WO2010132888A2 - Methods and compositions relating to fusions of alk for diagnosing and treating cancer - Google Patents

Methods and compositions relating to fusions of alk for diagnosing and treating cancer Download PDF

Info

Publication number
WO2010132888A2
WO2010132888A2 PCT/US2010/035147 US2010035147W WO2010132888A2 WO 2010132888 A2 WO2010132888 A2 WO 2010132888A2 US 2010035147 W US2010035147 W US 2010035147W WO 2010132888 A2 WO2010132888 A2 WO 2010132888A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
alk
primer
cancer
pcr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2010/035147
Other languages
English (en)
French (fr)
Other versions
WO2010132888A3 (en
Inventor
Josh Nickols
Eric Dahlhauser
David Haut
Kim Norman
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Insight Genetics Inc
Original Assignee
Insight Genetics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to JP2012511069A priority Critical patent/JP2012526563A/ja
Priority to EP16175320.7A priority patent/EP3133167B1/en
Priority to BRPI1012140A priority patent/BRPI1012140A2/pt
Priority to CN201080031440.3A priority patent/CN102575287B/zh
Priority to MX2011012162A priority patent/MX338297B/es
Priority to RU2011151049/10A priority patent/RU2562144C2/ru
Priority to US13/320,303 priority patent/US20120208713A1/en
Priority to AU2010248782A priority patent/AU2010248782B2/en
Application filed by Insight Genetics Inc filed Critical Insight Genetics Inc
Priority to EP10775673A priority patent/EP2432900A4/en
Priority to CA2762108A priority patent/CA2762108A1/en
Publication of WO2010132888A2 publication Critical patent/WO2010132888A2/en
Publication of WO2010132888A3 publication Critical patent/WO2010132888A3/en
Anticipated expiration legal-status Critical
Priority to US15/334,974 priority patent/US20170183743A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays

Definitions

  • anaplastic lymphoma kinase ALK
  • ALK anaplastic lymphoma kinase
  • the methods and compositions disclosed herein relate to the field of detection or diagnosis of the presence of a disease or condition such as cancer; assessing the susceptibility or risk for a disease or condition such as cancer; the monitoring disease progression for a disease such as cancer; and the determination of susceptibility or resistance to therapeutic treatment of a disease such as cancer, wherein the disease or condition is a cancer associated with a nucleic acid variation, truncation, or gene fusion of the ALK gene. It is understood and herein contemplated that the methods disclosed herein allow for rapid and sensitive detection of rare mutations (i.e., nucleotide variations that are low in number) including mutations comprising polypeptide fusions in the presence of
  • this invention in one aspect, relates to methods of detecting the presence of a cancer by detecting a nucleotide variation within a nucleic acid of interest comprising conducting reverse transcription polymerase chain reaction (RT-PCR) on mRNA extracted from a tissue sample from a subject with a cancer; wherein the presence of amplification product or an increase in amplification product relative to a control indicates the presence of a fusion, nucleotide variation, truncation, or excessive expression, thereby detecting the presence of a cancer.
  • RT-PCR reverse transcription polymerase chain reaction
  • the invention in one aspect, relates to methods of detecting the presence of a cancer by detecting the presence of one or more ALK related fusions, and/or the upregulated expression of wildtype ALK as may occur in certain cancers.
  • Figure 1 shows representative ALK fusion proteins, chromosomal rearrangements that generate them, their occurrence in ⁇ Z ⁇ T-positive lymphomas and inflammatory myofibroblastic tumor (IMT) sarcomas, and their subcellular localizations.
  • a partial listing of the more common oncogenic ALK fusions is shown (not shown: ALOIl-ALK, CARS- ALK, MYR9-ALK, SEC31LI-ALK, MSN-ALK, and TFG Xh -ALK).
  • C cytosolic
  • N nuclear
  • CM cell membrane
  • NM nuclear membrane.
  • TPM3 tropomyosin-3
  • ATIC 5- aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase;
  • CLTC clathrin heavy chain
  • TFG TRK-fused gene
  • TPM4 tropomyosin-4
  • MSN moesin
  • RanBP2 Ran-binding protein 2
  • EML4 echinoderm mircrotubule-associated protein-like 4.
  • Figure 2 shows forward and reverse primers for RT-PCR reactions to detect ALK fusions.
  • Figure 3 shows approximate probe position and breakage region of wildtype ALK and various fusion partners including seven variants of EMLA-ALK, NPM-ALK, MSN-ALK, CLTC-ALK, TPM-ALK, and KIF5B-ALK.
  • Figure 4 shows RT-PCR Amplification of ALK Fusion Targets.
  • Figure 5 shows a detection of ALK fusion and the identification of an amplicon by RT-PCR.
  • Figure 5 A shows that a sample from a subject can be obtained and tested for the presence of ALK fusions (known or previously unidentified), wildtype ALK, ALK kinase domains, as well as reaction controls for normalization between assays (COX5B) and positive and negative assay controls.
  • Figure 5B shows examples of the identification of fusions or wildtypes by amplicon size.
  • Ranges can be expressed herein as from “about” one particular value, and/or to "about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value "10" is
  • an “increase” can refer to any change that results in a larger amount of a composition or compound, such as an amplification product relative to a control.
  • an increase in the amount in amplification products can include but is not limited to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% increase.
  • the detection an increase in expression or abundance of a DNA, mRNA, or protein relative to a control necessarily includes detection of the presence of the DNA, mRNA, or protein in situations where the DNA, mRNA, or protein is not present in the control.
  • tissue samples can be obtained by any means known in the art including invasive and non-invasive techniques. It is also understood that methods of measurement can be direct or indirect. Examples of methods of obtaining or measuring a tissue sample can include but are not limited to tissue biopsy, tissue lavage, aspiration, tissue swab, spinal tap, magnetic resonance imaging (MRI), Computed Tomography (CT) scan, Positron Emission Tomography (PET) scan, and X-ray (with and without contrast media).
  • MRI magnetic resonance imaging
  • CT Computed Tomography
  • PET Positron Emission Tomography
  • Allele specific primers can be designed to target a mutation at a known location such that its signal can be preferentially amplified over wildtype DNA.
  • the disclosed methods in one aspect related to methods of detection or diagnosis of the presence of a disease or condition such as a cancer, assessing the susceptibility or risk for a disease or condition such as a cancer, the monitoring of the progression of a disease or condition such as a cancer, and the determination of susceptibility or resistance to therapeutic treatment for a disease or condition such as a cancer in a subject comprising detecting the presence or measuring the expression level of mRNA from a tissue sample from the subject; wherein an increase in the amount of amplification product relative to a control indicates the presence of a cancer, and wherein the cancer is associated with a nucleic acid variation, truncation, or gene fusion of ALK.
  • Anaplastic Lymphoma Kinase The ALK gene encodes a receptor tyrosine kinase (RTK) called ALK (SEQ ID NO: 1) (Genbank Accession No. U62540 (human coding sequence)) and is normally expressed primarily in the central and peripheral nervous systems.
  • ALK receptor tyrosine kinase
  • SEQ ID NO: 1 Genbank Accession No. U62540 (human coding sequence)
  • the ⁇ 620a ⁇ ALK polypeptide comprises a 1030aa extracellular domain which includes a 26aa amino-terminal signal peptide sequence, and binding sites located between residues 391 and 401. Additionally the ALK polypeptide comprises a kinase domain (residues 1116-1383) which includes three tyrosines responsible for autophosphorylation within the activation loop at residues 1278, 1282, and 1283.
  • ALK mutations have been shown to constitutively activate the kinase catalytic function of the ALK protein, with the deregulated mutant ALK in turn activating downstream cellular signaling proteins in pathways that promote aberrant cell proliferation.
  • the mutations that result in dysregulated ALK kinase activity are associated with several types of cancers.
  • ALK fusions represent the most common mutation of this tyrosine kinase.
  • Such fusions include but are not limited to (NPM-ALK), 5-aminoimidazole- 4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase (ATIC-ALK), clathrin heavy chain-ALK (CLTC-ALK), kinesin-1 heavy chain gene-ALK (KJF5B-ALK); Ran- binding protein 2-ALK (RANBP2-ALK), SEC3 ILl -ALK, tropomyosin-3- ⁇ iX (TPM3- ALK), tropomyosin-4-ALK (TVM4-ALK), TRK-fused gene(Large) -ALK (TFG L -ALK), TRK-fused gene(Small) -ALK (TFG S -ALK), CARS-ALK, EMLA-ALK, 5-aminoimidazole-4- car
  • CLTC-ALK and NPM- ⁇ 2X also occur in B-cell plasmablastic/immunoblastic lymphomas.
  • the TVM4-ALK fusion occurs in esophageal squamous cell carcinomas, and the ALK fusion ⁇ ML4-ALK, , TFG-ALK and KIF5B-ALK are found in non-small cell lung cancers.
  • EML4-ALK has also recently been identified in both colorectal and breast carcinomas as well.
  • detecting the presence of an ALK related fusion comprising detecting the presence of or measuring the amount of nucleic acid associated with an ALK fusion from a tissue sample from a subject, wherein the presence of a nucleic acid or an increase in a nucleic acid relative to a control indicated the presence of an ALK fusion.
  • ALK fusions are associated with several known cancer types. It is understood that one or more ALK fusions can be associated with a particular cancer. It is further understood that there are several types of cancer associated with ALK fusions including but not limited to anaplastic large-cell lymphoma (ALCL), neuroblastoma, breast cancer, ovarian cancer, colorectal carcinoma, non-small cell lung carcinoma, diffuse large B-cell lymphoma, esophageal squamous cell carcinoma, anaplastic large-cell lymphoma, neuroblastoma, inflammatory myofibroblastic tumors, malignant histiocytosis, and glioblastomas.
  • ACL anaplastic large-cell lymphoma
  • neuroblastoma neuroblastoma
  • breast cancer breast cancer
  • ovarian cancer colorectal carcinoma
  • non-small cell lung carcinoma diffuse large B-cell lymphoma
  • esophageal squamous cell carcinoma anaplastic large-cell lymphoma
  • ALCL anaplastic large-cell lymphomas comprise -2.5% of all NHL; within the pediatric age group specifically, -13% of all NHL (30 - 40% of all childhood large-cell lymphomas) are of this type.
  • more than a third of patients suffer multiple relapses following chemotherapy, thus the 5-year disease-free survival of ALK-positive ALCL is only -40%.
  • ALK+ Diffuse large B-cell lymphoma In 2003, ALK fusions were shown to occur in a non-ALCL form of NHL with the description of CLTC-ALK or NPM-ALK in diffuse large B-cell lymphomas (ALK+ DLBCLs). Consistent with their B-lineage, these NHLs express cytoplasmic IgA and plasma cell markers, and possess an immunoblastic
  • DLBCL Approximately 0.5-1% of all DLBCL is thought to be ALK-positive.
  • the identification of DLBCLs caused by mutant ALK is important because patients with these lymphomas have outcomes that are much inferior to ALK-negative DLBCL patients following CHOP-based treatments; thus, ALK+ DLBCL patients should strongly be considered as candidates for ALK-targeted kinase inhibitor therapy.
  • ALK+ systemic histiocytosis ALK+ systemic histiocytosis. ALK fusions were described in 2008 in another hematopoietic neoplasm, systemic histiocytosis. Three cases of this previously uncharacterized form of histiocytosis, which presents in early infancy, exhibited ALK immunoreactivity and the one case analyzed molecularly expressed TPM3-ALK.
  • IMT inflammatory myofibroblastic tumor
  • ALK inflammatory myofibroblastic tumor
  • Many IMTs are indolent and can be cured by resection.
  • locally recurrent, invasive, and metastatic EVITs are not uncommon and current chemo- and radio-therapies are completely ineffective.
  • chromosome 2p23 the location of the ALK gene
  • ALK immunoreactivity in 7 of 11 IMTs has been shown and TPM3-ALK and TPM4-ALK were identified in several cases. Additionally, two additional ALK fusions in LVIT, CLTC- and RanBP2-ALK were identified. ALK fusions have also been examined by immunostaining in 73 EvITs, finding 60% (44 of the 73 cases) to be ALK-positive. Thus, ALK deregulation is of pathogenic importance in a majority of EVITs.
  • Non-small cell lung carcinoma 1063793 Non-small cell lung carcinoma.
  • the role of ALK fusions in cancer expanded further with the description of the novel EML4-ALK chimeric protein in 5 of 75 (6.7%) Japanese non-small cell lung carcinoma patients.
  • the existence of ALK fusions in lung cancer was corroborated by a different group who found 6 of 137 (4.4%) Chinese lung cancer patients to express ALK fusions (EML4-ALK, 3 pts; TFG-ALK, 1 pt; X-ALK.
  • ALK fusions occur predominately in patients with adenocarcinoma (although occasional ALK-positive NSCLCs of squamous or mixed histologies are observed), mostly in individuals with minimal/no smoking history, and 2) ALK abnormalities usually occur exclusive of other common genetic abnormalities (e.g., EGFR and KRAS mutations).
  • ALK abnormalities usually occur exclusive of other common genetic abnormalities (e.g., EGFR and KRAS mutations).
  • the exact percentage of NSCLCs caused by ALK fusions is not yet clear but estimates based on reports in the biomedical literature suggest a range of -5-10%.
  • Esophageal squamous cell carcinoma hi 45 Egyptian patients, a proteomics approach identified proteins under or over-represented in esophageal squamous cell carcinomas (ESCCs); TPM4-ALK was among those proteins over-represented.
  • ESCCs esophageal squamous cell carcinomas
  • a second proteomics- based ESCC study - in this case, in Chinese patients — identified TPM4-ALK in these tumors as well.
  • ALK in familial and sporadic neuroblastoma Neuroblastoma is the most common extracranial solid tumor of childhood, and is derived from the developing neural crest. A small subset (-1-2%) of neuroblastomas exhibit a familial predisposition with an autosomal dominant inheritance. Most neuroblastoma patients have aggressive disease associated with survival probabilities ⁇ 40% despite intensive chemo- and radio-therapy, and the disease accounts for -15% of all childhood cancer mortality.
  • ALK had previously been found to be constitutively activated also due to high-level over-expression as a result of gene amplification in a small number of neuroblastoma cell lines, in fact, ALK amplification occurs in -15% of neuroblastomas in addition to activating point mutations. These missense mutations in ALK have been confirmed as activating mutations that drive neuroblastoma
  • a disease or condition such as cancer, for example an anaplastic lymphoma kinase (ALK) related cancer
  • ALK anaplastic lymphoma kinase
  • Also disclosed are methods of assessing the susceptibility or risk for a disease or condition, monitoring disease progression, or determination of susceptibility or resistance to therapeutic treatment for a cancer associated with a nucleic acid variation, truncation, or ALK fusion in a subject comprising detecting the presence or measuring the level or DNA, cDNA, or the expression level of mRNA from a tissue sample from the subject; wherein an increase in the amount of amplification product relative to a control indicates the presence of an ALK related cancer.
  • the detection of ALK fusion sequences indicates the presence of a cancer.
  • anaplastic lymphoma kinase (ALK) related cancer comprising detecting the presence or measuring the expression level of mRNA from a tissue sample from the subject; wherein the mRNA is specific to an ALK fusion; and wherein an increase in the amount of mRNA relative to a control indicates the presence of an ALK related cancer.
  • ALK anaplastic lymphoma kinase
  • ALK fusion related cancers can be treated with ALK kinase inhibitors.
  • ALK kinase inhibitor resistant cancers have also been discovered. These cancers are ALK fusions that further comprise point mutations of ALK in familial and sporadic cancers (e.g., neuroblastoma, breast cancer, ovarian cancer, colorectal carcinoma, non-small cell lung
  • ALK 1063793 9 carcinoma, diffuse large B-cell lymphoma, esophageal squamous cell carcinoma, anaplastic large-cell lymphoma, neuroblastoma, inflammatory myofibroblastic tumors, malignant histiocytosis, and glioblastomas).
  • the mutations in ALK result in constitutive activation of ALK. Accordingly ALK associated cancers are driven by these activating point mutations.
  • detecting the presence of a cancer is accomplished through the detection of point mutations in the sequence of ALK (i.e., by detecting the point mutation, an ALK- ⁇ olated cancer is identified).
  • the cancer further comprises one or more point mutations in ALK or wildtype ALK upregulation.
  • the disclosed ALK fusions can also cause deregulation of wildtype ALK.
  • the dysregulated wildtype ALK can result an increase in wildtype ALK being produced as well as the disregulation of the kinase catalytic activity.
  • the cause of an ALK related cancer can be due not only dysregulation of wildtype ALK or known ALK fusions, but one or more unidentified ALK fusions. Methods that are only able to detect known fusions would be unable to detect previously unknown fusions or mutations of ALK.
  • detecting not only the presence of a truncation, nucleic acid variation of ALK or an ALK fusion, but alos detecting the presence of wildtype ALK and ALK kinase activity the skilled artisan can determine if the cancer is due to dysregulated wildtype ALK, a known ALK fusion, or a previously unidentified ALK fusion or mutation of ALK. Accordingly, disclosed herein are methods for diagnosing a cancer, assessing the suceptability or risk or a cancer, or detecting
  • 1063793 IQ the presence of dysregulation of ALK further comprising detecting the presence of wildtype ALK and methods still further comprising detecting the presence of ALK kinase activity.
  • methods of diagnosing an ALK related cancer comprising detecting the presence of nucleic acid associated with an ALK fusion, wildtype ALK and/or an ALK kinase domain from a tissue sample in a subject.
  • the methods disclosed herein relate to the detection of nucleic acid variation in the form of, for example, point mutations and truncations, or the detection of expression of ALK fusions, aberrant wildtype ALK expression, or expression of ALK truncation mutants.
  • the methods comprise detecting either the abundance or presence of mRNA, or both.
  • ALK anaplastic lymphoma kinase
  • RNA sample A number of widely used procedures exist for detecting and determining the abundance of a particular mRNA in a total or poly(A) RNA sample. For example, specific mRNAs can be detected using Northern blot analysis, nuclease protection assays (NPA), in situ hybridization, or reverse transcription-polymerase chain reaction (RT-PCR), and microarray.
  • NPA nuclease protection assays
  • RT-PCR reverse transcription-polymerase chain reaction
  • each of these techniques can be used to detect specific RNAs and to precisely determine their expression level.
  • Northern analysis is the only method that provides information about transcript size, whereas NPAs are the easiest way to simultaneously examine multiple messages.
  • In situ hybridization is used to localize expression of a particular gene within a tissue or cell type, and RT-PCR is the most sensitive method for detecting and quantitating gene expression.
  • RT-PCR allows for the detection of the RNA transcript of any gene, regardless of the scarcity of the starting material or relative abundance of the specific mRNA.
  • an RNA template is copied into a complementary DNA (cDNA) using a retroviral reverse transcriptase.
  • the cDNA is then amplified exponentially by PCR using a DNA polymerase.
  • the reverse transcription and PCR reactions can occur in the same or difference tubes.
  • RT-PCR is somewhat tolerant of degraded RNA. As long as the RNA is intact within the region spanned by the primers, the target will be amplified.
  • Relative quantitative RT-PCR involves amplifying an internal control simultaneously with the gene of interest.
  • the internal control is used to normalize the samples. Once normalized, direct comparisons of relative abundance of a specific mRNA can be made across the samples. It is crucial to choose an internal control with a constant level of expression across all experimental samples (i.e., not affected by experimental treatment).
  • Commonly used internal controls e.g., GAPDH, ⁇ -actin, cyclophilin
  • GAPDH, ⁇ -actin, cyclophilin often vary in expression and, therefore, may not be appropriate internal controls. Additionally, most common internal controls are expressed at much higher levels than the mRNA being studied. For relative RT-PCR results to be meaningful, all products of the PCR reaction must be analyzed in the linear range of amplification. This becomes difficult for transcripts of widely different levels of abundance.
  • RT-PCR is used for absolute quantitation. This technique involves designing, synthesizing, and accurately quantitating a competitor RNA that can be distinguished from the endogenous target by a small difference in size or sequence. Known amounts of the competitor RNA are added to experimental samples and RT-PCR is performed. Signals from the endogenous target are compared with signals from the competitor to determine the amount of target present in the sample.
  • RT-PCR reverse transcription polymerase chain reaction
  • RT-PCR reverse transcription polymerase chain reaction
  • RT-PCR reverse transcription polymerase chain reaction
  • the reverse transcription polymerase chain reaction comprises a reverse primer capable of specifically hybridizing to one or more ALK sequences and at least one forward primer wherein the forward primer specifically hybridizes to an ALK fusion partner
  • RT-PCR reverse transcription polymerase chain reaction
  • 1063793 12 specifically hybridizing to one or more ALK sequences; a third RT-PCR reaction on mRNA from a tissue sample from the subject; wherein the reverse transcription polymerase chain reaction (RT-PCR) comprises a forward and reverse primer capable of specifically hybridizing to one or more ALK kinase domain sequences; and wherein the presence of an amplicon or the increase in the amount of amplification product relative to a control indicates the presence of an ALK related cancer and the presence of dysregulation of ALK kinase.
  • RT-PCR reverse transcription polymerase chain reaction
  • the presence of ALK fusion amplicon and a kinase domain amplicon indicates the presence of a known ALK fusion; the presence of a wildtype amplicon and a kinase domain amplicon indicates wildtype ALK, and the presence of kinase domain amplicon alone indicates the presence of a previously unidentified ALK fusion or mutated ALK.
  • Northern analysis is the easiest method for determining transcript size, and for identifying alternatively spliced transcripts and multigene family members. It can also be used to directly compare the relative abundance of a given message between all the samples on a blot.
  • the Northern blotting procedure is straightforward and provides opportunities to evaluate progress at various points (e.g., intactness of the RNA sample and how efficiently it has transferred to the membrane).
  • RNA samples are first separated by size via electrophoresis in an agarose gel under denaturing conditions. The RNA is then transferred to a membrane, crosslinked and hybridized with a labeled probe.
  • Nonisotopic or high specific activity radiolabeled probes can be used including random-primed, nick-translated, or PCR-generated DNA probes, in vitro transcribed RNA probes, and oligonucleotides. Additionally, sequences with only partial homology (e.g., cDNA from a different species or genomic DNA fragments that might contain an exon) may be used as probes.
  • probes are usually about 100-400 bases in length.
  • NPAs are the method of choice for the simultaneous detection of several RNA species. During solution hybridization and subsequent analysis, individual probe/target interactions are completely independent of one another. Thus, several RNA targets and appropriate controls can be assayed simultaneously (up to twelve have been used in the same reaction), provided that the individual probes are of different lengths. NPAs are also commonly used to precisely map mRNA termini and intron/exon junctions.
  • ISH In situ hybridization
  • ISH is a powerful and versatile tool for the localization of specific mRNAs in cells or tissues. Unlike Northern analysis and nuclease protection assays, ISH does not require the isolation or electrophoretic separation of RNA. Hybridization of the probe takes place within the cell or tissue. Since cellular structure is maintained throughout the procedure, ISH provides information about the location of mRNA within the tissue sample. The procedure begins by fixing samples in neutral-buffered formalin, and embedding the tissue in paraffin. The samples are then sliced into thin sections and mounted onto microscope slides.
  • tissue can be sectioned frozen and post-fixed in paraformaldehyde.
  • tissue can be sectioned frozen and post-fixed in paraformaldehyde.
  • a Proteinase K digestion is performed to increase probe accessibility, and a labeled probe is then hybridized to the sample sections. Radiolabeled probes are visualized with liquid film dried onto the slides, while nonisotopically labeled probes are conveniently detected with colorimetric or fluorescent reagents.
  • BESS base excision sequence scanning
  • SSCP single strand conformation polymorphism
  • HA heteroduplex analysis
  • CSGE conformation-sensitive gel electrophoresis
  • DGGE denaturing gradient gel electrophoresis
  • CDGE constant denaturing gel electrophoresis
  • TTGE temporal temperature gradient gel electrophoresis
  • TEERTM Template Exchange and Extension Reaction
  • TEERTM uses in its latter steps a selective amplification to increase the sensitivity of detection of rare and unknown mutations. This advantage translates to an ability to detect diseases early as well as the ability to monitor the accumulation of additional mutational changes in cancers as they continue to progress and mutate.
  • TEERTM is adaptable to multiple platforms including real-time PCR, fragment analysis, and electrophoresis. For example, TEERTM starting from sample acquisition to endpoint detection of rare ALK activating point mutations from a mixed clinical sample specimen that contains an abundance of normal DNA from contaminating non-tumor cells. The entire process can be completed in approximately 5.5 hours.
  • the TEERTM platform consists of 5 basic steps. 1. An allele-specific oligonucleotide containing a sequencing fluorescent fluorescein (FAM) tag and a biotin tag for solid-phase capture purification is used for PCR amplification of an initial ALK 270-bp template containing rare or novel mutations. 2. The amplicon is heat denatured and then allowed to hybridize along with the denatured wild-type ALK template, allowing Template Exchange to occur. 3. Any existing mismatched nucleotides are then cleaved enzymatically using the single stranded nuclease, CEL 1. 4. The DNA strand containing the excised mismatched base is extended with Taq polymerase. 5.
  • FAM sequencing fluorescent fluorescein
  • TEERTM The TEERTM process was originally developed to address a need in the oncology field for a high-throughput tool to detect undiscovered genetic polymorphisms in templates from malignant cells and tissues.
  • TEERTM was originally demonstrated using polyacrylamide gel electrophoresis (PAGE).
  • PAGE polyacrylamide gel electrophoresis
  • TEERTM is designed to detect genetic variation in DNA templates that may contain rare, known or novel mutations in comparison to a control, non-mutated DNA template. Based on the fact that sequencing products are unique to the template from which they are generated, TEERTM was used to compare an "unknown" DNA template that potentially contained mutations to a template confirmed to lack mutations. Any changes in the sequencing products reflected a genetic mutation in the unknown DNA template and could be visualized by gel electrophoresis.
  • the TEERTM process was adapted to a solid-phase microtiter detection platform to permit highthroughput analysis and improve ease of use.
  • Control and "unknown" DNA templates were amplified using a 5' biotinylated primer to generate biotinylated PCR products.
  • homoduplex and heteroduplex DNA was formed by the hybridization of PCR amplicons from control and "unknown" DNA templates.
  • the homoduplex and heteroduplex DNA was attached to the solid phase via conjugation to streptavidin-coated microplate wells in which all steps of the TEERTM process could then be easily performed, greatly simplifying sample handling and processing.
  • the TEERTM process is a modified allele-specif ⁇ c oligonucleotide hybridization assay and can be complexed to a real-time PCR platform for high throughput and high sensitivity. DNA detection and quantification
  • the methods disclosed herein relate to the detection of nucleic acid variation in the form of, for example, point mutations and truncations, or the detection of expression of ALK fusions, aberrant wildtype ALK expression, or expression of ALK truncation mutants.
  • the methods comprise detecting either the abundance or presence of mRNA, or both.
  • detection can directed to the abundance or presence of DNA, for example, cDNA.
  • methods and compositions for diagnosing an anaplastic lymphoma kinase (ALK) related cancer in a subject comprising measuring the presence or level of DNA from a tissue sample from the subject; wherein an increase in the amount of DNA relative to a control indicates the presence of an ALK related cancer.
  • ALK anaplastic lymphoma kinase
  • the technology of PCR permits amplification and subsequent detection of minute quantities of a target nucleic acid. Details
  • oligonucleotide primers are annealed to the denatured strands of a target nucleic acid, and primer extension products are formed by the polymerization of deoxynucleoside triphosphates by a polymerase.
  • a typical PCR method involves repetitive cycles of template nucleic acid denaturation, primer annealing and extension of the annealed primers by the action of a thermostable polymerase.
  • QPCR Quantitative PCR
  • microarrays real-time PCT; hot start PCR; nested PCR; allele- specific PCR; and Touchdown PCR.
  • Microarrays An array is an orderly arrangement of samples, providing a medium for matching known and unknown DNA samples based on base-pairing rules and automating the process of identifying the unknowns.
  • An array experiment can make use of common assay systems such as microplates or standard blotting membranes, and can be created by hand or make use of robotics to deposit the sample.
  • arrays are described as macroarrays or microarrays, the difference being the size of the sample spots.
  • Macroarrays contain sample spot sizes of about 300 microns or larger and can be easily imaged by existing gel and blot scanners.
  • microarray can be 300 microns or less, but typically less than 200 microns in diameter and these arrays usually contains thousands of spots.
  • Microarrays require specialized robotics and/or imaging equipment that generally are not commercially available as a complete system. Terminologies that have been used in the literature to describe this technology include, but not limited to: biochip, DNA chip, DNA microarray, GeneChip® (Affymetrix, Inc which refers to its high density, oligonucleotide- based DNA arrays), and gene array.
  • DNA microarrays or DNA chips are fabricated by high-speed robotics, generally on glass or nylon substrates, for which probes with known identity are used to determine complementary binding, thus allowing massively parallel gene expression and gene discovery studies. An experiment with a single DNA chip can provide information on thousands of genes simultaneously. It is herein contemplated that the disclosed microarrays can be used to monitor gene expression, disease diagnosis, gene discovery, drug discovery (pharmacogenomics), and toxicological research or toxicogenomics.
  • Type I microarrays comprise a probe cDNA (500-5,000 bases long) that is immobilized to a solid surface such as glass using robot spotting and exposed to a set of targets either separately or in a mixture. This method is traditionally referred to as DNA microarray.
  • Type I microarrays localized multiple copies of one or more polynucleotide sequences, preferably copies of a single polynucleotide sequence are immobilized on a plurality of defined regions of the substrate's surface.
  • a polynucleotide refers to a chain of nucleotides ranging from 5 to 10,000 nucleotides. These immobilized copies of a polynucleotide sequence are suitable for use as probes in hybridization experiments.
  • Typical dispensers include a micropipette delivering solution to the substrate with a robotic system to control the position of the micropipette with respect to the substrate. There can be a multiplicity of dispensers so that reagents can be delivered to the reaction regions simultaneously.
  • a microarray is formed by using ink-jet technology based on the piezoelectric effect, whereby a narrow tube containing a liquid of interest, such as oligonucleotide synthesis reagents, is encircled by an adapter. An electric charge sent across the adapter causes the adapter to expand at a different rate than the tube and forces a small drop of liquid onto a substrate.
  • a liquid of interest such as oligonucleotide synthesis reagents
  • Samples may be any sample containing polynucleotides (polynucleotide targets) of interest and obtained from any bodily fluid (blood, urine, saliva, phlegm, gastric juices, etc.), cultured cells, biopsies, or other tissue preparations.
  • DNA or RNA can be isolated from the sample according to any of a number of methods well known to those of skill in the art. In one embodiment, total RNA is isolated using the TRIzol total RNA isolation reagent (Life Technologies, Inc., Rockville, Md.) and RNA is isolated using oligo d(T) column chromatography or glass beads. After hybridization and processing, the hybridization signals obtained should reflect accurately the amounts of control target polynucleotide added to the sample.
  • the plurality of defined regions on the substrate can be arranged in a variety of formats.
  • the regions may be arranged perpendicular or in parallel to the length of the casing.
  • the targets do not have to be directly bound to the substrate, but rather can be bound to the substrate through a linker group.
  • the linker groups may typically
  • Linker groups include ethylene glycol oligomers, diamines, diacids and the like. Reactive groups on the substrate surface react with one of the terminal portions of the linker to bind the linker to the substrate. The other terminal portion of the linker is then functionalized for binding the probes.
  • Sample polynucleotides may be labeled with one or more labeling moieties to allow for detection of hybridized probe/target polynucleotide complexes.
  • the labeling moieties can include compositions that can be detected by spectroscopic, photochemical, biochemical, bioelectronic, immunochemical, electrical, optical or chemical means.
  • the labeling moieties include radioisotopes, such as 32 P, 33 P or 35 S, chemiluminescent compounds, labeled binding proteins, heavy metal atoms, spectroscopic markers, such as fluorescent markers and dyes, magnetic labels, linked enzymes, mass spectrometry tags, spin labels, electron transfer donors and acceptors, biotin, and the like.
  • Labeling can be carried out during an amplification reaction, such as polymerase chain reaction and in vitro or in vivo transcription reactions.
  • the labeling moiety can be incorporated after hybridization once a probe-target complex his formed.
  • biotin is first incorporated during an amplification step as described above. After the hybridization reaction, unbound nucleic acids are rinsed away so that the only biotin remaining bound to the substrate is that attached to target polynucleotides that are hybridized to the polynucleotide probes. Then, an avidin-conjugated fluorophore, such as avidin-phycoerythrin, that binds with high affinity to biotin is added.
  • avidin-conjugated fluorophore such as avidin-phycoerythrin
  • Hybridization causes a polynucleotide probe and a complementary target to form a stable duplex through base pairing.
  • Hybridization methods are well known to those skilled in the art
  • Stringent conditions for hybridization can be defined by salt concentration, temperature, and other chemicals and conditions. Varying additional parameters, such as hybridization time, the concentration of detergent (sodium dodecyl sulfate, SDS) or solvent (formamide), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Additional variations on these conditions will be readily apparent to those skilled in the art.
  • the polynucleotide probes are labeled with a fluorescent label and measurement of levels and patterns of complex formation is accomplished by fluorescence microscopy, preferably confocal fluorescence microscopy.
  • fluorescence microscopy preferably confocal fluorescence microscopy.
  • An argon ion laser excites the fluorescent label, emissions are directed to a photomultiplier and the amount of emitted light detected and quantitated.
  • the detected signal should be proportional to the amount of
  • the fluorescence microscope can be associated with a computer-driven scanner device to generate a quantitative two-dimensional image of hybridization intensities. The scanned image is examined to determine the abundance/expression level of each hybridized target polynucleotide.
  • polynucleotide targets from two or more different biological samples are labeled with two or more different fluorescent labels with different emission wavelengths. Fluorescent signals are detected separately with different photomultipliers set to detect specific wavelengths. The relative abundances/expression levels of the target polynucleotides in two or more samples is obtained.
  • microarray fluorescence intensities can be normalized to take into account variations in hybridization intensities when more than one microarray is used under similar test conditions.
  • individual polynucleotide probe/target complex hybridization intensities are normalized using the intensities derived from internal normalization controls contained on each microarray.
  • Type II microarrays comprise an array of oligonucleotides (20 ⁇ 80-mer oligos) or peptide nucleic acid (PNA) probes that is synthesized either in situ (on-chip) or by conventional synthesis followed by on-chip immobilization. The array is exposed to labeled sample DNA, hybridized, and the identity/abundance of complementary sequences are determined.
  • This method "historically” called DNA chips, was developed at Affymetrix, Inc. , which sells its photolithographically fabricated products under the GeneChip® trademark.
  • Type II arrays for gene expression are simple: labeled cDNA or cRNA targets derived from the mRNA of an experimental sample are hybridized to nucleic acid probes attached to the solid support. By monitoring the amount of label associated with each DNA location, it is possible to infer the abundance of each mRNA species represented.
  • hybridization has been used for decades to detect and quantify nucleic acids, the combination of the miniaturization of the technology and the large and growing amounts of sequence information, have enormously expanded the scale at which gene expression can be studied.
  • Microarray manufacturing can begin with a 5 -inch square quartz wafer. Initially the quartz is washed to ensure uniform hydroxylation across its surface. Because quartz is naturally hydroxylated, it provides an excellent substrate for the attachment of chemicals, such as linker molecules, that are later used to position the probes on the arrays.
  • chemicals such as linker molecules
  • the wafer is placed in a bath of silane, which reacts with the hydroxy! groups of the quartz, and forms a matrix of covalently linked molecules.
  • the distance between these silane molecules determines the probes' packing density, allowing arrays to hold over 500,000 probe locations, or features, within a mere 1.28 square centimeters. Each of these features harbors millions of identical DNA molecules.
  • the silane film provides a uniform hydroxyl density to initiate probe assembly.
  • Linker molecules, attached to the silane matrix provide a surface that may be spatially activated by light.
  • Probe synthesis occurs in parallel, resulting in the addition of an A, C, T, or G nucleotide to multiple growing chains simultaneously.
  • photolithographic masks carrying 18 to 20 square micron windows that correspond to the dimensions of individual features, are placed over the coated wafer. The windows are distributed over the mask based on the desired sequence of each probe.
  • ultraviolet light is shone over the mask in the first step of synthesis, the exposed linkers become deprotected and are available for nucleotide coupling.
  • a solution containing a single type of deoxynucleotide with a removable protection group is flushed over the wafer's surface. The nucleotide attaches to the activated linkers, initiating the synthesis process.
  • oligonucleotide can be occupied by lof - ⁇ nucleotides, resulting in an apparent need for 25 x 4, or 100, different masks per wafer, the synthesis process can be designed to significantly reduce this requirement.
  • Algorithms that help minimize mask usage calculate how to best coordinate probe growth by adjusting synthesis rates of individual probes and identifying situations when the same mask can be used multiple times.
  • probe hybridization under particular pH, salt, and temperature conditions can be optimized by taking into account melting temperatures and using empirical rules that correlate with desired hybridization behaviors.
  • To obtain a complete picture of a gene's activity some probes are selected from regions shared by multiple splice or polyadenylation variants, hi other cases, unique probes that distinguish between variants are favored. Inter-probe distance is also factored into the selection process.
  • a different set of strategies is used to select probes for genotyping arrays that rely on multiple probes to interrogate individual nucleotides in a sequence.
  • the identity of a target base can be deduced using four identical probes that vary only in the target position, each containing one of the four possible bases.
  • the presence of a consensus sequence can be tested using one or two probes representing specific alleles.
  • arrays with many probes can be created to provide redundant information, resulting in unequivocal genotyping.
  • generic probes can be used in some applications to maximize flexibility.
  • Some probe arrays allow the separation and analysis of individual reaction products from complex mixtures, such as those used in some protocols to identify single nucleotide polymorphisms (SNPs).
  • Real-time PCR monitors the fluorescence emitted during the reaction as an indicator of amplicon production during each PCR cycle (i.e., in real time) as opposed to the endpoint detection.
  • the real-time progress of the reaction can be viewed in some systems.
  • Real-time PCR does not detect the size of the amplicon and thus does not allow the differentiation between DNA and cDNA amplification, however, it is not influenced by non-specific amplification unless SYBR Green is used.
  • Real-time PCR quantitation eliminates post-PCR processing of PCR products. This helps to increase throughput and reduce the chances of carryover contamination.
  • Real-time PCR also offers a wide dynamic range of up to 10 7 -fold.
  • Dynamic range of any assay determines how much target concentration can vary and still be quantified.
  • a wide dynamic range means that a wide range of ratios of target and normaliser can be assayed with equal sensitivity and specificity. It follows that the broader the dynamic range, the more accurate the quantitation.
  • a real-time RT PCR reaction reduces the time needed for measuring the amount of amplicon by providing for the visualization of the amplicon as the amplification process is progressing.
  • the real-time PCR system is based on the detection and quantitation of a fluorescent reporter. This signal increases in direct proportion to the amount of PCR product in a reaction. By recording the amount of fluorescence emission at each cycle, it is possible to monitor the PCR reaction during exponential phase where the first significant increase in the amount of PCR product correlates to the initial amount of target template. The higher the starting copy number of the nucleic acid target, the sooner a significant increase in fluorescence is observed. A significant increase in fluorescence above the baseline value measured during the 3-15 cycles can indicate the detection of accumulated PCR product.
  • a fixed fluorescence threshold is set significantly above the baseline that can be altered by the operator.
  • the parameter C T is defined as the cycle number at which the fluorescence emission exceeds the fixed threshold.
  • hydrolysis probes include TaqMan probes, molecular beacons and scorpions. They use the fluorogenic 5' exonuclease activity of Taq polymerase to measure the amount of target sequences in cDNA samples.
  • TaqMan probes are oligonucleotides longer than the primers (20-30 bases long with a Tm value of 1O 0 C higher) that contain a fluorescent dye usually on the 5' base, and a quenching dye (usually TAMRA) typically on the 3' base.
  • a fluorescent dye usually on the 5' base
  • a quenching dye usually on the 3' base.
  • FRET F ⁇ rster or fluorescence resonance energy transfer
  • Molecular beacons also contain fluorescent (FAM, TAMRA, TET, ROX) and quenching dyes (typically DABCYL) at either end but they are designed to adopt a hairpin structure while free in solution to bring the fluorescent dye and the quencher in close proximity for FRET to occur. They have two arms with complementary sequences that form a very stable hybrid or stem. The close proximity of the reporter and the quencher in this hairpin configuration suppresses reporter fluorescence. When the beacon hybridises to the target during the annealing step, the reporter dye is separated from the quencher and the reporter fluoresces (FRET does not occur). Molecular beacons remain intact during PCR
  • 1063793 23 and must rebind to target every cycle for fluorescence emission. This will correlate to the amount of PCR product available. All real-time PCR chemistries allow detection of multiple DNA species (multiplexing) by designing each probe/beacon with a spectrally unique fluor/quench pair as long as the platform is suitable for melting curve analysis if SYBR green is used. By multiplexing, the target(s) and endogenous control can be amplified in single tube.
  • Scorpion probes sequence-specific priming and PCR product detection is achieved using a single oligonucleotide.
  • the Scorpion probe maintains a stem-loop configuration in the unhybridised state.
  • the fluorophore is attached to the 5' end and is quenched by a moiety coupled to the 3' end.
  • the 3' portion of the stem also contains sequence that is complementary to the extension product of the primer. This sequence is linked to the 5' end of a specific primer via a non-amplifiable monomer.
  • the specific probe sequence is able to bind to its complement within the extended amplicon thus opening up the hairpin loop. This prevents the fluorescence from being quenched and a signal is observed.
  • SYBR- green I or ethidium bromide a non-sequence specific fluorescent intercalating agent
  • SYBR green is a fluorogenic minor groove binding dye that exhibits little fluorescence when in solution but emits a strong fluorescent signal upon binding to double-stranded DNA.
  • Disadvantages of SYBR green-based real-time PCR include the requirement for extensive optimisation.
  • non-specific amplifications require follow-up assays (melting point curve or dissociation analysis) for amplicon identification.
  • the threshold cycle or the C T value is the cycle at which a significant increase in ⁇ Rn is first detected (for definition of ⁇ Rn, see below).
  • the threshold cycle is when the system begins to detect the increase in the signal associated with an exponential growth of PCR product during the log-linear phase. This phase provides the most useful information about the reaction (certainly more important than the end-point).
  • the slope of the log-linear phase is a reflection of the amplification efficiency.
  • the efficiency (Eff) of the reaction can
  • the efficiency of the PCR should be 90 - 100% (3.6 > slope > 3.1).
  • a number of variables can affect the efficiency of the PCR. These factors include length of the amplicon, secondary structure and primer quality. Although valid data can be obtained that fall outside of the efficiency range, the qRT-PCR should be further optimised or alternative amplicons designed.
  • the important parameter for quantitation is the Cj.
  • the threshold should be placed above any baseline activity and within the exponential increase phase (which looks linear in the log transformation).
  • Some software allows determination of the cycle threshold (Cj) by a mathematical analysis of the growth curve. This provides better run-to-run reproducibility.
  • a C T value of 40 means no amplification and this value cannot be included in the calculations.
  • the Cx value can be used for qualitative analysis as a pass/fail measure.
  • Multiplex TaqMan assays can be performed using multiple dyes with distinct emission wavelengths.
  • Available dyes for this purpose are FAM, TET, VIC and JOE (the most expensive).
  • TAMRA is reserved as the quencher on the probe and ROX as the passive reference.
  • FAM target
  • VIC endogenous control
  • JOE endogenous control
  • Nested PCR increases the specificity of DNA amplification, by reducing background due to non-specific amplification of DNA. Two sets of primers are being used in two successive PCRs. In the first reaction, one pair of primers is used to generate DNA products, which besides the intended target, may still consist of non-specifically amplified DNA fragments. The product(s) are then used
  • 1063793 25 in a second PCR with a set of primers whose binding sites are completely or partially different from and located 3' of each of the primers used in the first reaction.
  • Nested PCR is often more successful in specifically amplifying long DNA fragments than conventional PCR, but it requires more detailed knowledge of the target sequences.
  • methods of diagnosing an anaplastic lymphoma kinase (ALK) related cancer in a subject comprising conducting a PCR reaction on DNA from a tissue sample from the subject; wherein the PCR reaction comprises a reverse primer capable of specifically hybridizing to one or more ALK sequences and at least one forward primer; and wherein an increase in the amount of amplification product relative to a control indicates the presence of an ALK related cancer.
  • primers are a subset of probes which are capable of supporting some type of enzymatic manipulation and which can hybridize with a target nucleic acid such that the enzymatic manipulation can occur.
  • a primer can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art which do not interfere with the enzymatic manipulation.
  • probes are molecules capable of interacting with a target nucleic acid, typically in a sequence specific manner, for example through hybridization.
  • the hybridization of nucleic acids is well understood in the art and discussed herein.
  • a probe can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art.
  • compositions including primers and probes, which are capable of interacting with the disclosed nucleic acids such as SEQ ID NO: 1 or its complement.
  • the primers are used to support nucleic acid extension reactions, nucleic acid replication reactions, and/or nucleic acid amplification reactions.
  • the primers will be capable of being extended in a sequence specific manner. Extension of a primer in a sequence specific manner includes any methods wherein the sequence and/or composition of the nucleic acid molecule to which the primer is hybridized or otherwise associated directs or influences the composition or sequence of the product produced by the extension of the primer.
  • Extension of the primer in a sequence specific manner therefore includes, but is not limited to, PCR, DNA sequencing, DNA extension, DNA polymerization, RNA transcription, or reverse transcription. Techniques and conditions that amplify the primer in a sequence specific manner are disclosed. In certain embodiments the primers are used for the DNA amplification reactions, such as PCR or direct sequencing. It
  • the primers can also be extended using non- enzymatic techniques, where for example, the nucleotides or oligonucleotides used to extend the primer are modified such that they will chemically react to extend the primer in a sequence specific manner.
  • the disclosed primers hybridize with the disclosed nucleic acids or region of the nucleic acids or they hybridize with the complement of the nucleic acids or complement of a region of the nucleic acids.
  • one or more primers can be used to create extension products from and templated by a first nucleic acid.
  • the size of the primers or probes for interaction with the nucleic acids can be any size that supports the desired enzymatic manipulation of the primer, such as DNA amplification or the simple hybridization of the probe or primer.
  • a typical primer or probe would be at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98,
  • a primer or probe can be less than or equal to 6, 7, 8, 9, 10, 11, 12 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550,
  • the primers for the nucleic acid of interest typically will be used to produce extension products and/or other replicated or amplified products that contain a region of the nucleic acid of interest.
  • the size of the product can be such that the size can be accurately determined to within 3, or 2 or 1 nucleotides.
  • the product can be, for example, at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96,
  • 1063793 27 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides long.
  • the product can be, for example, less than or equal to 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800,
  • the forward primer can be selected from the group consisting of
  • the forward primer can be an intracellular ALK primer such as, for example, (primer 100) 5 'ACTACTGCTTTGCTGGC AAGACCT (SEQ ID NO: 6); an extracellular EMLA-ALK fusion primer such as, for example, (primer 103) 5' TGTTC AAGATCGCCTGTC AGCTCT (SEQ ID NO: 3); an extracellular NPM-ALK fusion primer such as, for example, (primer 102); 5 'TCTGTACAGCCAACGGTTTCCCTT (SEQ ID NO: 4); an extracellular CTLC- ALK fusion primer such as, for example, (primer 105) 5 'GAGAGTGCTTTGGAGCTTGTCTGT (SEQ ID NO: 5); or an extracellular wildtype ALK primer from a region of non-homology such
  • the reverse primer can be, for example, primer 101: 5' TCGTCCTGTTCAGAGCACACTTCA (SEQ ID NO: 7).
  • the reverse primer can be SEQ ID NO: 32, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 56, SEQ ID NO: 57, or SEQ ID NO: 58. It is understood that the methods comprise at least one forward primer and a reverse primer.
  • 1063793 28 SEC31L1- ⁇ Z ⁇ primer, TPM3-ALK primer, IFMA-ALK primer, TFG L - ⁇ primer, TFG S - ALK primer, CARS-ALK primer, BMlA-ALK primer, ALO 17-ALK primer, MY ⁇ .9-ALK primer, MSN-ALK primer, and TFG ⁇ -ALK primer; and wherein an increase in the amount of amplification product relative to a control indicates the presence of an ALK related cancer.
  • the forward primer is selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, and SEQ ID NO: 59.
  • RT-PCR reverse transcription polymerase chain reaction
  • the forward primer is an NPM- ALK fusion primer comprising SEQ DD NO: 4, and wherein an increase in the amount of amplification product relative to a control indicates the presence of an ALK related cancer.
  • the forward primer is a wildtype ALK primer and the reverse primer is SEQ ID NO: 7; wherein the forward primer is an YJF5B-ALK primer and the reverse primer is SEQ ID NO: 7; wherein the forward primer is an NPM-ALK " primer and the reverse primer is SEQ ID NO: 7; wherein the forward primer is an ATlC-ALK primer and the reverse primer is SEQ ID NO: 7; wherein the forward primer is an CLTC-ALK primer and the reverse primer is SEQ ID NO: 7; wherein the forward primer is an RANBP2-ALK primer and the reverse primer is SEQ ID NO: 7; wherein the forward primer is an SEC3 ILl -ALK primer and the reverse primer is SEQ ID NO: 7; wherein the forward primer is an TFM3-ALK primer and the reverse primer is SEQ ID NO: 7; wherein the forward primer is an TFM4-ALK primer and the reverse primer is SEQ ID NO: 7; wherein the
  • CARS -ALK primer and the reverse primer is SEQ ID NO: 7; wherein the forward primer is an EMLA-ALK primer and the reverse primer is SEQ ID NO: 7; wherein the forward primer is an ALO Yl-ALK primer and the reverse primer is SEQ ID NO: 7; wherein the forward primer is an MYH9-ALK primer and the reverse primer is SEQ ID NO: 7; or wherein the
  • 1063793 29 forward primer is an TFG XL -ALK primer and the reverse primer is SEQ ID NO: 7.
  • the primer pair comprises SEQ ID NOS: 2 and 7, SEQ ID NOS: 3 and 7, SEQ ID NOS: 4 and 7, SEQ ID NOS: 5 and 7, or SEQ ID NOS: 6 and 7.
  • primer pairs specifically disclosed herein are methods wherein the forward primer is a wildtype ALK primer and the reverse primer is SEQ ID NO: 46; wherein the forward primer is an KIF5B-ALK primer and the reverse primer is SEQ DD NO: 46; wherein the forward primer is an NPM-ALK primer and the reverse primer is SEQ ID NO: 46; wherein the forward primer is an ATIC- ⁇ LLAT primer and the reverse primer is SEQ ID NO: 46; wherein the forward primer is an CLTC- ⁇ ZAT primer and the reverse primer is SEQ ID NO: 46; wherein the forward primer is an RANBP2 -ALK primer and the reverse primer is SEQ ID NO: 46; wherein the forward primer is an SEC31L1- ⁇ 4Z,AT primer and the reverse primer is SEQ ID NO: 46; wherein the forward primer is an TPM3 -ALK primer and the reverse primer is SEQ ID NO: 46; wherein the forward primer is an TPM4- ALK primer and the reverse primer is SEQ ID NO: 46;
  • the primer pair comprises SEQ ID NOS: 2 and 46, SEQ ID NOS: 3 and 46, SEQ ID NOS: 4 and 46, SEQ ID NOS: 5 and 46, SEQ ID NOS: 6 and 46; SEQ ID NOS: 33 and 46; SEQ ID NOS: 34 and 46; SEQ ID NOS: 35 and 46; SEQ ID NOS: 36 and 46; SEQ ID NOS: 37 and 46; SEQ ID NOS: 38 and 46; SEQ ID NOS: 39 and 46; SEQ ID NOS: 40 and 46; SEQ ID NOS: 41 and 46; SEQ ID NOS: 42 and 46; SEQ ID NOS: 43 and 46; SEQ ID NOS: 44 and 46; SEQ ID NOS: 45 and 46; SEQ ID NOS: 485 and 46; SEQ ID NOS: 49 and 46; SEQ ID NOS: 50 and 46; SEQ ID NOS: 51 and 46; SEQ ID NOS: 52 and 46; SEQ ID NOS: 53 and 46; SEQ ID NO
  • RT-PCR or PCR reactions can be conducted separately, or in a single reaction.
  • the reaction can comprise a wildtype ALK primer paired with a reverse primer, as well as, an ALK fusion primer paired with the same reverse primer.
  • ALK anaplastic lymphoma kinase
  • RT-PCR reverse transcription polymerase chain reaction
  • multiplex PCR forward primer sets include but are not limited to a KIF5B-ALK fusion primer and a wildtype ALK primer, a CLTC -ALK fusion primer and a wildtype ALK primer, a RANBP2- ⁇ LL&T fusion primer and a wildtype ALK primer, an ATIC -ALK fusion primer and a wildtype ALK primer, a S ⁇ C2> ⁇ -ALK fusion primer and a wildtype ALK primer, a TPM3-ALK fusion primer and a wildtype ALK primer, a TPM4-
  • ALK fusion primer and a wildtype ALK primer a TFG L -ALK fusion primer and a wildtype ALK primer, a TFGs -ALK fusion primer and a wildtype ALK primer, a CARS -ALK fusion primer and a wildtype ALK primer, an ALOl 7 -ALK fusion primer and a wildtype ALK primer, a MY ⁇ 9-ALK fusion primer and a wildtype ALK primer, a MSN-ALK fusion primer and a wildtype ALK primer, a truncated ALK primer and a wildtype ALK primer, an ELM4-ALK fusion primer and a truncated ALK primer, a NPM-ALK fusion primer and a truncated ALK primer, a CLTC -ALK fusion primer and a truncated ALK primer, a KANBP2-ALK fusion primer and a truncated ALK primer, an ATIC -ALK fusion
  • a single reaction tube can include a forward primer that hybridizes to one or more ALK fusions, a wildtype ALK, or an ALK kinase domain and a reverse primer which hybridized to wildtype ALK. It is understood that the methods disclosed herein can comprise multiple reaction tubes.
  • the methods can include a first reaction to detect the presence of a known ALK fusion which comprises one or more forward ALK fusion primers and a reverse ALK primer which hybridizes to wildtype ALK (for example, the forward primers SEQ ID NOs 2, 3, 4, 5, 6, 34,35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 48, 49, 50, 51, 52, 53, and 59 and the reverse primer SEQ ID NOs: 7, 32, 46, 47, 56, 57, or 58); a second reaction tube which comprises a forward and reverse primer for the detection of wildtype ALK (for example, the forward primer SEQ ID NOs: 33, 54, or 55 and the reverse primer SEQ ID NOs: 7, 32, 46, 47, 56, 57, or 58); a forward and reverse primer to detect the presence of the kinase domain of ALK (for example, the forward primer SEQ ID NOs: 45 or 48 and the reverse primer SEQ ID NOs: 7, 32, 46, 47, 56, 57
  • 1063793 32 Assuming controls perform as designed, one of skill in the art can then detect amplification product in the fusion tube, wildtype tube, and kinase tube.
  • An assay resulting in amplicon being present in the fusion tube and kinase tube, but not the wildtype tube indicates the presence of a known ALK fusion. If the fusion tube is negative, but the wildtype tube and kinase tube are positive, then only wildtype ALK is present. If both the wildtype and fusion reaction tubes are negative, but the kinase tube is positive, then there is a previously unknown fusion present.
  • the tissue sample does not contain an ALK related cancer (see Figure 5A). It is understood that by measuring the amplicon size, the identity of a particular ALK fusion or wildtype ALK within a sample can be determined (see Figure 5B). Where an amplicon has a size that is not associated with a particular ALK fusion or wildtype ALK, then the amplicon represents a previously unknown ALK fusion.
  • Fluorescent change probes and fluorescent change primers refer to all probes and primers that involve a change in fluorescence intensity or wavelength based on a change in the form or conformation of the probe or primer and nucleic acid to be detected, assayed or replicated.
  • fluorescent change probes and primers include molecular beacons, Amplifluors, FRET probes, cleavable FRET probes, TaqMan probes, scorpion primers, fluorescent triplex oligos including but not limited to triplex molecular beacons or triplex FRET probes, fluorescent water-soluble conjugated polymers, PNA probes and QPNA probes.
  • Fluorescent change probes and primers can be classified according to their structure and/or function.
  • Fluorescent change probes include hairpin quenched probes, cleavage quenched probes, cleavage activated probes, and fluorescent activated probes.
  • Fluorescent change primers include stem quenched primers and hairpin quenched primers.
  • Hairpin quenched probes are probes that when not bound to a target sequence form a hairpin structure (and, typically, a loop) that brings a fluorescent label and a quenching moiety into proximity such that fluorescence from the label is quenched. When the probe binds to a target sequence, the stem is disrupted, the quenching moiety is no longer in proximity to the fluorescent label and fluorescence increases.
  • hairpin quenched probes are molecular beacons, fluorescent triplex oligos, triplex molecular beacons, triplex FRET probes, and QPNA probes.
  • Cleavage activated probes are probes where fluorescence is increased by cleavage of the probe.
  • Cleavage activated probes can include a fluorescent label and a quenching
  • Cleavage quenched probes are probes where fluorescence is decreased or altered by cleavage of the probe.
  • Cleavage quenched probes can include an acceptor fluorescent label and a donor moiety such that, when the acceptor and donor are in proximity, fluorescence resonance energy transfer from the donor to the acceptor causes the acceptor to fluoresce.
  • the probes are thus fluorescent, for example, when hybridized to a target sequence.
  • the donor moiety is no longer in proximity to the acceptor fluorescent label and fluorescence from the acceptor decreases. If the donor moiety is itself a fluorescent label, it can release energy as fluorescence (typically at a different wavelength than the fluorescence of the acceptor) when not in proximity to an acceptor. The overall effect would then be a reduction of acceptor fluorescence and an increase in donor fluorescence.
  • Donor fluorescence in the case of cleavage quenched probes is equivalent to fluorescence generated by cleavage activated probes with the acceptor being the quenching moiety and the donor being the fluorescent label.
  • Cleavable FRET (fluorescence resonance energy transfer) probes are an example of cleavage quenched probes.
  • Fluorescent activated probes are probes or pairs of probes where fluorescence is increased or altered by hybridization of the probe to a target sequence.
  • Fluorescent activated probes can include an acceptor fluorescent label and a donor moiety such that, when the acceptor and donor are in proximity (when the probes are hybridized to a target sequence), fluorescence resonance energy transfer from the donor to the acceptor causes the acceptor to fluoresce.
  • Fluorescent activated probes are typically pairs of probes designed to hybridize to adjacent sequences such that the acceptor and donor are brought into proximity. Fluorescent activated probes can also be single probes containing both a donor and acceptor where, when the probe is not hybridized to a target sequence, the donor and acceptor are not in proximity but where the donor and acceptor are brought into proximity when the probe hybridized to a target sequence. This can be accomplished, for example, by placing the donor and acceptor on opposite ends of the probe and placing target complement sequences at each end of the probe where the target complement sequences are complementary to adjacent sequences in a target sequence. If the donor moiety of a fluorescent activated probe is itself a fluorescent label, it can release energy as fluorescence (typically at a
  • FRET probes are an example of fluorescent activated probes.
  • Stem quenched primers are primers that when not hybridized to a complementary sequence form a stem structure (either an intramolecular stem structure or an intermolecular stem structure) that brings a fluorescent label and a quenching moiety into proximity such that fluorescence from the label is quenched.
  • stem quenched primers are used as primers for nucleic acid synthesis and thus become incorporated into the synthesized or amplified nucleic acid.
  • Examples of stem quenched primers are peptide nucleic acid quenched primers and hairpin quenched primers.
  • Peptide nucleic acid quenched primers are primers associated with a peptide nucleic acid quencher or a peptide nucleic acid fluor to form a stem structure.
  • the primer contains a fluorescent label or a quenching moiety and is associated with either a peptide nucleic acid quencher or a peptide nucleic acid fluor, respectively. This puts the fluorescent label in proximity to the quenching moiety. When the primer is replicated, the peptide nucleic acid is displaced, thus allowing the fluorescent label to produce a fluorescent signal.
  • Hairpin quenched primers are primers that when not hybridized to a complementary sequence form a hairpin structure (and, typically, a loop) that brings a fluorescent label and a quenching moiety into proximity such that fluorescence from the label is quenched. When the primer binds to a complementary sequence, the stem is disrupted, the quenching moiety is no longer in proximity to the fluorescent label and fluorescence increases. Hairpin quenched primers are typically used as primers for nucleic acid synthesis and thus become incorporated into the synthesized or amplified nucleic acid. Examples of hairpin quenched primers are Amplifluor primers and scorpion primers.
  • Cleavage activated primers are similar to cleavage activated probes except that they are primers that are incorporated into replicated strands and are then subsequently cleaved.
  • labels can be directly incorporated into nucleotides and nucleic acids or can be coupled to detection molecules such as probes and primers.
  • a label is any
  • 1063793 35 molecule that can be associated with a nucleotide or nucleic acid, directly or indirectly, and which results in a measurable, detectable signal, either directly or indirectly.
  • labels for incorporation into nucleotides and nucleic acids or coupling to nucleic acid probes are known to those of skill in the art. Examples of labels suitable for use in the disclosed method are radioactive isotopes, fluorescent molecules, phosphorescent molecules, enzymes, antibodies, and ligands. Fluorescent labels, especially in the context of fluorescent change probes and primers, are useful for real-time detection of amplification.
  • fluorescent labels include fluorescein isothiocyanate (FITC), 5,6-carboxymethyl fluorescein, Texas red, nitrobenz-2-oxa-l,3-diazol-4-yl (NBD), coumarin, dansyl chloride, rhodamine, amino-methyl coumarin (AMCA), Eosin, Erythrosin, BODIPY ® , CASCADE BLUE ® , OREGON GREEN ® , pyrene, lissamine, xanthenes, acridines, oxazines, phycoerythrin, macrocyclic chelates of lanthanide ions such as quantum dyeTM, fluorescent energy transfer dyes, such as thiazole orange-ethidium heterodimer, and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7.
  • FITC fluorescein isothiocyanate
  • NBD nitrobenz-2-oxa-l,3-
  • Examples of other specific fluorescent labels include 3-Hydroxypyrene 5,8,10-Tri Sulfonic acid, 5-Hydroxy Tryptamine (5-HT), Acid Fuchsin, Alizarin Complexon, Alizarin Red, Allophycocyanin, Aminocoumarin, Anthroyl Stearate, Astrazon Brilliant Red 4G, Astrazon Orange R, Astrazon Red 6B, Astrazon Yellow 7 GLL, Atabrine, Auramine, Aurophosphine, Aurophosphine G, BAO 9 (Bisaminophenyloxadiazole), BCECF, Berberine Sulphate, Bisbenzamide, Blancophor FFG Solution, Blancophor SV, Bodipy Fl, Brilliant Sulphoflavin FF, Calcien Blue, Calcium Green, Calcofluor RW Solution, Calcofluor White, Calcophor White ABT Solution, Calcophor White Standard Solution, Carbostyryl, Cascade Yellow, Catecholamine, Chinacrine, Coriphosphine O, Coumarin
  • Leucophor WS Lissamine Rhodamine B200 (RD200), Lucifer Yellow CH, Lucifer Yellow VS, Magdala Red, Marina Blue, Maxilon Brilliant Flavin 10 GFF, Maxilon Brilliant Flavin 8 GFF, MPS (Methyl Green Pyronine Stilbene), Mithramycin, NBD Amine, Nitrobenzoxadidole, Noradrenaline, Nuclear Fast Red, Nuclear Yellow, Nylosan Brilliant
  • the absorption and emission maxima, respectively, for some of these fluors are: FITC (490 ran; 520 ran), Cy3 (554 ran; 568 nm), Cy3.5 (581 ran; 588 nm), Cy5 (652 nm: 672 nm), Cy5.5 (682 nm; 703 nm) and Cy7 (755 nm; 778 nm), thus allowing their simultaneous detection.
  • fluorescein dyes include 6-carboxyfluorescein (6-FAM), 2',4',1,4,-tetrachlorofluorescein (TET), 2 l ,4',5',7',l,4-hexachlorofluorescein (HEX), 2',7'-dimethoxy-4 t , S'-dichloro- ⁇ -carboxyrhodamine (JOE), 2'-chloro-5'-fluoro-7 t ,8'- fused phenyl- l ⁇ -dichloro- ⁇ -carboxyfluorescein (NED), and 2'-chloro-7'-phenyl-l,4- dichloro-6-carboxyfluorescein (VIC).
  • Fluorescent labels can be obtained from a variety of commercial sources, including Amersham Pharmacia Biotech, Piscataway, NJ; Molecular Probes, Eugene, OR; and Research Organics, Cleveland, Ohio.
  • Additional labels of interest include those that provide for signal only when the probe with which they are associated is specifically bound to a target molecule, where such labels include: "molecular beacons" as described in Tyagi & Kramer, Nature Biotechnology (1996) 14:303 and EP 0 070 685 Bl.
  • Other labels of interest include those described in U.S. Pat. No. 5,563,037 which is incorporated herein by reference.
  • Labeled nucleotides are a form of label that can be directly incorporated into the amplification products during synthesis.
  • labels that can be incorporated into amplified nucleic acids include nucleotide analogs such as BrdUrd, aminoallyldeoxyuridine, 5-methylcytosine, bromouridine, and nucleotides modified with biotin or with suitable haptens such as digoxygenin.
  • Suitable fluorescence-labeled nucleotides are Fluorescein- isothiocyanate-dUTP, Cyanine-3-dUTP and Cyanine-5-dUTP.
  • nucleotide analog label for DNA is BrdUrd (bromodeoxyuridine, BrdUrd, BrdU, BUdR, Sigma- Aldrich Co).
  • nucleotide analogs for incorporation of label into DNA are BrdUrd (bromodeoxyuridine, BrdUrd, BrdU, BUdR, Sigma- Aldrich Co).
  • Other examples of nucleotide analogs for incorporation of label into DNA are
  • RNA RNA RNA RNA cleotide analog for incorporation of label into RNA
  • biotin-16-UTP biotin-16-uridine-5 '-triphosphate, Roche Molecular Biochemicals
  • Fluorescein, Cy3, and Cy5 can be linked to dUTP for direct labeling. Cy3.5 and Cy7 are available as avidin or anti-digoxygenin conjugates for secondary detection of biotin- or digoxygenin-labeled probes.
  • Biotin can be detected using streptavidin-alkaline phosphatase conjugate (Tropix, Inc.), which is bound to the biotin and subsequently detected by chemiluminescence of suitable substrates (for example, chemiluminescent substrate CSPD: disodium, 3-(4-methoxyspiro-[l,2,- dioxetane-3-2'-(5'-chloro)tricyclo [3.3.1.1 3 ' 7 ]decane]-4-yl) phenyl phosphate; Tropix, Inc.).
  • suitable substrates for example, chemiluminescent substrate CSPD: disodium, 3-(4-methoxyspiro-[l,2,- dioxetane-3-2'-(5'-chloro)tricyclo [3.3.1.1 3 ' 7 ]decane]-4-yl
  • Labels can also be enzymes, such as alkaline phosphatase, soybean peroxidase, horseradish peroxidase and polymerases, that can be detected, for example, with chemical signal amplification or by using a substrate to the enzyme which produces light (for example, a chemiluminescent 1,2-dioxetane substrate) or fluorescent signal.
  • enzymes such as alkaline phosphatase, soybean peroxidase, horseradish peroxidase and polymerases
  • a substrate to the enzyme which produces light for example, a chemiluminescent 1,2-dioxetane substrate
  • fluorescent signal for example, a chemiluminescent 1,2-dioxetane substrate
  • Molecules that combine two or more of these labels are also considered labels. Any of the known labels can be used with the disclosed probes, tags, and method to label and detect nucleic acid amplified using the disclosed method. Methods for detecting and measuring signals generated by labels are also known to those of skill in the art. For example, radioactive isotopes can be detected by scintillation counting or direct visualization; fluorescent molecules can be detected with fluorescent spectrophotometers; phosphorescent molecules can be detected with a spectrophotometer or directly visualized with a camera; enzymes can be detected by detection or visualization of the product of a reaction catalyzed by the enzyme; antibodies can be detected by detecting a secondary label coupled to the antibody. As used herein, detection molecules are molecules which interact with amplified nucleic acid and to which one or more labels are coupled.
  • RT-PCR reverse transcription polymerase chain reaction
  • 1063793 38 wherein an increase in the amount of amplification product relative to a control indicates the presence of an ALK related cancer; and wherein the control tissue is obtained is a noncancerous tissue. It is further understood that with respect to ALK- ⁇ elated cancers, the use of a non-cancerous tissue control can be utilized but is not necessary as cancerous tissue from a non-ALK related cancer may also be used.
  • an anaplastic lymphoma kinase (ALK) related cancer in a subject comprising conducting an RT-PCR reaction on mRNA from a tissue sample from the subject; wherein the reverse transcription polymerase chain reaction (RT-PCR) comprises a reverse primer capable of specifically hybridizing to one or more ALK sequences and at least one forward primer; and wherein an increase in the amount of amplification product relative to a control indicates the presence of an ALK related cancer; and wherein the control tissue is obtained from non-ALK related cancerous tissue.
  • RT-PCR reverse transcription polymerase chain reaction
  • lymphomas Hodgkins and non-Hodgkins
  • leukemias carcinomas, carcinomas of solid tissues
  • squamous cell carcinomas adenocarcinomas
  • sarcomas gliomas, high grade gliomas, blastomas, neuroblastomas, plasmacytomas, histiocytomas, melanomas, adenomas, hypoxic tumours, myelomas, ADDS- related lymphomas or sarcomas, metastatic cancers, or cancers in general.
  • 1063793 39 inflammatory myofibroblastic tumors IMTs.
  • IMTs inflammatory myofibroblastic tumors
  • ALK anaplastic lymphoma kinase
  • RT-PCR reverse transcription polymerase chain reaction
  • the cancer is selected from the group consisting of non-small cell lung carcinoma, diffuse large B-cell lymphoma, , systemic histiocytosis, breast cancer, colorectal carcinoma, esophageal squamous cell carcinoma, anaplastic large-cell lymphoma, neuroblastoma, and inflammatory myofibroblastic tumors (IMTs).
  • methods of assessing the suitability of an ALK inhibitor treatment for a cancer in a subject comprising measuring mRNA from a tissue sample from the subject; wherein an increase in the amount of ALK sequence mRNA relative to a control indicates a cancer that can be treated with an ALK inhibitor.
  • 1063793 40 relative to a control indicates a cancer that can be treated with an ALK inhibitor. It is further understood that the disclosed methods can further comprise any of the primers disclosed herein and utilize the multiplexing PCR techniques disclosed.
  • MRD minimal residual disease
  • a highly sensitive and easily performed diagnostic assay such as those proposed herein.
  • Preclinical studies have identified a spectrum of ALK kinase domain point mutations that confer resistance to small-molecule inhibitors such as NVP- TAE684 and PF-2341066.
  • Such assays are known to be highly predictive of clinically relevant inhibitor resistance mutations based on their use for the prediction of mutations that confer resistance to inhibitors such as Gleevec that have been used clinically now for a number of years.
  • TEERTM Template Exchange Extension Reaction
  • Patent No. 6,150,105, and U.S. Application No. 12/152,512 which are incorporated herein by reference in their entirety for their teachings on the detection of nucleotide variation.
  • Methods for detection of ALK-related nucleic acid variation disclosed herein have many uses including but not limited to the detection or diagnosis of the presence of a
  • 1063793 41 disease or condition such as cancer assessing the susceptibility or risk for a disease or condition associated with a nucleic acid variation, the monitoring disease progression, and the determination of susceptibility or resistance to therapeutic treatment.
  • nucleic acid of interest can be any nucleic acid to which the determination of the presence or absence of nucleotide variation is desired.
  • the nucleic acid of interest can comprise a sequence that corresponds to the wild-type sequence of the reference nucleic acid. It is further disclosed
  • a reference nucleic acid can be any nucleic acid against which a nucleic acid of interest is to be compared.
  • the reference nucleic acid has a known sequence (and/or is known to have a sequence of interest as a reference). Although not required, it is useful if the reference sequence has a known or suspected close relationship to the nucleic acid of interest.
  • the reference sequence can be usefully chosen to be a sequence that is a homolog or close match to the nucleic acid of interest, such as a nucleic acid derived from the same gene or genetic element from the same or a related organism or individual.
  • the reference nucleic acid can comprise a wildtype sequence or alternatively can comprise a known mutation including, for example, a mutation the presence or absence of which is associated with a disease or resistance to therapeutic treatment.
  • the disclosed methods can be used to detect or diagnose the presence of known mutations in a nucleic acid of interest by comparing the nucleic acid of interest to a reference nucleic acid that comprises a wildtype sequence (i.e., is known not to possess the mutation) and examining for the presence or absence of variation in the nucleic acid of interest, where the absence of variation would indicate the absence of a mutation.
  • the reference nucleic acid can possess a known mutation.
  • nucleotide variation refers to any change or difference in the nucleotide sequence of a nucleic acid of interest relative to the nucleotide sequence of a reference nucleic acid.
  • a nucleotide variation is said to occur when the sequences between the reference nucleic acid and the nucleic acid of interest (or its complement, as appropriate in context) differ.
  • a substitution of an adenine (A) to a guanine (G) at a particular position in a nucleic acid would be a nucleotide variation provided the reference nucleic acid comprised an A at the corresponding position.
  • a variation is based upon the reference nucleic acid and does not indicate whether or not a sequence is wildtype.
  • a nucleic acid with a known mutation is used as the reference nucleic acid
  • a nucleic acid not possessing the mutation would be considered to possess a nucleotide variation (relative to the reference nucleic acid).
  • nucleotide for a nucleotide. It is understood and contemplated herein that where reference is made to a type of base, this refers a base that in a nucleotide in a nucleic acid strand is capable of hybridizing (binding) to a defined set of one or more of the canonical bases.
  • nuclease-resistant nucleotides can be, for example, guanine (G), thymine (T), and cytosine (C).
  • G guanine
  • T thymine
  • C cytosine
  • Any type of modified or alternative base can be used in the disclosed methods and compositions, generally limited only by the capabilities of the enzymes used to use such bases.
  • modified and alternative nucleotides and bases are known, some of which are described below and elsewhere herein.
  • the type of base that such modified and alternative bases represent can be determined by the pattern of base pairing for that base as described herein.
  • any analog, derivative, modified, or variant base that based pairs primarily with thymine would be considered the same type of base as adenine.
  • the analog, derivative, modified, or variant has the same pattern of base pairing as another base, it can be considered the same type of base.
  • Modifications can made to the sugar or phosphate groups of a nucleotide.
  • Modified nucleotides to be incorporated into extension products and to be selectively removed by the disclosed agents in the disclosed methods can be any modified nucleotide that functions as needed in the disclosed method as is described elsewhere herein. Modified nucleotides can also be produced in existing nucleic acid strands, such as extension products, by, for example, chemical modification, enzymatic modification, or a combination. Many types of nuclease-resistant nucleotides are known and can be used in the disclosed methods. For example, nucleotides have modified phosphate groups and/or modified sugar groups can be resistant to one or more nucleases. Nuclease-resistance is defined herein as resistance to removal from a nucleic acid by any one or more nucleases.
  • nuclease resistance of a particular nucleotide can be defined in terms of a relevant nuclease.
  • the nuclease-resistant nucleotides need only be resistant to that particular nuclease.
  • useful nuclease-resistant nucleotides include thio-modified nucleotides and borano-modified nucleotides.
  • nucleotide is a molecule that contains a base moiety, a sugar moiety and a phosphate moiety. Nucleotides can be linked together through their phosphate moieties and sugar moieties creating an internucleoside linkage.
  • the base moiety of a nucleotide can be adenin-9-yl (adenine, A), cytosin-1-yl (cytosine, C), guanin-9-yl (guanine, G), uracil- 1-yl (uracil, U), and thymin-1-yl (thymine, T).
  • the sugar moiety of a nucleotide is a ribose or a deoxyribose.
  • the phosphate moiety of a nucleotide is pentavalent phosphate.
  • a non- limiting example of a nucleotide would be 3'-AMP (3'-adenosine monophosphate) or 5'- GMP (5'-guanosine monophosphate).
  • a nucleotide analog is a nucleotide which contains some type of modification to either the base, sugar, or phosphate moieties. Modifications to the base moiety would include natural and synthetic modifications of A, C, G, and T/U as well as different purine or pyrimidine bases, such as uracil-5-yl hypoxanthin-9-yl (inosine, I), and 2-aminoadenin-9-yl.
  • a modified base includes but is not limited to 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl
  • Modifications to the sugar moiety would include natural modifications of the ribose and deoxy ribose as well as synthetic modifications.
  • Sugar modifications include but are not limited to the following modifications at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Cl to ClO, alkyl or C2 to ClO alkenyl and alkynyl.
  • 2' sugar modifications also include but are not limited to -O[(CH2)n O]m CH3, - O(CH2)n OCH3, -O(CH2)n NH2, -O(CH2)n CH3, -O(CH2)n -ONH2, and - O(CH2)nON[(CH2)n CH3)]2, where n and m are from 1 to about 10.
  • T position examples include but are not limited to: Cl to ClO lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2 CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties
  • 1063793 46 of an oligonucleotide and other substituents having similar properties. Similar modifications may also be made at other positions on the sugar, particularly the 3' position of the sugar on the 3 1 terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Modified sugars would also include those that contain modifications at the bridging ring oxygen, such as CH2 and S. Nucleotide sugar analogs may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.
  • Nucleotide analogs can also be modified at the phosphate moiety.
  • Modified phosphate moieties include but are not limited to those that can be modified so that the linkage between two nucleotides contains a phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, methyl and other alkyl phosphonates including 3'-alkylene phosphonate and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates.
  • nucleotide analogs need only contain a single modification, but may also contain multiple modifications within one of the moieties or between different moieties.
  • Nucleotide substitutes are molecules having similar functional properties to nucleotides, but which do not contain a phosphate moiety, such as peptide nucleic acid (PNA). Nucleotide substitutes are molecules that will recognize nucleic acids in a Watson- Crick or Hoogsteen manner, but which are linked together through a moiety other than a PNA.
  • PNA peptide nucleic acid
  • Nucleotide substitutes are able to conform to a double helix type structure when interacting with the appropriate target nucleic acid.
  • Nucleotide substitutes are nucleotides or nucleotide analogs that have had the phosphate moiety and/or sugar moieties replaced. Nucleotide substitutes do not contain a standard phosphorus atom. Substitutes for the phosphate can be for example, short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbones sulfide, sulfoxide and sulfone backbones
  • formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
  • alkene containing backbones sulfamate backbones
  • sulfonate and sulfonamide backbones amide backbones; and others having mixed N, O, S and CH2 component parts.
  • nucleotide substitute that both the sugar and the phosphate moieties of the nucleotide can be replaced, by for example an amide type linkage (aminoethylglycine) (PNA).
  • PNA aminoethylglycine
  • United States patents 5,539,082; 5,714,331; and 5,719,262 teach how to make and use PNA molecules, each of which is herein incorporated by reference. It is also possible to link other types of molecules (conjugates) to nucleotides or nucleotide analogs. Conjugates can be chemically linked to the nucleotide or nucleotide analogs.
  • Such conjugates include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium l ⁇ -di-O-hexadecyl-rac-glycero-S-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.
  • lipid moieties such as a cholesterol moiety, cholic acid, a thioether,
  • a Watson-Crick interaction is at least one interaction with the Watson-Crick face of a nucleotide, nucleotide analog, or nucleotide substitute.
  • the Watson-Crick face of a nucleotide, nucleotide analog, or nucleotide substitute includes the C2, Nl, and C6 positions of a purine based nucleotide, nucleotide analog, or nucleotide substitute and the C2, N3, C4 positions of apyrimidine based nucleotide, nucleotide analog, or nucleotide substitute.
  • a Hoogsteen interaction is the interaction that takes place on the Hoogsteen face of a nucleotide or nucleotide analog, which is exposed in the major groove of duplex DNA.
  • the Hoogsteen face includes the N7 position and reactive groups (NH2 or O) at the C6 position of purine nucleotides.
  • hybridization typically means a sequence driven interaction between at least two nucleic acid molecules, such as a primer or a probe and a gene.
  • Sequence driven interaction means an interaction that occurs between two nucleotides or nucleotide analogs or nucleotide derivatives in a nucleotide specific manner. For example, G interacting with C or A interacting with T are sequence driven interactions. Typically sequence driven interactions occur on the Watson-Crick face or Hoogsteen face of the nucleotide.
  • the hybridization of two nucleic acids is affected by a number of conditions and parameters known to those of skill in the art. For example, the salt concentrations, pH, and temperature of the reaction all affect whether two nucleic acid molecules will hybridize.
  • selective hybridization conditions can be defined as stringent hybridization conditions.
  • stringency of hybridization is controlled by both temperature and salt concentration of either or both of the hybridization and washing steps.
  • the conditions of hybridization to achieve selective hybridization may involve hybridization in high ionic strength solution (6X SSC or 6X SSPE) at a temperature that is about 12-25°C below the
  • Tm the melting temperature at which half of the molecules dissociate from their hybridization partners
  • washing at a combination of temperature and salt concentration chosen so that the washing temperature is about 5 0 C to 20°C below the Tm.
  • the temperature and salt conditions are readily determined empirically in preliminary experiments in which samples of reference DNA immobilized on filters are hybridized to a labeled nucleic acid of interest and then washed under conditions of different stringencies. Hybridization temperatures are typically higher for DNA-RNA and RNA-RNA hybridizations. The conditions can be used as described above to achieve stringency, or as is known in the art.
  • a preferable stringent hybridization condition for a DNA:DNA hybridization can be at about 68°C (in aqueous solution) in 6X SSC or 6X SSPE followed by washing at 68°C.
  • Stringency of hybridization and washing if desired, can be reduced accordingly as the degree of complementarity desired is decreased, and further, depending upon the G-C or A-T richness of any area wherein variability is searched for.
  • stringency of hybridization and washing if desired, can be increased accordingly as homology desired is increased, and further, depending upon the G-C or A-T richness of any area wherein high homology is desired, all as known in the art.
  • selective hybridization conditions are by looking at the amount (percentage) of one of the nucleic acids bound to the other nucleic acid. For example, in some embodiments selective hybridization conditions would be when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93,
  • the non-limiting primer is in for example, 10 or 100 or 1000 fold excess. This type of assay can be performed at under conditions where both the limiting and non-limiting primer are for example, 10 fold or 100 fold or 1000 fold below their k d , or where only one of the nucleic acid molecules is 10 fold or 100 fold or 1000 fold or where one or both nucleic acid molecules are above their ka.
  • selective hybridization is by looking at the percentage of primer that gets enzymatically manipulated under conditions where hybridization is required to promote the desired enzymatic manipulation. For example, in some embodiments selective hybridization conditions would be when at least about, 60, 65, 70,
  • 1063793 50 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the primer molecules are extended.
  • Conditions also include those suggested by the manufacturer or indicated in the art as being appropriate for the enzyme performing the manipulation. Just as with homology, it is understood that there are a variety of methods herein disclosed for determining the level of hybridization between two nucleic acid molecules.
  • kits that are drawn to reagents that can be used in practicing the methods disclosed herein.
  • the kits can include any reagent or combination of reagents discussed herein or that would be understood to be required or beneficial in the practice of the disclosed methods.
  • the kits could include one or more primers disclosed herein to perform the extension, replication and amplification reactions discussed in certain embodiments of the methods, as well as the buffers and enzymes required to use the primers as intended.
  • kits that include at least one reverse primer wherein the reverse primer hybridizes to a portion of wildtype ALK such as the kinase domain of wild-type ALK.
  • Examples of reverse primers that can be used in the disclosed kits include but are not limited to SEQ ID NO. 7, SEQ ID NO: 32, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 56, and SEQ ID NO: 57.
  • the kits disclosed herein can include one or more forward primers that specifically hybridize to a fusion partner of ALK or wild-type ALK.
  • the forward primer can hybridize to wildtype ALK, 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase (ATIC), clathrin heavy chain (CLTC), Ran-binding protein 2 (RANBP2), SEC31L1, tropomyosin-3 (TPM3), tropomyosin-4 (TPM4), TRK- fused gene(Large) (TFG L ), TRK-fused gene(Small) (TFG S ), CARS, ALO17, moesin
  • a non-limiting list of forward primers that can be used in the kits disclosed herein include but are not limited to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, and SEQ ID NO: 59.
  • kits including one or more forward primers that specifically hybridizes to wildtype ALK, 5- aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase (ATIC), clathrin heavy chain (CLTC), Ran-binding protein 2 (RANBP2), SEC31L1, tropomyosin-3 (TPM3), tropomyosin-4 (TPM4), TRK-fused gene(Large) (TFG L ), TRK- fused gene(Small) (TFGs), CARS, ALOl 7, moesin (MSN), non-muscle myosin heavy chain gene (MYH9), or TRK-fused gene(Extra Large) (TFG XL
  • kits can also include controls to insure the methods disclosed herein are properly functioning and to normalize results between assays.
  • controls can also include controls to insure the methods disclosed herein are properly functioning and to normalize results between assays.
  • disclosed herein are positive cDNA controls, negative cDNA controls, and control primer pairs.
  • kits can include a control primer pairs for the detection of Homo sapiens ATP synthase, H+ transporting, mitochondrial Fl complex, O subunit (ATP5O), nuclear gene encoding mitochondrial protein mRNA; Homo sapiens NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa (NDUF A2), mRNA; Homo sapiens glyceraldehyde-3 -phosphate dehydrogenase (GAPDH), mRNA; Homo sapiens H3 histone, family 3A (H3F3A), mRNA; Homo sapiens proteasome (prosome, macropain) subunit, beta type, 4 (PSMB4), mRNA; Homo sapiens ribosomal protein S27a (RPS27A), transcript variant 1, mRNA; Homo sapiens eukaryotic translation initiation factor 4A, isoform 2 (EEF4A2), mRNA; Homo sapiens ribosomal
  • kits can include such other reagents and material for performing the disclosed methods such as a enzymes (e.g., polymerases), buffers, sterile water, reaction tubes. Additionally the kits can also include modified nucleotides, nuclease-resistant nucleotides, and or labeled nucleotides. Additionally, the disclosed kits can include instructions for performing the methods disclosed herein and software for enable the calculation of the presence of an ALK mutatio.
  • a enzymes e.g., polymerases
  • buffers e.g., sterile water, reaction tubes.
  • the kits can also include modified nucleotides, nuclease-resistant nucleotides, and or labeled nucleotides. Additionally, the disclosed kits can include instructions for performing the methods disclosed herein and software for enable the calculation of the presence of an ALK mutatio.
  • kits can comprise sufficient material in a single assay run simultaneously or separately to conduct the methods to determine if a sample contains a wildtype ALK, a known ALK fusion, or a previously unidentified ALK fusion.
  • the kits can also include sufficient material to run control reactions.
  • kits comprising a positive cDNA control reaction tube, a negative cDNA control reaction tube, a control primer reaction tube, a reaction tube to detect known ALK fusions, a reaction tube to detect wildtype ALK, and a reaction tube to detect kinase activity.
  • the disclosed kit can be used to determine ALK status - either wildtype expression, kinase domain overexpression, or fusion mutation overexpression — on the basis of measurements made relative to internal control genes.
  • ALK status can be determined via an equation of ALK(numerator)/internal control (denominator) where the resulting quotient is a range of outcomes that indicate tested tissues, cell lines or other samples are either ALK positive or ALK negative.
  • the ratio and quotient determined to indicate ALK positive or negative status will be established separately for each tissue and specimen type.
  • compositions disclosed herein and the compositions necessary to perform the disclosed methods can be made using any method known to those of skill in the art for that particular reagent or compound unless otherwise specifically noted.
  • the disclosed nucleic acids such as, the oligonucleotides to be used as primers can be made using standard chemical synthesis methods or can be produced using enzymatic methods or any other known method. Such methods can range from standard enzymatic digestion followed by nucleotide fragment isolation to purely synthetic methods, for example, by the cyanoethyl phosphoramidite method using a Milligen or Beckman System lPlus DNA synthesizer (for example, Model 8700 automated synthesizer of Milligen- Biosearch, Burlington, MA or ABI Model 380B). Examples
  • Example 1 ALK fusion genes in hematological malignancies and solid tumors (anaplastic large-cell lymphoma, ALK+ diffuse large B-cell lymphoma, ALK+ systemic histiocytosis, IMT sarcoma, non-small cell lung carcinoma, esophageal squamous cell carcinoma, breast cancer, colorectal carcinoma).
  • ALK fusion genes in hematological malignancies and solid tumors (anaplastic large-cell lymphoma, ALK+ diffuse large B-cell lymphoma, ALK+ systemic histiocytosis, IMT sarcoma, non-small cell lung carcinoma, esophageal squamous cell carcinoma, breast cancer, colorectal carcinoma).
  • ALK fusion genes in hematological malignancies and solid tumors anaplastic large-cell lymphoma, ALK+ diffuse large B-cell lymphoma, ALK+ systemic histiocytosis, IMT sarcoma,
  • the novel EML4-ALK fusion protein is found in nearly 7% of Japanese non-small cell lung carcinoma patients.
  • tissue samples from a subject with a cancer are obtained.
  • mRNA is extracted from the tissue samples.
  • the RT-PCR reaction utilizes at least one forward primer and a reverse primer.
  • Figure 2 shows examples of various primer pairings.
  • the forward primer can be an intracellular ALK primer (primer 100) 5'ACTACTGCTTTGCTGGCAAGACCT (SEQ ID NO: 6); an extra cellular EML4-ALK fusion primer (primer 103) 5 'TGTTCAAGATCGCCTGTCAGCTCT (SEQ ID NO: 3); an extracellular NPM-ALK fusion primer (primer 102); 5 'TCTGTACAGCCAACGGTTTCCCTT (SEQ ID NO: 4); an extracellular CTLC-ALK fusion primer (primer 105) 5'GAGAGTGCTTTGGAGCTTGTCTGT (SEQ ID NO: 5); or an extracellular wildtype ALK primer from a region of non-homology (primer 104) 5' TTCCTTCATCAGTCCACTGGGCAT (SEQ ID NO: 2).
  • the reverse primer can be primer 101 : 5' TCGTCCTGTTCAGAGCACACTTCA (SEQ ID NO: 7).
  • Template Exchange Extension Reaction refers to a class of methods that can compare an unknown or unsequenced nucleic acid template to a sequenced template to determine if they are identical. It is based on the fact that sequencing products are unique to the template from which they are generated. The disclosed methods and compositions involve particular forms of TEER.
  • TEER template exchange extension reaction
  • TEER was shown to detect mutations in a microplate format. Streptavidin coated microplate wells are used to attach a biotinylated PCR product to the solid phase. Homo and heteroduplex molecules are formed during hybridization in the solid phase. Each step of the process is readily accomplished in the microtiter plate, this greatly simplify sample handling and processing.
  • TEER can readily detect insertion and deletions. These mutations create a mismatch at the point of the insertion/deletion or just 3' of the mutation (on the wildtype extension strand) where the sequence frame is shifted. Detection of these mutations can be hindered in areas where long stretches of the same nucleotide or repeat sequences are present. For example, when a stretch is sufficiently long a hairpin loop can begin to form such that the insertion or deletion is squeezed out and may not be detected. Insertions or deletions near the middle of these stretches are more problematic to detect than those at the ends.
  • TEER was selecting for a mutant signal over the normal or wildtype signal. It was generating a signal from one "mutant” out of 60 "normal” single base extensions. The increase in signal of the heteroduplex over homoduplex was not dramatic, about 4 fold, but provided evidence that the process was working. This, along with the need to increase the signal to noise ratio of microplate detection, to the determination of whether PCR could be used to amplify the mutation such that it can be further characterized by DNA sequencing. Utilizing PCR to amplify the mutation first allows for rapid and sensitive detection of rare mutations. Samples that are positive can be sequenced to locate and identify the mutation. Each of the 4 bases is targeted in a separate reaction so that each base in the sequence is analyzed. Once TEER selection has taken place, the four reactions products from a sample may be combined together and analyzed in one real-time PCR detection reaction.
  • the first step in TEER is the template exchange.
  • PCR amplified wildtype DNA that has been modified randomly at a specific base is hybridized to DNA amplified from a sample with a potential mutation.
  • the duplex DNA has mismatches at one end to prevent degradation with Exo III and the opposite end has a 3' recessed end to allow ligation of a linker probe for solid phase attachment.
  • the linker ensures that all of the target is hybridized to its complement and that it is a full length extension product. Any incomplete extension products will not be ligated and will be readily removed from the plate by using a stringent wash.
  • the heteroduplex DNA is treated with enzymes or chemicals that cleave specifically at the modified nucleotide in the wildtype strand only. The complementary strand potentially containing a mutation is not affected. This creates a subset of abasic sites representative of each occurrence of the base in the sequence. This is essentially a sequencing ladder, less the targeted base, on an intact full-length template.
  • the next step in TEER is an extension reaction with exonuclease resistant nucleotides.
  • alpha-thionucleotides are being used. It is understood and herein contemplated that Boron nucleotides can also be used.
  • a mixture of three alpha-thio deoxynucleotide triphosphates (dNTPs) that represent the three possible nucleotide mutations, are used in the extension reaction with Thermosequenase.
  • a dNTP matching the targeted base is not present. For example, when thymine (via uracil) was the targeted base, then the extension nucleotides would be alpha-thio dATP, dCTP, and dGTP.
  • Exonuclease III can be used to select for mutations. Extension products terminated with thionucleotides represent mutations and are resistant to exonuclease III. Unprotected wildtype template is degraded.
  • the edited wildtype strand now contains a copy of the mutation.
  • the polymerase uses strand displacement, or a 5' to 3' exonuclease depending on the polymerase, to advance to the end of the mutant template. This process releases the mutant duplex from the solid phase.
  • the released DNA can be transferred from the microplate directly into a realtime PCR reaction.
  • the selected mutant template is amplified specifically using a real-time fluorescent forward primer and reverse primer.
  • a real-time fluorescent forward primer and reverse primer For example, SYBR green dye or a fluorogenic hairpin primer that fluoresces only after it has been extended such as a LUX primer (Invitrogen, Carlsbad, CA) can be used.
  • LUX primer Invitrogen, Carlsbad, CA
  • the use of internal hybridizing probes for real-time PCR such as Taqman or dual labeled FRET probes is not recommended since the site of the mutation is not known.
  • ALK mutations can be identified from lung cancer biopsy specimens. This work can include benchmarking comparison studies with the available diagnostic standards, an ALK FISH assay and anti-ALK immunohistochemistry (IHC).
  • a strategy to identify ALK mutations and their sub-variants through the detection of unique 5' regions of ALK fusion partners was designed.
  • the strategy was predicated on reverse transcription and extension and/or amplification from a region within the 3' intracellular region of ALK mRNAs, across the junctional site, and into the 5' portion of the fusion partner.
  • Generated cDNA or amplified DNA are post-labeled with a covalently linked fluoroprobe and serve as input to the microarray.
  • Each synthesized probe was optimized to a melting temperature of 65 °C and a unique hybridization region within the 5' fusion partner or ALK using the program OLIGOANLYZER 3.1®.
  • the melting temperature and approximate length of 30 nucleotides were selected based on reports of optimized microarray conditions.
  • a 5' monomethoxytrityl C-6 amino linker has been added to the probes to enable their purification and conjugation to prepared glass slides. This linker was selected based on chemistry optimization.
  • two probes for each ALK fusion partner ideally at different regions of the fusion partner, were synthesized to provide an alternative method of identification in the event that a probe was prevented from binding to a region by a conformational restriction of tertiary DNA structure. These criteria were also applied to the design of the internal controls.
  • Each synthesized primer was again optimized to a theoretical melting temperature of 60 0 C and unique regions of within both the 5' fusion partner and 3' ALK intracellular domain using the program OLIGOANL YZER 3.1®.
  • the primer defined as "Universal ALK Reverse Primer” serve as a common primer for the reverse transcription step.
  • the other listed primers permit for subsequent PCR steps and amplification of putative targets. These criteria were also applied to the design of the internal controls.
  • Optimization of RT-PCR Primers Primers for RT-PCR have been optimized to a binding Tm of 60°C for the generation of putative target DNA. These primers have been optimized as single amplicon reactions; however, several or all can be batched to allow multiplexing of putative target DNA.
  • Figure 4 shows gel electrophoresis of target DNAs amplified from each ALK variant and fusion of interest.
  • PCR amplification protocol utilized 35 cycles with 95°C for 15min; 94°C for 30s; 52°C for 1 min; 72°C for 1 min; 72°C for 15min, and 4°C.
  • Lu AL Hsu IC. Detection of single DNA base mutations with mismatch repair enzymes. Genomics 1992;14(2):249-55.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
PCT/US2010/035147 2009-05-15 2010-05-17 Methods and compositions relating to fusions of alk for diagnosing and treating cancer Ceased WO2010132888A2 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
US13/320,303 US20120208713A1 (en) 2009-05-15 2010-05-17 Methods and compositions relating to fusions of alk for diagnosing and treating cancer
BRPI1012140A BRPI1012140A2 (pt) 2009-05-15 2010-05-17 métodos e composições relacionados a fusões de alk para o diagnóstico e o tratamento de cânceres
CN201080031440.3A CN102575287B (zh) 2009-05-15 2010-05-17 用于诊断和治疗癌症的涉及alk融合物的方法和组合物
MX2011012162A MX338297B (es) 2009-05-15 2010-05-17 Metodos y composiciones relacionados con fusiones de alk para el diagnostico y tratamiento de cancer.
RU2011151049/10A RU2562144C2 (ru) 2009-05-15 2010-05-17 Способы и композиции, связанные со слиянием алк, для диагностики и лечения рака
AU2010248782A AU2010248782B2 (en) 2009-05-15 2010-05-17 Methods and compositions relating to fusions of ALK for diagnosing and treating cancer
EP10775673A EP2432900A4 (en) 2009-05-15 2010-05-17 METHOD AND COMPOSITIONS RELATED TO ALK FUSIONS FOR DIAGNOSIS AND TREATMENT OF CANCER
JP2012511069A JP2012526563A (ja) 2009-05-15 2010-05-17 癌を診断および治療するためのalkの融合に関する方法および組成物
EP16175320.7A EP3133167B1 (en) 2009-05-15 2010-05-17 Methods relating to fusions of alk for diagnosing cancer
CA2762108A CA2762108A1 (en) 2009-05-15 2010-05-17 Methods and compositions relating to fusions of alk for diagnosing and treating cancer
US15/334,974 US20170183743A1 (en) 2009-05-15 2016-10-26 Methods and compositions relating to fusions of alk for diagnosing and treating cancer

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US17893709P 2009-05-15 2009-05-15
US61/178,937 2009-05-15

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/320,303 A-371-Of-International US20120208713A1 (en) 2009-05-15 2010-05-17 Methods and compositions relating to fusions of alk for diagnosing and treating cancer
US15/334,974 Continuation US20170183743A1 (en) 2009-05-15 2016-10-26 Methods and compositions relating to fusions of alk for diagnosing and treating cancer

Publications (2)

Publication Number Publication Date
WO2010132888A2 true WO2010132888A2 (en) 2010-11-18
WO2010132888A3 WO2010132888A3 (en) 2011-01-20

Family

ID=43085621

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/035147 Ceased WO2010132888A2 (en) 2009-05-15 2010-05-17 Methods and compositions relating to fusions of alk for diagnosing and treating cancer

Country Status (11)

Country Link
US (2) US20120208713A1 (enExample)
EP (2) EP3133167B1 (enExample)
JP (2) JP2012526563A (enExample)
CN (1) CN102575287B (enExample)
AU (1) AU2010248782B2 (enExample)
BR (1) BRPI1012140A2 (enExample)
CA (1) CA2762108A1 (enExample)
ES (1) ES2700098T3 (enExample)
MX (1) MX338297B (enExample)
RU (1) RU2562144C2 (enExample)
WO (1) WO2010132888A2 (enExample)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011095894A2 (en) 2010-02-04 2011-08-11 Jichi Medical University Identification, assessment, and therapy of cancers with innate or acquired resistance to alk inhibitors
US8168383B2 (en) 2006-04-14 2012-05-01 Cell Signaling Technology, Inc. Gene defects and mutant ALK kinase in human solid tumors
US8232060B2 (en) 2006-04-14 2012-07-31 Cell Signaling Technology, Inc. Gene defects and mutant ALK kinase in human solid tumors
CN102888452A (zh) * 2012-05-18 2013-01-23 复旦大学附属肿瘤医院 一种筛查alk融合基因的方法
WO2013177705A1 (en) * 2012-05-28 2013-12-05 National Research Council Of Canada Genotyping assay for identifying chromosomal rearrangements
WO2014026133A1 (en) * 2012-08-09 2014-02-13 Insight Genetics, Inc. Methods and compositions relating to alk for diagnosing and treating inflammatory breast and other human cancers
RU2509153C1 (ru) * 2012-11-28 2014-03-10 Федеральное государственное бюджетное учреждение "Российский онкологический научный центр имени Н.Н. Блохина" Российской академии медицинских наук (ФГБУ "РОНЦ им. Н.Н. Блохина" РАМН) Способ анализа транслокаций eml4-alk, ассоциированных с чувствительностью рака легкого к противоопухолевой таргетной терапии
CN103805687A (zh) * 2012-11-09 2014-05-21 益善生物技术股份有限公司 Alk融合基因检测的pcr引物、试剂盒和液相芯片
WO2013119950A3 (en) * 2012-02-08 2014-11-13 Insight Genetics, Inc. Methods and compositions relating to fusions of ros1 for diagnosing and treating cancer
EP3137630A4 (en) * 2014-04-28 2017-11-29 Insight Genetics, Inc. Methods and compositions relating to fusions of alk for diagnosing and treating cancer
US10072298B2 (en) 2013-04-17 2018-09-11 Life Technologies Corporation Gene fusions and gene variants associated with cancer
EP3438288A1 (en) * 2014-03-27 2019-02-06 Life Technologies Corporation Gene fusions and gene variants associated with cancer
EP2986736B1 (en) * 2013-04-17 2019-09-18 Life Technologies Corporation Gene fusions and gene variants associated with cancer
US10551383B2 (en) 2010-08-06 2020-02-04 Cell Signaling Technology, Inc. Methods of detecting a polypeptide having anaplastic lymphoma kinase activity in kidney cancer
EP3666907A4 (en) * 2017-08-07 2021-05-05 Cytogen, Inc. Eml4-alk gene mutation analysis method

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2882759C (en) * 2012-08-31 2018-11-20 The Regents Of The University Of Colorado Detection of the ntrk1-mprip gene fusion for cancer diagnosis
CN103290120B (zh) * 2013-05-24 2015-03-25 厦门艾德生物医药科技有限公司 一种用于检测alk基因表达的探针、引物及试剂盒
WO2016106701A1 (zh) * 2014-12-31 2016-07-07 深圳华大基因股份有限公司 检测非小细胞肺癌的qRT-PCR引物、探针、芯片、试剂盒、应用和方法
CN107532209A (zh) * 2015-04-17 2018-01-02 豪夫迈·罗氏有限公司 检测基因融合的多重pcr
CN107022610B (zh) * 2017-04-01 2019-02-05 常州桐树生物科技有限公司 肿瘤驱动基因的检测芯片及其应用
RU2681165C1 (ru) * 2017-12-01 2019-03-04 Общество с ограниченной ответственностью "Научно-Исследовательский Центр Молекулярной Биомедицины" (ООО "НИЦ МолБиоМед") Способ определения активности теломеразы методом двойной амплификации теломерных повторов в реальном времени
CN111235272B (zh) * 2020-01-10 2023-07-07 厦门艾德生物医药科技股份有限公司 一次性检测肺癌多重基因突变的组合物及其应用
CN113005200B (zh) * 2021-04-14 2023-07-04 深圳乐土生物科技有限公司 一种检测肉瘤融合基因突变的引物组合物、试剂盒及应用
CN114807124B (zh) * 2022-04-01 2023-09-12 上海信诺佰世医学检验有限公司 一种检测alk融合基因的引物和探针组合物、试剂盒及方法

Family Cites Families (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
AU8126694A (en) * 1993-10-26 1995-05-22 Affymax Technologies N.V. Arrays of nucleic acid probes on biological chips
US6696548B2 (en) * 1993-12-03 2004-02-24 St. Jude Children's Research Hospital Antibodies for recognition of alk protein tyrosine/kinase receptor
US5529925A (en) * 1993-12-03 1996-06-25 St. Jude Children's Research Hospital Nucleic acid sequences and fusion proteins present in human t(2;5) lymphoma
US20020137890A1 (en) * 1997-03-31 2002-09-26 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
GB9812768D0 (en) * 1998-06-13 1998-08-12 Zeneca Ltd Methods
US7339033B2 (en) * 1998-06-26 2008-03-04 Genentech, Inc. Pro1481
GB0319227D0 (en) * 2003-08-15 2003-09-17 Novartis Ag Organic compounds
ATE429495T1 (de) * 2005-01-25 2009-05-15 Sky Genetics Inc Nukleinsäuren für die apoptose von krebszellen
WO2006085326A2 (en) * 2005-02-10 2006-08-17 Siano Mobile Silicon Ltd. System and method for mitigating memory requirements
WO2006094073A2 (en) * 2005-03-02 2006-09-08 Acadia Pharmaceuticals Inc. Functional bioluminescence energy resonance transfer (bret) assay to screen, identify and characterize receptor tyrosine kinase ligands
US20060286558A1 (en) * 2005-06-15 2006-12-21 Natalia Novoradovskaya Normalization of samples for amplification reactions
CA2598893C (en) * 2006-10-11 2012-04-10 Astellas Pharma Inc. Eml4-alk fusion gene
JP5562640B2 (ja) * 2007-04-13 2014-07-30 セル・シグナリング・テクノロジー・インコーポレイテツド ヒト固形腫瘍における遺伝子欠失及び突然変異alkキナーゼ

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DIRKS ET AL., INT. J. CANCER, vol. 100, 2002, pages 49 - 56
LAMANT ET AL., AM. J. PATH., vol. 156, 2000, pages 1711 - 1721
See also references of EP2432900A4

Cited By (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9523130B2 (en) 2006-04-14 2016-12-20 Cell Signaling Technology, Inc. Methods of treating non-small cell lung carcinoma (NSCLC)
US8168383B2 (en) 2006-04-14 2012-05-01 Cell Signaling Technology, Inc. Gene defects and mutant ALK kinase in human solid tumors
US8232060B2 (en) 2006-04-14 2012-07-31 Cell Signaling Technology, Inc. Gene defects and mutant ALK kinase in human solid tumors
US8288102B2 (en) 2006-04-14 2012-10-16 Cell Signaling Technology, Inc. Gene defects and mutant ALK kinase in human solid tumors
US11505833B2 (en) 2006-04-14 2022-11-22 Cell Signaling Technology, Inc. Compositions for detecting mutant anaplastic lymphoma kinase in lung cancer
US8377642B2 (en) 2006-04-14 2013-02-19 Cell Signaling Technology, Inc. Gene defects and mutant ALK kinase in human solid tumors
US8481279B2 (en) 2006-04-14 2013-07-09 Cell Signaling Technology, Inc. Methods of treating lung cancer using inhibitors anaplastic lymphoma kinase
US8486645B2 (en) 2006-04-14 2013-07-16 Cell Signaling Technology, Inc. Gene defects and mutant ALK kinase in human solid tumors
US10955416B2 (en) 2006-04-14 2021-03-23 Cell Signaling Technology, Inc. Compositions for detecting mutant anaplastic lymphoma kinase in human lung cancer
US10870892B2 (en) 2006-04-14 2020-12-22 Cell Signaling Technology, Inc. Compositions for detecting mutant anaplastic lymphoma kinase in lung cancer
US9988688B2 (en) 2006-04-14 2018-06-05 Cell Signaling Technology, Inc. Compositions for detecting mutant anaplastic lymphoma kinase in lung cancer
US9018230B2 (en) 2010-02-04 2015-04-28 Jichi Medical University Identification, assessment, and therapy of cancers with innate or acquired resistance to ALK inhibitors
WO2011095894A2 (en) 2010-02-04 2011-08-11 Jichi Medical University Identification, assessment, and therapy of cancers with innate or acquired resistance to alk inhibitors
AU2011212165B2 (en) * 2010-02-04 2016-03-03 Jichi Medical University Identification, assessment, and therapy of cancers with innate or acquired resistance to ALK inhibitors
EP2531858A4 (en) * 2010-02-04 2013-08-07 Univ Jichi Medical IDENTIFICATION, TESTING AND THERAPY OF CANCER DISORDERS WITH INNATE OR INCOMPATED RESISTANCE TO ALK INHIBITORS
US10551383B2 (en) 2010-08-06 2020-02-04 Cell Signaling Technology, Inc. Methods of detecting a polypeptide having anaplastic lymphoma kinase activity in kidney cancer
WO2013119950A3 (en) * 2012-02-08 2014-11-13 Insight Genetics, Inc. Methods and compositions relating to fusions of ros1 for diagnosing and treating cancer
CN104364391A (zh) * 2012-02-08 2015-02-18 因赛特遗传学公司 用于诊断和治疗癌症的涉及ros1融合的方法和组合物
CN102888452B (zh) * 2012-05-18 2014-08-27 复旦大学附属肿瘤医院 一种筛查alk融合基因的方法
CN102888452A (zh) * 2012-05-18 2013-01-23 复旦大学附属肿瘤医院 一种筛查alk融合基因的方法
WO2013177705A1 (en) * 2012-05-28 2013-12-05 National Research Council Of Canada Genotyping assay for identifying chromosomal rearrangements
WO2014026133A1 (en) * 2012-08-09 2014-02-13 Insight Genetics, Inc. Methods and compositions relating to alk for diagnosing and treating inflammatory breast and other human cancers
CN103805687A (zh) * 2012-11-09 2014-05-21 益善生物技术股份有限公司 Alk融合基因检测的pcr引物、试剂盒和液相芯片
CN103805687B (zh) * 2012-11-09 2016-06-01 益善生物技术股份有限公司 Alk融合基因检测的pcr引物、试剂盒和液相芯片
RU2509153C1 (ru) * 2012-11-28 2014-03-10 Федеральное государственное бюджетное учреждение "Российский онкологический научный центр имени Н.Н. Блохина" Российской академии медицинских наук (ФГБУ "РОНЦ им. Н.Н. Блохина" РАМН) Способ анализа транслокаций eml4-alk, ассоциированных с чувствительностью рака легкого к противоопухолевой таргетной терапии
US10072298B2 (en) 2013-04-17 2018-09-11 Life Technologies Corporation Gene fusions and gene variants associated with cancer
EP2986736B1 (en) * 2013-04-17 2019-09-18 Life Technologies Corporation Gene fusions and gene variants associated with cancer
AU2014254394B2 (en) * 2013-04-17 2020-06-18 Life Technologies Corporation Gene fusions and gene variants associated with cancer
US11746379B2 (en) 2013-04-17 2023-09-05 Life Technologies Corporation Gene fusions and gene variants associated with cancer
EP3438288A1 (en) * 2014-03-27 2019-02-06 Life Technologies Corporation Gene fusions and gene variants associated with cancer
EP3137630A4 (en) * 2014-04-28 2017-11-29 Insight Genetics, Inc. Methods and compositions relating to fusions of alk for diagnosing and treating cancer
EP3666907A4 (en) * 2017-08-07 2021-05-05 Cytogen, Inc. Eml4-alk gene mutation analysis method
US11718882B2 (en) 2017-08-07 2023-08-08 Cytogen, Inc. EML4-ALK gene mutation analysis method

Also Published As

Publication number Publication date
JP2012526563A (ja) 2012-11-01
RU2011151049A (ru) 2013-06-20
WO2010132888A3 (en) 2011-01-20
MX338297B (es) 2016-04-11
EP3133167B1 (en) 2018-09-12
RU2562144C2 (ru) 2015-09-10
AU2010248782A1 (en) 2012-01-19
CN102575287B (zh) 2016-11-16
CA2762108A1 (en) 2010-11-18
AU2010248782B2 (en) 2015-06-11
MX2011012162A (es) 2012-01-30
CN102575287A (zh) 2012-07-11
US20120208713A1 (en) 2012-08-16
EP3133167A1 (en) 2017-02-22
JP2016052332A (ja) 2016-04-14
US20170183743A1 (en) 2017-06-29
BRPI1012140A2 (pt) 2016-05-03
EP2432900A2 (en) 2012-03-28
ES2700098T3 (es) 2019-02-14
JP6397833B2 (ja) 2018-09-26
EP2432900A4 (en) 2012-11-21

Similar Documents

Publication Publication Date Title
EP3133167B1 (en) Methods relating to fusions of alk for diagnosing cancer
WO2013119950A2 (en) Methods and compositions relating to fusions of ros1 for diagnosing and treating cancer
US7906287B2 (en) Methods of screening nucleic acids for single nucleotide variations
WO2014052613A2 (en) Methods and compositions relating to next generation sequencing for genetic testing in alk related cancers
WO2017201276A1 (en) Methods of detecting a mutated gene by multiplex digital pcr
US9428812B2 (en) Kit comprising primers for amplifying ALK kinase domain nucleic acids
US20150232940A1 (en) Methods and compositions relating to diagnosing and treating receptor tyrosine kinase related cancers
JP6153758B2 (ja) 多型検出用プローブ、多型検出方法、薬効判定方法及び多型検出用キット
JP6205216B2 (ja) 変異検出用プローブ、変異検出方法、薬効判定方法及び変異検出用キット
US20180208993A1 (en) Highly sensitive methods for detecting btk resistance mutations in rna and dna
US20150240301A1 (en) Methods and compositions relating to next generation sequencing for genetic testing in alk related cancers
WO2014026133A1 (en) Methods and compositions relating to alk for diagnosing and treating inflammatory breast and other human cancers
JP2005110606A (ja) 高血圧性腎障害素因の検査方法
WO2012146251A1 (en) Method for detecting mutations using a three primer system and differently melting amplicons

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080031440.3

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10775673

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2012511069

Country of ref document: JP

Ref document number: 2762108

Country of ref document: CA

Ref document number: MX/A/2011/012162

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2010248782

Country of ref document: AU

Ref document number: 9870/DELNP/2011

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2011151049

Country of ref document: RU

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2010775673

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2010775673

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2010248782

Country of ref document: AU

Date of ref document: 20100517

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 13320303

Country of ref document: US

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: PI1012140

Country of ref document: BR

ENP Entry into the national phase

Ref document number: PI1012140

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20111116