WO2011041789A1 - Piscine reovirus immunogenic compositions - Google Patents
Piscine reovirus immunogenic compositions Download PDFInfo
- Publication number
- WO2011041789A1 WO2011041789A1 PCT/US2010/051346 US2010051346W WO2011041789A1 WO 2011041789 A1 WO2011041789 A1 WO 2011041789A1 US 2010051346 W US2010051346 W US 2010051346W WO 2011041789 A1 WO2011041789 A1 WO 2011041789A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- prv
- polypeptide
- seq
- antibody
- nos
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/15—Reoviridae, e.g. calf diarrhea virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
- A61P31/22—Antivirals for DNA viruses for herpes viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/08—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
- C07K16/10—RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5252—Virus inactivated (killed)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5254—Virus avirulent or attenuated
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/70—Multivalent vaccine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2720/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
- C12N2720/00011—Details
- C12N2720/12011—Reoviridae
- C12N2720/12022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2720/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
- C12N2720/00011—Details
- C12N2720/12011—Reoviridae
- C12N2720/12034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2720/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
- C12N2720/00011—Details
- C12N2720/12011—Reoviridae
- C12N2720/12211—Orthoreovirus, e.g. mammalian orthoreovirus
- C12N2720/12222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2720/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
- C12N2720/00011—Details
- C12N2720/12011—Reoviridae
- C12N2720/12211—Orthoreovirus, e.g. mammalian orthoreovirus
- C12N2720/12234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- HSMI Heart and skeletal muscle inflammation
- HSMI is transmissible but the causal agent has not been previously isolated. HSMI is an important disease that threatens aquaculture. There is a need for immunogenic compositions and vaccines suitable for preventing and containing PRV infection and for treating animals having HSMI. This invention addresses these needs.
- the invention relates to Piscine reovirus (PRV), a novel orthoreovirus-like virus associated with Salmon HSMI, and isolated nucleic acids sequences and peptides thereof.
- PRV Piscine reovirus
- the invention is also related to antibodies against antigens derived from PRV and method for generating such antibodies.
- the invention is also related to
- immunogenic compositions for inducing an immune response against PRV in an animal.
- the invention provides a PRV immunogenic composition comprising a PRV nucleic acid.
- the PRV nucleic acid is a nucleic acid sequence of any of SEQ ID NOs: 1-10.
- the PRV nucleic acid comprises least 24 consecutive nucleic acids of any of SEQ ID NOs: 1-10.
- the PRV nucleic acid is substantially identical to the nucleic acid sequence of any of SEQ ID NOs: 1-10.
- the PRV nucleic acid is a variant of any of SEQ ID NOs: 1-10 having at least about 85% identity to SEQ ID NOs: 1-10.
- the variant has at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NOs: 1-10.
- the invention provides a PRV immunogenic composition comprising a PRV polypeptide.
- the PRV polypeptide is a polypeptide encoded by any of SEQ ID NOs: 1-10.
- the PRV polypeptide is a polypeptide encoded by a nucleic acid comprising least 24 consecutive nucleic acids of any of SEQ ID NOs: 1-10.
- the PRV polypeptide is a polypeptide encoded by a nucleic acid that is substantially identical to the nucleic acid sequence of any of SEQ ID NOs: 1-10.
- the PRV polypeptide polypeptide is a polypeptide encoded by a nucleic acid that is a variant of any of SEQ ID NOs: 1-10 having at least about 85% identity to SEQ ID NOs: 1-10.
- the variant has at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NOs: 1-10.
- the PRV polypeptide is a polypeptide comprising the amino acid sequence of SEQ ID NOs: 29-40.
- yet another variant has at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NOs: 1-10.
- the PRV polypeptide is a polypeptide comprising the amino
- the PRV polypeptide is a polypeptide comprising least 8 consecutive amino acids of any of SEQ ID NOs: 29-40. In still a further embodiment, the PRV polypeptide is substantially identical to the amino acid sequence of any of SEQ ID NOs: 29-40. In still another embodiment, the PRV polypeptide is a variant of any of SEQ ID NOs: 29-40 and having at least about 85% identity to SEQ ID NOs: 29-40. In still a further embodiment, the variant has at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NOs: 29-40.
- the invention provides an antibody that binds a PRV or a PRV polypeptide and inhibits, neutralizes or reduces the function or activity of the PRV or PRV polypeptide.
- the antibody is a polyclonal antibody.
- the antibody is a monoclonal antibody.
- the antibody is a teleost antibody.
- the antibody is a salmon antibody.
- the antibody is an IgM antibody.
- the antibody is a chimeric antibody.
- the invention provides an immunogenic composition comprising a killed virus comprising a PRV polypeptide.
- the invention provides an immunogenic composition comprising an attenuated virus comprising a PRV polypeptide.
- any of the immunogenic compositions described herein further comprise at least one excipient, additive or adjuvant.
- any of the immunogenic compositions described herein further comprise at least one polypeptide, or fragment thereof, from an additional virus.
- the invention provides an immunogenic composition comprising a fusion polypeptide, wherein the fusion polypeptide comprises a PRV polypeptide, a fragement, of a variant thereof and at least one polypeptide, or fragment thereof, from an additional virus.
- the additional virus is selected from the group consisting of Sleeping disease virus (SDV); salmon pancreas disease virus (SPDV); infectious salmon anemia (ISAV); Viral hemorrhagic septicemia virus (VHSV); infectious hematopoietic necrosis virus (IHNV); infectious pancreatic necrosis virus (IPNV); spring viremia of carp (SVC); channel catfish virus (CCV); Aeromonas salmonicida; Renibacterium salmoninarum; Moritella viscosis, Yersiniosis;
- SDV Sleeping disease virus
- SPDV salmon pancreas disease virus
- SPDV infectious salmon anemia
- VHSV Viral hemorrhagic septicemia virus
- IHNV infectious hematopoietic necrosis virus
- IPNV infectious pancreatic necrosis virus
- SVC channel catfish virus
- Aeromonas salmonicida Renibacterium salmoninarum
- Pasteurellosis Vibro anguillarum; Vibrio logei; Vibrio ordalii; Vibrio salmonicida; Edwardsiella ictaluri; Edwardsiella tarda; Cytophaga columnari; or Piscirickettsia salmonis.
- the invention provides a method of inducing an immune response in an animal, the method comprising administering any PRV immunogenic composition described herein.
- the invention provides a method for preventing, or reducing PRV infection in an animal, the method comprising administering any PRV
- the invention provides a method for preventing, or reducing PRV infection in an animal, the method comprising administering to the animal any antibody described herein.
- the method of any administration in the methods described herein is oral admistration, immersion administration or injection administration.
- the invention provides for use of any of the immunogenic compositions described herein in the manufacture of a vaccine for the treatment of condition PRV infection in an animal.
- the invention provides for use of any of the immunogenic compositions described herein in the manufacture of a vaccine for preventing or reducing a condition PRV infection in an animal.
- FIG. 1 Piscine reovirus (PRV) sequence obtained by pyrosequencing.
- Genomic regions identified by BLASTN, BLASTX, FASTX, and FASD are shown in red, blue, green, and orange respectively.
- FIG. 1 Phylogenetic analysis of the R A-dependent RNA-polymerase of Reoviridae. Full length amino acid sequences were aligned using the ClustalX14 implemented on MEGA software (Tamura et al, Mol Biol Evol 24, 1596-1599 (2007)) and refined using T-Coffee (Notredame et al, J Mol Biol 302, 205-217 (2000)) to incorporate protein structure data. Phylogenetic analysis was performed using p- distance as model of amino acid substitution as implemented by ICTV for analysis of the Reoviridae family (Mertens et al., T. Family Reoviridae. 447-454 (Elsevier Academic Press, 2005)). MEGA was used to produce phylogenetic trees, reconstructed through the Neighbor Joining (NJ) method. The statistical significance of a particular tree topology was evaluated by bootstrap re-sampling of the sequences 1000 times.
- NJ Neighbor Joining
- Figure 3 Graphical representation of group differences in the log ratio of virus load normalized to a salmon host gene. Nonparametric approaches were used to determine statistical significance for comparisons of the relative viral load among healthy and HSMI-affected farmed fish. Log transformations, which did not normalize log ratio distributions, were nonetheless performed for all samples after calculating LI (virus) / EF1A (housekeeping) ratios to aid in graphical representation.
- Figure 3 A shows a comparison of adjusted log ratio in mixed heart and kidney samples from healthy farmed fish and farmed fish with HSMI; *, p ⁇ 0.0001 (Mann- Whitney U).
- Figure 3B shows a comparison of adjusted log ratios in farmed fish without HSMI (healthy farmed fish), in the early phase of an HSMI outbreak, in the middle of an HSMI outbreak, and during the peak of an HSMI outbreak; **, p ⁇ 0.0005; *, p ⁇ 0.01 (individual Mann- Whitney U). Adjusted log ratios also differed significantly across all four farmed fish groups (p ⁇ 0.0001; Kruskal-Wallis).
- Figure 4 In situ hybridization was performed using locked nucleic acid (LNA) probes targeting the L2 segment of the Piscine reovirus. Sections were permeabilized using proteinase K followed by hybridization with digoxigenin (DIG)-labeled LNA probes. Sections were incubated with a mouse monoclonal anti-DIG-horse radish peroxidase and stained using a Tyramide Signal Amplification System. Sections were counterstained with Meyer's hematoxylin solution.
- Figure 4A shows heart from HSMI- infected fish (lOx).
- Figure 4B shows heart from HSMI-infected fish (40x).
- Figure 4C shows heart from non-infected fish (40x).
- Figure 4D shows heart from a fish infected with salmon pancreas disease virus.
- FIG. 5 Phylogenetic analysis of the Lambda- 1 ORF of the Aquareovirus and Orthoreo virus. Bayesian phylogenetic analyses of sequence differences among segments ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS ( ⁇ and ⁇ 3 of aquareovirus and orthoreovirus had different genomic organizations) were conducted using BEAST, BEAUti and Tracer analysis software packages. Preliminary analyses were run for 10,000,000 generations with the Dayhoff amino acid substitution model to select the clock and demographic models most appropriate for each ORF. An analysis of the marginal likelihoods indicated that the relaxed lognormal molecular clock and constant population size model was chosen for all datasets.
- FIG. 6 Phylogenetic analysis of the Lambda-2 ORF of the Aquareovirus and Orthoreovirus. Bayesian phylogenetic analyses of sequence differences among segments ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS ( ⁇ and ⁇ 3 of aquareovirus and orthoreovirus had different genomic organizations) were conducted using BEAST, BEAUti and Tracer analysis software packages. Preliminary analyses were run for 10,000,000 generations with the Dayhoff amino acid substitution model to select the clock and demographic models most appropriate for each ORF. An analysis of the marginal likelihoods indicated that the relaxed lognormal molecular clock and constant population size model was chosen for all datasets.
- FIG. 7 Phylogenetic analysis of the Lambda-3 ORF of the Aquareovirus and Orthoreovirus. Bayesian phylogenetic analyses of sequence differences among segments ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS ( ⁇ and ⁇ 3 of aquareovirus and orthoreovirus had different genomic organizations) were conducted using BEAST, BEAUti and Tracer analysis software packages. Preliminary analyses were run for 10,000,000 generations with the Dayhoff amino acid substitution model to select the clock and demographic models most appropriate for each ORF. An analysis of the marginal likelihoods indicated that the relaxed lognormal molecular clock and constant population size model was chosen for all datasets.
- FIG. 8 Phylogenetic analysis of the Mu-1 ORF of the Aquareovirus and Orthoreovirus. Bayesian phylogenetic analyses of sequence differences among segments ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS ( ⁇ and ⁇ 3 of aquareovirus and orthoreovirus had different genomic organizations) were conducted using BEAST, BEAUti and Tracer analysis software packages. Preliminary analyses were run for 10,000,000 generations with the Dayhoff amino acid substitution model to select the clock and demographic models most appropriate for each ORF. An analysis of the marginal likelihoods indicated that the relaxed lognormal molecular clock and constant population size model was chosen for all datasets.
- FIG. 9 Phylogenetic analysis of the Mu-2 ORF of the Aquareovirus and Orthoreovirus.
- Bayesian phylogenetic analyses of sequence differences among segments ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS were conducted using BEAST, BEAUti and Tracer analysis software packages. Preliminary analyses were run for 10,000,000 generations with the Dayhoff amino acid substitution model to select the clock and demographic models most appropriate for each ORF. An analysis of the marginal likelihoods indicated that the relaxed lognormal molecular clock and constant population size model was chosen for all datasets.
- FIG. 10 Phylogenetic analysis of the Mu-3 ORF of the Aquareovirus and Orthoreovirus. Bayesian phylogenetic analyses of sequence differences among segments ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS ( ⁇ and ⁇ 3 of aquareovirus and orthoreovirus had different genomic organizations) were conducted using BEAST, BEAUti and Tracer analysis software packages. Preliminary analyses were run for 10,000,000 generations with the Dayhoff amino acid substitution model to select the clock and demographic models most appropriate for each ORF. An analysis of the marginal likelihoods indicated that the relaxed lognormal molecular clock and constant population size model was chosen for all datasets.
- FIG. 11 Phylogenetic analysis of the Sigma-2 ORF of the Aquareovirus and Orthoreovirus. Bayesian phylogenetic analyses of sequence differences among segments ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS ( ⁇ and ⁇ 3 of aquareovirus and orthoreovirus had different genomic organizations) were conducted using BEAST, BEAUti and Tracer analysis software packages. Preliminary analyses were run for 10,000,000 generations with the Dayhoff amino acid substitution model to select the clock and demographic models most appropriate for each ORF. An analysis of the marginal likelihoods indicated that the relaxed lognormal molecular clock and constant population size model was chosen for all datasets.
- FIG. 12 Phylogenetic analysis of the Sigma-NS ORF of the Aquareovirus and Orthoreovirus. Bayesian phylogenetic analyses of sequence differences among segments ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS ( ⁇ and ⁇ 3 of aquareovirus and orthoreovirus had different genomic organizations) were conducted using BEAST, BEAUti and Tracer analysis software packages. Preliminary analyses were run for 10,000,000 generations with the Dayhoff amino acid substitution model to select the clock and demographic models most appropriate for each ORF. An analysis of the marginal likelihoods indicated that the relaxed lognormal molecular clock and constant population size model was chosen for all datasets.
- HP hydrophobic region
- TM transmembrane domain
- BR basic region
- the pathology of PRV infection can include liver discoloration, heamopericardium, congestion in fatty tissue and swollen spleen.
- Figure 15 Coverage by pyrosequencing.
- Figure 16 Phylogenetic analysis of PRV, Orthoreovirus and Aquareovirus.
- Figure 17 Diagnosis of HSMI showing infiltration of the epicardium as well as severe inflammation of the myocardium.
- Figure 18A shows outer capsid proteins ⁇ , ⁇ 3, ⁇ 2, ⁇ and inner capsid proteins ⁇ , ⁇ 2, ⁇ 2, and ⁇ 3.
- Figure 18B shows amplification of ⁇ , ⁇ 3 and full length segments by PCR.
- Figure 18C shows that the amplified segments can be cloned into an expression vector to make an expression construct. The expression can be used to express antigens in an expression system (e.g. E. coli). The antigens can then be purified and used to immunize rabbits.
- an expression system e.g. E. coli
- Figure 19 shows FAST (fusion-associated small transmembrane protein encoded by S4.
- Figure 19B shows the variation of the antigenic index as a function of amino acid position. The higher the antigenic index, the more likely should be that antibodies would "see" those groups of residues.
- Figure 20 The antiserum recognizes the protein as found in Western blots of E.coli His-tag fusion protein. Lines 11-13, eluates of purified protein; L14-15, dilutions of pellet of induced bacteria, L16-L17 pellet of non-induced bacteria
- Figure 21 The antiserum recognizes the ⁇ 2 protein as found in western blots of E.coli His-tag fusion protein and different negative controls. Lines 2-4, eluates of purified protein; L5-6, dilutions of pellet of induced bacteria, L7-L8 pellet of non- induced bacteria.
- PRV refers to isolates of the Piscine reoviruses described herein.
- animal refers to a vertebrate, including, but not limited to a teleost (e.g. salmon).
- PRV polypeptide includes a PRV polypeptide, a PRV polypeptide fragment or a PRV polypeptide variant, or a polypeptide substantially identical to a PRV polypeptide.
- the term “antibody” refers to an antibody that binds to a PRV polypeptide, a PRV polypeptide fragment or a PRV polypeptide variant, or a polypeptide substantially identical to a PRV polypeptide and inhibit, neutralize or reduce the activity or function of a PRV polypeptide or a PRV.
- the term antibody specifically excludes diagnostic antibodies which bind a PRV polypeptide, a PRV polypeptide fragment or a PRV polypeptide variant, or a polypeptide substantially identical to a PRV polypeptide and which do not inhibit, neutralize or reduce the activity or function of the polypeptide or the PRV.
- HSMI appears 5 to 9 months after fish are transferred from fresh water to ocean pens (Kongtorp et al., J Fish Dis 27, 351- 358 (2004)), but outbreaks have been recorded as early as 14 days following seawater transfer.
- Affected fish are anorexic and display abnormal swimming behavior.
- Autopsy findings typically include a pale heart, yellow liver, ascites, swollen spleen and petechiae in the perivisceral fat.
- the pathology is further characterized by epi-, endo- and myocarditis, myocardial necrosis, myositis and necrosis of red skeletal muscle, and up to 20% mortality (Kongtorp et al, Dis Aquat Organ 59, 217-224 (2004)). While mortality is variable (up to 20%), morbidity may be very high in affected cages. HSMI is diagnosed on the basis of histopathology. The major pathological changes occur in the myocardium and red skeletal muscle, where extensive inflammation and multifocal necrosis of myocytes are evident.
- the present invention shows that HSMI is associated with infection with a novel reo virus termed Piscine reo virus (PRV).
- PRV was identified through high-throughput pyrosequencing of serum and heart tissue of experimentally infected fish using novel frequency analysis methods as well as standard alignment methods.
- the present invention provides PRV nucleic acid sequences.
- the invention is directed to expression constructs, for example plasmids and vectors, and isolated nucleic acids which comprise PRV nucleic acid sequences of SEQ ID NOs: 1-10, fragments, complementary sequences, and/or variants thereof.
- nucleic acid sequences and polypeptides described herein may be useful for multiple applications, including, but not limited to, generation of antibodies and generation of immunogenic compositions.
- the invention is directed to an immunogenic composition comprising a polypeptide encoded by a PRV nucleic sequence acid of any one of SEQ ID NOs: 1-10.
- the invention is directed to an immunogenic composition
- a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 29-40.
- the invention provides an isolated PRV nucleic acid having the sequence of any of SEQ ID NOs: 1-10, or a fragment thereof.
- the invention provides an isolated PRV nucleic acid which comprises consecutive nucleotides having a sequence selected from the group consisting of any of SEQ ID NOs: 1-10, or a fragment thereof.
- the invention provides an isolated PRV nucleic acid which comprises consecutive nucleotides having a sequence selected from a variant of any of SEQ ID NOs: 1-10 or a fragment thereof.
- the variant has at least about 85% identity to SEQ ID NOs: 1-10, or a fragment thereof.
- the variant has at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NOs: 1-10, or a fragment thereof.
- the invention provides an isolated PRV nucleic acid
- the invention provides an isolated PRV nucleic acid which comprises consecutive nucleotides complementary to a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
- the invention provides an isolated PRV nucleic acid which comprises consecutive nucleotides complementary to a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
- the variant has at least about 85% identity to SEQ ID NOs: 1-10, or a fragment thereof.
- the variant has at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NOs: 1-10, or a fragment thereof.
- the invention provides an isolated PRV nucleic acid having a sequence substantially identical to a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
- the invention provides an isolated PRV nucleic acid having a sequence substantially identical to a sequence complementary to a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
- the PRV nucleic acid sequences described herein may be useful for, inter alia, expression of PRV -encoded proteins or fragments, variants, or derivatives thereof, generation of antibodies against PRV proteins, generating vaccines against Piscine reoviruses, and screening for drugs effective against Piscine reoviruses as described herein.
- the invention provides an isolated PRV polypeptide encoded by a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
- the PRV polypeptide fragment can be a polypeptide comprising about 8 consecutive amino acids of a PRV polypeptide described herein. In another embodiment, the fragment can be a polypeptide comprising about 10
- the fragment can be a polypeptide comprising about 14 consecutive amino acids of a PRV polypeptide described herein. In another embodiment, the fragment can be a polypeptide comprising about 16 consecutive amino acids of a PRV polypeptide described herein. In another embodiment, the fragment can be a polypeptide comprising about 18 consecutive amino acids of a PRV polypeptide described herein. In another embodiment, the fragment can be a polypeptide comprising about 20 consecutive amino acids of a PRV polypeptide described herein. In another embodiment, the fragment can be a polypeptide comprising about 21 or more consecutive amino acids of a PRV polypeptide described herein.
- the PRV polypeptide fragment can be a polypeptide comprising from about 8 to about 50, about 8 to about 100, about 8 to about 200, about 8 to about 300, about 8 to about 400, about 8 to about 500, about 8 to about 600, about 8 to about 700, about 8 to about 800, about 8 to about 900 or more consecutive amino acids from a PRV polypeptide.
- the invention provides an isolated PRV polypeptide encoded by a nucleic acid which comprises consecutive nucleotides having a sequence selected from a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
- the invention provides an isolated PRV polypeptide encoded by a nucleic acid which comprises consecutive nucleotides having a sequence selected from a variant of a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10 or a fragment thereof.
- the variant has at least about 85% identity to SEQ ID NOs: 1-10, or a fragment thereof.
- the variant has at least about 90%>, about 95.5%, about 96%>, about 96.5%>, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NOs: 1-10, or a fragment thereof.
- the invention provides an isolated PRV polypeptide encoded by a nucleic acid complementary a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
- the invention provides an isolated PRV polypeptide encoded by a nucleic acid which comprises consecutive nucleotides a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
- the invention provides an isolated PRV polypeptide encoded by a nucleic acid having a sequence substantially identical to a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
- the invention provides an isolated PRV polypeptide encoded by a nucleic acid having a sequence substantially identical to a sequence
- the invention provides an isolated PRV polypeptide having the sequence of any of SEQ ID NOs: 29-40, or a fragment thereof.
- the invention provides an isolated PRV polypeptide which comprises consecutive amino acids having a sequence selected from the group consisting of any of SEQ ID NOs: 29-40, or a fragment thereof.
- the invention provides an isolated PRV polypeptide which comprises consecutive amino acids having a sequence selected from a variant of any of SEQ ID NOs: 29-40, or a fragment thereof.
- the variant has at least about 85% identity to SEQ ID NOs: 29-40, or a fragment thereof.
- the variant has at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NOs: 1-10, or a fragment thereof.
- the invention provides an isolated PRV polypeptide having a sequence substantially identical to a PRV amino acid sequence in any of SEQ ID NOs: 29-40, or a fragment thereof.
- the PRV polypepetides and amino acid sequences described herein may be useful for, inter alia, expression of PRV -encoded proteins or fragments, variants, or derivatives thereof, and generating vaccines against Piscine reo viruses.
- the invention provides an isolated PRV polypeptide encoded by a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
- the isolated PRV polypeptide fragment can be a
- the fragment can be a polypeptide comprising about 8 consecutive amino acids of a PRV amino acid sequence of any of SEQ ID NOs: 29-40. In another embodiment, the fragment can be a polypeptide comprising about 10 consecutive amino acids of a PRV amino acid sequence of any of SEQ ID NOs: 29-40. In another embodiment, the fragment can be a polypeptide comprising about 14 consecutive amino acids of a PRV amino acid sequence of any of SEQ ID NOs: 29-40. In another embodiment, the fragment can be a polypeptide comprising about 16 consecutive amino acids of a PRV amino acid sequence of any of SEQ ID NOs: 29-40. In another embodiment, the fragment can be a polypeptide comprising about 18 consecutive amino acids of a PRV amino acid sequence of any of SEQ ID NOs: 29-40.
- the fragment can be a polypeptide comprising about 20 consecutive amino acids of a PRV amino acid sequence of any of SEQ ID NOs: 29-40. In another embodiment, the fragment can be a polypeptide comprising about 21 or more consecutive amino acids of a PRV amino acid sequence of any of SEQ ID NOs: 29-40.
- the isolated PRV polypeptide fragment can be a polypeptide comprising from about 8 to about 50, about 8 to about 100, about 8 to about 200, about 8 to about 300, about 8 to about 400, about 8 to about 500, about 8 to about 600, about 8 to about 700, about 8 to about 800, about 8 to about 900 or more consecutive amino acids of a PRV amino acid sequence of any of SEQ ID NOs: 29-40.
- the invention provides an isolated PRV polypeptide which comprises consecutive amino acids having a sequence selected from a PRV amino acid sequence of any of SEQ ID NOs: 29-40.
- the invention provides an isolated PRV polypeptide which comprises consecutive nucleotides having a sequence selected from a variant a PRV amino acid sequence of any of SEQ ID NOs: 29-40, or a fragment thereof.
- the variant has at least about 85% identity to any of SEQ ID NOs: 29-40, or a fragment thereof.
- the variant has at least about 90%>, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to any of SEQ ID NOs: 29-40, or a fragment thereof.
- the invention provides an isolated PRV polypeptide substantially identical to variant a PRV amino acid sequence of any of SEQ ID NOs: 29-40, or a fragment thereof.
- substantially identical in the context of two nucleic acids or polypeptides, refers to two or more sequences or subsequences that have at least of at least 98%>, at least 99% or higher nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection.
- polypeptides that a substantially identical to the PRV polypeptides described herein can also be used to generate antibodies that bind to the PRV polypeptides described herein.
- Percent identity in the context of two or more nucleic acids or polypeptide sequences, refers to the percentage of nucleotides or amino acids that two or more sequences or subsequences contain which are the same.
- a specified percentage of amino acid residues or nucleotides can have a specified identity over a specified region, when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
- the invention provides a PRV polypeptide which is a variant of a PRV polypeptide and has at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to a PRV polypeptide shown in SEQ ID NOs 29-40.
- PRV polypeptides and the antibodies and antibody generation methods related thereto encompass PRV polypeptides isolated from different virus isolates that have sequence identity levels of at least about 90%, while still representing the same PRV protein with the same immunological characteristics.
- sequence identities can be determined by analysis with a sequence comparison algorithm or by a visual inspection. Protein and/or nucleic acid sequence identities (homologies) can be evaluated using any of the variety of sequence comparison algorithms and programs known in the art.
- sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
- test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
- sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
- sequence comparison of nucleic acids and proteins the BLAST and BLAST 2.2.2. or FASTA version 3.0t78 algorithms and the default parameters discussed below can be used.
- BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and proteins of the invention.
- Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information
- the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
- the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Natl. Acad. Sci. U.S.A. 90:5873-5787, 1993).
- One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
- P(N) the smallest sum probability
- a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, less than about 0.01, and less than about 0.001.
- PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments to show relationship and percent sequence identity. It also plots a tree or dendogram showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. Mol. Evol. 35:351-360, 1987. The method used is similar to the method described by Higgins & Sharp, CABIOS 5: 151-153, 1989. The program can align up to 300 sequences, each of a maximum length of 5,000 nucleotides or amino acids.
- the multiple alignment procedure begins with the pairwise alignment of the two most similar sequences, producing a cluster of two aligned sequences. This cluster is then aligned to the next most related sequence or cluster of aligned sequences. Two clusters of sequences are aligned by a simple extension of the pairwise alignment of two individual sequences. The final alignment is achieved by a series of progressive, pairwise alignments.
- the program is run by designating specific sequences and their amino acid or nucleotide coordinates for regions of sequence comparison and by designating the program parameters.
- PILEUP a reference sequence is compared to other test sequences to determine the percent sequence identity relationship using the following parameters: default gap weight (3.00), default gap length weight (0.10), and weighted end gaps.
- PILEUP can be obtained from the GCG sequence analysis software package, e.g., version 7.0 (Devereaux et al, Nuc. Acids Res. 12:387-395, 1984.
- the invention provides a computer readable medium having stored thereon (i) a nucleic acid sequence selected from the group consisting of: a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, a sequence substantially identical to a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10; a sequence variant of a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10; or (ii) an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of: a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, an amino acid sequence encoded by a sequence substantially identical to a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10; an amino acid sequence encoded by a sequence variant of a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10.
- the polypeptides described herein can be used for raising antibodies (e.g. for vaccination purposes).
- the invention provides antibody that binds a PRV polypeptide, a PRV polypeptide fragment or a PRV polypeptide variant, or a polypeptide substantially identical to a PRV polypeptide and wherein the antibody is a vaccine antibody that inhibits, neutralizes or reduces the activity or function of the polypeptide or a PRV.
- the antibody is a polyclonal antibody, a monoclonal antibody, a teleost antibody or a chimeric antibody. Methods for purifying immunoglobulins from teleosts are also known in the art.
- the invention provides a PRV immunogenic composition comprising a PRV polypeptide, a PRV polypeptide fragment or a PRV polypeptide variant, or a polypeptide substantially identical to a PRV polypeptide.
- immunogenic polypeptide refers to a PRV
- immunogenic polypeptide also refers to a PRV polypeptide, or a fragment of a PRV polypeptide that can be used to generate an antibody against the PRV polypeptide, or a fragment of a PRV polypeptide using other antibody generation techniques known in the art, including, but not limited to, hybridoma, phage display and ribosome display technologies.
- the invention provides a PRV vaccine composition comprising a PRV nucleic acid, a PRV nucleic acid fragment or a PRV nucleic acid variant, a nucleic acid substantially identical to a PRV nucleic acid, a PRV polypeptide, a PRV polypeptide fragment or a PRV polypeptide variant, or a polypeptide
- the invention is directed to methods for generating antibodies that bind to the PRV polypeptides described herein by generating antibodies that bind to a fragment of a polypeptide described herein.
- vaccines for combating PRV infection that comprise a protein or immunogenic fragments of a PRV
- Still another embodiment of the present invention relates to the PRV proteins described herein or immunogenic fragments thereof for use in a vaccine.
- the invention relates to the use of the PRV proteins described herein or immunogenic fragments thereof for the manufacturing of a vaccine for combating PRV infections.
- the PRV immunogenic compositions and PRV vaccines described herein are capable of ameliorating the symptoms of a PRV infection and/or of reducing the duration of a PRV infection.
- the immunogenic compositions are capable of inducing protective immunity against PRV infection.
- the immunogenic compositions of the invention can be effective against the PRV disclosed herein, and may also be cross-reactive with, and effective against, multiple different clades and strains of PRV, and against other reoviruses.
- the invention provides a nucleic acid vectors comprising a PRV nucleic acid sequence, a PRV nucleic acid fragment or a PRV nucleic acid variant, or a nucleic acid substantially identical to a PRV nucleic acid.
- the invention provides a nucleic acid vector encoding a PRV polypeptide, a PRV polypeptide fragment or a PRV polypeptide variant, or a
- Non-limiting examples of vectors include, but are not limited to retroviral, adenoviral, adeno-associated viral, lentiviral, and vesiculostomatitis viral vectors.
- the invention provides a host organism comprising a nucleic acid vector encoding a PRV polypeptide, a PRV polypeptide fragment or a PRV polypeptide variant, or a polypeptide substantially identical to a PRV polypeptide.
- the host organism is a prokaryote, a eukaryote, or a fungus.
- the organism is a teleost (e.g. a salmon).
- the invention provides a method of inducing an immune response in an animal (e.g. a salmon), the method comprising administering a PRV nucleic acid, a PRV polypeptide or a PRV immunogenic composition to the animal.
- an animal e.g. a salmon
- Methods for administering polypeptides to animals (e.g. teleosts), and methods for generating immune responses in animals (e.g. teleosts) by administering immunogenic peptides in immunogenically effective amounts are known in the art.
- IgD, IgZ, IgT and IgH immunoglobulins have also been identified in teleosts (Hordvik et al, (1999) Scandinavian Journal of Immunology, 50, 202-2101; Hirono et al, (2003) Fish & Shellfish Immunology, 15, 63-70; Danilova et al, (2000) Immunogenetics, 52, 81-91; Hansen et al, (1994) Molecular Immunology, 31, 499- 501; Savan et al, (2005) European Journal of Immunology, 35, 3320-3331).
- polypeptides described herein can be used in the form of a PRV
- an immunogenic composition to vaccinate an animal e.g. a teleost
- an animal e.g. a teleost
- An immunogenic composition for use in vaccination can also include attenuated live viral vaccines, inactivated (killed) viral vaccines, and subunit vaccines.
- PRVs may be attenuated by removal or disruption of viral sequences whose products cause or contribute to the disease and symptoms associated with PRV infection, and leaving intact those sequences required for viral replication.
- PRV vaccines may also comprise inactivated PRV, such as by chemical treatment, to "kill" the viruses such that they are no longer capable of replicating or causing disease in animals, but still induce an immune response in an animal (e.g. a salmon).
- inactivated PRV such as by chemical treatment
- suitable viral inactivation methods known in the art and one of skill in the art can readily select a suitable method and produce an inactivated "killed" PRV suitable for use as a vaccine.
- Methods of purification of polypeptides and of inactivated virus are known in the art and may include one or more of, for instance gradient centrifugation, ultracentrifugation, continuous-flow ultracentrifugation and chromatography, such as ion exchange chromatography, size exclusion chromatography, and liquid affinity chromatography. Additional method of purification include ultrafiltration and dialfiltration. See J P Gregersen "Hergori von Virussimpfstoffen aus Zellkulturen” Chapter 4.2 in Pharmazeutician Biotechnology (eds. O. Kayser and R H Mueller)ticianliche Verlagsgesellschaft, Stuttgart, 2000. See also, O'Neil et al, "Virus Harvesting and Affinity Based Liquid Chromatography. A Method for Virus
- Polypeptides and viruses can be purified using chromatography, such as ion exchange, chromatography. Chromatic purification allows for the production of large volumes of virus containing suspension.
- the viral product of interest can interact with the chromatic medium by a simple adsorption/desorption mechanism, and large volumes of sample can be processed in a single load. Contaminants which do not have affinity for the adsorbent pass through the column. The virus material can then be eluted in concentrated form.
- Anion exchange resins that may be used include DEAE, EMD TMAE.
- Cation exchange resins may comprise a sulfonic acid-modified surface.
- Viruses can be purified using ion exchange chromatography comprising a strong anion exchange resin (e.g. EMD TMAE) for the first step and EMD-SO 3 (cation exchange resin) for the second step.
- a metal-binding affinity chromatography step can optionally be included for further purification. (See, e.g., WO 97/06243).
- a resin such as Fractogel EMD can also be used This synthetic methacrylate based resin has long, linear polymer chains covalently attached and allows for a large amount of sterically accessible ligands for the binding of biomolecules without any steric hindrance.
- MCS Matrex Cellufme Sulfate
- a resin for use in purification method is Matrex Cellufme Sulfate (MCS).
- MCS consists of a rigid spherical (approx. 45-105 ⁇ diameter) cellulose matrix of 3,000 Dalton exclusion limit (its pore structure excludes macromolecules), with a low concentration of sulfate ester functionality on the 6- position of cellulose.
- the functional ligand (sulfate ester) is relatively highly dispersed, it presents insufficient cationic charge density to allow for most soluble proteins to adsorb onto the bead surface. Therefore the bulk of the protein found in typical virus pools (cell culture supernatants, e.g. pyrogens and most contaminating proteins, as well as nucleic acids and endotoxins) are washed from the column and a degree of purification of the bound virus is achieved.
- Inactivated viruses may be further purified by gradient centrifugation, or density gradient centrifugation.
- gradient centrifugation or density gradient centrifugation.
- density gradient centrifugation For commercial scale operation a continuous flow sucrose gradient centrifugation would be an option. This method can be used to purify antiviral vaccines and is known to one skilled in the art.
- Additional purification methods which may be used to purify viruses of the invention include the use of a nucleic acid degrading agent, a nucleic acid degrading enzyme, such as a nuclease having DNase and RNase activity, or an endonuclease, such as from Serratia marcescens, membrane adsorbers with anionic functional groups or additional chromatographic steps with anionic functional groups (e.g. DEAE or TMAE).
- An ultrafiltration/dialfiltration and final sterile filtration step could also be added to the purification method.
- the purified immunogenic preparations described herein can be substantially free of contaminating proteins derived from the cells or cell culture and can comprise less than about 1000, 500, 250, 150, 100, or 50 pg cellular nucleic acid ⁇ g virus antigen, and less than about 1000, 500, 250, 150, 100, or 50 pg cellular nucleic acid/dose.
- vaccination of animals may be performed by directly injecting the PRV polypeptides, fragments or variants thereof into the animal to generate an immunogenic response.
- the PRV polypeptides can be injected by themselves, or as immunogenic PRV compositions comprising other components, including, for example, excipients, additives and adjuvants.
- the PRV nucleic acid sequences of the invention can be delivered to cultured cells, for example by transfecting cultured cells with plasmids or expression vectors containing PRV nucleic acid sequences, or by infecting cultured cells with recombinant viruses containing PRV nucleic acid sequences.
- PRV polypeptides may then be expressed in a host cell or expression system and purified.
- a host cell may be a cell of bacterial origin, e.g. Escherichia coli, Bacillus subtilis and Lactobacillus species, in combination with bacteria-based plasmids as pBR322, or bacterial expression vectors as pGEX, or with bacteriophages.
- the host cell may also be of eukaryotic origin, e.g. yeast-cells in combination with yeast-specific vector molecules, or higher eukaryotic cells like insect cells (Luckow et al; Bio-technology 6: 47-55 (1988)) in combination with vectors or recombinant baculoviruses, plant cells in combination with e.g. Ti-plasmid based vectors or plant viral vectors (Barton, K. A. et al; Cell 32: 1033 (1983), mammalian cells like Hela cells, Chinese Hamster Ovary cells (CHO) or Crandell Feline Kidney- cells, also with appropriate vectors or recombinant viruses.
- yeast-cells in combination with yeast-specific vector molecules
- higher eukaryotic cells like insect cells (Luckow et al; Bio-technology 6: 47-55 (1988)) in combination with vectors or recombinant baculoviruses
- plant cells in combination with e.g. Ti-plasmid
- in vitro expression systems such as in-vitro transcription and in-vitro translation systems can also be used to generate the PRV polypeptides described herein.
- the purified proteins can then be incorporated into compositions suitable for administration to animals. Methods and techniques for expression and purification of recombinant proteins are well known in the art, and any such suitable methods may be used.
- Vaccination may also be performed by direct vaccination with a DNA encoding a PRV polypeptide.
- the nucleic acid is administered to the animal, and the immunogenic polypeptide(s) encoded by the nucleic acid are expressed in the animal, such that an immune response against the proteins or peptides is generated in the animal.
- Subunit vaccines may also be proteinaceous vaccines, which contain the viral proteins or subunits themselves, or portions of those proteins or subunits. Any suitable plasmid or expression vector capable of driving expression of a polypeptide may be used. Plasmids and expression vectors can include a promoter for directing transcription of the nucleic acid.
- the nucleic acid sequence encoding PRV polypeptides may also be incorporated into a suitable recombinant virus for
- suitable viruses include, but are not limited to, vaccinia viruses, retroviruses, adenoviruses and adeno-associated viruses.
- vaccinia viruses retroviruses
- adenoviruses adeno-associated viruses.
- Vaccination with the PRV nucleic acids and polypeptides described herein can also be performed using live recombinant carriers capable of expressing the polypeptides described herein.
- Live recombinant carriers are micro-organisms or viruses in which additional genetic information, e.g. a nucleic acid sequence encoding a PRV polypeptide, or a fragment thereof has been cloned. Fish infected with such live recombinant carriers will produce an immunological response not only against the immunogens of the carrier, but also against the PRV polypeptide or PRV polypeptide fragment.
- live recombinant carriers suitable for use with the methods described herein includes Vibrio anguillarum (Singer, J. T. et al. New
- passive vaccination can be performed by raising PRV antibodies in a first animal species (e.g. a rabbit), from antibody-producing cell lines, or from in- vitro techniques before administering such antibodies (in purified or unpurified form) to second animal species (e.g. a teleost).
- first animal species e.g. a rabbit
- second animal species e.g. a teleost
- This type of passive vaccination can be used when the second animal is already infected with a PRV.
- passive vaccination can be useful where the infection in the second animal cannot, or has not had sufficient time to mount an immune response to the infection.
- Vaccination with the PRV nucleic acids and polypeptides described herein can be performed in teleosts by injection, immersion, dipping or through oral administration.
- the administration protocol can be optimized in accordance with standard vaccination practice
- the PRV nucleic acids, polypeptides or immunogenic compositions described herein can be mixed with feed, coated on the feed or be administered in an encapsulated form.
- vaccination may be performed by incubating live feed such as Artemia nauplii, copepods or rotifers in a PRV vaccine suspension prior to feeding an animal (e.g. a teleost) such that ingestion of the live feed will cause the PRV vaccine to accumulate in the digestive tract of the animal undergoing vaccination.
- live feed such as Artemia nauplii, copepods or rotifers in a PRV vaccine suspension
- an animal e.g. a teleost
- Carriers suitable for use in oral vaccination include both metabolizable and non-metabolizable substances.
- Vaccination of teleosts can also be performed by immersion protocols. Skin and gill epithelia in fish have mucosal surfaces that contribute to the recognition of pathogens by adsorbing antigens. Adsorption in turn results in the activation of antibody producing cells as part of the immune response.
- vaccination of fish with the polypeptides described herein can be performed by immersing fish in water containing a PRV vaccine composition. At least two types of immersion vaccination can be used in conjunction with the polypeptides described herein.
- dip vaccination fish are immersed in water comprising for a short period of time (e.g. about 30 seconds) in a concentrated vaccine solution (e.g. 1 part vaccine, 9 parts water).
- immersion occurs for longer periods of time (e.g. several hours) in water containing lower vaccine concentrations.
- PRV vaccine In bath vaccination, immersion occurs for longer periods of time (e.g. several hours) in water containing lower vaccine concentrations.
- One skilled in the art will readily be able to determine the dilution of PRV vaccine and the duration of immersion sufficient to induce a immune reaction in an immersion protocol.
- Another method for vaccinating teleosts with the PRV nucleic acids and polypeptides described herein is by injection vaccination.
- injection vaccination a vaccine is injected into the abdominal cavity of the fish.
- a common site for needle insertion in salmon is the midline of the abdomen, one pelvic fin length in front of the base of the pelvic fins.
- immunogenic compositions can be delivered into the body cavity of the fish in an oil emulsion, or other adjuvants or additives that enhance and/or prolong immune responses.
- injection vaccination can also be performed by intramuscular injection.
- improper handling and needle insertion can cause mortality of fish and thus light anesthesia may be used during the vaccination process to reduce stress and mechanical injury to the animals.
- needles having the proper length and thickness can be important to ensure proper vaccination while avoiding secondary complications due to infection, inflammation or tissue damage.
- PRV nucleic acids, polypeptides or immunogenic compositions described herein can also be delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g.,
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- Capsules and cartridges may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
- the PRV nucleic acids, polypeptides or immunogenic compositions described herein can be administered in any immunologically effective amount sufficient to trigger an immune response in an animal. In certain instances, this amount can be between about 0.01 and about 1000 micrograms of the PRV nucleic acid, polypeptide or immunogenic composition per animal.
- the term "immunologically effective amount” refers to an amount capable of inducing, or enhancing the induction of, the desired immune response in an animal.
- the desired response may include, inter alia, inducing an antibody or cell-mediated immune response, or both.
- the desired response may also be induction of an immune response sufficient to ameliorate the symptoms of a PRV infection, reduce the duration of a PRV infection, and/or provide protective immunity in an animal against subsequent challenge with a PRV.
- An immunologically effective amount may be an amount that induces actual "protection" against PRV infection, meaning the prevention of any of the symptoms or conditions resulting from PRV infection in animals.
- An immunologically effective amount may also be an amount sufficient to delay the onset of symptoms and conditions associated with infection, reduce the degree or rate of infection, reduce in the severity of any disease or symptom resulting from infection, and reduce the viral load of an infected animal.
- an effective amount can be determined by conventional means, starting with a low dose of and then increasing the dosage while monitoring the immunological effects. Numerous factors can be taken into consideration when determining an optimal amount to administer, including the size, age, and general condition of the animal, the presence of other drugs in the animal, the virulence of the particular PRV against which the animal is being vaccinated, and the like. The actual dosage is can be chosen after consideration of the results from various animal studies.
- the immunologically effective amount of the immunogenic composition may be administered in a single dose, in divided doses, or using a "prime-boost" regimen.
- the compositions may be administered by any suitable route, including, but not limited to oral, immersion, parenteral, intradermal, transdermal, subcutaneous, intramuscular, intravenous, intraperitoneal, intranasal, oral, or intraocular routes, or by a combination of routes.
- suitable route including, but not limited to oral, immersion, parenteral, intradermal, transdermal, subcutaneous, intramuscular, intravenous, intraperitoneal, intranasal, oral, or intraocular routes, or by a combination of routes.
- the skilled artisan will be able to formulate the vaccine composition according to the route chosen.
- antibodies that bind PRV polypeptides described herein can also be generated by any other method known in the art.
- PRV binding antibodies include, but are not limited to, ribosome display, yeast display, and bacterial display
- Ribosome display is a method of translating mRNAs into their cognate proteins while keeping the protein attached to the RNA.
- the nucleic acid coding sequence is recovered by RT-PCR (Mattheakis, L. C. et al. 1994. Proc Natl Acad Sci USA 91, 9022).
- Yeast display is based on the construction of fusion proteins of the membrane-associated alpha-agglutinin yeast adhesion receptor, agal and aga2, a part of the mating type system (Broder, et al. 1997. Nature Biotechnology, 15:553-7).
- Bacterial display is based fusion of the target to exported bacterial proteins that associate with the cell membrane or cell wall (Chen and Georgiou 2002.
- phage and other antibody display methods afford the opportunity to manipulate selection against the antigen target in vitro and without the limitation of the possibility of host effects on the antigen or vice versa.
- antibodies that bind PRV polypeptides may be obtained by selecting from libraries, e.g. a phage library.
- a phage library can be created by inserting a library of random oligonucleotides or a library of polynucleotides containing sequences of interest, such as from the B-cells of an immunized animal (Smith, G. P. 1985. Science 228: 1315-1317).
- Antibody phage libraries contain heavy (H) and light (L) chain variable region pairs in one phage allowing the expression of single-chain Fv fragments or Fab fragments (Hoogenboom, et al. 2000, Immunol Today 21(8) 371-10).
- the diversity of a phagemid library can be manipulated to increase and/or alter the immunospecificities of the monoclonal antibodies of the library to produce and subsequently identify additional, desirable, teleost antibodies.
- the heavy (H) chain and light (L) chain immunoglobulin molecule encoding genes can be randomly mixed (shuffled) to create new HL pairs in an assembled immunoglobulin molecule.
- either or both the H and L chain encoding genes can be mutagenized in a complementarity determining region (CDR) of the variable region of the immunoglobulin polypeptide, and subsequently screened for desirable affinity and neutralization capabilities.
- CDR complementarity determining region
- Antibody libraries also can be created synthetically by selecting one or more framework sequences and introducing collections of CDR cassettes derived from antibody repertoires or through designed variation (Kretzschmar and von Ruden 2000, Current Opinion in Biotechnology, 13:598-602).
- the positions of diversity are not limited to CDRs but can also include the framework segments of the variable regions or may include other than antibody variable regions, such as peptides.
- Pepsin or papain digestion of whole antibodies that bind PRV polypeptides can be used to generate antibody fragments that bind PRV polypeptides.
- an Fab fragment consists of a monovalent antigen-binding fragment of an antibody molecule, and can be produced by digestion of a whole antibody molecule with the enzyme papain, to yield a fragment consisting of an intact light chain and a portion of a heavy chain.
- An (Fab')2 fragment of an antibody can be obtained by treating a whole antibody molecule with the enzyme pepsin, without subsequent reduction.
- An Fab' fragment of an antibody molecule can be obtained from (Fab') 2 by reduction with a thiol reducing agent, which yields a molecule consisting of an intact light chain and a portion of a heavy chain. Two Fab' fragments are obtained per antibody molecule treated in this manner.
- Antibodies can be produced through chemical crosslinking of the selected molecules (which have been produced by synthetic means or by expression of nucleic acid that encode the polypeptides) or through recombinant DNA technology combined with in vitro, or cellular expression of the polypeptide, and subsequent oligomerization. Antibodies can be similarly produced through recombinant technology and expression, fusion of hybridomas that produce antibodies with different epitope specificities, or expression of multiple nucleic acid encoding antibody variable chains with different epitopic specificities in a single cell.
- Antibodies may be either joined directly or indirectly through covalent or non- covalent binding, e.g. via a multimerization domain, to produce multimers.
- multimerization domain mediates non-covalent protein-protein interactions. Specific examples include coiled-coil (e.g., leucine zipper structures) and alpha-helical protein sequences. Sequences that mediate protein-protein binding via Van der Waals' forces, hydrogen bonding or charge-charge bonds can also be used as multimerization domains. Additional examples include basic-helix-loop-helix domains and other protein sequences that mediate heteromeric or homomeric protein-protein interactions among nucleic acid binding proteins (e.g., DNA binding transcription factors, such as TAFs).
- TAFs DNA binding transcription factors
- Another example is human platelet factor 4, which self- assembles into tetramers.
- extracellular protein TSP4 a member of the thrombospondin family, which can form pentamers.
- Additional specific examples are the leucine zippers of jun, fos, and yeast protein GCN4.
- Antibodies may be directly linked to each other via a chemical cross linking agent or can be connected via a linker sequence (e.g., a peptide sequence) to form multimers.
- the antibodies described herein can be polyclonal or monoclonal.
- the antibodies can also be chimeric (i.e., a combination of sequences from more than one species, for example, a chimeric mouse-salmon immunoglobulin).
- Species specific antibodies avoid certain of the problems associated with antibodies that possess variable and/or constant regions form other species. The presence of such protein sequences form other species can lead to the rapid clearance of the antibodies or can lead to the generation of an immune response against the antibody by an antibody.
- the antibodies described herein can be antibodies that bind to other molecules (antigens) via heavy and light chain variable domains, V H and V L , respectively.
- the antibodies described herein include, but are not limited to IgY, IgY(AFc)), IgG, IgD, IgA, IgM, IgE, and IgL.
- the antibodies may be intact immunoglobulin molecules, two full length heavy chains linked by disulfide bonds to two full length light chains, as well as subsequences (i.e. fragments) of immunoglobulin molecules, with or without constant region, that bind to an epitope of an antigen, or subsequences thereof (i.e. fragments) of immunoglobulin molecules, with or without constant region, that bind to an epitope of an antigen.
- Antibodies may comprise full length heavy and light chain variable domains, V H and V L , individually or in any combination.
- the basic immunoglobulin (antibody) structural unit can comprise a tetramer.
- Each tetramer can be composed of two identical pairs of polypeptide chains, each pair having one "light” (about 25 kD) and one "heavy” chain (about 50-70 kD).
- the N- terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition.
- the terms variable light chain (Vi) and variable heavy chain (V H ) refer to these light and heavy chains respectively.
- the antibodies described herein may exist as intact immunoglobulins or as a number of well characterized fragments produced by digestion with various peptidases.
- pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab)' 2 , a dimer of Fab which itself is a light chain joined to V H -C H 1 by a disulfide bond.
- the F(ab)' 2 may be reduced under mild conditions to break the disulfide linkage in the hinge region thereby converting the F(ab)' 2 dimer into an Fab' monomer.
- the Fab' monomer is essentially an Fab with part of the hinge region (see, Fundamental Immunology, W. E.
- Fab' domain is defined in terms of the digestion of an intact antibody, one of skill will appreciate that such Fab' fragments may be synthesized de novo either chemically or by utilizing recombinant DNA methodology.
- the Fab' regions may be derived from antibodies of animal or human origin or may be chimeric (Morrison et al, Proc Natl. Acad. Sci. USA 81, 6851-10855 (1984) both incorporated by reference herein) (Jones et al, Nature 321, 522-525 (1986), and published UK patent application No. 8707252, both incorporated by reference herein).
- the antibodies described herein can include or be derived from any mammal, such as but not limited to, a fish, a human, a mouse, a rabbit, a rat, a rodent, a primate, or any combination thereof and includes isolated fish, human, primate, rodent, mammalian, chimeric, humanized and/or CDR-grafted or CDR-adapted antibodies, immunoglobulins, cleavage products and other portions and variants thereof.
- the antibody is purified.
- the antibodies described herein include full length antibodies, subsequences (e.g., single chain forms), dimers, trimers, tetramers, pentamers, hexamers or any other higher order oligomer that retains at least a part of antigen binding activity of monomer.
- Multimers can comprise heteromeric or homomeric combinations of full length antibody, subsequences, unmodified or modified as set forth herein and known in the art.
- Antibody multimers are useful for increasing antigen avidity in comparison to monomer due to the multimer having multiple antigen binding sites.
- Antibody multimers are also useful for producing oligomeric (e.g., dimer, trimer, tertamer, etc.) combinations of different antibodies thereby producing compositions of antibodies that are multifunctional (e.g., bifunctional, trifunctional, tetrafunctional, etc.).
- antibody subsequences include, for example, Fab, Fab', (Fab') 2 , Fv, or single chain antibody (SCA) fragment (e.g., scFv).
- Subsequences include portions which retain at least part of the function or activity of full length sequence. For example, an antibody subsequence will retain the ability to selectively bind to an antigen even though the binding affinity of the subsequence may be greater or less than the binding affinity of the full length antibody.
- An Fv fragment is a fragment containing the variable region of a light chain V L and the variable region of a heavy chain V H expressed as two chains.
- the association may be non-covalent or may be covalent, such as a chemical cross-linking agent or an intermolecular disulfide bond (Inbar et al, (1972) Proc. Natl. Acad Sci. USA 69:2659; Sandhu (1992) Crit. Rev. Biotech. 12:437).
- antibody subsequences such as separation of heavy chains to form monovalent light-heavy chain fragments, further cleavage of fragments, or other enzymatic, chemical, or genetic techniques may also be used, provided that the subsequences bind to the antigen to which the intact antibody binds.
- a single chain antibody is a genetically engineered or enzymatically digested antibody containing the variable region of a light chain VL and the variable region of a heavy chain, optionally linked by a flexible linker, such as a polypeptide sequence, in either VL-linker-VH orientation or in VH-linker-VL orientation.
- a single chain Fv fragment can be produced by linking two variable domains via a disulfide linkage between two cysteine residues.
- Methods for producing scFv antibodies are described, for example, by Whitlow et al, (1991) In: Methods: A Companion to Methods in Enzymology 2:97; U.S. Pat. No. 4,946,778; and Pack et al, (1993) Bio/Technology 11 : 1271.
- the PRV nucleic acids, polypeptides and immunogenic compositions described herein can be used to generate antibodies that that inhibit, neutralize or reduce the activity or function of a polypeptide or a PRV.
- the invention is directed to a method for treating an animal (e.g. a salmon), the method comprising administering to the animal PRV nucleic acids, polypeptides and immunogenic compositions, or administering to the animal an antibody which specifically binds to a PRV polypeptide such that the activity or function of a PRV polypeptide or a PRV is inhibited, neutralized or reduced.
- the invention described herein relates to PRV immunogenic compositions comprising PRV polypeptides or PRV nucleic acids.
- PRV immunogenic compositions comprising PRV polypeptides or PRV nucleic acids.
- the PRV immunogenic compositions can further comprise carriers, adjuvants, excipients and the like.
- the PRV immunogenic compositions described herein can be formulated readily by combining the active compounds with
- the PRV immunogenic compositions described herein can be formulated in a conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used to induce an immunogenic response.
- physiologically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used to induce an immunogenic response.
- Such carriers can be used to formulate suitable tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like.
- the immunogenic composition can be obtained by solid excipient, grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
- the immunogenic composition described herein can be manufactured in a manner that is itself known, e.g. by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes. Proper formulation is dependent upon the route of
- a immunogenetically effective amount of a PRV immunogenic composition When a immunogenetically effective amount of a PRV immunogenic composition is administered to an animal, the composition can be in the form of a pyrogen-free, parenterally acceptable aqueous solution.
- PRV immunogenic compositions described herein can contain, in addition to protein or other active ingredient of the present invention, an isotonic vehicle such as Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, Lactated Ringer's Injection, or other vehicle as known in the art.
- the immunogenic composition of the present invention may also contain stabilizers, preservatives, buffers, antioxidants, or other additives known to those of skill in the art.
- the PRV immunogenic compositions can be formulated in aqueous solutions, physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
- physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
- penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
- protein or other active ingredient of the present invention can be in the form of a tablet, capsule, powder, solution or elixir.
- the immunogenic composition of the invention may additionally contain a solid carrier such as a gelatin or an adjuvant.
- the PRV immunogenic compositions described herein can encode or contain any of the PRV proteins or peptides described herein, or any portions, fragments, derivatives or mutants thereof, that are immunogenic in an animal.
- One of skill in the art can readily test the immunogenicity of the PRV proteins and peptides described herein, and can select suitable proteins or peptides to use in subunit vaccines.
- the PRV immunogenic compositions described herein comprise at least one PRV amino acid or polypeptide, such as those described herein.
- the compositions may also comprise one or more additives including, but not limited to, one or more pharmaceutically acceptable carriers, buffers, stabilizers, diluents, preservatives, solubilizers, liposomes or immunomodulatory agents.
- Suitable immunomodulatory agents include, but are not limited to, adjuvants, cytokines, polynucleotide encoding cytokines, and agents that facilitate cellular uptake of the PRV-derived immunogenic component.
- the PRV immunogenic compositions described herein can also contain an immunostimulatory substance, a so-called adjuvant Adjuvants in general comprise substances that boost the immune response of the host in a non-specific manner.
- adjuvants are known in the art. Examples of adjuvants frequently used in fish and shellfish farming are muramyldipeptides, lipopolysaccharides, several glucans and glycans and Carbopol® (a homopolymer).
- An extensive overview of adjuvants suitable for fish and shellfish vaccines is given in the review paper by Jan Raa (Reviews in Fisheries Science 4(3): 229-288 (1996)).
- the PRV immunogenic compositions described herein may also comprise a so-called "vehicle".
- a vehicle is a compound to which the protein adheres, without being covalently bound to it. Such vehicles are e.g. biomicrocapsules, micro-alginates, liposomes and macrosols, all known in the art.
- the vaccine may comprise one or more suitable surface-active compounds or emulsifiers, e.g. Span or Tween. Certain organic solvents such as dimethylsulfoxide also may be employed.
- the PRV immunogenic compositions described herein can also be mixed with stabilizers, e.g. to protect degradation-prone proteins from being degraded, to enhance the shelf-life of the vaccine, or to improve freeze-drying efficiency.
- stabilizers are i.e.. SPGA (Bovarnik et al; J. Bacteriology 59: 509 (1950)), carbohydrates e.g. sorbitol, mannitol, trehalose, starch, sucrose, dextran or glucose, proteins such as albumin or casein or degradation products thereof, and buffers, such as alkali metal phosphates..
- a liquid carrier such as water, petroleum, oils of animal or plant origin such as peanut oil, mineral oil, soybean oil, or sesame oil, or synthetic oils
- the liquid form of the immunogenic composition may further contain physiological saline solution, dextrose or other saccharide solution, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol.
- the immunogenic composition contains from about 0.5 to 90% by weight of protein or other active ingredient of the present invention, and from about 1 to 50% protein or other active ingredient of the present invention.
- the PRV immunogenic compositions described herein include push- fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
- the push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers.
- the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
- stabilizers may be added.
- the PRV immunogenic compositions described herein can also be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
- Formulations for injection may be presented in unit dosage form, e.g., in ampules or in multi-dose containers, with an added preservative.
- the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- the PRV immunogenic compositions described herein can also be in the form of a complex of the protein(s) or other active ingredient of present invention along with protein or peptide antigens.
- the PRV immunogenic compositions described herein can be made suitable for parenteral administration and can include aqueous solutions comprising PRV nuleic acids or polypeptides in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
- Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
- the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
- the active ingredient maybe in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
- a suitable vehicle e.g., sterile pyrogen-free water
- the PRV immunogenic compositions described herein can also be in the form of a liposome in which protein of the present invention is combined, in addition to other acceptable carriers, with amphipathic agents such as lipids which exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or lamellar layers in aqueous solution.
- amphipathic agents such as lipids which exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or lamellar layers in aqueous solution.
- Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithins, phospholipids, saponin, bile acids, and the like. Preparation of such liposomal formulations is within the level of skill in the art, as disclosed, for example, in U.S. Pat. Nos. 4,235,871; 4,501,728;
- the PRV immunogenic compositions described herein can also be formulated as long acting formulations administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.
- the compositions may be delivered using a sustained-release system, such as semipermeable matrices of solid hydrophobic polymers containing the therapeutic agent.
- sustained-release materials have been established and are well known by those skilled in the art.
- Sustained-release capsules may, depending on their chemical nature, release the compounds for a few weeks up to over 100 days.
- additional strategies for protein or other active ingredient stabilization may be employed.
- the compounds may be formulated with suitable polymeric or hydrophobic materials (for example, as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
- Carriers for use with the PRV immunogenic compositions described herein can be a co-solvent systems comprising benzyl alcohol, a nonpolar surfactant, a water- miscible organic polymer, and an aqueous phase.
- the co-solvent system may be the VPD co-solvent system.
- VPD is a solution of 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant polysorbate 80, and 65% w/v polyethylene glycol 300, made up to volume in absolute ethanol.
- the VPD co-solvent system (VPD:5W) consists of VPD diluted 1 : 1 with a 5% dextrose in water solution.
- This co-solvent system dissolves hydrophobic compounds well, and itself produces low toxicity upon systemic administration.
- the proportions of a co-solvent system may be varied considerably without destroying its solubility and toxicity characteristics.
- the identity of the co- solvent components can also be varied: for example, other low-toxicity nonpolar surfactants may be used instead of polysorbate 80; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g. polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
- the immunogenic compositions also may comprise suitable solid or gel phase carriers or excipients.
- suitable solid or gel phase carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
- Many of the active ingredients of the invention may be provided as salts with immunogenically compatible counter ions.
- Such immunogenically acceptable base addition salts are those salts which retain the biological effectiveness and properties of the free acids and which are obtained by reaction with inorganic or organic bases such as sodium hydroxide, magnesium hydroxide, ammonia, trialkylamine, dialkylamine, monoalkylamine, dibasic amino acids, sodium acetate, potassium benzoate, triethanol amine and the like.
- Excipients suitable for use in the immunogenic compositions described herein include fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. Dragee cores are provided with suitable coatings.
- fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol
- cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose,
- concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
- Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
- the immunogenic compositions and vaccines described herein can also be multivalent immunogenic compositions that further comprise additional polypeptides or nucleic acid sequences encoding additional polypeptides from other viruses.
- the immunogenic compositions and vaccines described herein can also be multivalent immunogenic compositions that further comprise additional polypeptide fragments or nucleic acid sequences encoding additional polypeptide fragements from other viruses.
- the immunogenic compositions and vaccines described herein can also be multivalent immunogenic compositions that further comprise additional viruses (e.g. viruses that are either attenuated, killed or otherwise deactivated) or nucleic acid sequences encoding additional viruses (e.g. viruses that are either attenuated, killed or otherwise deactivated).
- additional viruses e.g. viruses that are either attenuated, killed or otherwise deactivated
- nucleic acid sequences encoding additional viruses e.g. viruses that are either attenuated, killed or otherwise deactivated.
- the immunogenic compositions and vaccines described herein can also comprise fusions proteins, or nucleic acids encoding fusion proteins comprising a PRV polypeptide, or a fragment thereof, and a polypeptide, or a polypeptide fragment from another virus.
- viruses, viral polypeptides of other viruses or fragments thereof that can be included in the immunogenic compositions include, but are not limited to, Sleeping disease virus (SDV), or SDV viral polypeptides or fragments thereof; salmon pancreas disease virus (SPDV), or SPDV viral polypeptides or fragments thereof; infectious salmon anemia (ISAV), or ISAV viral polypeptides or fragments thereof; Viral hemorrhagic septicemia virus (VHSV), or VHSV viral polypeptides or fragments thereof; infectious hematopoietic necrosis virus (IFiNV), or IFiNV viral polypeptides or fragments thereof; infectious pancreatic necrosis virus (IPNV), or IPNV viral polypeptides or fragments thereof; spring viremia of carp (SVC), or SVC viral polypeptides or fragments thereof; channel catfish virus (CCV), or CCV viral polypeptides or fragments thereof; Aeromonas salmonicida, or Aeromonas salmonici
- SDV Sleeping disease
- cDNA encoding structural protein- 1 of infectious salmon anemia virus described in U.S. Pat. No. 6,471,964.
- ISAV antigens are also disclosed in WO 01/10469.
- SPDV antigens are disclosed in WO 99/58639.
- P. salmonis antigens are disclosed in WO 01/68865.
- Whitespot Virus antigens disclosed in WO 01/09340.
- a 200nt fragment that is approximately 50% homologous at the amino acid level to mammalian Orthoreoviruses was obtained through high throughput sequencing of samples obtained from farmed salmon with HSMI in Norway. Quantitative PCR assays of muscle tissue from salmon with HSMI and normal salmon reveals a higher viral load in salmon with HSMI.
- Example 2 Heart and skeletal muscle inflammation of farmed salmon is associated with infection with a novel reovirus
- database alignment analysis at the nucleotide level revealed no evidence of infection, the predicted amino acid sequence of one 265 nucleotide read was 49% similar to the core-spike protein ⁇ 2 of Mammalian orthoreovirus 3 (AF378009).
- the HSMI serum sample with the highest genetic load by PCR (3.0 x 106 genome copies/ ⁇ ) was selected for additional pyrosequencing yielding 120,705 reads.
- a suite of bioinformatic tools was used to identify viral sequences.
- BLASTN and BLASTX (Altschul et al, J Mol Biol 215, 403-410 (1990)) detected 1.5% and 53.9% of the predicted viral genome, respectively, enabling identification of segments LI, L2, L3, Ml, M2 and M3 ( Figure 1).
- FASTX Pearson et al, Genomics 46, 24-36(1997) yielded an additional 5.5% of the genome and detected motifs in the SI segment as well as additional sequences in the L2 and M3 segments.
- the genome of the PRV comprises at least 10 RNA segments (GenBank Accession numbers GU994013-GU994022).
- Reoviruses are non-enveloped icosahedral viruses with double-stranded RNA genomes comprising 10-12 segments. Twelve genera are defined based on host range, number of genome segments, G/C content, and antigenic relationships.
- a phylogenetic tree constructed using L gene segment sequences of known reoviruses indicate that PRV represents a distinct genetic lineage branching off the root of the aquareovirus and orthoreovirus genera, viruses of fish and shellfish, reptiles, birds and mammals (Figure 2).
- Analysis of all ten PRV gene segments confirmed the divergence of PRV sequence with respect to other Reoviruses ( Figures 5 to 12). All PRV gene segments contained the 3' terminal nucleotides
- the orthoreoviruses have polycistronic segments in either SI or S4. Whereas aquareovirus species C are polycistronic in the S7 (the orthoreovirus SI homolog), the other aquareovirus species are not (Attoui et al, J Gen Virol 83, 1941-1951 (2002)).
- homologues of the ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS sequences of PRV are found in orthoreoviruses and aquareo viruses, the ⁇ and ⁇ 3 sequences and the small putative open reading frames observed in S2 and SI appear distinctive.
- the structure of the latter is similar to a fusion-associated small transmembrane (FAST) reovirus protein
- Reovirus FAST proteins are nonstructural, single-pass membrane proteins that induce cell-cell fusion and syncytium formation (Shmulevitz et al, EMBO J 19, 902-912 (2000)).
- PRV was detected in only sixteen of these samples (24.2%). Two of these sixteen samples were positive by the cutoff established for farmed salmon with relative log ratios of 6.70 and 7.58; the other fourteen had
- PRV RNA was distributed throughout the myocardium and endocardium of salmon with HSMI ( Figure 4A, 4B) but not detected in normal salmon or salmon infected with salmon pancreas disease virus ( Figure 4C, 4D)
- PRV has not been cultured. Furthermore, PRV has been found in farmed fish that do not show clinical signs of HSMI. Moreover, PRV has been also detected in low quantities in wild Atlantic salmon. Nonetheless, the tissue distribution and load of PRV are correlated with disease in naturally and experimentally infected salmon.
- HSMI was experimentally-induced in normal Atlantic salmon by inoculation with heart and kidney extracts from fish with HSMI or cohabitation with fish with HSMI.
- RNA extracted from heart tissue from Atlantic salmon with experimentally- induced HSMI was used as template for high throughput pyrosequencing. Sequences were analyzed using a suite of bioinformatic applications available at the GreenePortal website (http://tako.cpmc. Columbia edu/Tools), including FASD, a method whereby the statistical distribution of oligonucleotide frequencies within an unknown sequence set is compared to frequencies calculated for known sequence sets.
- RNA extracts were treated with DNase I and cDNA generated by using the Superscript II system for reverse transcription primed by random octamers that were linked to an arbitrary defined 17-mer primer sequence (Palacios et al, Emerg Infect Dis 13, 73-81 (2007)).
- the resulting cDNA was treated with RNase H and then randomly amplified by the polymerase chain reaction (PCR); applying a 9: 1 mixture of a primer corresponding to the defined 17-mer sequence and the random octamer-linked 17-mer primer, respectively (Palacios et al., Emerg Infect Dis 13, 73-81 (2007)).
- Products >70 base pairs (bp) were selected by column purification and ligated to specific linkers for sequencing on the 454 Genome Sequencer FLX without fragmentation of the cDNA (Margulies, M. et al, Nature 437, 376-380 (2005); Palacios et al. N Engl J Med 358, 991-998 (2008); Cox-Foster et al, Science 318, 283-287 (2007)).
- Phylogenetic analysis were performed using p-distance as model of amino acid substitution as accepted by ICTV for analysis of the Reoviridae family.
- MEGA was used to produce phylogenetic trees, reconstructed through the Neighbor Joining (NJ) method.
- Quantitative assays were established based upon virus specific sequences obtained from the high throughput sequencing for several reo virus segments.
- Six different realtime assays were designed targeting genome fragment LI, L2 and M3 (SYBR green) as well as LI and S4 (MGB assays) (See Table 2 for a list of the primers).
- Samples from different organs from experimentally infected fish were positive while samples from non-infected control fish were negative.
- the real-time PCR for segment LI was performed using the QIAGEN OneStep kit.
- Six ⁇ of template RNA were denatured (95°C/5 min). Reactions were performed using the following concentrations: 400 nM primer, 300 nM probe and 1.25 mM MgCl 2 .
- Standard curves were created using RNA pooled from three fish with high viral loads. Standard curves were made in duplicates for both the MGB assay and the EFIA assay (Olsvik et al, BMC Mol Biol 6, 21 (2005)) and relative viral RNA loads for field samples were calculated by using normalization against EFIA.
- Table 2 Primers for realtime assays for targeting genome fragment LI, L2 and M3 (SYBR green) as well as LI and S4.
- AqureoGT70F SYBR L2 (1577- AGGATGTATGCCACTAGCTCC SEQ ID NO: 11 green 1561)
- AqureoGT70R SYBR L2 1513- GCTGGTAACTGGCTTACTGCTAAT SEQ ID NO: 12 green 1536)
- AquareoNS86F SYBR M3 (2119- TCAGTGCGGGGAACTCTAGTGGCA SEQ ID NO: 15 green 2096)
- AquareoNS86R SYBR M3 (2025- GACGACCTTGAACGCACGAGCGTG SEQ ID NO: 16 green 2048)
- In situ hybridization was performed in compliance with the protocol from GeneDetect (Auckland, New Zealand) with some modifications using LNA probes targeting L2. Sections were permeabilized using 40 ⁇ g ml-1 Proteinase K in TE buffer at 37°C for 15 min followed by hybridization with a mixture of two 5' and 3' double DIG labeled LNA probes (5 ' -C ACC ATC AGTGAACTTAGGAGC AAC-3 ' and 5'- CATACTCCAAGATCATCGCCAGCA-3') (SEQ ID NO: 28 and SEQ ID NO: 41, respectively) (250 nM each) for 18 hours at 50°C. Stringency washes were carried out at 60°C.
- Sections were incubated with a mouse monoclonal anti-DIG-HRP overnight at 4°C and stained using a Tyramide Signal Amplification System (Perkin Elmer, MA, USA) according to the manufacturer's protocol. Sections were counterstained with Meyer's hematoxylin solution. Negative controls included were samples from non- infected fish from experimental trial, head kidney samples from non-infected fish as a source of immune cells, salmon with pancreatic disease (a differential diagnosis to HSMI), and samples from material sent for diagnostics at random.
- a Tyramide Signal Amplification System Perkin Elmer, MA, USA
- StatView version 5.0.1 software for Windows was used for all statistical analyses. Samples without detectable LI viral gene transcripts were excluded from statistical analysis. Log transformations were performed for all other samples after calculating LI/ EF1A ratios (adjusted by a factor of 108). Log-transformed data were retained to facilitate graphical display of group differences, though distributions were not normalized by this method; thus, nonparametric analytic approaches were employed (Mann- Whitney U-test for comparison of healthy and HSMI fish; Kruskal-Wallis for comparisons of healthy and early, middle and peak phase HSMI fish). For all tests, statistical significance was assumed where p ⁇ 0.05.
- Syncytium formation and vacuolization can be observed after infecting epithelioma paplosum cyprini (EPC) cells and fat head minnow (FHM) cells with tissue homogenate from HSMI diagnosed fish, however the cytopathic effect (CPE) is rarely seen after 2 to 4 passages.
- EPC epithelioma paplosum cyprini
- FHM fat head minnow
- Virus-like particles of 60 to 80 nm diameter are been observed in necrotic cardiomyocytes diagnosed with HSMI.
- Chloroform sensitivity analysis shows that PRV belongs to the Reoviridae family, which is a family of naked viruses.
- Example 11 Screening of heart samples from experimental challenge
- the open reading frame (ORF), minus the 126 first nucleotides, of the M2 genomic segment (SEQ ID NO: 5) encoding the ⁇ protein was cloned in the pETlOO plasmid and expressed as His-tag fusion protein in E.coli, purified.
- the ⁇ protein is posttranscriptionally cleaved into ⁇ in mammalian orthoreovirus in a process wherein 42 aa are removed from the N-terminus of ⁇ .
- the protein was used for immunization of a rabbit to obtain polyclonal, antiserum.
- the antiserum recognizes the ⁇ protein as found in Western blots of E. coli His-tag fusion protein and different negative controls ( Figure 20).
- the antiserum recognizes PRV, as has been shown in immunohistochemistry of hearts of fish with HSMI.
- ORF open reading frame
- SEQ ID NO: 2 The open reading frame (ORF), from nucleotide 29-1018 of the SI genomic segment (SEQ ID NO: 2) encoding the ⁇ 3 protein (330 amino acids long) (SEQ ID NO: 39) was cloned in the pETlOl plasmid and expressed as His-tag fusion protein in E. coli, purified and used for immunization for a rabbit to obtain polyclonal, ⁇ 3 -specific antiserum.
- the antiserum recognizes the s3 protein as found in western blots of E. coli His-tag fusion protein and different negative controls.
- the antiserum recognizes native PRV, as has been shown in immunohistochemistry of heart of fish with HSMI.
- ORF open reading frame
- SEQ ID NO: 2 The open reading frame (ORF), from the nucleotide 22-1281 of the S2 genomic segment (SEQ ID NO: 2) encoding the ⁇ protein (420 amino acids long) (SEQ ID NO: 35) was cloned in the pETlOl plasmid and expressed as a His-tag fusion protein in E. Coli, purified and used for immunization of a rabbit to obtain polyclonal, a2-specific antiserum. The antiserum recognizes the ⁇ protein as found in western blots of E. coli His-tag fusion protein ( Figure 21) and in immunohistochemistry of hearts of fish with HSMO.
- Table 4 Annotation of ORFs proteins. Based on in silico analysis.
- Example 13 Virus characterization and virulence studies
- PRV virus segments were cloned and expressed in insect and fish cell lines to examine potential virulence factors virus characterization and virulence studies. The hemagglutinating properties of the virus will also be tested and samples from geographically distant areas will be sequenced to study potential differences and strain variations.
- Example 14 Screening of wild fish and fertilized eggs
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Genetics & Genomics (AREA)
- Mycology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Analytical Chemistry (AREA)
- Pathology (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2776386A CA2776386C (en) | 2009-10-02 | 2010-10-04 | Piscine reovirus immunogenic compositions |
| CN2010800446027A CN102647988A (zh) | 2009-10-02 | 2010-10-04 | 鱼呼肠弧病毒免疫原性组合物 |
| EP10821407.3A EP2482824B1 (en) | 2009-10-02 | 2010-10-04 | Piscine reovirus immunogenic compositions |
| US13/499,874 US9395356B2 (en) | 2009-10-02 | 2010-10-04 | Piscine reovirus immunogenic compositions |
| JP2012532138A JP2013506672A (ja) | 2009-10-02 | 2010-10-04 | 魚類レオウイルス免疫原性組成物 |
| DKPA201170227A DK179132B1 (en) | 2009-10-02 | 2011-05-11 | Piscine reovirus immunogenic compositions |
| US15/181,916 US20160287694A1 (en) | 2009-10-02 | 2016-06-14 | Piscine reovirus immunogenic compositions |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US24805809P | 2009-10-02 | 2009-10-02 | |
| US61/248,058 | 2009-10-02 | ||
| US32504710P | 2010-04-16 | 2010-04-16 | |
| US61/325,047 | 2010-04-16 | ||
| US38059410P | 2010-09-07 | 2010-09-07 | |
| US61/380,594 | 2010-09-07 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/499,874 A-371-Of-International US9395356B2 (en) | 2009-10-02 | 2010-10-04 | Piscine reovirus immunogenic compositions |
| US15/181,916 Division US20160287694A1 (en) | 2009-10-02 | 2016-06-14 | Piscine reovirus immunogenic compositions |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2011041789A1 true WO2011041789A1 (en) | 2011-04-07 |
Family
ID=43826692
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2010/051346 Ceased WO2011041789A1 (en) | 2009-10-02 | 2010-10-04 | Piscine reovirus immunogenic compositions |
| PCT/US2010/051348 Ceased WO2011041790A1 (en) | 2009-10-02 | 2010-10-04 | Piscine reovirus diagnostic compositions |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2010/051348 Ceased WO2011041790A1 (en) | 2009-10-02 | 2010-10-04 | Piscine reovirus diagnostic compositions |
Country Status (8)
| Country | Link |
|---|---|
| US (3) | US9395356B2 (https=) |
| EP (2) | EP2482825B1 (https=) |
| JP (1) | JP2013506672A (https=) |
| CN (1) | CN102647988A (https=) |
| CA (2) | CA2776534A1 (https=) |
| CL (5) | CL2012000822A1 (https=) |
| DK (1) | DK179132B1 (https=) |
| WO (2) | WO2011041789A1 (https=) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015185605A1 (en) * | 2014-06-03 | 2015-12-10 | Veterinærinstituttet | New reovirus infecting rainbow trout |
| US9366667B2 (en) | 2009-10-02 | 2016-06-14 | The Trustees Of Columbia University In The City Of New York | Piscine reovirus diagnostic compositions |
| EP3216875A3 (en) * | 2014-04-18 | 2017-12-13 | Schweitzer Biotech Company Ltd. | Methods for detecting pathogens piscine reovirus (prv), infectious pancreatic necrosis virus (ipnv), salmonid alphaviurs (sav), and infectious salmon anemia virus (isav) in coldwater fish |
| WO2019110664A1 (en) | 2017-12-06 | 2019-06-13 | Intervet International B.V. | Use of a non-structural protein from prv to protect against heart and skeletal muscle inflammation |
| CN110408637A (zh) * | 2019-08-08 | 2019-11-05 | 中国水产科学研究院长江水产研究所 | 一种草鱼出血病酵母口服疫苗及应用 |
| WO2021122507A1 (en) | 2019-12-16 | 2021-06-24 | Intervet International B.V. | Inactivated piscine orthoreovirus vaccine |
| EP3862443A4 (en) * | 2018-10-05 | 2022-10-12 | Schweitzer Biotech Company Ltd. | PROCEDURE FOR DETECTING FISH PATHOGENS |
| WO2025156063A1 (es) * | 2024-01-25 | 2025-07-31 | Universidad De Santiago De Chile | Vacuna, método de producción, uso para tratar y prevenir proteínas de cápside de piscine orthoreovirus |
Families Citing this family (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2922621C (en) * | 2013-08-30 | 2023-05-23 | Pharmaq As | Method for propagating piscine orthoreovirus |
| IL230970A0 (en) | 2014-02-13 | 2014-09-30 | Univ Ramot | Tilapia virus vaccines |
| WO2016075277A1 (en) | 2014-11-14 | 2016-05-19 | Patogen Analyse As | Novel fish virus and method for detection |
| CR20210528A (es) | 2014-12-15 | 2021-12-06 | Univ Columbia | VIRUS NUEVO DE TILAPIA Y USOS DEL MISMO(Divisional Exp: 2017-0322) |
| US10688050B1 (en) | 2018-12-21 | 2020-06-23 | Synthon B.V. | Pharmaceutical composition comprising ibrutinib |
| NO344967B1 (en) | 2019-01-30 | 2020-08-03 | Patogen As | Piscine Orthoreovirus Virulence Markers |
| CN109971890A (zh) * | 2019-04-30 | 2019-07-05 | 上海海洋大学 | Ii型草鱼呼肠孤病毒的微滴式数字pcr检测试剂盒及其专用引物和探针 |
| CN110079507B (zh) * | 2019-05-06 | 2022-05-20 | 中国海洋大学 | 抗牙鲆黏膜免疫球蛋白IgT的单克隆抗体及其应用 |
| NO346211B1 (en) | 2020-07-14 | 2022-04-19 | Patogen As | Piscine Orthoreovirus Virulence Markers |
| CN112206317B (zh) * | 2020-10-12 | 2023-09-22 | 浙江省淡水水产研究所 | 一种草鱼出血病二价核酸菌蜕疫苗的制备方法 |
| CN112048575A (zh) * | 2020-10-26 | 2020-12-08 | 深圳市莱孚生物科技有限公司 | 一种用于鉴定草鱼出血热病毒的引物及探针以及检测方法 |
| CN113527475B (zh) * | 2021-06-07 | 2022-04-29 | 浙江省农业科学院 | 一种分泌鸭新型呼肠孤病毒σC蛋白单抗的杂交瘤细胞、单抗及应用 |
| CN114164159B (zh) * | 2021-06-21 | 2023-10-03 | 湖南师范大学 | 一种具有防治鱼类杀鲑气和迟缓爱德华氏菌感染的二联疫苗及其制备方法与应用 |
| KR102734012B1 (ko) * | 2021-08-19 | 2024-11-25 | 성균관대학교산학협력단 | 바이러스성 출혈성 패혈증 바이러스에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편, 및 이들의 용도 |
| CN118853676B (zh) * | 2024-09-03 | 2025-03-07 | 中国水产科学研究院淡水渔业研究中心 | 一种草鱼ii型呼肠孤病毒反义rna及其重组载体、试剂盒和应用 |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060014225A1 (en) * | 2002-12-13 | 2006-01-19 | Aurelium Biopharma Inc. | Vimentin directed diagnostics and therapeutics for multidrug resistant neoplastic disease |
| US20060165698A1 (en) * | 2003-01-20 | 2006-07-27 | Max-Planck-Gesellschaft Zur Foerung Der Wissenscha | L-amino acid oxidase with cytotoxic activity from aplysia punctata |
| US20080124793A1 (en) * | 2000-12-01 | 2008-05-29 | Roy Duncan | Membrane fusion proteins derived from reovirus |
| WO2008106803A1 (en) * | 2007-03-07 | 2008-09-12 | Nventa Biopharmaceuticals Corporation | Double-stranded locked nucleic acid compositions |
Family Cites Families (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4235871A (en) | 1978-02-24 | 1980-11-25 | Papahadjopoulos Demetrios P | Method of encapsulating biologically active materials in lipid vesicles |
| US4501728A (en) | 1983-01-06 | 1985-02-26 | Technology Unlimited, Inc. | Masking of liposomes from RES recognition |
| NZ207394A (en) | 1983-03-08 | 1987-03-06 | Commw Serum Lab Commission | Detecting or determining sequence of amino acids |
| WO1986006487A1 (en) | 1985-04-22 | 1986-11-06 | Commonwealth Serum Laboratories Commission | Method for determining mimotopes |
| NZ215865A (en) | 1985-04-22 | 1988-10-28 | Commw Serum Lab Commission | Method of determining the active site of a receptor-binding analogue |
| US4737323A (en) | 1986-02-13 | 1988-04-12 | Liposome Technology, Inc. | Liposome extrusion method |
| GB8607679D0 (en) | 1986-03-27 | 1986-04-30 | Winter G P | Recombinant dna product |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| US4837028A (en) | 1986-12-24 | 1989-06-06 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| DK0538496T3 (da) | 1991-08-26 | 2004-02-23 | Baxter Healthcare Sa | Rekombinant fjerkrækoppevirus med intakt FPV tk-gen |
| FR2737730B1 (fr) | 1995-08-10 | 1997-09-05 | Pasteur Merieux Serums Vacc | Procede de purification de virus par chromatographie |
| CA2327353C (en) | 1998-05-08 | 2010-09-21 | Akzo Nobel Nv | Structural proteins of fish pancreatic disease virus and uses thereof |
| US20080256662A1 (en) * | 1999-05-10 | 2008-10-16 | Byrum Joseph R | Nucleic acid molecules and other molecules associated with plants |
| WO2001009340A1 (en) | 1999-08-03 | 2001-02-08 | Akzo Nobel N.V. | Proteins derived from white spot syndrome virus and uses thereof |
| EP1637614A3 (en) | 1999-08-07 | 2006-11-29 | Novartis AG | Nucleic acids and antibodies for detection of ISAV (infectious salmon anaemia virus) |
| DK1094069T4 (da) | 1999-10-18 | 2008-07-21 | Intervet Int Bv | DNA kodende for strukturelt protein-1 fra infektiös lakseanæmivirus og anvendelser deraf |
| AU2001240791A1 (en) | 2000-03-11 | 2001-09-24 | Novartis Ag | Sequence |
| US6979733B2 (en) * | 2001-08-03 | 2005-12-27 | Diversa Corporation | Epoxide hydrolases, nucleic acids encoding them and methods of making and using them |
| GB2429711B (en) | 2004-06-11 | 2008-05-21 | Pharmaq As | Heart and skeletal muscle inflammation (HSMI) virus |
| US7361468B2 (en) * | 2004-07-02 | 2008-04-22 | Affymetrix, Inc. | Methods for genotyping polymorphisms in humans |
| JP4911529B2 (ja) | 2005-02-22 | 2012-04-04 | 日本碍子株式会社 | 光変調器 |
| US8088976B2 (en) | 2005-02-24 | 2012-01-03 | Monsanto Technology Llc | Methods for genetic control of plant pest infestation and compositions thereof |
| JPWO2007020983A1 (ja) * | 2005-08-18 | 2009-02-26 | 独立行政法人科学技術振興機構 | オオムギest配列を利用して作製された二倍体コムギ遺伝地図を用いるコムギの育種方法 |
| DK179025B1 (da) * | 2005-09-16 | 2017-08-28 | Intervet Int Bv | Fiskevaccine |
| SG191602A1 (en) * | 2007-03-12 | 2013-07-31 | Oncolytics Biotech Inc | Reoviruses having modified sequences |
| JPWO2010024284A1 (ja) * | 2008-09-01 | 2012-01-26 | 国立大学法人北海道大学 | 魚類抗ウイルスワクチン、魚類免疫賦活剤、および魚類免疫付与方法 |
| WO2011041789A1 (en) | 2009-10-02 | 2011-04-07 | The Trustees Of Columbia University In The City Of New York | Piscine reovirus immunogenic compositions |
-
2010
- 2010-10-04 WO PCT/US2010/051346 patent/WO2011041789A1/en not_active Ceased
- 2010-10-04 CA CA2776534A patent/CA2776534A1/en not_active Abandoned
- 2010-10-04 EP EP10821408.1A patent/EP2482825B1/en not_active Revoked
- 2010-10-04 WO PCT/US2010/051348 patent/WO2011041790A1/en not_active Ceased
- 2010-10-04 US US13/499,874 patent/US9395356B2/en active Active
- 2010-10-04 CA CA2776386A patent/CA2776386C/en active Active
- 2010-10-04 EP EP10821407.3A patent/EP2482824B1/en active Active
- 2010-10-04 JP JP2012532138A patent/JP2013506672A/ja active Pending
- 2010-10-04 US US13/499,867 patent/US9366667B2/en active Active
- 2010-10-04 CN CN2010800446027A patent/CN102647988A/zh active Pending
-
2011
- 2011-05-11 DK DKPA201170227A patent/DK179132B1/en active
-
2012
- 2012-04-02 CL CL2012000822A patent/CL2012000822A1/es unknown
- 2012-04-02 CL CL2012000821A patent/CL2012000821A1/es unknown
-
2013
- 2013-10-10 CL CL2013002907A patent/CL2013002907A1/es unknown
- 2013-10-11 CL CL2013002933A patent/CL2013002933A1/es unknown
-
2016
- 2016-01-29 CL CL2016000240A patent/CL2016000240A1/es unknown
- 2016-06-14 US US15/181,916 patent/US20160287694A1/en not_active Abandoned
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080124793A1 (en) * | 2000-12-01 | 2008-05-29 | Roy Duncan | Membrane fusion proteins derived from reovirus |
| US20060014225A1 (en) * | 2002-12-13 | 2006-01-19 | Aurelium Biopharma Inc. | Vimentin directed diagnostics and therapeutics for multidrug resistant neoplastic disease |
| US20060165698A1 (en) * | 2003-01-20 | 2006-07-27 | Max-Planck-Gesellschaft Zur Foerung Der Wissenscha | L-amino acid oxidase with cytotoxic activity from aplysia punctata |
| WO2008106803A1 (en) * | 2007-03-07 | 2008-09-12 | Nventa Biopharmaceuticals Corporation | Double-stranded locked nucleic acid compositions |
Non-Patent Citations (3)
| Title |
|---|
| DATABASE GENBANK [online] 20 November 2008 (2008-11-20), "EST_ssal_eve_23282 ssaleve thyroid Salmo salar cDNA Salmo salar cDNA clone ssal_eve_531_277_fwd 5-, mRNA sequence.", XP008155435, Database accession no. EG879913 * |
| DATABASE SWISS-PROT [online] 31 October 2006 (2006-10-31), "Nonstructural protein sigma NS", XP008156755, Database accession no. 072469 * |
| See also references of EP2482824A4 * |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9366667B2 (en) | 2009-10-02 | 2016-06-14 | The Trustees Of Columbia University In The City Of New York | Piscine reovirus diagnostic compositions |
| EP3216875A3 (en) * | 2014-04-18 | 2017-12-13 | Schweitzer Biotech Company Ltd. | Methods for detecting pathogens piscine reovirus (prv), infectious pancreatic necrosis virus (ipnv), salmonid alphaviurs (sav), and infectious salmon anemia virus (isav) in coldwater fish |
| TWI660176B (zh) * | 2014-04-18 | 2019-05-21 | 福又達生物科技股份有限公司 | 冷水魚病原菌魚呼吸道與腸道病毒檢測方法 |
| NO346439B1 (en) * | 2014-06-03 | 2022-08-15 | Veterinærinstituttet | New reovirus infecting rainbow trout |
| NO20161983A1 (en) * | 2014-06-03 | 2016-12-14 | Veterinærinstituttet | New reovirus infecting rainbow trout |
| WO2015185605A1 (en) * | 2014-06-03 | 2015-12-10 | Veterinærinstituttet | New reovirus infecting rainbow trout |
| WO2019110664A1 (en) | 2017-12-06 | 2019-06-13 | Intervet International B.V. | Use of a non-structural protein from prv to protect against heart and skeletal muscle inflammation |
| EP3862443A4 (en) * | 2018-10-05 | 2022-10-12 | Schweitzer Biotech Company Ltd. | PROCEDURE FOR DETECTING FISH PATHOGENS |
| CN110408637A (zh) * | 2019-08-08 | 2019-11-05 | 中国水产科学研究院长江水产研究所 | 一种草鱼出血病酵母口服疫苗及应用 |
| CN110408637B (zh) * | 2019-08-08 | 2020-12-25 | 中国水产科学研究院长江水产研究所 | 一种草鱼出血病酵母口服疫苗及应用 |
| WO2021122507A1 (en) | 2019-12-16 | 2021-06-24 | Intervet International B.V. | Inactivated piscine orthoreovirus vaccine |
| US12502426B2 (en) | 2019-12-16 | 2025-12-23 | Intervet Inc. | Inactivated piscine orthoreovirus vaccine |
| WO2025156063A1 (es) * | 2024-01-25 | 2025-07-31 | Universidad De Santiago De Chile | Vacuna, método de producción, uso para tratar y prevenir proteínas de cápside de piscine orthoreovirus |
Also Published As
| Publication number | Publication date |
|---|---|
| CL2013002933A1 (es) | 2014-06-27 |
| DK179132B1 (en) | 2017-11-27 |
| US20160287694A1 (en) | 2016-10-06 |
| CA2776534A1 (en) | 2011-04-07 |
| CA2776386A1 (en) | 2011-04-07 |
| US20130058968A1 (en) | 2013-03-07 |
| US20130072542A1 (en) | 2013-03-21 |
| US9395356B2 (en) | 2016-07-19 |
| EP2482825B1 (en) | 2016-11-23 |
| CL2013002907A1 (es) | 2014-03-21 |
| CA2776386C (en) | 2018-02-27 |
| EP2482824A4 (en) | 2013-06-19 |
| US9366667B2 (en) | 2016-06-14 |
| EP2482825A4 (en) | 2013-06-26 |
| CN102647988A (zh) | 2012-08-22 |
| JP2013506672A (ja) | 2013-02-28 |
| EP2482825A1 (en) | 2012-08-08 |
| EP2482824A1 (en) | 2012-08-08 |
| CL2012000822A1 (es) | 2012-07-20 |
| DK201170227A (en) | 2011-05-11 |
| WO2011041790A1 (en) | 2011-04-07 |
| CL2016000240A1 (es) | 2016-07-29 |
| CL2012000821A1 (es) | 2012-08-03 |
| EP2482824B1 (en) | 2016-11-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| DK179132B1 (en) | Piscine reovirus immunogenic compositions | |
| Saint-Jean et al. | Infectious pancreatic necrosis virus: biology, pathogenesis, and diagnostic methods | |
| CA2690668C (en) | Vaccines containing canine parvovirus genetic variants | |
| RU2547589C2 (ru) | Новый птичий астровирус | |
| US8178110B2 (en) | Reovirus compositions and methods of use | |
| JP7046607B2 (ja) | 先天性振戦に対するペスチウイルスワクチン | |
| WO2014153168A2 (en) | Porcine astrovirus sequences and uses thereof | |
| US20130071421A1 (en) | Turkey viral hepatitis virus and uses thereof | |
| US20130129762A1 (en) | Marker vaccine for classical swine fever | |
| Cheggag et al. | Pathotypic, molecular, and serological response of specific-pathogen-free chickens inoculated by three very virulent infectious bursal disease virus strains | |
| Elfeil et al. | Protective efficacy of commercially available infectious bronchitis vaccination regimes against heterologous IBV QX challenge | |
| Ashraf | Studies on infectious bursal disease virus | |
| CA2737378C (en) | Vaccines containing canine parvovirus genetic variants | |
| Harris | Characterization of infectious bursal disease viruses isolated from commercial chickens | |
| US20150093403A1 (en) | Canine circovirus sequences and uses thereof | |
| Dawe | Characterization of Immune Responses to Avian Reovirus Variants and Evaluation of an Attenuation Method | |
| Ismael et al. | Egyptian Journal of Veterinary Sciences | |
| Zhang et al. | Molecular characteristics of VP4 and VP7 of a Rotavirus A in cattle in Yunnan Province, China | |
| Hassan | Molecular, Pathogenesis and Immunological Studies of the Canadian Delmarva (DMV/1639) Infectious Bronchitis Virus (IBV) Variant | |
| Hassebroek | Severe Acute Respiratory Syndrome Coronavirus-2 Vaccine Development: A Virus-Like Particle Vaccine Approach | |
| Ismael et al. | Characterization of vvIBDV in Vaccinated Broilers and Evaluation of Protection of Different Vaccination Programs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201080044602.7 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10821407 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2776386 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012532138 Country of ref document: JP |
|
| REEP | Request for entry into the european phase |
Ref document number: 2010821407 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010821407 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13499874 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013002933 Country of ref document: CL |