selected from adenine, biotin, 0 thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (f) 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
[000113] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of methionine and cysteine; (2) between about 0.00123 and 0.00246 moles of ferric or ferrous ions per liter; (3) between about 1.8 and about 3.6 g/L of
25 glutamine or another nitrogen source; (4) between about 0.3 and about 0.6 g/L of thioctic acid; (5) between about 15 and about 30 mg/L of riboflavin; and (6) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) leucine; (e) isoleucine; (f) valine; (g) arginine; (h) histidine; (i) tryptophan; (j) phenylalanine; (k) 1 or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (1) 1 or more components selected
30 from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
[000114] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; and (2) effective amounts of: (a) a IP CpBΦtøϊMS ©liiiCdrfelRf <&St'<|b) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) 1 or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
[000115] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; and (2) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen 0 source; (h) riboflavin; (i) thioctic acid; (j) 1 or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (k) 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
[000116] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.2 and about 0.75 of 1 or more components selected from biotin and 5 adenine; and (2) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (k) 1 or more components selected from thiamine, pyridoxal, para- aminobenzoic acid, pantothenate, and nicotinamide; and (1) 1 or more components selected from cobalt, 0 copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
[000117] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 3 and about 6 mg/L each of 1 or more components selected from thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (2) effective amounts of: (a) apH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) 5 glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (k) biotin; (1) adenine; and (1) 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
[000118] In another embodiment, the present invention provides a defined microbiological media, 0 comprising: (1) between about 0.2 and about 0.75 mg/L each of 1 or more components selected from biotin and adenine; (2) between about 3 and about 6 mg/L each of 1 or more components selected from thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and (3) effective amounts of: (a) a pH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or "f^WlWJi^fey ^Kiitt Jar another nitrogen source; (h) riboflavin; (i) thioctic acid; (J) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; and (k) 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
[000119] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.005 and about 0.02 g/L each of 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, and calcium; and (2) effective amounts of: (a) apH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (T) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; and (k) 1 or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide.
[00012O]In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.4 and about 1 g/L of citrate; and (2) effective amounts of: (a) apH buffer; (b) a carbohydrate; (c) a divalent cation; (d) methionine; (e) cysteine; (f) ferric or ferrous ions; (g) glutamine or another nitrogen source; (h) riboflavin; (i) thioctic acid; (j) 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (k) 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, and calcium; and (1) 1 or more components selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide.
[00012I]In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of methionine and cysteine; (2) between about 0.00123 and 0.00246 moles of ferric or ferrous ions per liter; (3) between about 1.8 and about 3.6 g/L of glutamine or another nitrogen source; (4) between about 0.3 and about 0.6 g/L of thioctic acid; (5) between about 15 and about 30 mg/L of riboflavin; (6) between about 0.3 and about 0.6 g/L each of 1 or more components selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (7) between about 0.2 and about 0.75 mg/L each of 1 or more components selected from biotin and adenine; (8) between about 3 and about 6 mg/L each of 1 or more components selected from thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; (9) between about 0.005 and about 0.02 g/L each of 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, and calcium; (10) between about 0.4 and about 1 g/L of citrate; and (11) and effective amounts of: (a) a pH buffer; (b) a carbohydrate; and (c) a divalent cation. p-|][φQ..Ϊ%^lS^L|< irø|t]jfcϊi-|#χ1B®i-fent, the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of methionine and cysteine; (2) between about 0.00123 and 0.00246 moles of ferric or ferrous ions per liter; (3) between about 1.8 and about 3.6 g/L of glutamine or another nitrogen source; (4) between about 0.3 and about 0.6 g/L of thioctic acid; (5) between 5 about 15 and about 30 mg/L of riboflavin; (6) between about 0.3 and about 0.6 g/L each of leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (7) between about 0.2 and about 0.75 mg/L each of 1 or more components selected from biotin and adenine; (8) between about 3 and about 6 mg/L each of 1 or more components selected from thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; (9) between about 0.005 and about 0.02 g/L each of 1 or more 0 components selected from cobalt, copper, boron, manganese, molybdenum, zinc, and calcium; (10) between about 0.4 and about 1 g/L of citrate; and (11) and effective amounts of: (a) a pH buffer; (b) a carbohydrate; and (c) a divalent cation.
[000123] In another embodiment, the present invention provides a defined microbiological media, comprising: (1) between about 0.3 and about 0.6 g/L each of methionine and cysteine; (2) between about 5 0.00123 and 0.00246 moles of ferric or ferrous ions per liter; (3) between about 1.8 and about 3.6 g/L of glutamine or another nitrogen source; (4) between about 0.3 and about 0.6 g/L of thioctic acid; (5) between about 15 and about 30 mg/L of riboflavin; (6) between about 0.3 and about 0.6 g/L each of leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; (7) between about 0.2 and about 0.75 mg/L each of biotin and adenine; (8) between about 3 and about 6 mg/L each of thiamine, pyridoxal, para- 0 aminobenzoic acid, pantothenate, and nicotinamide; (9) between about 0.005 and about 0.02 g/L each of 1 or more components selected from cobalt, copper, boron, manganese, molybdenum, zinc, and calcium; (10) between about 0.4 and about 1 g/L of citrate; and (11) and effective amounts of: (a) a pH buffer; (b) a carbohydrate; and (c) a divalent cation.
[000124] In another embodiment, a defined microbiological media of methods and compositions of the 5 present invention is suitable for growth of a Listeria strain. In another embodiment, the Listeria strain is a
Listeria vaccine strain. In another embodiment, the Listeria strain is a LM strain. In another embodiment, the Listeria strain is any other Listeria strain of the present invention. In another embodiment, the Listeria strain is any other Listeria strain enumerated herein. In another embodiment, the Listeria strain is any other Listeria strain known in the art. In another embodiment, the defined microbiological media is suitable for 0 growth of any other bacterial strain known in the art. Each possibility represents a separate embodiment of the present invention.
[000125] In another embodiment, a defined microbiological media of the present invention further comprises an aqueous solvent. In another embodiment, the aqueous solvent is water. In another lPlC ^P^fe^t^iSfipitli^^I^eiaiaiilscllVent is any other aqueous solvent known in the art. Each possibility represents a separate embodiment of the present invention.
[000126] The carbohydrate utilized in methods and compositions of the present invention is, in another embodiment, glucose. In another embodiment, the carbohydrate is lactose. In another embodiment, the
5 carbohydrate is fructose. In another embodiment, the carbohydrate is mannose. In another embodiment, the carbohydrate is cellobiose. In another embodiment, the carbohydrate is trehalose. In another embodiment, the carbohydrate is maltose. In another embodiment, the carbohydrate is glycerol. In another embodiment, the carbohydrate is glucosamine. In another embodiment, the carbohydrate is N-acetylglucosamine. In another embodiment, the carbohydrate is N-acetylmuramic acid. In another embodiment, the carbohydrate 0 is any other carbohydrate that can be utilized by Listeria. Each possibility represents a separate embodiment of the present invention.
[000127] In another embodiment, the amount of a carbohydrate present in a defined microbiological media of methods and compositions of the present invention is between about 12-18 grams/liter (g/L). In another embodiment, the amount is 15 g/L. In another embodiment, the amount is 10 g/L. In another embodiment, 15 the amount is 9 g/L. In another embodiment, the amount is 11 g/L. In another embodiment, the amount is 12 g/L. In another embodiment, the amount is 13 g/L. In another embodiment, the amount is 14 g/L. In another embodiment, the amount is 16 g/L. In another embodiment, the amount is 17 g/L. In another embodiment, the amount is 18 g/L. In another embodiment, the amount is 19 g/L. In another embodiment, the amount is 20 g/L. In another embodiment, the amount is more than 20 g/L.
20 [000128] In another embodiment, the amount is 9-15 g/L. In another embodiment, the amount is 10-15 g/L.
In another embodiment, the amount is 11-15 g/L. In another embodiment, the amount is 12-16 g/L. In another embodiment, the amount is 13-17 g/L. In another embodiment, the amount is 14-18 g/L. In another embodiment, the amount is 16-19 g/L. In another embodiment, the amount is 17-20 g/L. In another embodiment, the amount is 10-20 g/L. In another embodiment, the amount is 12-20 g/L. In another 25 embodiment, the amount is 15-20 g/L.
[000129] In another embodiment, the total amount of carbohydrate in the media is one of the above amounts . In another embodiment, the amount of one of the carbohydrates in the media is one of the above amounts. In another embodiment, the amount of each of the carbohydrates in the media is one of the above amounts.
[000130] Each of the above amounts of carbohydrates represents a separate embodiment of the present
30 invention.
[000131] The cobalt present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present as a cobalt ion. In another embodiment, the cobalt is present W .r'Φb'BtiiMS M ϊidHhG 8hf odiment, the salt is cobalt chloride. In another embodiment, the salt is any other cobalt salt known in the art. In another embodiment, the cobalt is present as any other form of cobalt known in the art.
[000132] In another embodiment, the cobalt salt is a hydrate (e.g. cobalt chloride hexahydrate). In another embodiment, the cobalt salt is anhydrous. In another embodiment, the cobalt salt is any other form of a cobalt salt known in the art. Each of the above forms of cobalt represents a separate embodiment of the present invention.
[000133] A hydrate of a component of a defined media of methods and compositions of the present invention is, in another embodiment, a monohydrate. In another embodiment, the hydrate is a dihydrate. In another embodiment, the hydrate is a trihydrate. In another embodiment, the hydrate is a tetrahydrate. In another embodiment, the hydrate is a pentahydrate. In another embodiment, the hydrate is a hexahydrate. In another embodiment, the hydrate is a heptahydrate. In another embodiment, the hydrate is any other hydrate known in the art. Each possibility represents a separate embodiment of the present invention.
[000134] The copper present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present as a copper ion. In another embodiment, the copper ion is a copper (I) ion. In another embodiment, the copper ion is a copper (II) ion. In another embodiment, the copper ion is a copper (DI) ion.
[000135] In another embodiment, the copper is present as a copper salt. In another embodiment, the salt is copper chloride. In another embodiment, the salt is any other copper salt known in the art. In another embodiment, the copper is present as any other form of copper known in the art.
[000136] In another embodiment, the copper salt is a hydrate (e.g. copper chloride dihydrate). In another embodiment, the copper salt is anhydrous. In another embodiment, the copper salt is any other form of a copper salt known in the art. Each of the above forms of copper represents a separate embodiment of the present invention.
[000137] The boron present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present as a borate ion. In another embodiment, the boron is present as a borate acid (e.g. boric acid, H3BO3). In another embodiment, the boron is present as any other form of boron known in the art.
[000138] In another embodiment, the borate salt or borate acid is a hydrate. In another embodiment, the borate salt or borate acid is anhydrous. In another embodiment, the borate salt or borate acid is any other form of a borate salt or borate acid known in the art. Each of the above forms of boron represents a separate embodiment of the present invention.
Figure imgf000029_0001
in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present as a manganese ion. In another embodiment, the manganese is present as a manganese salt. In another embodiment, the salt is manganese sulfate. In another embodiment, the salt is any other manganese salt known in the art. In another embodiment, the manganese 5 is present as any other form of manganese known in the art.
[000140] In another embodiment, the manganese salt is a hydrate (e.g. manganese sulfate monohydrate). In another embodiment, the manganese salt is anhydrous. In another embodiment, the manganese salt is any other form of a manganese salt known in the art. Each of the above forms of manganese represents a separate embodiment of the present invention.
10 [000141] The molybdenum present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present as a molybdate ion. In another embodiment, the molybdenum is present as a molybdate salt. In another embodiment, the salt is sodium molybdate. In another embodiment, the salt is any other molybdate salt known in the art. In another embodiment, the molybdenum is present as any other form of molybdenum known in the art.
15 [000142] In another embodiment, the molybdate salt is a hydrate (e.g. sodium molybdate dihydrate). In another embodiment, the molybdate salt is anhydrous. In another embodiment, the molybdate salt is any other form of a molybdate salt known in the art. Each of the above forms of molybdenum represents a separate embodiment of the present invention.
[000143] The zinc present in defined microbiological media of methods and compositions of the present
20 invention is, in another embodiment, present as a zinc ion. In another embodiment, the zinc is present as a zinc salt. In another embodiment, the salt is zinc chloride. In another embodiment, the salt is any other zinc salt known in the art. In another embodiment, the zinc is present as any other form of zinc known in the art.
[000144] In another embodiment, the zinc salt is a hydrate (e.g. zinc chloride heptahydrate). In another
25 embodiment, the zinc salt is anhydrous. In another embodiment, the zinc salt is any other form of a zinc salt known in the art. Each of the above forms of zinc represents a separate embodiment of the present invention.
[000145] The iron present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present as a ferric ion. In another embodiment, the iron is present as a
30 ferrous ion. In another embodiment, the iron is present as a ferric salt. In another embodiment, the iron is present as a ferrous salt. In another embodiment, the salt is ferric sulfate. In another embodiment, the salt is ferric citrate. In another embodiment, the salt is any other ferric salt known in the art. In another
Figure imgf000030_0001
in the art. In another embodiment, the iron is present as any other form of iron known in the art.
[000146] In another embodiment, the ferric or ferrous salt is a hydrate (e.g. ferric sulfate monohydrate). In another embodiment, the ferric or ferrous salt is anhydrous. In another embodiment, the ferric or ferrous 5 salt is any other form of a ferric or ferrous salt known in the art. Each of the above forms of iron represents a separate embodiment of the present invention.
[000147] The calcium present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present as a calcium ion. In another embodiment, the calcium is present as a calcium salt. In another embodiment, the salt is calcium chloride. In another embodiment, the 0 salt is any other calcium salt known in the art. In another embodiment, the calcium is present as any other form of calcium known in the art.
[000148] In another embodiment, the calcium salt is a hydrate (e.g. calcium chloride dihydrate). In another embodiment, the calcium salt is anhydrous. In another embodiment, the calcium salt is any other form of a calcium salt known in the art. Each of the above forms of calcium represents a separate embodiment of the 5 present invention.
[000149] The citrate present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present as a citrate ion. In another embodiment, the citrate is present as a citrate salt. In another embodiment, the citrate is present as a citrate acid (e.g. citric acid). In another embodiment, the citrate is present as both ferric citrate and citric acid (Examples), m another embodiment, 0 the citrate is present as any other form of citrate known in the art.
[000150] In another embodiment, the citrate salt or citrate acid is a hydrate. In another embodiment, the citrate salt or citrate acid is anhydrous. In another embodiment, the citrate salt or citrate acid is any other form of a citrate salt or citrate acid known in the art. Each of the above forms of citrate represents a separate embodiment of the present invention.
5 [000151] The cobalt present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in an amount of 0.02 g/L (Examples). In another embodiment, the amount is about 0.02 g/L. In another embodiment, the amount is 0.003 g/L. In another embodiment, the amount is 0.005 g/L. In another embodiment, the amount is 0.007 g/L. In another embodiment, the amount is 0.01 g/L. In another embodiment, the amount is 0.015 g/L. In another embodiment, the amount is 0.025
30 g/L. In another embodiment, the amount is 0.03 g/L. In another embodiment, the amount is 0.003-0.006 g/L. In another embodiment, the amount is 0.005-0.01 g/L. In another embodiment, the amount is 0.01-0.02 g/L. In another embodiment, the amount is 0.02-0.04 g/L. In another embodiment, the amount is 0.03-0.06 /USD B /4-M-BS-.!- .-
[000152] In another embodiment, the cobalt is present in an amount that is the molar equivalent of 0.02 g/L of cobalt chloride hexahydrate. In another embodiment, the amount of cobalt present is the molar equivalent of about 0.02 g/L of cobalt chloride hexahydrate. In another embodiment, the amount of cobalt present is the molar equivalent of another of the above amounts or ranges of cobalt chloride hexahydrate.
Each of the above amounts or ranges of cobalt represents a separate embodiment of the present invention.
[000153] The copper present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in an amount of 0.019 g/L (Examples). In another embodiment, the amount is about 0.019 g/L. In other embodiments, the amount is any of the amounts or ranges listed above for cobalt.
[000154] In another embodiment, the copper is present in an amount that is the molar equivalent of 0.019 g/L of copper chloride dihydrate. In another embodiment, the amount of copper present is the molar equivalent of about 0.019 g/L of copper chloride dihydrate. In another embodiment, the amount of copper present is the molar equivalent of copper chloride dihydrate in any of the amounts or ranges listed above for cobalt. Each of the above amounts or ranges of copper represents a separate embodiment of the present invention.
[000155] The borate present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in an amount of 0.016 g/L (Examples). In another embodiment, the amount is about 0.016 g/L. In other embodiments, the amount is any of the amounts or ranges listed above for cobalt.
[000156] In another embodiment, the borate is present in an amount that is the molar equivalent of 0.016 g/L of boric acid. In another embodiment, the amount of borate present is the molar equivalent of about 0.016 g/L of boric acid. In another embodiment, the amount of borate present is the molar equivalent of boric acid in any of the amounts or ranges listed above for cobalt. Each of the above amounts or ranges of borate represents a separate embodiment of the present invention.
[000157] The manganese present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in an amount of 0.016 g/L (Examples). In another embodiment, the amount is about 0.016 g/L. In other embodiments, the amount is any of the amounts or ranges listed above for cobalt.
[000158] In another embodiment, the manganese is present in an amount that is the molar equivalent of 0.016 g/L of manganese sulfate monohydrate. In another embodiment, the amount of manganese present is the molar equivalent of about 0.016 g/L of manganese sulfate monohydrate. In another embodiment, the amount of manganese present is the molar equivalent of manganese sulfate monohydrate in any of the iP* C 'i^^ιlril€MMg.e§'l'jisf4dSlSv:I.f or cobalt. Each of the above amounts or ranges of manganese represents a separate embodiment of the present invention.
[000159] The molybdenum present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in an amount of 0.02 g/L (Examples). In another 5 embodiment, the amount is about 0.02 g/L. In other embodiments, the amount is any of the amounts or ranges listed above for cobalt.
[000160] In another embodiment, the molybdenum is present in an amount that is the molar equivalent of 0.2 g/L of sodium molybdate dihydrate. In another embodiment, the amount of molybdenum present is the molar equivalent of about 0.02 g/L of sodium molybdate dihydrate. In another embodiment, the amount of 0 molybdenum present is the molar equivalent of sodium molybdate dihydrate in any of the amounts or ranges listed above for cobalt. Each of the above amounts or ranges of molybdenum represents a separate embodiment of the present invention.
[000161] The zinc present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in an amount of 0.02 g/L (Examples). In another embodiment, 5 the amount is about 0.02 g/L. In other embodiments, the amount is any of the amounts or ranges listed above for cobalt.
[000162] In another embodiment, the zinc is present in an amount that is the molar equivalent of 0.02 g/L of zinc chloride heptahydrate. In another embodiment, the amount of zinc present is the molar equivalent of about 0.02 g/L of zinc chloride heptahydrate. In another embodiment, the amount of zinc present is the 0 molar equivalent of zinc chloride heptahydrate in any of the amounts or ranges listed above for cobalt. Each of the above amounts or ranges of zinc represents a separate embodiment of the present invention.
[000163] In another embodiment, ferric sulfate or a related compound is present in defined microbiological media of methods and compositions of the present invention. In another embodiment, the ferric sulfate or related compound is present in an amount of 0.01 g/L (Examples). In another embodiment, the amount is 5 about 0.01 g/L. In other embodiments, the amount is any of the amounts or ranges listed above for cobalt.
[000164] In another embodiment, the iron is present in an amount that is the molar equivalent of 0.01 g/L of ferric sulfate. In another embodiment, the amount of iron present is the molar equivalent of about 0.01 g/L of ferric sulfate. In another embodiment, the amount of iron present is the molar equivalent of ferric sulfate in any of the amounts or ranges listed above for cobalt. Each of the above amounts or ranges of iron 0 represents a separate embodiment of the present invention.
[000165] The calcium present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in an amount of 0.01 g/L (Examples). In another embodiment, F" C
Figure imgf000033_0001
pLiLln other embodiments, the amount is any of the amounts or ranges listed above for cobalt.
[000166] In another embodiment, the calcium is present in an amount that is the molar equivalent of 0.01 g/L of calcium chloride dihydrate. In another embodiment, the amount of calcium present is the molar 5 equivalent of about 0.01 g/L of calcium chloride dihydrate. In another embodiment, the amount of calcium present is the molar equivalent of calcium chloride dihydrate in any of the amounts or ranges listed above for cobalt. Each of the above amounts or ranges of calcium represents a separate embodiment of the present invention.
[000167] The citrate present in defined microbiological media of methods and compositions of the present 0 invention is, in another embodiment, present in an amount of 0.9 g/L (Examples). In another embodiment, the amount is 0.6 g/L in the form of citric acid (Examples). In another embodiment, the amount is 0.4 g/L in the form of ferric citrate (Examples). In another embodiment, the amount is 0.6 g/L in the form of citric acid and 0.4 g/L in the form of ferric citrate (Examples). In another embodiment, the amount is about 0.6 g/L. In another embodiment, the amount is 0.1 g/L. In another embodiment, the amount is 0.2 g/L. In
15 another embodiment, the amount is 0.3 g/L. In another embodiment, the amount is 0.4 g/L. In another embodiment, the amount is 0.5 g/L. In another embodiment, the amount is 0.7 g/L. In another embodiment, the amount is 0.8 g/L. In another embodiment, the amount is 1 g/L. In another embodiment, the amount is more than 1 g/L.
[000168] In another embodiment, the citrate is present in an amount that is the molar equivalent of 0.6 g/L of 20 citric acid. In another embodiment, the amount of citrate present is the molar equivalent of about 0.6 g/L of citric acid. In another embodiment, the amount of citrate present is the molar equivalent of about 0.4 g/L of ferric citrate. In another embodiment, the amount of citrate present is the molar equivalent of 0.4 g/L of ferric citrate. In another embodiment, the amount of citrate present is the molar equivalent of 0.6 g/L of citric acid and 0.4 g/L of ferric citrate. In another embodiment, the amount of citrate present is the about
25 molar equivalent of 0.6 g/L of citric acid and 0.4 g/L of ferric citrate. In another embodiment, the amount of citrate present is the molar equivalent of citric acid in any of the amounts or ranges listed above for citrate. Each of the above amounts or ranges of citrate represents a separate embodiment of the present invention.
[000169] One or more of the adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide present in defined microbiological media of methods and compositions of the present
30 invention are, in another embodiment, present as the free compound. In another embodiment, one of the above compounds is present as a salt thereof. In another embodiment, one of the above compounds is present as a derivative thereof. In another embodiment, one of the above compounds is present as a hydrate thereof. In other embodiments, the salt, derivative, or hydrate can be any salt, derivative, or hydrate known P Cln /^^£Λhi"'M'#lbliti8w3-foπns of adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide represents a separate embodiment of the present invention.
[000170] The thiamine (vitamin B 1) present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in the form of thiamine HCl. In another
5 embodiment, the thiamine is present as any other salt, derivative, or hydrate of thiamine known in the art.
In another embodiment, another form of vitamin B 1 is substituted for thiamine. Each possibility represents a separate embodiment of the present invention.
[000171] In another embodiment, the thiamine is present in an amount of 4 mg/L (Examples). In another embodiment, the amount is about 0.5 mg/L. In another embodiment, the amount is 0.7 mg/L. In another 0 embodiment, the amount is 1 mg/L. In another embodiment, the amount is 1.5 mg/L. In another embodiment, the amount is 2 mg/L. In another embodiment, the amount is 3 mg/L. In another embodiment, the amount is 5 mg/L. In another embodiment, the amount is 6 mg/L. In another embodiment, the amount is 8 mg/L. In another embodiment, the amount is more than 8 mg/L. In another embodiment, the thiamine is present in an amount that is the molar equivalent of 4 mg/L of thiamine HCl. In another embodiment, the 5 thiamine is present in an amount that is the molar equivalent of thiamine HCl in one of the above amounts. Each possibility represents a separate embodiment of the present invention.
[000172] The pyridoxal (vitamin B6) present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in the form of pyridoxal HCl. In another embodiment, the pyridoxal is present as any other salt, derivative, or hydrate of pyridoxal known in the art. 0 In another embodiment, another form of vitamin B6 is substituted for pyridoxal. Each possibility represents a separate embodiment of the present invention.
[000173] In another embodiment, the pyridoxal is present in an amount of 4 mg/L (Examples). In another embodiment, the amount is any of the amounts or ranges listed above for thiamine. In another embodiment, the amount of pyridoxal present is the molar equivalent of about 4 mg/L of pyridoxal HCl. In another
25 embodiment, the amount of pyridoxal present is the molar equivalent of pyridoxal HCl in any of the amounts or ranges listed above for thiamine. Each possibility represents a separate embodiment of the present invention.
[000174] The adenine (vitamin B4) present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in the form of free adenine. In another
30 embodiment, the adenine is present as any other salt, derivative, or hydrate of adenine known in the art. In another embodiment, another form of vitamin B4 is substituted for adenine. Each possibility represents a separate embodiment of the present invention.
Figure imgf000035_0001
adenine is present in an amount of 0.25 mg/L (Examples). In another embodiment, the amount is any of the amounts or ranges listed above for cobalt. In another embodiment, the amount of adenine present is the molar equivalent of about 0.25 mg/L of free adenine. In another embodiment, the amount of adenine present is the molar equivalent of free adenine in any of the amounts or
5 ranges listed above for cobalt. Each possibility represents a separate embodiment of the present invention.
[000176] The biotin (vitamin B7) present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in the form of free biotin. In another embodiment, the biotin is present as any other salt, derivative, or hydrate of biotin known in the art. In another embodiment, another form of vitamin B7 is substituted for biotin. Each possibility represents a separate 0 embodiment of the present invention.
[000177] In another embodiment, the biotin is present in an amount of 2 mg/L (Examples). In another
* embodiment, the amount is any of the amounts or ranges listed above for thiamine. In another embodiment, the amount of biotin present is the molar equivalent of about 2 mg/L of free biotin. In another embodiment, the amount of biotin present is the molar equivalent of free biotin in any of the amounts or ranges listed 5 above for thiamine. Each possibility represents a separate embodiment of the present invention.
[000178] The para-aminobenzoic acid (vitamin B-x) present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in the form of free para- aminobenzoic acid. In another embodiment, the para-aminobenzoic acid is present as any other salt, derivative, or hydrate of para-aminobenzoic acid known in the art. In another embodiment, another form of 0 vitamin B-x is substituted for para-aminobenzoic acid. Each possibility represents a separate embodiment of the present invention.
[000179] In another embodiment, the para-aminobenzoic acid is present in an amount of 4 mg/L (Examples). In another embodiment, the amount is any of the amounts or ranges listed above for thiamine. In another embodiment, the amount of para-aminobenzoic acid present is the molar equivalent of about 4 mg/L of free 5 para-aminobenzoic acid. In another embodiment, the amount of para-aminobenzoic acid present is the molar equivalent of free para-aminobenzoic acid in any of the amounts or ranges listed above for thiamine. Each possibility represents a separate embodiment of the present invention.
[000180] The pantothenate (vitamin B5) present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in the form of calcium 0 pantothenate. In another embodiment, the pantothenate is present as any other salt, derivative, or hydrate of pantothenate known in the art. In another embodiment, another form of vitamin B5 is substituted for pantothenate. Each possibility represents a separate embodiment of the present invention. P QPβQϊ&l| B fflllfcef έϊritiWffiiilήl, the pantothenate is present in an amount of 4 mg/L (Examples). In another embodiment, the amount is any of the amounts or ranges listed above for thiamine. In another embodiment, the amount of pantothenate present is the molar equivalent of about 4 mg/L of calcium pantothenate. In another embodiment, the amount of pantothenate present is the molar equivalent of calcium pantothenate in
5 any of the amounts or ranges listed above for thiamine. Each possibility represents a separate embodiment of the present invention.
[000182] The nicotinamide (vitamin B3) present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, present in the form of free nicotinamide.
In another embodiment, the nicotinamide is present as any other salt, derivative, or hydrate of nicotinamide 0 known in the art. In another embodiment, another form of vitamin B3 is substituted for nicotinamide. Each possibility represents a separate embodiment of the present invention.
[000183] In another embodiment, the nicotinamide is present in an amount of 4 mg/L (Examples). In another embodiment, the amount is any of the amounts or ranges listed above for thiamine. In another embodiment, the amount of nicotinamide present is the molar equivalent of about 4 mg/L of free nicotinamide. In 5 another embodiment, the amount of nicotinamide present is the molar equivalent of free nicotinamide in any of the amounts or ranges listed above for thiamine. Each possibility represents a separate embodiment of the present invention.
[000184] 1 or more of the leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine present in defined microbiological media of methods and compositions of the present invention are, in 0 another embodiment, present as free AA. In another embodiment, one of the above compounds is present as a salt thereof. In another embodiment, one of the above compounds is present as a derivative thereof. In another embodiment, one of the above compounds is present as a hydrate thereof. In other embodiments, the salt, derivative, or hydrate can be any salt, derivative, or hydrate known in the art. Each possibility represents a separate embodiment of the present invention.
5 [000185] In another embodiment, 1 or more of the leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine is present in an amount of 0.4 g/L (Examples). In another embodiment, the amount is about 0.05 g/L. In another embodiment, the amount is 0.07 g/L. In another embodiment, the amount is 0.1 g/L. In another embodiment, the amount is 0.15 g/L. In another embodiment, the amount is 0.2 g/L. In another embodiment, the amount is 0.3 g/L. In another embodiment, the amount is 0.5 g/L. In another 0 embodiment, the amount is 0.6 g/L. In another embodiment, the amount is 0.8 g/L. In another embodiment, the amount is more than 0.8 g/L. In another embodiment, one or more of these AA is present in an amount that is the molar equivalent of 0.4 g/L of the free AA. In another embodiment, the amount is the molar equivalent of thiamine the free AA in one of the above amounts. Each possibility represents a separate lipbMϊSl@t|Qf,thφti&β#1ention.
[000186] In another embodiment, a defined media of methods and compositions of the present invention contains 2 of the amino acids (AA) listed in the second section of Table IB, e.g. leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine. In another embodiment, the defined media contains 1 of these AA. In another embodiment, the defined media contains 3 of these AA. In another embodiment, the media contains 4 of these AA. In another embodiment, the media contains 5 of these AA. In another embodiment, the media contains 6 of these AA. In another embodiment, the defined media contains at least 1 of these AA. In another embodiment, the defined media contains at least 2 of these AA. In another embodiment, the defined media contains at least 3 of these AA. In another embodiment, the media contains at least 4 of these AA. In another embodiment, the media contains at least 5 of these AA. In another embodiment, the media contains at least 6 of these AA. In another embodiment, the media contains all of these AA. In another embodiment, the media comprises 1 of these AA (i.e. contains at least 1, but may contain more, of these AA). In another embodiment, the media comprises 2 of these AA. In another embodiment, the media comprises 3 of these AA. In another embodiment, the media comprises 4 of these AA. In another embodiment, the media comprises 5 of these AA. In another embodiment, the media comprises 6 of these AA. Each possibility represents a separate embodiment of the present invention.
[000187] In another embodiment, a defined media of methods and compositions of the present invention contains 2 of the vitamins listed in the third section of Table IB, e.g. adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide. In another embodiment, the defined media contains 1 of these vitamins. In another embodiment, the defined media contains 3 of these vitamins. In another embodiment, the media contains 4 of these vitamins. In another embodiment, the media contains 3 of these vitamins. In another embodiment, the media contains 5 of these vitamins. In another embodiment, the media contains 6 of these vitamins. In another embodiment, the defined media contains at least 1 of these vitamins. In another embodiment, the defined media contains at least 2 of these vitamins. In another embodiment, the defined media contains at least 3 of these vitamins. In another embodiment, the media contains at least 4 of these vitamins. In another embodiment, the media contains at least 3 of these vitamins. In another embodiment, the media contains at least 5 of these vitamins. In another embodiment, the media contains at least 6 of these vitamins. In another embodiment, the media contains all of these vitamins. In another embodiment, the media comprises 1 of these vitamins (i.e. contains at least 1, but may contain more, of these vitamins). In another embodiment, the media comprises 2 of these vitamins. In another embodiment, the media comprises 3 of these vitamins. In another embodiment, the media comprises 4 of these vitamins. In another embodiment, the media comprises 5 of these vitamins. In another embodiment, the media comprises 6 of these vitamins. Each possibility represents a separate embodiment of the present invention. P1 itrøOJr-δi&Jϊi SiJϊiher lliMdiMiA, a defined media of methods and compositions of the present invention contains 2 of the trace elements listed in the fourth section of Table IB, e.g. cobalt, copper, boron, manganese, molybdenum, zinc, iron, calcium, and citrate. In another embodiment, the defined media contains 1 of these trace elements. In another embodiment, the defined media contains 3 of these trace 5 elements. In another embodiment, the media contains 4 of these trace elements. In another embodiment, the media contains 3 of these trace elements. In another embodiment, the media contains 5 of these trace elements. In another embodiment, the media contains 6 of these trace elements. In another embodiment, the media contains 7 of these trace elements. In another embodiment, the media contains 8 of these trace elements. In another embodiment, the defined media contains at least 1 of these trace elements. In another 0 embodiment, the defined media contains at least 2 of these trace elements. In another embodiment, the defined media contains at least 3 of these trace elements. In another embodiment, the media contains at least 4 of these trace elements. In another embodiment, the media contains at least 3 of these trace elements. In another embodiment, the media contains at least 5 of these trace elements. In another embodiment, the media contains at least 6 of these trace elements. In another embodiment, the media 5 contains at least 7 of these trace elements. In another embodiment, the media contains at least 8 of these trace elements. In another embodiment, the media contains all of these trace elements. In another embodiment, the media comprises 1 of these trace elements (i.e. contains at least 1, but may contain more, of these trace elements). In another embodiment, the media comprises 2 of these trace elements. In another embodiment, the media comprises 3 of these trace elements. In another embodiment, the media comprises 4 0 of these trace elements. In another embodiment, the media comprises 5 of these trace elements. In another embodiment, the media comprises 6 of these trace elements. In another embodiment, the media comprises 7 of these trace elements. In another embodiment, the media comprises 8 of these trace elements. Each possibility represents a separate embodiment of the present invention.
[000189] In another embodiment, a defined media of methods and compositions of the present invention 5 contains more than 1 component from 2 of the above classes of components; e.g more than 1 of the AA listed in the second section of Table IB, and more than 1 of the vitamins listed in the third section. In another embodiment, the media contains more than 2 components from 2 of the above classes of components; e.g more than 2 of the AA listed in the second section of Table IB, and more than 2 of the trace elements listed in the fourth section. In another embodiment, the media contains more than 3 0 components from 2 of the above classes. In another embodiment, the media contains more than 4 components from 2 of the above classes. In another embodiment, the media contains more than 5 components from 2 of the above classes. In another embodiment, the media contains more than 6 components from 2 of the above classes. In another embodiment, the media contains all of the components from 2 of the above classes. jtøόWAjb&iiSeit, a defined media of methods and compositions of the present invention contains more than 1 component from all of the above classes of components (e.g. more than 1 component each from AA, vitamins and trace elements). In another embodiment, the media contains more than 2 components from all of the above classes of components. In another embodiment, the media contains more than 3 components from all of the above classes. In another embodiment, the media contains more than 4 components from all of the above classes. In another embodiment, the media contains more than all components from 2 of the above classes. In another embodiment, the media contains more than 6 components from all of the above classes. In another embodiment, the media contains all of the components from all of the above classes.
[00019I]In another embodiment, the media contains any other combination of numbers of components from each of the above classes; e.g. 2 AA, 2 vitamins, and 3 trace elements; 3 AA, 3 vitamins, and 2 trace elements; 2 AA, 3 vitamins, and all of the trace elements, etc.
[000192] Each combination of numbers of components from each of the above classes represents a separate embodiment of the present invention.
[000193] In another embodiment, a defined media of methods and compositions of the present invention consists of 1 of the above recipes, mixtures of components, lists of components in specified amounts, or combinations of numbers of components from each of the above classes. Each possibility represents a separate embodiment of the present invention.
[000194] The divalent cation present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, Mg. In another embodiment, the divalent cation is Ca. In another embodiment, the divalent cation is any other divalent cation known in the art. Mg can, in other embodiments, be present in any form of Mg known in the art, e.g. MgSO4 (Examples). In another embodiment, the divalent cation is present in an amount that is the molar equivalent of about 0.41 g/mL. In other embodiments, the divalent cation is present in an other effective amount, as known to those skilled in the art.
[000195] The pH buffer present in defined microbiological media of methods and compositions of the present invention is, in another embodiment, 3-(N-Morpholino)-propanesulfonic acid (MOPS). In another embodiment, the pH buffer is phosphate buffer. In another embodiment, the pH buffer is potassium phosphate (e.g. KH2PO4, and/or K2HPO4)-based or sodium phosphate (e.g. Na2HPO4 and/or NaH2PO4)- based, or is a mixture thereof. In another embodiment, the pH buffer comprises different phosphate salts. In another embodiment, the pH buffer is any other compound known in the art that has pH buffer capacity. Mg can, in other embodiments, be present in any form of Mg known in the art, e.g. MgSO4 (Examples). In another embodiment, the pH buffer is present in an amount that is the molar equivalent of about 0.41 g/mL. IP" £;]tolδ!th^lfcSlWitoeΗ^i*lil:pH'bIffer is present in another effective amount, as known to those skilled in the art. Each possibility represents a separate embodiment of the present invention.
[000196] In another embodiment, a nitrogen source other than glutamine is utilized in defined media of the present invention. In another embodiment, the nitrogen source is another amino acid. In another embodiment, the nitrogen source is another source of peptides or proteins (e.g. casitone or casamino acids).
In another embodiment, the nitrogen source is ammonium chloride. In another embodiment, the nitrogen source is ammonium nitrate. In another embodiment, the nitrogen source is ammonium sulfate. In another embodiment, the nitrogen source is another ammonium salt. In another embodiment, the nitrogen source is any other nitrogen source known in the art. Each possibility represents a separate embodiment of the present invention.
[000197] In another embodiment, a defined microbiological media of methods and compositions of the present invention does not contain a component derived from an animal source. In another embodiment, the media does not contain an animal-derived component of incompletely defined composition (e.g. yeast extract, bacto-tryptone, etc.). In another embodiment, the media does not contain an animal-derived protein. In another embodiment, the media does not contain an animal-derived carbohydrate. In another embodiment, the media does not contain an animal-derived protein source. In another embodiment, the media does not contain an animal-derived carbohydrate source. Each possibility represents a separate embodiment of the present invention.
[000198] In another embodiment, "defined microbiological media" refers to a media whose components are known. In another embodiment, the term refers to a media that does not contain a component derived from an animal source. In another embodiment, the term refers to a media whose components have been chemically characterized. Each possibility represents a separate embodiment of the present invention.
[000199] In another embodiment, a defined media of methods and compositions of the present invention is prepared by dissolving the iron and magnesium salts separately in water and heating the solutions to 60° C. In another embodiment, this preparation method prevents iron precipitation. In another embodiment, the solutions are subsequently filter-sterilized and simultaneously added to the fermenter culture medium. In another embodiment, the defined media is prepared by any other method disclosed in the Examples herein. In another embodiment, the defined media is prepared by any other method known in the art. Each possibility represents a separate embodiment of the present invention.
[000200] In another embodiment, a defined media of methods and compositions of the present invention is capable of supporting growth of the Listeria strain to about 1.1 x 1010 CFU/mL (e.g. when grown in flasks; Examples). In another embodiment, the defined media supports growth to about 1.1 x 1010 CFU/mL (e.g. when grown in fermenters; Examples). In another embodiment, the defined media supports growth to about P C
Figure imgf000041_0001
in fermenters; Examples). In- another embodiment, the defined media supports growth of viable bacteria (e.g. bacteria that can be cryopreserved without significant loss of viability) to about 3 x 1010 CFU/mL (e.g. when grown in fermenters; Examples). In another embodiment, the defined media supports growth to an ODeoo of about 4.5 (Examples). In other embodiments, the defined 5 media supports growth to another OD6O0 value enumerated herein. In other embodiments, the defined media supports growth to another CFU/mL value enumerated herein. In another embodiment, the defined media supports growth to a density approximately equivalent to that obtained with TB. In another embodiment, the defined media supports growth to a density approximately equivalent to that obtained with LB. Each possibility represents a separate embodiment of the present invention.
0 [000201 ] In another embodiment, a defined media of methods and compositions of the present invention is capable of supporting a growth rate of the Listeria strain of about 0.25 h"1. (Examples). In another embodiment, the growth rate is about 0.15 h"1. In another embodiment, the growth rate is about 0.2 h"1. In another embodiment, the growth rate is about 0.3 h"1. In another embodiment, the growth rate is about 0.4 h"1. In another embodiment, the growth rate is about 0.5 h"1. In another embodiment, the growth rate is 5 about 0.6 h" . In another embodiment, the defined media supports a growth rate approximately equivalent to that obtained with TB. In another embodiment, the defined media supports a growth rate approximately equivalent to that obtained with LB. Each possibility represents a separate embodiment of the present invention.
[000202] In another embodiment, the present invention provides a method of determining a presence of a 0 suspected contaminant in a stock of a Listeria strain, comprising testing an aliquot of the stock for growth of the suspected contaminant on a minimal media containing a minimal salts solution, a carbohydrate, a divalent cation, and thiamine, thereby determining a presence of a suspected contaminant in a stock of a Listeria strain (Example 6).
[000203] As provided herein, the results of the present invention identify effective methods for 5 characterizing Listeria strains in various ways. Such methods have utility in determining the purity of
Listeria cultures and stocks (e.g. frozen stocks) and in detecting the presence of potential contaminants.
[000204] The minimal media utilized in the above method, is, in another embodiment, a liquid media. In another embodiment, the minimal media is a soft agar. In another embodiment, the minimal media is an agar of regular consistency (e.g. not especially soft). In another embodiment, the minimal media does not 0 contain a source of nitrogen other than thiamine. In another embodiment, the minimal media does not contain an energy source other than glucose (or another carbohydrate) and thiamine. Each possibility represents a separate embodiment of the present invention. I^flOiJQSQJSϊJlliiHlthό^liybfflffiiit, the thiamine is thiamine hydrochloride. In another embodiment, the thiamine is any other form or salt of thiamine known in the art. Each possibility represents a separate embodiment of the present invention.
[000206] In another embodiment, the present invention provides a method of determining a presence of a 5 suspected contaminant in a stock of a Listeria strain, comprising testing an aliquot of the stock for growth of the suspected contaminant on a mannitol salt agar plate, thereby determining a presence of a suspected contaminant in a stock of a Listeria strain (Example 6).
[000207] In another embodiment, the mannitol salt agar is obtained as poured plates (e.g. from bioMerieux (Durham, NC). In another embodiment, the mannitol salt agar is obtained as a mixture, ready to be heated 0 and poured. In another embodiment, the mannitol salt agar is obtained as a powder. Each possibility represents a separate embodiment of the present invention.
[000208] In another embodiment, the contaminant whose presence is tested for is B subtilis. In another embodiment, the contaminant is a micrococcus. In another embodiment, the contaminant is E. coli. In another embodiment, the contaminant is C. albicans. In another embodiment, the contaminant is 5 Staphylococcus. In another embodiment, the contaminant is any other contaminant known in the art. In another embodiment, the contaminant or contaminants whose presence is tested for are contaminants previously identified in the production facility used to grow or produce the Listeria strain. In another embodiment, the contaminant or contaminants whose presence is tested for are environmental isolates from the production facility used to grow or produce the Listeria strain or the local environment. Each 0 possibility represents a separate embodiment of the present invention.
[000209] In another embodiment, the Staphylococci whose presence is tested for is 5. aureus. In another embodiment, the Staphylococci is any other type of Staphylococci known in the art. Each possibility represents a separate embodiment of the present invention.
[000210] Methods for identifying contaminants are well known in the art. For example, B subtilis is 5 identified by its gram-positive sporing rod. S. aureus is identified by its gram-positive coccus (GPC). E. coli is identified by its gram-negative rod, etc. These methods are well known in the art.
[000211] In another embodiment, methods of the present invention that test for the presence of a potential contaminant utilize counter selection. "Counter selection" refers, in another embodiment, to inhibiting the growth of the desired Listeria strain while allowing potential contaminant organisms to grow. In another 0 embodiment, counter selection utilizes combinations of various media and supplements. In another embodiment, the use of such combinations enables testing for several potential contaminants. Each possibility represents a separate embodiment of the present invention. P1 CCD0FO.21B3 S !afeSlherftiiB|>S3βe1iit, the present invention provides a method for hemolysis testing of a bacterial stock containing a Listeria strain, comprising adding the strain to a plate comprising a lower layer of solid or semi-solid media and an upper layer of solid or semi-solid media, wherein the lower layer comprises a growth media and the upper layer comprises about 5% blood and a bacterial growth media,
5 thereby testing a hemolysis of a bacterial stock containing a Listeria strain. In another embodiment, the bacterial growth media is a defined media. In other embodiments, the bacterial growth media is any defined media of the present invention. In other embodiments, the bacterial growth media is any defined media known in the art. Each possibility represents a separate embodiment of the present invention.
[000213] In another embodiment, the blood is sheep' s blood. In another embodiment, the blood is any other 0 type of blood known in the art. Each possibility represents a separate embodiment of the present invention.
[000214] The upper layer of the plate is, in another embodiment, a maximum of 5 millimeters (mm) in thickness. In another embodiment, the thickness is a maximum of 4 mm. In another embodiment, the thickness is a maximum of 3 mm. In another embodiment, the thickness is a maximum of 6 mm. In another embodiment, the thickness is 5 mm. In another embodiment, the thickness is 6 mm. In another 5 embodiment, the thickness is 4 mm. In another embodiment, the thickness is 3 mm.
[000215] The lower layer of the plate is, in another embodiment, a maximum of 5 millimeters (mm) in thickness. In another embodiment, the thickness is a maximum of 4 mm. In another embodiment, the thickness is a maximum of 3 mm. In another embodiment, the thickness is a maximum of 6 mm. In another embodiment, the thickness is 5 mm. In another embodiment, the thickness is 6 mm. In another 0 embodiment, the thickness is 4 mm. In another embodiment, the thickness is 3 mm.
[000216] The overall thickness of agar in the plate is, in other embodiments, any of the thicknesses enumerated above.
[000217] In another embodiment, the plate has a single layer of agar (e.g. containing blood mixed with a bacterial growth media). The thickness of the layer agar is, in other embodiments, any of the thicknesses 5 enumerated above.
[000218] Each type of plates represents a separate embodiment of the present invention.
[000219] In another embodiment, the present invention provides a method of characterizing a Listeria strain, comprising performing a method of the present invention. In another embodiment, the present invention provides a method of testing a Listeria culture, stock or cell bank for contamination, comprising 0 performing a method of the present invention.
[000220] In another embodiment, the method of characterizing a Listeria strain or testing a Listeria culture, P1C Stbό¥JSIl3f ftjaflέW'lbiftSHlnation comprises testing the growth performance using some or all of the growth media in Table 2.
[000221] In another embodiment, the method of characterizing a Listeria strain or testing a. Listeria culture, stock or cell bank for contamination comprises performing a catalase test on the Listeria culture, stock or 5 cell bank (Example 6).
[000222] In another embodiment, the method of characterizing a Listeria strain or testing a Listeria culture, stock or cell bank for contamination comprises performing mast-ring testing on the Listeria culture, stock or cell bank (Example 6).
[000223] In another embodiment, the method of characterizing a Listeria strain or testing a Listeria culture, 0 stock or cell bank for contamination comprises testing the Listeria culture, stock or cell bank with a test strip or kit (e.g. an API test strip) (Example 6).
[000224] In another embodiment, the method of the present invention of characterizing a Listeria strain or testing a Listeria culture, stock or cell bank for contamination further comprises testing the antibiotic resistance (e.g. resistance to CAP, streptomycin, and/or a combination thereof) of the Listeria culture, stock 5 or cell bank (Example 6).
[000225] In another embodiment, the method of the present invention of characterizing a Listeria strain or testing a Listeria culture, stock or cell bank for contamination further comprises testing or observing the motility of the Listeria culture, stock or cell bank (Example 6).
[000226] In another embodiment, the method of the present invention of characterizing a Listeria strain or 0 testing a Listeria culture, stock or cell bank for contamination further comprises testing the auxotrophic growth requirements of the Listeria culture, stock or cell bank (Example 6).
[000227] In another embodiment, the method of the present invention of characterizing a Listeria strain or testing a Listeria culture, stock or cell bank for contamination comprises a combination of 2 of the above methods. In another embodiment, the method comprises a combination of 3 of the above methods. In 5 another embodiment, the method comprises a combination of 4 of the above methods. In another embodiment, the method comprises a combination of 5 of the above methods. In another embodiment, the method comprises a combination of 6 of the above methods. In another embodiment, the method comprises a combination of 7 of the above methods. In another embodiment, the method comprises a combination of more than 7 of the above methods. Each possibility represents a separate embodiment of the present 0 invention.
[000228] In another embodiment, the present invention provides a method of plasmid extraction from P" C
Figure imgf000045_0001
performing a method of the present invention.
[000229] In another embodiment, the present invention provides a method of testing the antibiotic resistance of a Listeria strain, comprising replica plating as described in Example 1.
[000230] In another embodiment, the present invention provides a method of determining the presence of a
5 potential contaminant in a Listeria stock, comprising testing the growth of the Listeria stock on a minimal media lacking cysteine, as described in Example 6. In another embodiment, the present invention provides a method of determining the presence of a potential contaminant in a Listeria stock, comprising testing the growth of the Listeria stock on a minimal media lacking methionine, as described in Example 6.
[00023I]In another embodiment, the media concentration of CAP in methods of the present invention is 0 about 34 μg/ml. In another embodiment, the concentration of CAP is about 5 μg/ml. In another embodiment, the concentration is about 7 μg/ml. In another embodiment, the concentration is about 9 μg/ml. In another embodiment, the concentration is about 11 μg/ml. In another embodiment, the concentration is about 14 μg/ml. In another embodiment, the concentration is about 17 μg/ml. In another embodiment, the concentration is about 20 μg/ml. In another embodiment, the concentration is about 25 5 μg/ml. In another embodiment, the concentration is about 30 μg/ml. In another embodiment, the concentration is about 40 μg/ml. In another embodiment, the concentration is about 45 μg/ml. In another embodiment, the concentration is about 50 μg/ml. In another embodiment, the concentration is about 60 μg/ml.
[000232] In another embodiment, the CAP concentration is about 5-10 μg/ml. In another embodiment, the 0 concentration is about 10-15 μg/ml. In another embodiment, the concentration is about 15-20 μg/ml. In another embodiment, the concentration is about 20-25 μg/ml. In another embodiment, the concentration is about 25-30 μg/ml. In another embodiment, the concentration is about 30-35 μg/ml. In another embodiment, the concentration is about 35-40 μg/ml. In another embodiment, the concentration is about
40-45 μg/ml. In another embodiment, the concentration is about 45-50 μg/ml. In another embodiment, the 5 concentration is about 5-15 μg/ml. In another embodiment, the concentration is about 10-20 μg/ml. In another embodiment, the concentration is about 15-25 μg/ml. In another embodiment, the concentration is about 20-30 μg/ml. In another embodiment, the concentration is about 30-40 μg/ml. In another embodiment, the concentration is about 40-50 μg/ml. In another embodiment, the concentration is about
50-60 μg/ml. In another embodiment, the concentration is about 10-25 μg/ml. In another embodiment, the 0 concentration is about 20-35 μg/ml. In another embodiment, the concentration is about 25-40 μg/ml. In another embodiment, the concentration is about 10-30 μg/ml. In another embodiment, the concentration is about 20-40 μg/ml. In another embodiment, the concentration is about 20-50 μg/ml. Each possibility of the present invention.
[000233] The concentration of streptomycin in media utilized in methods of the present invention is, in another embodiment, about 25 μg/ml. In other embodiments, the streptomycin concentration is any of the
CAP concentrations enumerated above. In another embodiment, the streptomycin concentration is any streptomycin concentration known in the art. Each possibility represents a separate embodiment of the present invention.
[000234] The concentration of alanine in media utilized in methods of the present invention is, in another embodiment, about 100 μg/ml (Examples). In another embodiment, the concentration is about 50 μg/ml. In another embodiment, the concentration is about 60 μg/ml. In another embodiment, the concentration is about 80 μg/ml. In another embodiment, the concentration is about 120 μg/ml. In another embodiment, the concentration is about 150 μg/ml. In another embodiment, the concentration is about 200 μg/ml. In another embodiment, the concentration is about 250 μg/ml. In another embodiment, the concentration is about 300 μg/ml. In another embodiment, the concentration is 60-100 μg/ml. In another embodiment, the concentration is 80-120 μg/ml. In another embodiment, the concentration is 100-150 μg/ml. In another embodiment, the concentration is 150-200 μg/ml. In another embodiment, the concentration is 200-300 μg/ml. In other embodiments, the alanine concentration is any of the concentrations enumerated above for CAP. In another embodiment, the alanine concentration is any alanine concentration known in the art. Each possibility represents a separate embodiment of the present invention.
[000235] Each of the above combinations of numbers of components represents a separate embodiment of the present invention.
[000236] In another embodiment, the Listeria strain of methods and compositions of the present invention has a mutation in a chromosomal copy of a gene essential for growth, viability or virulence thereof and an exogenous copy of said gene, a fragment thereof, a homologue of said gene, or a fragment thereof.
[000237] In another embodiment, the gene is a transcription factor. In another embodiment, the gene is necessary for synthesis of a metabolite essential for growth or viability of the Listeria strain. In another embodiment, the gene is prfA. prfA regulates the expression of a number of L. monocytogenes virulence factors. In another embodiment, the gene is an alanine racemase (dal) gene. In another embodiment, the gene is a D-amino acid aminotransferase gene (dat) gene. In another embodiment, a vector contained in the Listeria strain expresses a fragment of one of the above proteins. In another embodiment, the vector expresses a homologue of one of the above proteins. In another embodiment, the vector expresses a variant of one of the above proteins. In another embodiment, the vector comprises a nucleic acid molecule, according to one of the definitions below or one of the definitions in the art. Each possibility represents a MΪsent invention. -«
[000238] In another embodiment of the present invention, "nucleic acids" refers to a string of at least two base-sugar-phosphate combinations. The term includes, in another embodiment, DNA and RNA. "Nucleotides" refers, in another embodiment, to the monomeric units of nucleic acid polymers. RNA may be, in another embodiment, in the form of a tRNA (transfer RNA), snRNA (small nuclear RNA), rRNA (ribosomal RNA), mRNA (messenger RNA), anti-sense RNA, small inhibitory RNA (siRNA), micro RNA (miRNA) and ribozymes. The use of siRNA and miRNA has been described (Caudy AA et al, Genes & Devel 16: 2491-96 and references cited therein). DNA may be in form of plasmid DNA, viral DNA, linear DNA, or chromosomal DNA or derivatives of these groups. In addition, these forms of DNA and RNA may be single, double, triple, or quadruple stranded. The term also includes, in another embodiment, artificial nucleic acids that may contain other types of backbones but the same bases. In another embodiment, the artificial nucleic acid is a PNA (peptide nucleic acid). PNA contain peptide backbones and nucleotide bases and are able to bind, in another embodiment, to both DNA and RNA molecules. In another embodiment, the nucleotide is oxetane modified. In another embodiment, the nucleotide is modified by replacement of one or more phosphodiester bonds with a phosphorothioate bond. In another embodiment, the artificial nucleic acid contains any other variant of the phosphate backbone of native nucleic acids known in the art. The use of phosphothiorate nucleic acids and PNA are known to those skilled in the art, and are described in, for example, Neilsen PE, Curr Opin Struct Biol 9:353-57; and Raz NK et al Biochem Biophys Res Commun. 297:1075-84. The production and use of nucleic acids is known to those skilled in art and is described, for example, in Molecular Cloning, (2001), Sambrook and Russell, eds. and Methods in
Enzymology: Methods for molecular cloning in eukaryotic cells (2003) Purchio and G. C. Fareed. Each nucleic acid derivative represents a separate embodiment of the present invention.
[000239] In another embodiment, the mutation in the chromosomal copy of the gene is a deletion mutation. In another embodiment, the mutation reduces an expression or activity of a product of said gene.
[000240] The exogenous copy of the gene is, in another embodiment, contained in a vector. In another embodiment, the vector is a plasmid. In another embodiment, the vector does not integrate into the genome of the Listeria strain. In another embodiment, the vector contains a Listeria origin of replication. In another embodiment, the vector further comprises a gene encoding a heterologous antigen. In another embodiment, the vector further comprises an antibiotic resistance gene. In another embodiment, the vector does not contain an antibiotic resistance gene.
[000241] In another embodiment, the plasmid carried by the Listeria strain of methods and compositions of the present invention is retained in the absence of antibiotic selection pressure for an extended period of time. In another embodiment, the extended period is 40 generations. In another embodiment, the period is P C !D.getolStβ^iιIn*Mdftfi6&&diment, the period is 25 generations. In another embodiment, the period is 30 generations. In another embodiment, the period is 35 generations. In another embodiment, the period is 50 generations. In another embodiment, the period is 60 generations. In another embodiment, the period is 80 generations. In another embodiment, the period is 100 generations. In another embodiment, the period
5 is 150 generations. In another embodiment, the period is 200 generations. In another embodiment, the period is 300 generations. In another embodiment, the period is 400 generations. In another embodiment, the period is 500 generations. In another embodiment, the period is more than 500 generations.
[000242] Each type of Listeria strains represents a separate embodiment of the present invention. Each of the above methods may be combined with each of the above types of Listeria strains, and each 0 combination represents a separate embodiment of the present invention.
[000243] In another embodiment, the present invention provides a kit comprising a reagent utilized in performing a method of the present invention. In another embodiment, the present invention provides a kit comprising a composition, tool, or instrument of the present invention.
[000244] In another embodiment, a method of the present invention utilizes an analog of 1 of the media 5 components listed above. In another embodiment, the method utilizes a derivative of 1 of the above media components. In another embodiment, the method utilizes an isomer of 1 of the above media components. In another embodiment, the method utilizes a metabolite of 1 of the above media components. In another embodiment, the method utilizes a salt of 1 of the above media components. In another embodiment, the method utilizes a hydrate of 1 of the above media components. In another embodiment, the method utilizes 0 an N-oxide of 1 of the above media components. Each possibility represents a separate embodiment of the present invention.
EXPERIMENTAL DETAILS SECTION
EXAMPLE 1: A Prf A-CONT AINING PLASMID IS STABLE IN A L. MONOCYTOGENES STRAIN WITH A PrfA DELETION IN THE ABSENCE OF ANTIBIOTICS
5 MATERIALS AND EXPERIMENTAL METHODS
Plasmid
[000245] pGG55 is a 12876 bp plasmid containing a CAP resistance gene, Listeria origin of replication, the prfA gene, and a haemolysin A/E7 fusion protein (Figure 1).
Bacteria 0 [000246] L. monocytogenes (LM) strain XFL7 contains a 300 base pair deletion in the prfA gene. XFL7 carries pGG55, which partially restores virulence and confers CAP resistance, and is described in United P C^te'^f Irø fippliyMΦljifflbllcation No. 200500118184, which is incorporated herein by reference.
Protocol for plasmid extraction from Listeria
[000247] 1 mL of an Lm-LLO-E7 research working cell bank vial was inoculated into 27 mL BHl medium containing 34 μg/mL CAP and grown for 24 hours at 37°C and 200 rpm.
5 [000248] Seven 2.5 mL samples of the culture were pelleted (15000 rpm for 5 minutes), and pellets were incubated at 370C with 50 μl lysozyme solution for varying amounts of time, from 0-60 minutes.
[000249] Lysozyme solution:
- 29 μl 1 M dibasic Potassium Phosphate
- 21 μl 1 M monobasic Potassium Phosphate 0 - 500 μl 40% Sucrose (filter sterilized through 0.45 /μm filter)
- 450 μl water
- 60 μl lysozyme (50 mg/mL)
[000250] After incubation with the lysozyme, the suspensions were centrifuged as before and the supernatants discarded. Each pellet was subjected to plasmid extraction by a modified version of the 5 QIAprep Spin Miniprep Kit® (Qiagen, Germantown, Maryland) protocol. Changes to the protocol were as follows:
1. Volumes of buffers PI, P2 and N3 were all increased threefold to allow complete lysis of the increased biomass.
2. 2 mg/mL of lysozyme was added to the resuspended cells before the addition of P2. The lysis 0 solution was then incubated at 37°C for 15 minutes before neutralization.
3. Plasmid DNA was resuspended in 30 μL rather than 50 μL to increase the concentration.
[000251] In other experiments, cells were incubated for 15 min in Pl buffer + Lysozyme, then incubated with P2 (lysis buffer) and P3 (neutraliztion buffer) at room temperature (rt).
[000252] Equal volumes of isolated plasmid DNA from each subculture were electrophoresed on an 0.8% 5 agarose gel stained with ethidium bromide (EtBr) and visualized for any signs of structural or segregation instability.
[000253] The results showed that plasmid extraction from Lm-LLO-E7 increases in efficiency with increasing incubation time with lysozyme, up to an optimum incubation time of 50 minutes. p<
Figure imgf000050_0001
effective method for plasmid extraction from Listeria vaccine strains.
Replica plating
[000255] Dilutions of the original culture were plated onto plates containing LB or TB agar in the absence or presence of 34 μg/mL CAP. Differences between counts on selective and non-selective agar were used to 5 determine whether there was any gross segregational instability of the plasmid.
RESULTS
[000256] The genetic stability (i.e. the extent to which the plasmid is retained by or remains stably associated with the bacteria in the absence of selection pressure; e.g. antibiotic selection pressure) of the pGG55 plasmid in LM strain XFL7 in the absence of antibiotic was assessed by serial sub-culture in both 0 Luria-Bertani media (LB: 5 g/L NaCl, 10 g/ml soy peptone, 5 g/L yeast extract) and Terrific Broth media (TB: 10 g/L glucose, 11.8 g/L soy peptone, 23.6 g/L yeast extract, 2.2 g/L KH2PO4, 9.4 g/L K2HPO4), in duplicate cultures. 50 mL of fresh media in a 250 mL baffled shake flask was inoculated with a fixed number of cells (1 ODmL), which was then subcultured at 24 hour intervals. Cultures were incubated in an orbital shaker at 370C and 200 rpm. At each subculture the OD6Oo was measured and used to calculate the 5 cell doubling time (or generation) elapsed, until 30 generations were reached in LB and 42 in TB. A known number of cells (15 ODmL) at each subculture stage (approximately every 4 generations) were pelleted by centrifugation, and plasmid DNA was extracted. Plasmid DNA was subjected to agarose gel electrophoresis and EtBr staining. While the amount of plasmid in the preps varied slightly between samples, the overall trend was a constant amount of plasmid with respect to the generational number of the 0 bacteria (Figures 2A-2B). Thus, pGG55 exhibited stability in strain XFL7, even in the absence of antibiotic.
[000257] Plasmid stability was also monitored during the stability study by replica plating on agar plates at each stage of the subculture. Consistent with results from the agarose gel electrophoresis, there was no overall change in the number of plasmid-containing cells throughout the study in either LB or TB liquid 5 culture (Figures 3 and 4, respectively).
[000258] Thus, prfA-encoding plasmids exhibit are stable in the absence of antibiotic in Listeria strains containing prfA mutations.
EXAMPLE 2: OPTIMIZATION OF CRYOPRESERVATION CONDITIONS FOR LISTERIA
VACCINE STRAINS
0 MATERIALS AND EXPERIMENTAL METHODS
[000259] An LB Research Working Cell Bank (RWCB) was produced by the following protocol: 5 ODmL |%.^lf®||i|:|^t'ttf.|)i€iiiJi$ dE the OD600 reading and the volume of culture in ml) samples were taken from 20OmL cultures grown in LB or TB with 34 μg/mL CAP in 2L shake flasks at several different OD6O0. Samples were cryopreserved using 20% v/v glycerol and frozen at less than -700C for one day, then were thawed and used to inoculate 50 mL of the same media used for the starter cultures. Initial growth kinetics of these cultures was measured by monitoring the OD6oo and comparing the growth curves for any sign of lag phase.
[000260] An RWCB containing 50 vials of Lm-LL0-E7, cryopreserved in mid-log phase, was produced. Cells from the original glycerol stocks, CTL 2003#0810N, were streaked out onto an LB-agar plate with 34 μg/mL CAP. After a 24-hour incubation, single colonies were selected and grown in 5mL of LB-CAP for 24 hours at 37°C, which was then used to inoculate 50 mL of LB-CAP. At an OD6O0 of 0.7, cells were cryopreserved after adding glycerol to 20% v/v, dividing into 50 1-mL aliquots in sterile cryovials, and storing below -700C.
RESULTS
[000261] To determine the optimum culture density at which to cryopreserve an XFL7 strain carrying the pGG55 plasmid (referred to as Lm-LLO-E7), bacteria were grown in 200 mL (milliliter) baffled shake flasks in either LB or TB. At various 600 A optical densities (OD6O0), 5 ODmL aliquots were removed, glycerol was added to 20% v/v, and the cells were frozen at -700C. After 24 h (hours) storage at -700C, samples were thawed and used to inoculate 50 mL of fresh media of the same type (LB or TB), and initial growth kinetics of cultures were monitored. As depicted in Figure 5, all the cultures immediately entered exponential growth without showing any signs of a lag phase. Thus, among the OD6oo utilized, the highest
OD6O0 (0.8 for LB and 1.1 for TB) were determined to be optimum for short-term cryopreservation.
[000262] Next, an LB Research Working Cell Bank (RWCB) was produced by adding 20% v/v glycerol to an 0.8 OD6O0 culture and storing below -7O0C (see Materials and Experimental Methods section). Viability of the RWCB was determined before freezing by replica plating, as described for Example 1 , after defined storage intervals. As depicted in Figure 6, the viability in the first LB cell bank appeared to drop from 1 x
109 to 3 x 108 CFU/mL following storage at -700C.
[000263] A second and a third LB RWCB were generated, this time at OD600 of 0.72 and 0.74, respectively. These 2 RWCB exhibited viabilities ranging between 8 and 12 x 108 CFU/mL, with no decrease in viability throughout the course of the study. The difference between these RWCB and the first one is the difference in the OD600 at the time of cryopreservation. Thus, an OD of 0.8 corresponds to the end of exponential growth and the beginning of stationary phase of Lm-LLO-E7. Consequently, an OD600 of 0.7 was used subsequently. The second RWCB was assigned the number 2003#0933A and was utilized to inoculate the cultures used in subsequent experiments.
Figure imgf000052_0001
was generated from cultures at an OD60O of 1.1. The number of viable cells remained stable at 1 x 109 CFU/mL (Figure 7).
[000265] Thus, methods of the present invention (e.g. conditions of 20% glycerol and OD600 of 0.7) are efficacious for generating cryopreserved Listeria vaccine strains and stocks with stable long-term viability.
5 EXAMPLE 3: OPTIMIZATION OF MEDIA FOR GROWTH OF LISTERIA VACCINE
STRAINS IN SHAKE FLASK FERMENTATIONS
MATERIALS AND EXPERIMENTAL METHODS
Cultures
[000266] 50 mL volumes of each of the 4 different defined media were inoculated with 250 μL aliquots of 0 the LB RWCB and incubated in 250 mL shake flasks at 37°C overnight. 20 ODmL of the 50 mL culture were then used to inoculate 200 mL of the same media in 2 L shake flasks. This type of cell propagation procedure encourages viability and exponential growth of the bacteria.
RESULTS
[000267] Growth curves of the Listeria vaccine strain in LB and TB were investigated in more detail, to 5 assess growth potential. The maximum OD600 reached in TB and LB were 4 and 0.8 units, which correspond to 1 x 1010 and 9 x 108 CFU/mL, respectively (Figure 8).
[000268] Experiments were performed to develop a defined synthetic medium that could support a similar growth to that of TB. A MOPS pH buffer was used instead of a phosphate buffer because its superior buffering capacity would be appropriate for the demands of shake flask growth. The formula outlined in 0 Table IA below was used as the starting point. In addition to the pH buffer and standard components ("basic components"), the medium contained supplements expected to improve growth of the vaccine strain. These supplements were divided into 4 groups: essential compounds, amino acids (AA), vitamins and trace elements.
[000269] Table IA. Original defined media composition.
Figure imgf000052_0002
> It™*
Figure imgf000053_0001
[000270] To determine whether supplementation with the 3 latter groups (AA, vitamins, trace elements) improved the growth of Lm-LLO-E7, bacteria were grown in 50 mL starter cultures, then 250 mL cultures, of the following media in shake flasks:
5 1. Bulk medium (i.e. water plus the basic components in Table IA), essential components, AA, vitamins and trace elements.
2. Bulk medium, essential components, AA and vitamins.
3. Bulk medium, essential components and AA.
4. Bulk medium and essential components. 0 [000271 ] As depicted in Figure 9, the presence of both AA and vitamins was necessary to support significant growth in the 50 mL cultures, and the presence of trace elements enhanced the growth rate. However, at the 200 mL stage the presence of trace elements did not influence growth rate (Figure 10). It is possible that the trace elements supported the adaptation of Lm-LLO-E7 from the LB cell bank into the defined F' C tt di^iHEMllfe^itiPitlgdEBIsed on these results, all 4 of the groups in Figure IA were included in the defined medium in subsequent experiments.
[000272] To determine the effect of increasing the concentrations of the 4 groups of supplements of Table 1, concentrations of all the components of these 4 groups were increased by a factor of 2 or 4 to produce
5 "2X" and "4X" defined media, respectively. In addition, 4X defined media containing 1, 2 or 3 g/L of inorganic nitrogen in the form Of NH4SO4 were tested. Growth of these 5 cultures was compared to the media of Table IA ("control") in the 50 mL- 200 mL protocol.
[000273] All media tested exhibited similar growth for the first 4 hours, after which the growth in the control media began to decelerate, stopping completely at 13 hours, while the 2X and 4X media continued 0 to support exponential growth (Figure 11). Flasks containing the 2X and 4X media reached final OD6oo of
2.5 units and 3.5, respectively. Inclusion OfNH4SO4 slightly increased final biomass concentrations, but considerably decreased the growth rate.
[000274] Thus, increasing the nutrient level, but not inclusion OfNH4SO4, significantly improved the growth of the vaccine strain in defined media. Based on these results, NH4SO4 was not included in subsequent 5 experiments.
[000275] Next, the effect in 50 mL and 200 mL cultures of the following additional modifications to the media was examined: 1) further increasing the concentration of the 4 groups of supplements from Table IA (to 6 and 8 times the original concentration); 2) increasing the concentration of glutamine (a source of organic nitrogen) to 8 times the original concentration; and 3) removing iron from the media. As depicted 0 in Figure 12 (results from 200 mL cultures) , further increasing the concentration of either glutamine or the 4 groups of supplements did not enhance the final biomass concentration of Lm-LLO-E7. Removal of iron, by contrast, reduced the maximum biomass concentration.
[000276] The effect of increasing the glucose concentration of the 4X media was examined. Increasing the glucose concentration from 10 to 15 g/L significantly improved growth rate and biomass.
5 [000277] The final OD600 of each of the 4X supplements was 4.5, which corresponded to 1.1 x 1010 CFU/mL, approximately the same as the final biomass obtained with TB. Thus, a defined media was developed that supported growth of a Listeria vaccine strain to the same extent as TB.
[000278] In conclusion, media containing 4x the original concentration of the 4 groups of supplements from
Table IA (referred to henceforth as "4X media") supported optimal growth of Lm-LLO-E7 in 50 mL and 0 200 mL shake flask cultures. Iron was required for optimal growth. Increasing the glucose from 10 to 15 g/L increased the total biomass achieved. The resulting optimized defined media recipe is depicted in
Table IB. ..defined media composition.
Figure imgf000055_0001
EXAMPLE 4: OPTIMIZATION OF MEDIA FOR GROWTH OF LISTERIA VACCINE
STRAINS IN BATCH FERMENTATIONS
MATERIALS AND EXPERIMENTAL METHODS tClfllrfcoi1 sf Til1 firmenter vessels containing 4500 mL of either TB or defined medium with 34 μg/mL CAP were utilized in this Example. 20 ODmL of Lm-LLO-E7 was used to inoculate a 200 mL starter culture containing CAP, which was grown at 37°C in an orbital shaker at 200 rpm for 10 hours until it reached mid-log phase; 450 ODmL was used to inoculate the fermenter vessels. The temperature, pH and dissolved oxygen concentration were continuously monitored and controlled during the fermentation at levels of 37°C, 7.0, and 20% of saturation.
RESULTS
[000281] Factors such as dissolved oxygen concentration or pH likely limited the growth of Lm-LLO-E7 in
Example 3, as they are not controlled in shake flasks. Consistent with this possibility, the pH of the cultures in the shake flasks had decreased to approximately 5.5 units . In a batch fermenter, by contrast, pH and dissolved oxygen levels are continuously monitored and controlled. Thus, separate experiments were performed to optimize media used for batch fermentations.
[000282] 200 mL cultures of Lm-LLO-E7 were grown overnight in either TB or the defined medium from Table IB until mid-log phase (ODeoo of 1 - 2).450 ODmL of the starter culture was used to inoculate 5L batch fermenters containing the same media. Bacteria grown in TB culture began to grow exponentially immediately upon inoculation, with a specific growth rate of 0.5 h"1, then entered into a deceleration phase 7 hours after inoculation, reaching stationary phase at a viable cell density of 2.1 x 1010 CFU/mL (Figure 13A). Bacteria grown in defined media also exhibited exponential growth; however, the growth rate was 0.25 h"1, and final viable cell density was 1.4 x 1010 CFU/mL. A total yield of 8.9 x 1013 CFR was obtained from the batch fermentation. Both batch fermentations entered into stationary phase as a result of carbon limitation, as evidenced by the finding that the glucose concentration had reached zero at stationary phase. Since LM cannot utilize AA as a carbon source, the cells were unable to grow in the absence of carbohydrate.
[000283] At all densities tested, bacteria grown in TB retained their viability throughout subsequent steps in the process (Figure 13B). Bacteria grown in defined media maintained their viability up to an OD of 3-4 (Figure 13C).
[000284] It was further found that, to prevent iron precipitation, iron and magnesium salts could be dissolved separately in water and heated to 60° C, then filter-sterilized and simultaneously added to the fermenter culture medium.
EXAMPLE 5: FURTHER OPTIMIZATION OF CRYOPRESERVATION CONDITIONS FOR
LISTERIA VACCINE STRAINS
[000285] The next experiment examined the viability of cryopreserved Lm-LLO-E7 in the presence of each :i|f^)i:MliasiPM^#^feiii1iiiSt..glycerol, mannitol, DMSO and sucrose. PBS was used as a control. In addition, 3 different storage methods were compared: -2O0C, -700C, and snap freezing in liquid nitrogen followed by storage at -700C.
[000286] A shake flask containing 200 mL of the 4X media from Table IB was grown to an OD600 of 1.6. Fifteen 10 mL samples were pelleted by centrifugation, the supernatants removed, and the cells resuspended in 10 mL of PBS containing 2% w/v of the appropriate cryoprotectant. One mL aliquots of each resuspended sample were transferred into vials and stored using the appropriate method. Viability was measured by replica plating (with and without CAP) before storage and after 3-28 days or storage, and the percentage of viable cells remaining was calculated. 2% w/v glycerol at -70° C was found to be the best short-term cryopreservation method; with the bacteria exhibiting approximately 100% viability. The cell viability remained high over the 3-28 days under several of the conditions utilized (Figures 14-16).
Conclusion- Examples 1-5
[000287] The pGG55 plasmid in Lm-LLO-E7 showed no signs of structural or segregational instability after 35 or 42 cell generations. A RWCB was produced, and the viability of the cells preserved in the RWCB remained constant at approximately 1 x 109 CFU/mL after freezing and thawing. The ability of 2 complex media to support the growth of Lm-LLO-E7 was determined. LB and TB supported growth to maximum cell densities of approximately 9 x 108 and 1 x 1010 CFU/mL, corresponding to OD6O0 of 0.8 and 4.0 units, respectively. A defined media that supported growth to an extent similar to TB was developed and optimized for shake flask cultivations. Lm-LLO-E7 reached a higher biomass concentration in 5L batch fermenters compared to shake flask cultivation, likely due to the ability to control the pH in fermenters.
The optimum method for cryopreservation of the cells was also investigated. Lm-LLO-E7 cryopreserved in PBS containing 2% w/v glycerol exhibited approximately 100% viability following storage at less than - 700C for 3 days.
EXAMPLE 6: LISTERIA VACCINE STRAIN RWCB CHARACTERIZATION MATERIALS AND EXPERIMENTAL METHODS
Control strains
[000288] Two control LM strains were obtained from the NCTC culture collection: type strain NCTC 10357 and NCTC 11994, a typical strain.
Media for monosepsis testing [000289] Mannitol salt agar media was prepared using the components in Table 4B below. Components were individually prepared and sterilized at 121 0C for 15 min.
[000290] For the minimal media with thiamine, 6g Select Agar (Invitrogen) was mixed with deionized water
Figure imgf000058_0001
and sterilized. The following components were individually prepared and sterilized:
M9 Minimal salts solution (10X strength; Life Technologies)
20% D- Glucose solution magnesium sulfate 1 M solution. thiamine hydrochloride solution 10 mg/ml sterile filtered.
[000291] To cooled molten agar, 10 ml of glucose solution, 0.5 ml of magnesium sulfate solution, 50 ml of minimal salts solution, and 0.5 ml of thiamine were added. Solution was mixed gently and poured immediately.
0 RESULTS
[000292] A range of testing was performed to characterize the Lm-LLO-E7 RWCB:
Growth characteristics on various media
[000293] Growth ability of the Lm-LLO-E7 RWCB on various media was assessed. Results are depicted in Table 2:
5 [000294] Table 2. Growth performance of Lm-LLO-E7 on different media.
Figure imgf000058_0002
ID' f"
Figure imgf000059_0001
Cαtαlαse test
[000295] A catalase test using a commercial reagent kit (Bio-Merieux, Inc, Marcy l'Etoile, France) was performed on the Lm-LLO-E7 RWCB and the control Listeria strains. A positive result in this test is indicated by a blue color, facilitating detection on slides. All strains tested positive.
5 Mαst-ring (αnti-microbiαl sensitivity disc) testing
[000296] The sensitivity of Lm-LLO-E7 to different anti-microbial agents was tested using the mast-ring test. 200 μl of a suspension of Lm-LLO-E7 in Ringers solution was spread over the surface of duplicate
TSA plates. The anti-microbial sensitivity discs, which are attached in a ring formation, were placed carefully on the surface and the plates incubated for 48 hours at 37°C. Growth was weak but discernible. 0 Sensitivity was indicated by a zone size above 10 mm (Table 3).
[000297] Table 3. Mast-ring testing of Lm-LLO-E7.
Figure imgf000059_0002
API - Listeria Test
[000298] Lm-LLO-E7 was tested using API test strips (Bio-Merieux, Inc). The bacteria exhibited API Listeria-Profile 6510, identified as L. monocytogenes. Of the control strains, NCTC 11994 also exhibited 5 profile 6510, while NCTC 10357 exhibited a different profile: 6550, also identified as LM.
Monosepsis test (culture purity) using M9 minimal medium
[000299] Growth abilities of Lm-LLO-E7 and a number of other organisms on minimal M9 medium were tested. Cultures were plated onto agar-minimal M9 medium plates, containing magnesium sulfate with glucose as a carbon source. Testing showed that, while Listeria could not grow on this medium, a range of 0 other organisms could do so. In some cases, supplementation with thiamine and/or proline was required
(Table 4A). Composition of the minimal media is set forth in Table 4B. OpQSqQgSΦMS^-^ϊMiϊWihlities of Lm-LLO-E7 and other organisms on minimal M9 medium.
Figure imgf000060_0001
[000301] Table 4B. Composition of the minimal media.
Figure imgf000060_0002
[000302] In addition, the growth of Lm-LLO-E7 and Staphylococcus aureus was tested on a mannitol salt agar. Staphylococcus aureus, but not Lm-LLO-E7, grew on the mannitol salt agar plates, providing an additional purity/contamination test for Listeria cell banks.
[000303] In conclusion, these results provide a purity/contamination test for Listeria cell banks with respect to a range of possible contaminants.
Antibiotic resistance
[000304] To assess the ability of antibiotic replica plating to test the purity of Lm-LLO-E7 RWCB, serial dilutions in Ringers solution were performed and the dilutions plated onto LB agar plates to obtain single colonies. Plates were incubated at 37° C for 24-48 hours. Colonies were then replica plated onto LB + 2 p Caiϊf^rltftSflRlβQϊfcteftifeltaSDiS a!hd incubated for an additional 24-48 hours to determine the percentage of resistant colonies. Replica plating yielded colonies on both the agars containing CAP (Table 5).
[000305] Table 5. Resistance test of Lm-LLO-E7 to CAP (first and second of duplicate plates).
Figure imgf000061_0001
[000306] Viable count results indicated the absence of viable bacteria on the agar with 50 μg/mL CAP. The replica plated 50 μg/mL plates were re-plated onto a second set of 50 μg/mL plates; in addition, colonies were streaked directly from the replica-plated growth onto a second 50 μg/mL agar plate. After 72 hours, weak growth was observed for the streaked and replica plated plates. The lack of immediate growth on LB- 50 μg/mL CAP plates was likely due to the inability of the acetyl transferase to destroy the high concentration of CAP. Supporting this conclusion, no colonies grew when bacteria were plated directly from Ringer's solution to LB plates containing 50 μg/mL CAP.
[000307] Resistance of Lm-LLO-E7 and the 2 control strains to CAP and streptomycin was determined. Lm- LLO-E7, NCTC 10357 and NCTC 11994 were streaked onto plates containing CAP and streptomycin at concentrations of 34 and 25 μg/mL, respectively, and incubated for 72 hours. Results are depicted in Table 5 6.
[000308] Table 6. Resistance of Lm-LLO-E7 and Listeria control strains to CAP and streptomycin (first and second of duplicate plates).
Figure imgf000061_0002
[000309] In addition, Lm-LLO-E7 (approximately 200 CFU/plate) was replica-plated onto plates containing 34 μg/mL CAP, 25 μg/mL streptomycin, and the two antibiotics combined, and incubated for 48 hours. 0 The Lm-LLO-E7 colonies did replica plate well and were quite distinct. Colonies on the streptomycin plate were not as large as those on the CAP or combination plates (Table 7).
[000310] Table 7. Additional replica plating of Lm-LLO-E7.
Figure imgf000061_0003
■■ C "T'./ ill S O B ,/ H-H-B S :IL
[000311] In conclusion, replica plating is an efficacious method for testing the antibiotic resistance of the Lm-LLO-E7 RWCB.
Motility
[000312] All strains of Listeria were cultured in TSB broth and incubated at different temperatures overnight (22, 30, and 37° C). Wet mount slides were then prepared and examined under reduced light conditions. AU culture showed actively motile cells. In each preparation some cells were tumbling, end over end. This was more apparent in the cultures grown at the lower temperatures.
Hemolysis Test
[000313] Initial testing utilized pre-prepared blood plates. Results indicated no zone of clearing either around or under the colonies, even after prolonged incubation (Table 8).
[000314] Table 8. Initial hemolysis test of Lm-LLO-E7.
Figure imgf000062_0001
[000315] The next set of experiments utilized altered blood plates containing home-mixed media. 5 % sheep's blood was mixed with LB-agar and poured very thinly (approx 5 mm depth). Prior to plating, bacteria from some samples were grown on media with no added iron, to determine whether iron levels were influencing the haemolysin O production (Table 9).
[000316] Table 9. Additional hemolysis testing of Lm-LLO-E7 and control strains.
Figure imgf000062_0002
Figure imgf000063_0001
[000317] In additional testing, the thin-poured, home-mixed plates were compared to layered plates for hemolysis testing of Lm-LLO-E7, the two control strains, and PBFT43c, using altered blood plates and layered plates. For layered plates, a thin layer of LB was poured and allowed to set, followed by a thin layer of the blood agar. After inoculation, plates were incubated for 48 hours at 37° C.
[000318] The hemolysis test with the thinly layered agar was successful (Table 10). β-hemolysis, as evidence by zones of clearing, was easily detected on this agar, while the detection was masked by thicker agar plates. The green coloring represented some haemolytic activity but not total cell destruction, as evidenced by the zones of clearing. The controls provided a good comparison of hemolytic activity.
[000319] Table 10. Additional hemolysis testing using altered blood plates and layered plates.
Figure imgf000063_0002
[000320] In conclusion, the use of layered blood agar plates provides an effective hemolysis test for Listeria vaccine strains.
Auxotrophic requirements testing EDQP3-2 ϊ JE&fiβ jnMtMMl prepared using the recipe depicted in Table 11 , with the addition of 6 g/litre bacteriological agar. All vitamins and AA were prepared as individual solutions and sterile filtered. The MOPS, Glucose and salt solutions were combined and autoclaved (except magnesium sulfate, which was autoclaved separately and added before the plates were poured). Plates were prepared from the defined media, and from defined media lacking methionine and cysteine.
[000322] Table 11. Defined media used in auxotrophy testing.
Figure imgf000064_0001
[000323] Bacteria were streaked onto the medium from a suspension taken from a blood plate and re- suspended in Ringers solution, incubated for 72 hours, and observed for growth.
[000324] The results of this test indicated that cysteine and methionine are essential growth components for Lm-LLO-E7 (Table 12).
[000325] Table 12. Results of auxotrophy testing of Lm-LLO-E7.
Figure imgf000064_0002
[000326] Thus, medium lacking cysteine and/or methionine can be used as a test for auxotrophy. In one embodiment, approximately 1000 colonies per test are plated from a serial dilution and the medium is observed for any growth that may be due to either a contaminant or a revertant.
[000327] In conclusion, the results of this Example provide procedures for characterization of Listeria cell banks. The Lm-LLO-E7 RWCB exhibited characteristics of LM control strains by the catalase test, API strip testing, M9 minimal medium growth, motility testing, hemolysis test, and other methods. These tests confirm the identity of the organisms in the Lm-LLO-E7 RWCB and demonstrate lack of contamination. I T.,--ΕMEHKLE"^#-MlffiLUPMENT OF ADDITIONAL CONTAMINATION TESTS FOR
LISTERIA VACCINE STRAIN RWCB
[000328] The yeast Candida albicans is plated onto minimal medium, with and without thiamine and/or proline supplementation, as described in Example 6. These tests provide additional contamination tests for the Lm-LLO-E7 RWCB and other Listeria strains, e.g. Listeria vaccine strains.
EXAMPLE 8: DEVELOPMENT OF ADDITIONAL MAST-RING TESTING FOR LISTERIA
VACCINE STRAIN RWCB
[000329] Additional mast-ring testing of Listeria vaccine strains is performed with blood agar plates to improve bacterial growth. These tests provide additional antibiotic sensitivity tests for the Lm-LLO-E7 RWCB and other Listeria strains, e.g. Listeria vaccine strains.
EXAMPLE 9: CHARACTERIZING THE COLONIAL MORPHOLOGY OF LISTERIA
VACCINE STRAIN RWCB
[000330] A morphological description is compiled of the Lm-LLO-E7 RWCB grown on LB or blood. Methods for obtaining total cell counts utilize methods for direct cell counting and/or discriminatory techniques to enable independent quantitation of viable and non- viable cells.
[000331] In one method, cells are labeled using membrane filtration and/or stained with epifluorescence vital stain, after which live cells fluoresce with green color and dead cells to fluoresce with orange color, then cells are counted under a fluorescence microscope. In another method, a Chemscan® machine is utilized. In another method, a hemocytometer is used to directly count the cells. In another embodiment, flow cytometry is utilized. These tests provide additional colonial morphology tests for the Lm-LLO-E7 RWCB and other Listeria strains, e.g. Listeria vaccine strains.
EXAMPLE 10: CONSTRUCTION OF AN ALTERNATE VECTOR, Lmdd-pTV3
MATERIALS AND EXPERIMENTAL METHODS
Construction of antibiotic resistance factor free plasmid pTV3 [000332] Construction of p60-dal cassette. The first step in the construction of the antibiotic resistance gene-free vector was construction of a fusion of a truncated p60 promoter to the dal gene. The LM alanine racemase (dal) gene (forward primer: 5'-CCA TGG TGA CAG GCT GGC ATC-3'; SEQ ID NO: 1) (reverse primer: 5'-GCT AGC CTA ATG GAT GTA TTT TCT AGG-3'; SEQ ID NO: 2) and a minimal p60 promoter sequence (forward primer: 5'-TTA ATT AAC AAA TAG TTG GTA TAG TCC-3'; SEQ ID No: 3) (reverse primer: 5'-GAC GAT GCC AGC CTG TCA CCA TGG AAA ACT CCT CTC-3'; SEQ ID
No: 4) were isolated by PCR amplification from the genome of LM strain 10403S. The primers introduced P C>'?'%eIlM:rø®^inif(|ft||ii:p|§,fequence, an Nhel site downstream of the dal sequence (restriction sites in bold type), and an overlapping dal sequence (the first 18 bp) downstream of the p60 promoter for subsequent fusion of p60 and dal by splice overlap extension (SOE)-PCR. The sequence of the truncated p60 promoter was: caaatagttggtatagtcctctttagcctttggagtattatctcatcatttgttttttaggtgaaaactgggtaaacttagtattatcaatataaaattaattctcaaata cttaattacgtactgggattttctgaaaaaagagaggagttttcc (SEQ ID NO: 5, Kohler et al, J Bacteriol 173: 4668-74, 1991). Using SOE-PCR, the p60 and dal PCR products were fused and cloned into cloning vector pCR2.1 (Invitrogen, La Jolla, CA).
[000333] Removal of antibiotic resistance genes from pGG55. The subsequent cloning strategy for removing the CAP acetyltransferase (CAT) genes from pGG55 and introducing the p60-dal cassette also intermittently resulted in the removal of the gram-positive replication region (oriRep; Brantl et al, Nucleic
Acid Res 18: 4783-4790, 1990). In order to re-introduce the gram-positive oriRep, the oriRep was PCR- amplifϊed from pGG55, using a 5 '-primer that added a Narl/Ehel site upstream of the sequence
(GGCGCCACTAACTCAACGCTAGTAG, SEQ ID NO: 6) and a 3'-primer that added a Nhel site downstream of the sequence (GCTAGCCAGCAAAGAAAAACAAACACG, SEQ ID NO: 7). The PCR product was cloned into cloning vector pCR2.1 and sequence verified.
[000334] To incorporate the p60-dal sequence into the pGG55 vector, the p60-dal expression cassette was excised from pCR-p60dal by Pacl/Nhel double digestion. The replication region for gram-positive bacteria in pGG55 was amplified from pCR-oriRep by PCR (primer 1, 5'-GTC GAC GGT CAC CGG CGC CAC TAA CTC AAC GCT AGT AG-3'; SEQ ID No: 8); (primer 2, 5'-TTA ATT AAG CTA GCC AGC AAA GAA AAA CAA ACA CG-3'; SEQ ID No: 9), to introduce additional Ehel and Nhel restriction sites. The PCR product was ligated into pCR2.1-TOPO (Invitrogen, Carlsbad, Calif.), and the sequence was verified. The replication region was excised by Ehel/Nhel digestion, and vector pGG55 was double digested with Ehel and Nhel, removing both CAT genes from the plasmid simultaneously. The two inserts, p60-dal and oriRep, and the pGG55 fragment were ligated together, yielding pTV3.
Preparation of DN A for real-time PCR
[000335] Total Listeria DNA was prepared using the Masterpure Total DNA kit (Epicentre, Madison, WI). Briefly, Listeria were cultured for 24 hours at 37° C and shaken at 250 rpm in 25 ml of Luria-Bertoni broth (LB). Bacterial cells were pelleted by centrifugation, resuspended in PBS supplemented with 5 mg/ml of lysozyme and incubated for 20 minutes at 37° C, after which DNA was isolated.
[000336] In order to obtain standard target DNA for real-time PCR, the LLO-E7 gene was PCR amplified from pGG55 (S'-ATGAAAAAAATAATGCTAGTTTTTATTAC-S' (SEQ ID NO: 10); 5'- GCGGCCGCTTAATGATGATGATGATGATGTGGTTTCTG AGAACAGATG-3' (SEQ ID NO: 11)) P C ind'HrfriidSibS yelttpSlSuil (Novagen, San Diego, CA). Similarly, the plcA amplicon was cloned into pCR2.1. E. coli were transformed with pET-LLOE7 and pCR-plcA, respectively, and purified plasmid DNA was prepared for use in real-time PCR.
Real-time PCR
5 [000337] Taqman primer-probe sets (Applied Biosystems, Foster City, CA) were designed using the ABI PrimerExpress software (Applied Biosystems) with E7 as a plasmid target, using the following primers: 5'-GCAAGTGTGACTCTACGCTTCG-S' (SEQ ID NO: 12); 5'-TGCCCATTAAC AGGTCTTCC A-31 (SEQ ID NO: 13); 5'-FAM-TGCGTA CAAAGCACACACGTAGACATTCGTAC-TAMRA-3' (SEQ ID NO: 14) and the one-copy gene plcA (TGACATCGTTTGTGTTTGAGCTAG -3' (SEQ ID NO: 15), 5'- 0 GCAGCGCTCTCTATACCAGGTAC-S' (SEQ ID NO: 16); 5'-TET-TTAATGTCCATGTTA TGTCTCCGTTATAGCTCATCGTA-TAMRA-S'; SEQ ID NO: 17) as a Listeria genome target.
[000338] 0.4 μM primer and 0.05 mM probe were mixed with PuRE Taq RTG PCR beads (Amersham, Piscataway, NJ). Standard curves were prepared for each target with purified plasmid DNA, pET-LLOE7 and pCR-plcA (internal standard) and used to calculate gene copy numbers in unknown samples. Mean 5 ratios of E7 copies / plcA copies were calculated based on the standard curves and calibrated by dividing the results for Lmdd-TV3 and Lm-LLOE7 with the results from Lm-E7, a Listeria strain with a single copy of the E7 gene integrated into the genome. All samples were run in triplicate in each qPCR assay which was repeated 3 times. Variation between samples was analyzed by Two-Way ANOVA using the KyPlot software. Results were deemed statistically significant if p < 0.05.
0 Growth measurements
[000339] Bacteria were grown at 37°C, 250 rpm shaking in Luria Bertani (LB) Medium +/- 100 micrograms (μg)/ml D-alanine and/or 37 μg/ml CAP. The starting inoculum was adjusted based on OD6oo ran measurements to be the same for all strains.
RESULTS
5 [000340] An auxotroph complementation system based on D-alanine racemase was utilized to mediate plasmid retention in LM without the use of an antibiotic resistance gene. Listeria strain Lm dal(-)/dat(-) (Lmdd) is a mutant that is not able to synthesize D-alanine racemase due to partial deletions of the dal and the dat genes. Plasmid pGG55, which is based on E. coli-Listeria shuttle vector pAM401 , was modified by removing both CAT genes and replacing them with a p60-dal expression cassette under control of the 0 Listeria p60 promoter, as described in the Methods section (depicted in Figure 17). DNA was purified from several colonies (Figure 18).
[000341] To determine plasmid stability in vitro, LM-LLO-E7 and Lmdd(pTV3) were cultured for 70 IP' i?igiher4iitlfiπ!:te'"pr|lφ]!lg!ΪBd(f.absence of selective pressure. CFU were determined daily on selective and nonselective plates for each culture. In this system, plasmid loss results in a greater number of colonies growing on nonselective plates (BHI plus D-alanine for Lmdd(pTV3), BHI only (no CAP) for LM-LLO- E7) versus selective plates (BHI only (no alanine) for Lmdd(pTV3), BHI plus CAP for LM-LLO-E7). No 5 difference in CFU was detected between nonselective and selective plates (Figure 19A), indicating stable maintenance of the plasmid throughout the culture for at least 70 generations, when the experiment was terminated.
[000342] In addition, plasmid stability in vivo was tested in C57BL/6 mice by isolating viable bacteria at different time points after injection. CFU counts on selective and nonselective plates were used to 0 determine plasmid maintenance among the isolated bacteria (Figure 19B). No differences in CFU were detected on selective and nonselective plates for each construct, indicating the stable presence of the recombinant plasmid in all bacteria isolated.
[000343] In summary, pTV3 was stably maintained in Listeria, both in vitro and in vivo. Lmdd-pTV3 gained ability to grow in media lacking alanine, and remained sensitive to CAP, indicating the successful removal 5 of both CAT genes from the plasmid. Representative plates are depicted in Figures 20-21.
[000344] The pTV3 copy number per cell was compared between Lm-LLOE7 in the presence of CAP and Lmdd-TV3 in the absence of CAP by real-time PCR of the E7 sequences, in both Listeria and E. coli. Lm- LLOE7 expresses the LLO/E7 fusion protein from pGG55. Plasmid copy numbers of Lmdd-TV3 and Lm- LLOE7 did not significantly differ from one another, showing stable retention of plasmid pTV3 in both 0 Listeria and E. coli.
[000345] In order to verify the complementation of bacterial functions, in vitro growth kinetics were compared among Lmdd, Lmdd-TV3 and Lm-LLOE7. Lmdd-TV3, but not non-complemented Lmdd was able to grow in alanine-free media (Figure 22). In fact, Lmdd-TV3 reached logarithmic growth phase sooner than both Lm-LLOE7 and Lmdd complemented with exogenous D-alanine. This growth attenuation 5 of Lm-LLOE7 was partially due to the metabolic burden of CAT expression. However, even in the absence of CAP, Lm-LLOE7 still grew more slowly in vitro than Lmdd-TV3.
EXAMPLE 11: LISTERIA VACCINE VECTORS GROWN IN MINIMAL MEDIA ARE
IMMUNOGENIC
MATERIALS AND EXPERIMENTAL METHODS
0 Experimental design
[000346] 2 x 105 TC-I (ATCC, Manassas, VA) were implanted subcutaneously in mice (n=8) and allowed to grow for about 7 days, after which tumors were palpable. TCI is a C57BL/6 epithelial cell line that was i1njώ'MffiIM:;iwittHi*f:ii?fife-ind E7 and transformed with activated ras, which forms tumors upon subcutaneous implantation. Mice were immunized with the appropriate Listeria strain on days 7 and 14 following implantation of tumor cells. A non-immunized control group (naϊve) was also included. Tumor growth was measured with electronic calipers.
RESULTS
[000347] Mice were implanted with TC-I tumors, then vaccinated with Listeria-Εl vectors grown in Brain- Heart Infusion media, Terrific Broth, or the defined media of Example 3. The Listeria vectors grown in defined media protected mice from tumor growth, in some cases inducing tumor regression, as did the vectors grown in the other media. This was evidence by suppression of tumor growth and/or tumor regression in all mice in the three vaccinated groups. By contrast, several mice from the control group had to be sacrificed because their tumor growth reached 2 cm (Figure 23).
[000348] Thus, defined media of the present invention are efficacious in growing immunogenic vaccine vectors.
EXAMPLE 12; DETERMINATION OF OPTIMUM CONDITIONS FOR THE GROWTH AND CRYOPRESERVATION OF Lmdd-TV3
[000349] The optimum conditions for the growth and cryopreservation of Lmdd-TV3 are determined as described in Examples 1-5. Optimal conditions for Lmdd-TV3 are similar to those of Lm-LLOE7. A master cell bank and working cell bank of Lmdd-TV3 are generated as described in Examples 1-5.
EXAMPLE 13: FURTHER CHARACTERIZATION OF Lmdd-TV3
[000350] Lmdd-TV3 is further characterized by a catalase test, mast-ring testing, API strip testing, monosepsis testing, antibiotic resistance testing, motility testing, hemolysis testing, and auxotrophy testing, as described in Examples 6-9. Characteristics of Lmdd-TV3 are similar to those of Lm-LLOE7.
EXAMPLE 14: PREPARATION OF A LYOPHILIZED LM VACCINE STRAIN
[000351] A culture of an LM vaccine strain is grown as described above in Examples 1-5, 10, and 12. 100 ml of the culture is aliquoted to each of two 250-ml centrifuge bottles. Cells are recovered by centrifugation at 7,000 rpm, 4°C, for 15 minutes, washed by resuspension and centrifugation in sterile Ix PBS, resuspended again in sterile Ix PBS, and combined into a 50-ml conical bottom, polypropylene centrifuge tube. Contents of the tube are frozen at -700C for 1 hour, or until frozen solid, in an inclined position to maximize surface area and facilitate lyophilization. The tube is placed, with the cap loosened, in a glass lyophilization vessel, which is attached to the lyophilizer, and desiccated under vacuum until dry.
Dessicated bacteria are stored in an airtight container containing dessicant.

Claims

1. A method for cryopreservation of a Listeria strain, comprising the steps of growing an inoculum of said Listeria strain in a nutrient media, thereby producing a culture; freezing said culture in a solution with a glycerol content of 2% - 20%; and storing said solution at a temperature between " 70 - "80 degrees Celsius, inclusive, thereby cryopreserving a Listeria strain.
2. The method of claim 1, wherein said Listeria strain is a Listeria vaccine strain.
3. The method of claim 1, wherein said temperature is -70 degrees Celsius.
4. The method of claim 1, wherein said cryopreservation is for a maximum of 28 days.
5. The method of claim 1 , whereby the step of freezing is performed when said culture has an OD60O of 0.7 units.
6. The method of claim 1 , whereby the step of freezing is performed when said culture has an OD6oo of 0.8 units.
7. The method of claim 1 , whereby said Listeria strain exhibits a viability of over 90% after thawing following two months of said cryopreservation.
8. The method of claim 1, whereby said Listeria strain is capable of exponential growth essentially immediately after thawing and dilution, following several months of said cryopreservation.
9. A method for producing a cell bank of a Listeria strain, comprising growing an inoculum of said Listeria strain in a nutrient media, thereby producing a culture; freezing said culture in a solution with a glycerol content of 2% - 20%; and storing said solution at a temperature between -20 and - 80 degrees Celsius, inclusive, thereby producing a cell bank of a Listeria strain.
10. The method of claim 9, wherein said cell bank is a master cell bank.
11. The method of claim 9, wherein said cell bank is a working cell bank.
P' C W I Ji11CMIltbύaM'i!liβ9|.wherein said cell bank is a Good Manufacturing Practice (GMP) cell bank.
13. The method of claim 9, wherein said cell bank is suitable for production of clinical-grade material.
14. The method of claim 9, wherein said Listeria strain is a Listeria vaccine strain.
15. The method of claim 9, wherein the step of growing is performed with a shake flask.
5 16. The method of claim 9, wherein said nutrient media has a maximum volume of 2 liters per vessel.
17. The method of claim 9, whereby the step of freezing is performed when said culture has an OD6O0 of 0.7 units.
18. The method of claim 9, whereby the step of freezing is performed when said culture has a biomass of 5 x l08 CFU/mL.
0 19. The method of claim 9, wherein said glycerol content is 20%.
20. The method of claim 9, whereby the step of storing is for a minimum of 1 week.
21. The method of claim 9, wherein said temperature is -70 degrees Celsius.
22. The method of claim 9, whereby said Listeria strain exhibits a viability of over 90% after thawing following two months of said storage.
5 23. The method of claim 9, whereby said Listeria strain is capable of exponential growth essentially immediately after thawing and dilution, following several months of said storing.
24. A method for producing a batch of Listeria vaccine doses, comprising growing an inoculum of a Listeria vaccine strain in a nutrient media, thereby producing a culture; freezing said culture in a solution with a glycerol content of 2-20%; and storing said solution at a temperature between "70 - " 0 80 degrees Celsius, inclusive, thereby producing a batch of Listeria vaccine doses.
25. The method of claim 24, wherein said Listeria vaccine doses are suitable for administration to P C T/* IHϊS€iiCsiαiydlcft S 81,
26. The method of claim 24, wherein the step of growing is performed with a batch fermenter.
27. The method of claim 24, whereby said culture is inoculated from a cell bank.
28. The method of claim 24, wherein said nutrient media has a minimum volume of 2 liters per vessel.
5 29. The method of claim 24, whereby the step of freezing is performed when said culture has an OD6oo of 7.5-8.5 units, inclusive.
30. The method of claim 24, whereby the step of freezing is performed when said culture has a biomass of 1-2 x 1010 colony-forming units (CFU)/mL.
31. The method of claim 24, wherein said glycerol content is 2%.
0 32. The method of claim 24, whereby the step of storing is for a maximum of 28 days.
33. The method of claim 24, wherein said temperature is -70 degrees Celsius.
34. A cell bank of a Listeria strain exhibiting viability upon thawing of greater than 90%, wherein said cell bank is produced by the method of claim 9.
35. The cell bank of claim 34, wherein said Listeria strain is a Listeria vaccine strain.
5 36. A method for preservation of a Listeria strain, comprising the steps of growing an inoculum of said Listeria strain in a nutrient media, thereby producing a culture; and lyophilizing said culture, thereby preserving a Listeria strain.
37. The method of claim 36, wherein said Listeria strain is a Listeria vaccine strain.
38. A method for producing a cell bank of a Listeria strain, comprising growing an inoculum of said 0 Listeria strain in a nutrient media, thereby producing a culture; and lyophilizing said culture, thereby producing a cell bank of a Listeria strain.
IV UfMMM^MMuBiB 3B, wherein said cell bank is a master cell bank.
40. The method of claim 38, wherein said cell bank is a working cell bank.
41. The method of claim 38, wherein said cell bank is a Good Manufacturing Practice (GMP) cell bank.
42. The method of claim 38, wherein said cell bank is suitable for production of clinical-grade material.
43. The method of claim 38, wherein said Listeria strain is a Listeria vaccine strain.
44. The method of claim 38, wherein the step of growing is performed with a shake flask.
45. The method of claim 38, wherein said nutrient media has a maximum volume of 2 liters per vessel.
46. The method of claim 38, whereby the step of lyophilizing is performed when said culture has an OD600 of 0.7 units.
47. The method of claim 38, whereby the step of lyophilizing is performed when said culture has a biomass of 5 x 108 CFU/mL.
48. A method for producing a batch of Listeria vaccine doses, comprising growing an inoculum of a Listeria vaccine strain in a nutrient media, thereby producing a culture; and lyophilizing said culture, thereby producing a batch of Listeria vaccine doses.
49. The method of claim 48, wherein said Listeria vaccine doses are suitable for administration to human subjects.
50. The method of claim 48, wherein the step of growing is performed with a batch fermenter.
51. The method of claim 48, whereby said culture is inoculated from a cell bank.
52. The method of claim 48, wherein said nutrient media has a minimum volume of 2 liters per vessel. P C "33/ ϋϊMMlthbiiiol cffisiB J8, whereby the step of lyophilizing is performed when said culture has an
OD600 of 7.5-8.5 units, inclusive.
54. A cell bank of a Listeria strain produced by the method of claim 38.
55. The cell bank of claim 54, wherein said Listeria strain is a Listeria vaccine strain.
5 56. A microbiological media, comprising:
0.3 - 0.6 g/L of methionine; and
- effective amounts of:
cysteine, a pH buffer, a carbohydrate, a divalent cation, ferric or ferrous ions, glutamine, riboflavin, and thioctic acid;
0 a component selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine;
a component selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and
a component selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, 5 and citrate
57. The microbiological media of claim 56, wherein said effective amount of a carbohydrate is 12-18
g/L.
58. The microbiological media of claim 56, wherein said microbiological media does not contain a component derived from an animal source.
0 59. A microbiological media, comprising:
- 0.3 - 0.6 g/L of cysteine; and
effective amounts of:
methionine, a pH buffer, a carbohydrate, a divalent cation, ferric or ferrous ions, glutamine, P C T',/ Ii S CMoflyMiAWitϋdilhilbctic acid;
a component selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine;
a component selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, 5 pantothenate, and nicotinamide; and
a component selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate
60. The microbiological media of claim 59, wherein said effective amount of a carbohydrate is 12- 18 g/L.
0 61. The microbiological media of claim 59, wherein said microbiological media does not contain a component derived from an animal source.
62. A microbiological media, comprising:
0.00123 - 0.00246 moles of ferric or ferrous ions per liter; and
effective amounts of:
5 - a pH buffer, a carbohydrate, and a divalent cation;
methionine, cysteine, glutamine, riboflavin, and thioctic acid;
a component selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine;
a component selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, 0 pantothenate, and nicotinamide; and
a component selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
63. A microbiological media, comprising: C "IV U £rø&gM«$ Elaine;
and effective amounts of:
a pH buffer, a carbohydrate, a divalent cation, methionine, cysteine, ferric or ferrous ions, riboflavin, and thioctic acid;
- a component selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine;
a component selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and
a component selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
64. A microbiological media, comprising:
15 - 30 mg/L of riboflavin; and
effective amounts of:
a pH buffer, a carbohydrate, a divalent cation, methionine, cysteine, ferric or ferrous ions, glutamine, and thioctic acid;
a component selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine;
a component selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and
- a component selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
65. A microbiological media, comprising:
0.3 - 0.6 g/L of thioctic acid; and P C TV* tlleffSβe-aMoyhlili:,:!..
a pH buffer, a carbohydrate, a divalent cation, methionine, cysteine; ferric or ferrous ions, glutamine, and riboflavin;
a component selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and 5 phenylalanine;
a component selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and
a component selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
0 66. A microbiological media, comprising:
0.3 - 0.6 g/L each of methionine and cysteine;
0.00123 - 0.00246 moles of ferric or ferrous ions per liter;
1.8 - 3.6 g/L of glutamine;
- 0.3 - 0.6 g/L of thioctic acid;
5 - 15 - 30 mg/L of riboflavin; and
- effective amounts of:
a pH buffer, a carbohydrate, and a divalent cation;
a component selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine;
0 - a component selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and
a component selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and PΌ T.,-- us ossaaψim-s s i
67. A microbiological media, comprising:
0.3 - 0.6 g/L each of a component selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; and
5 - effective amounts of:
a pH buffer, a carbohydrate, a divalent cation, methionine, cysteine, ferric or ferrous ions, glutamine, riboflavin, and thioctic acid;
a component selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and
0 a component selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
68. The microbiological media of claim 67, wherein said effective amount of a carbohydrate is 12-18 g/L.
69. The microbiological media of claim 67, wherein said microbiological media does not contain a 5 component derived from an animal source.
70. A microbiological media, comprising:
1.5 - 3 mg/L each of a component selected from biotin and adenine; and
effective amounts of:
a pH buffer, a carbohydrate, a divalent cation, methionine, cysteine, ferric or ferrous ions, 0 glutamine, riboflavin, and thioctic acid;
a component selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine;
a component selected from thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and P- C "IV U S QiSatiiftHiI©tiMJL
a component selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
71. A microbiological media, comprising:
5 - 3 - 6 mg/L each of a component selected from thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and
effective amounts of:
a pH buffer, a carbohydrate, a divalent cation, methionine, cysteine, ferric or ferrous ions, glutamine, riboflavin, and thioctic acid, biotin, adenine;
0 - a component selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; and
a component selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, and citrate.
72. A microbiological media, comprising:
5 - 1.5 - 3 mg/L each of a component selected from biotin and adenine;
3 - 6 mg/L each of a component selected from thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and
effective amounts of:
a pH buffer, a carbohydrate, a divalent cation, methionine, cysteine, ferric or ferrous ions, 0 glutamine, riboflavin, and thioctic acid;
a component selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; and
a component selected from cobalt, copper, boron, manganese, molybdenum, zinc, calcium, p c; T./ us oa.cϊt»&!NB s ,1
73. A microbiological media, comprising:
0.005 - 0.02 g/L each of a component selected from cobalt, copper, boron, manganese, molybdenum, zinc, and calcium; and
5 - effective amounts of:
a pH buffer, a carbohydrate, a divalent cation, methionine, cysteine, ferric or ferrous ions, glutamine, riboflavin, and thioctic acid;
a component selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; and
0 - a component selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide.
74. The microbiological media of claim 73, wherein said effective amount of a carbohydrate is 12-18 g/L.
75. The microbiological media of claim 73, wherein said microbiological media does not contain a 5 component derived from an animal source.
76. A microbiological media, comprising:
0.4 — 1 g/L of citrate; and
effective amounts of:
a pH buffer, a carbohydrate, a divalent cation, methionine, cysteine, ferric or ferrous ions, 0 glutamine, riboflavin, and thioctic acid;
a component selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine;
a component selected from cobalt, copper, boron, manganese, molybdenum, zinc, and P C T S IJ S IMeitfmf «<& S JL
a component selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide.
77. The microbiological media of claim 76, wherein said effective amount of a carbohydrate is 12-18 5 g/L.
78. The microbiological media of claim 76, wherein said microbiological media does not contain a component derived from an animal source.
79. A microbiological media, comprising:
- 0.3 - 0.6 g/L each of methionine and cysteine;
0 - 0.00123 - 0.00246 moles of ferric or ferrous ions per liter;
- 1.8 - 3.6 g/L of glutamine;
- 0.3 - 0.6 g/L of thioctic acid;
15 - 30 mg/L of riboflavin;
- 0.3 - 0.6 g/L each of a component selected from leucine, isoleucine, valine, arginine, histidine, 5 tryptophan, and phenylalanine;
1.5 - 3 mg/L each of a component selected from biotin and adenine;
3 - 6 mg/L each of a component selected from thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide;
0.005 - 0.02 g/L each of a component selected from cobalt, copper, boron, manganese, 0 molybdenum, zinc, and calcium;
- 0.4 - 1 g/L of citrate; and
effective amounts of: a pH buffer, a carbohydrate, and a divalent cation.
80. A microbiological media, comprising: PE
Figure imgf000082_0001
and cysteine;
- 0.00123 - 0.00246 moles of ferric or ferrous ions per liter;
1.8 - 3.6 g/L of glutamine;
- 0.3 - 0.6 g/L of thioctic acid;
5 - 15 - 30 mg/L of riboflavin;
- 0.3 - 0.6 g/L each of leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine;
1.5 - 3 mg/L each of biotin and adenine;
3 - 6 mg/L each of thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide;
- 0.005 - 0.02 g/L each of a component selected from cobalt, copper, boron, manganese, 0 molybdenum, zinc, and calcium;
- 0.4 - 1 g/L of citrate; and
- effective amounts of: a pH buffer, a carbohydrate, and a divalent cation.
81. A method of determining a presence of a suspected contaminant in a stock of a Listeria strain, comprising testing an aliquot of said stock for growth of said suspected contaminant on a minimal 5 media containing a minimal salts solution, a carbohydrate, a divalent cation, and thiamine, thereby determining a presence of a suspected contaminant in a stock of a Listeria strain.
82. The method of claim 81, wherein said Listeria strain is a Listeria vaccine strain.
83. The method of claim 81, wherein said contaminant is B subtilis, a micrococcus, E. coli, or C. albicans
0 84. A method of determining a presence of a suspected contaminant in a stock of a Listeria strain, comprising testing an aliquot of said stock for growth of said suspected contaminant on a mannitol salt agar plate, thereby determining a presence of a suspected contaminant in a stock of a Listeria strain.
IP C 8F-/ i,roCiftditlj<-tdφf#]iiiβ§_L wherein said Listeria strain is a Listeria vaccine strain.
86. The method of claim 84, wherein said contaminant is Staphylococci S. aureus.
87. A method for hemolysis testing of a bacterial stock containing a Listeria strain, comprising adding said strain to a plate comprising a lower layer of solid or semi-solid media and an upper layer of
5 solid or semi-solid media, wherein said lower layer comprises a growth media and said upper layer comprises 5% blood and a bacterial growth media, thereby testing a hemolysis of a bacterial stock containing a Listeria strain.
88. The method of claim 87, wherein said bacterial growth media is a defined media.
89. The method of claim 88, wherein said defined media comprises:
0 - 0.3 - 0.6 g/L each of a component selected from leucine, isoleucine, valine, arginine, histidine, tryptophan, and phenylalanine; and
effective amounts of:
a pH buffer, a carbohydrate, a divalent cation, methionine, cysteine, ferric or ferrous ions, glutamine, riboflavin, and thioctic acid;
5 - a component selected from adenine, biotin, thiamine, pyridoxal, para-aminobenzoic acid, pantothenate, and nicotinamide; and
a component selected from cobalt, copper, boron, manganese, molybdenum, zinc, iron, calcium, and citrate.
90. The method of claim 87, wherein said blood is sheep's blood.
0 91. The method of claim 87, wherein said upper layer is a maximum of 5 millimeters in thickness.
92. The method of claim 1, wherein said solution contains 2% glycerol.
PCT/US2006/044681 2005-11-17 2006-11-16 Methods for producing, growing, and preserving listeria vaccine vectors WO2007061848A2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US73741905P 2005-11-17 2005-11-17
US60/737,419 2005-11-17
US75819406P 2006-01-12 2006-01-12
US60/758,194 2006-01-12

Publications (2)

Publication Number Publication Date
WO2007061848A2 true WO2007061848A2 (en) 2007-05-31
WO2007061848A3 WO2007061848A3 (en) 2007-09-13

Family

ID=38067780

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2006/044681 WO2007061848A2 (en) 2005-11-17 2006-11-16 Methods for producing, growing, and preserving listeria vaccine vectors

Country Status (1)

Country Link
WO (1) WO2007061848A2 (en)

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008109155A2 (en) 2007-03-08 2008-09-12 The Trustees Of The University Pennsylvania Compositions and methods for treatment of cervical cancer
US7588930B2 (en) 2000-03-29 2009-09-15 The Trustees Of The University Of Pennsylvania Compositions and methods for enhancing the immunogenicity of antigens
WO2010008782A1 (en) 2008-06-23 2010-01-21 The Trustees Of The University Of Pennsylvania Non-hemolytic llo fusion proteins and methods of utilizing same
US7700344B2 (en) 2001-03-26 2010-04-20 The Trustees Of The University Of Pennsylvania Compositions and methods for enhancing the immunogenicity of antigens
US8241636B2 (en) 2006-08-15 2012-08-14 The Trustees Of The University Of Pennsylvania Compositions comprising HMW-MAA and fragments thereof, and methods of use thereof
US8268326B2 (en) 2006-08-15 2012-09-18 The Trustees Of The University Of Pennsylvania Compositions comprising HMW-MAA and fragments thereof, and methods of use thereof
WO2013025925A1 (en) * 2011-08-16 2013-02-21 Advaxis Compositions and methods for prevention of escape mutation in the treatment of her2/neu over-expressing tumors
US8791237B2 (en) 1994-11-08 2014-07-29 The Trustees Of The University Of Pennsylvania Compositions and methods for treatment of non-hodgkins lymphoma
US8956621B2 (en) 1994-11-08 2015-02-17 The Trustees Of The University Of Pennsylvania Compositions and methods for treatment of cervical dysplasia
US9084747B2 (en) 2009-11-11 2015-07-21 Advaxis, Inc. Compositions and methods for prevention of escape mutation in the treatment of HER2/NEU over-expressing tumors
CN105506054A (en) * 2016-02-05 2016-04-20 夏淑平 Listeria monocytogenes selective medium
CN105506055A (en) * 2016-02-05 2016-04-20 夏淑平 Selective medium for listeria monocytogenes of stool sample
US9549973B2 (en) 2000-03-27 2017-01-24 The Trustees Of The University Of Pennsylvania Compositions and methods comprising KLK3 or FOLH1 antigen
US9644212B2 (en) 2008-05-19 2017-05-09 Advaxis, Inc. Dual delivery system for heterologous antigens
US9650639B2 (en) 2008-05-19 2017-05-16 Advaxis, Inc. Dual delivery system for heterologous antigens
WO2017085691A1 (en) * 2015-11-20 2017-05-26 Advaxis, Inc. Manufacturing device and method of an immunotherapeutic formulation comprising a recombinant listeria strain
US9919038B2 (en) 2009-03-04 2018-03-20 The Trustees Of The University Of Pennsylvania Compositions comprising angiogenic factors and methods of use thereof
US9943590B2 (en) 2010-10-01 2018-04-17 The Trustees Of The University Of Pennsylvania Use of Listeria vaccine vectors to reverse vaccine unresponsiveness in parasitically infected individuals
US10016617B2 (en) 2009-11-11 2018-07-10 The Trustees Of The University Of Pennsylvania Combination immuno therapy and radiotherapy for the treatment of Her-2-positive cancers
US10058599B2 (en) 2012-03-12 2018-08-28 Advaxis, Inc. Suppressor cell function inhibition following Listeria vaccine treatment
US10064898B2 (en) 2011-03-11 2018-09-04 Advaxis, Inc. Listeria-based adjuvants
WO2019060115A1 (en) * 2017-09-19 2019-03-28 Advaxis, Inc. Compositions and methods for lyophilization of bacteria or listeria strains
EP3350337A4 (en) * 2015-09-15 2019-04-03 Advaxis, Inc. Manufacturing method of an immunotherapeutic formulation comprising a recombinant listeria strain
US20190322714A1 (en) * 2016-11-30 2019-10-24 Advaxis, Inc. Immunogenic Compositions Targeting Recurrent Cancer Mutations And Methods Of Use Thereof
US20210040468A1 (en) * 2011-03-16 2021-02-11 Biospecifics Technologies Corp. Compositions and methods for producing clostridial collagenases

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5830702A (en) * 1990-10-31 1998-11-03 The Trustees Of The University Of Pennsylvania Live, recombinant listeria monocytogenes and production of cytotoxic T-cell response
US20060121053A1 (en) * 2004-10-18 2006-06-08 Pamela Sweeney High cell density process for growth of Listeria

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5830702A (en) * 1990-10-31 1998-11-03 The Trustees Of The University Of Pennsylvania Live, recombinant listeria monocytogenes and production of cytotoxic T-cell response
US20060121053A1 (en) * 2004-10-18 2006-06-08 Pamela Sweeney High cell density process for growth of Listeria

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
AVIS K. ET AL.: 'Cryopreservatin Application in Pharmaceuticals and Biotechnology. Drug Manufacturing and Technology Series', vol. 5, 1999, COLORADO article WAGNER ET AL.: 'Method selection considerations for long-term preservation of mammalian cells and microorganisms', pages 315 - 359 *
EL-KEST ET AL.: 'Injury and Death of Frozen Listeria Monocytogenes as Affected by Glycerol and Milk Components?' J. DAIRY SCIENCE vol. 74, 1991, pages 1201 - 1208 *
GROUP HODGSON. LISTERIA METHODS, [Online] 2000, Retrieved from the Internet: <URL:http://www.template.bio.warwick.ac.uk/staff/hodgson/listeria/methods.html> *
KATHARIOU S.: 'Tn916-Induced Mutations in the Hemolysin Determinant Affecting Virulence of Listeria monocytogenes' JOURNAL OF BACTERIOLOGY March 1987, pages 1291 - 1297 *
KUHN M. ET AL.: 'Hemolysin Supports Survival But Not Entry of the Intracellular Bacterium Listeria Monocytogenes' INFECTION AND IMMUNITY January 1988, *
SAMBROOK ET AL.: 'Molecular Cloning A Laboratory Manual' COLD SPRING HARBOUR LABORATORY PRESS vol. 3, 1989, page A.5 *

Cited By (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8956621B2 (en) 1994-11-08 2015-02-17 The Trustees Of The University Of Pennsylvania Compositions and methods for treatment of cervical dysplasia
US8114414B2 (en) 1994-11-08 2012-02-14 The Trustees Of The University Of Pennsylvania Compositions and methods for treatment of cervical cancer
US8791237B2 (en) 1994-11-08 2014-07-29 The Trustees Of The University Of Pennsylvania Compositions and methods for treatment of non-hodgkins lymphoma
US9549973B2 (en) 2000-03-27 2017-01-24 The Trustees Of The University Of Pennsylvania Compositions and methods comprising KLK3 or FOLH1 antigen
US7655238B2 (en) 2000-03-29 2010-02-02 The Trustees Of The University Of Pennsylvania Compositions and methods for enhancing the immunogenicity of antigens
US7588930B2 (en) 2000-03-29 2009-09-15 The Trustees Of The University Of Pennsylvania Compositions and methods for enhancing the immunogenicity of antigens
US7635479B2 (en) 2000-03-29 2009-12-22 The Trustees Of The University Of Pennsylvania Composition and methods for enhancing immunogenecity of antigens
US8771702B2 (en) 2001-03-26 2014-07-08 The Trustees Of The University Of Pennsylvania Non-hemolytic LLO fusion proteins and methods of utilizing same
US9499602B2 (en) 2001-03-26 2016-11-22 Advaxis, Inc. Non-hemolytic LLO fusion proteins and methods of utilizing same
US7700344B2 (en) 2001-03-26 2010-04-20 The Trustees Of The University Of Pennsylvania Compositions and methods for enhancing the immunogenicity of antigens
US10166276B2 (en) 2006-05-02 2019-01-01 The Trustees Of The University Of Philadelphia Compositions and methods for treatment of non-hodgkins lymphoma
US8268326B2 (en) 2006-08-15 2012-09-18 The Trustees Of The University Of Pennsylvania Compositions comprising HMW-MAA and fragments thereof, and methods of use thereof
US8241636B2 (en) 2006-08-15 2012-08-14 The Trustees Of The University Of Pennsylvania Compositions comprising HMW-MAA and fragments thereof, and methods of use thereof
WO2008109155A2 (en) 2007-03-08 2008-09-12 The Trustees Of The University Pennsylvania Compositions and methods for treatment of cervical cancer
US11446369B2 (en) 2007-05-10 2022-09-20 Advaxis, Inc. Compositions and methods comprising KLK3 or FOLH1 antigen
US9650639B2 (en) 2008-05-19 2017-05-16 Advaxis, Inc. Dual delivery system for heterologous antigens
US9644212B2 (en) 2008-05-19 2017-05-09 Advaxis, Inc. Dual delivery system for heterologous antigens
EP2942355A1 (en) 2008-06-23 2015-11-11 The Trustees of the University of Pennsylvania Non-hemolytic llo fusion proteins and uses thereof
WO2010008782A1 (en) 2008-06-23 2010-01-21 The Trustees Of The University Of Pennsylvania Non-hemolytic llo fusion proteins and methods of utilizing same
EP3530669A1 (en) 2008-06-23 2019-08-28 The Trustees of the University of Pennsylvania Non-hemolytic llo fusion proteins and uses thereof
US10189885B2 (en) 2008-06-23 2019-01-29 The Trustees Of The University Of Pennsylvania Non-hemolytic LLO fusion proteins and methods of utilizing same
US10695410B2 (en) 2009-03-04 2020-06-30 The Trustees Of The University Of Pennsylvania Compositions comprising angiogenic factors and methods of use thereof
US9919038B2 (en) 2009-03-04 2018-03-20 The Trustees Of The University Of Pennsylvania Compositions comprising angiogenic factors and methods of use thereof
US9084747B2 (en) 2009-11-11 2015-07-21 Advaxis, Inc. Compositions and methods for prevention of escape mutation in the treatment of HER2/NEU over-expressing tumors
US10016617B2 (en) 2009-11-11 2018-07-10 The Trustees Of The University Of Pennsylvania Combination immuno therapy and radiotherapy for the treatment of Her-2-positive cancers
US9017660B2 (en) 2009-11-11 2015-04-28 Advaxis, Inc. Compositions and methods for prevention of escape mutation in the treatment of Her2/neu over-expressing tumors
US9943590B2 (en) 2010-10-01 2018-04-17 The Trustees Of The University Of Pennsylvania Use of Listeria vaccine vectors to reverse vaccine unresponsiveness in parasitically infected individuals
US10064898B2 (en) 2011-03-11 2018-09-04 Advaxis, Inc. Listeria-based adjuvants
US20210040468A1 (en) * 2011-03-16 2021-02-11 Biospecifics Technologies Corp. Compositions and methods for producing clostridial collagenases
WO2013025925A1 (en) * 2011-08-16 2013-02-21 Advaxis Compositions and methods for prevention of escape mutation in the treatment of her2/neu over-expressing tumors
US10058599B2 (en) 2012-03-12 2018-08-28 Advaxis, Inc. Suppressor cell function inhibition following Listeria vaccine treatment
EP3350337A4 (en) * 2015-09-15 2019-04-03 Advaxis, Inc. Manufacturing method of an immunotherapeutic formulation comprising a recombinant listeria strain
WO2017085691A1 (en) * 2015-11-20 2017-05-26 Advaxis, Inc. Manufacturing device and method of an immunotherapeutic formulation comprising a recombinant listeria strain
CN105506055A (en) * 2016-02-05 2016-04-20 夏淑平 Selective medium for listeria monocytogenes of stool sample
CN105506054A (en) * 2016-02-05 2016-04-20 夏淑平 Listeria monocytogenes selective medium
US20190322714A1 (en) * 2016-11-30 2019-10-24 Advaxis, Inc. Immunogenic Compositions Targeting Recurrent Cancer Mutations And Methods Of Use Thereof
US11897927B2 (en) * 2016-11-30 2024-02-13 Advaxis, Inc. Immunogenic compositions targeting recurrent cancer mutations and methods of use thereof
WO2019060115A1 (en) * 2017-09-19 2019-03-28 Advaxis, Inc. Compositions and methods for lyophilization of bacteria or listeria strains
US11179339B2 (en) 2017-09-19 2021-11-23 Advaxis, Inc. Compositions and methods for lyophilization of bacteria or listeria strains

Also Published As

Publication number Publication date
WO2007061848A3 (en) 2007-09-13

Similar Documents

Publication Publication Date Title
WO2007061848A2 (en) Methods for producing, growing, and preserving listeria vaccine vectors
KR101317256B1 (en) Separation of contaminants from Streptococcus pneumoniae polysaccharide by pH manipulation
JP7284156B2 (en) Compositions and methods for lyophilization of bacteria or Listeria strains
Lang et al. Production of ectoine through a combined process that uses both growing and resting cells of Halomonas salina DSM 5928 T
JP6467521B2 (en) Streptomyces and method for producing milbemycin A4 using the same
CN106133131B (en) Novel streptomyces filamentous variants and methods of producing daptomycin using same
CN112011464B (en) Trichoderma reesei for producing ergothioneine
RU2537006C2 (en) RECOMBINANT PLASMID pPA-OPRFI DNA CODING HYBRID RECOMBINANT F-I PROTEIN OF Pseudomonas aeruginosa OUTER MEMBRANE, STRAIN Escherichia coli PA-OPRFI PRODUCING HYBRID RECOMBINANT F-I PROTEIN OF Pseudomonas aeruginosa OUTER MEMBRANE AND METHOD FOR PRODUCING HYBRID RECOMBINANT F-I PROTEIN OF Pseudomonas aeruginosa OUTER MEMBRANE
CN107988136B (en) Marine bdellovibrio bacteriovorus and application thereof in promoting formation of bdelloplast under ampicillin
KR101135649B1 (en) Novel Cryoprotective Exopolysaccharide
Malik Preservation of unicellular gree algae by a liquid-drying method
EP1430109A2 (en) Cultivation of mycobacteria
CN108220217B (en) Attenuated listeria monocytogenes for delivering and expressing exogenous antigen and application thereof
CN108498793B (en) Pseudomonas fragrans DNA vaccine, preparation method and application thereof
US20230173053A1 (en) Lyophilized Live Bordetella Vaccines
US11898139B2 (en) Culturing method for genus Rhizobium bacteria
CN118006534A (en) Cultivation method of escherichia coli recombinant strain with surface expression of African swine fever IrrE protein
CN108048471B (en) Ternary complex toxin with anti-tumor activity and preparation method thereof
JP6103577B2 (en) Green sulfur bacterial mutant and method for producing bacteriochlorophyll c homologue using the same
CN116836902A (en) Bacillus thuringiensis subspecies israeli double-mutation engineering bacterium and construction method and application thereof
CN117904164A (en) Bacillus licheniformis engineering bacteria and application thereof in regulating and controlling gamma-polyglutamic acid with different molecular weights
Lopez et al. Preservation of microbial strains in the wine industry
Samykannu et al. Crystallization and X-Ray Diffraction Studies of Salmonella Invasion Protein D (SipD), Insight Tip Component of Salmonella typhi Type III Secretion System
JP2024010288A (en) Method for producing dried bacterial cell, and dried bacterial cell
WO2013122064A1 (en) Green sulfur bacteria variant and bacteriochlorophyll

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06837912

Country of ref document: EP

Kind code of ref document: A2