WO2009158620A2 - Signatures and determinants associated with metastasis methods of use thereof - Google Patents

Signatures and determinants associated with metastasis methods of use thereof Download PDF

Info

Publication number
WO2009158620A2
WO2009158620A2 PCT/US2009/048862 US2009048862W WO2009158620A2 WO 2009158620 A2 WO2009158620 A2 WO 2009158620A2 US 2009048862 W US2009048862 W US 2009048862W WO 2009158620 A2 WO2009158620 A2 WO 2009158620A2
Authority
WO
WIPO (PCT)
Prior art keywords
determinants
tumor
subject
sample
determinant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2009/048862
Other languages
English (en)
French (fr)
Other versions
WO2009158620A3 (en
Inventor
Lynda Chinn
Kenneth L. Scott
Papia Ghosh
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Dana Farber Cancer Institute Inc
Original Assignee
Dana Farber Cancer Institute Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN2009801331437A priority Critical patent/CN102132160A/zh
Priority to EP09771151A priority patent/EP2307886A2/en
Priority to MX2010014280A priority patent/MX2010014280A/es
Priority to JP2011516713A priority patent/JP2011526693A/ja
Priority to BRPI0914734A priority patent/BRPI0914734A2/pt
Priority to NZ590385A priority patent/NZ590385A/xx
Priority to AU2009262022A priority patent/AU2009262022A1/en
Priority to US13/001,203 priority patent/US20110182881A1/en
Application filed by Dana Farber Cancer Institute Inc filed Critical Dana Farber Cancer Institute Inc
Priority to CA2728674A priority patent/CA2728674A1/en
Publication of WO2009158620A2 publication Critical patent/WO2009158620A2/en
Publication of WO2009158620A3 publication Critical patent/WO2009158620A3/en
Priority to IL210245A priority patent/IL210245A0/en
Anticipated expiration legal-status Critical
Priority to ZA2011/00225A priority patent/ZA201100225B/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809Methods for determination or identification of nucleic acids involving differential detection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5758Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/112Disease subtyping, staging or classification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/56Staging of a disease; Further complications associated with the disease
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/60Complex ways of combining multiple protein biomarkers for diagnosis

Definitions

  • the present invention relates generally to the identification of biological signatures associated with and genetic determinants effecting cancer metastasis and methods of using such biological signatures and determinants in the screening, prevention, diagnosis, therapy, monitoring, and prognosis of cancer.
  • Metastasis is the cardinal feature of most lethal solid tumors and represents a complex multi-step biological process driven by an ensemble of genetic or epigenetic alterations that confer a tumor cell the ability to bypass local control and invade through surrounding matrix, survive transit in vasculature or lymphatics, ultimately colonize on foreign soil and grow (Gaorav P. Gupta and Joan Massague (2006) Cell). It is the general consensus that such metastasis-conferring genetic events can be acquired stochastically as tumor grows and expands; indeed, total tumor burden is a positive predictor of metastatic risk. On the other hand, mounting evidence has promoted the thesis that some tumors may be endowed (or not) from the earliest stages with the capacity to metastasize.
  • the present invention relates in part to the discovery that certain biological markers (referred to herein as "DETERMINANTS”), such as proteins, nucleic acids, polymorphisms, metabolites, and other analytes, as well as certain physiological conditions and states, are present or altered in subjects with an increased risk of developing a metastatic tumor.
  • biological markers referred to herein as "DETERMINANTS”
  • proteins, nucleic acids, polymorphisms, metabolites, and other analytes are present or altered in subjects with an increased risk of developing a metastatic tumor.
  • the invention provides a method with a for assessing a risk of development of a metastatic tumor in a subject.
  • Risk of developing a metastatic tumor is determined by measuring the level of an effective amount of a DETERMINANT in a sample from the subject.
  • An increased risk of developing a metastatic tumor in the subject is determined by measuring a clinically significant alteration in the level of the DETERMINANT in the sample.
  • an increased risk of developing a metastatic tumor in the subject is determined by comparing the level of the effective amount DETERMINANT to a reference value.
  • the reference value is an index.
  • the invention provides a method for assessing the progression of a tumor in a subject by detecting the level of an effective amount a DETERMINANTS in a first sample from the subject at a first period of time, detecting the level of an effective amount of DETERMINANTS in a second sample from the subject at a second period of time and comparing the level of the DETERMINANTS detected in to a reference value.
  • the first sample is taken from the subject prior to being treated for the tumor and the second sample is taken from the subject after being treated for the tumor.
  • the invention provides a method for monitoring the effectiveness of treatment or selecting a treatment regimen for a metastatic tumor by detecting the level of an effective amount of DETERMINANTS in a first sample from the subject at a first period of time and optionally detecting the level of an effective amount of DETERMINANTS in a second sample from the subject at a second period of time.
  • the level of the effective amount of DETERMINANTS detected at the first period of time is compared to the level detected at the second period of time or alternatively a reference value. Effectiveness of treatment is monitored by a change in the level of the effective amount of DETERMINANTS from the subject.
  • the invention provides a method of treating a patient with a tumor, by identifying a patient with a tumor where an effective amount of DETERMINANTS are altered in a clinically significant manner as measured in a sample from the tumor, an treating the patient with a therapeutic regimen that prevents or reduces tumor metastasis.
  • the invention provide a method of selecting a tumor patient in need of adjuvant treatment by assessing the risk of metastasis in the patient by measuring an effective amount of DETERMINANTS where a clinically significant alteration two or more DETERMINANTS in a tumor sample from the patient indicates that the patient is in need of adjuvant treatment.
  • the invention provides a method of informing a treatment decision for a tumor patient by obtaining information on an effective amount of DETERMINANTS in a tumor sample from the patient, and selecting a treatment regimen that prevents or reduces tumor metastasis in the patient if two or more DETERMINANTS are altered in a clinically significant manner.
  • the assessment/monitoring is achieved with a predetermined level of predictability.
  • predetermined level of predictability is meant that that the method provides an acceptable level of clininal or diagnostic accuracy.
  • Clinical and diagnositic accuracy a is determined by methods known in the art, such as by the methods decribed herein.
  • a DETERMINANT includes for example DETERMINANT 1-360 described herein. One, two, three, four, five, ten or more DETERMINANTS are measured. Preferably, at least two DETERMINANTS selected from DETERMINANTS 1-25, 41,61, 62, 63, 66, 74, 96, 99, 103, 126, 135, 137, 138, 177, 190, 210, 212, 217, 218, 227, 239, 261, and 271 are measured. Optionally, the methods of the invention further include measuring at least one standard parameters associated with a tumor. [00013] The level of a DETERMINANT is measured electrophoretically or immunochemically. For example the level of the determinant is detected by radioimmunoassay, immunofluorescence assay or by an enzyme-linked immunosorbent assay.
  • the subject has a primary tumor, a recurrent tumor, or a metastatic tumor.
  • the sample is taken for a subject that has previously been treated for the tumor.
  • the sample is taken from the subject prior to being treated for the tumor.
  • the sample is a tumor biopsy such as a core biopsy, an excisional tissue biopsy or an incisional tissue biopsy, or a blood sample with circulating tumor cells.
  • a metastatic tumor reference expression profile containing a pattern of marker levels of an effective amount of two or more markers selected from DETERMINANTS 1-360.
  • the profile contains a pattern of marker levels of DETERMINANTS 1-25, 41,61, 62, 63, 66, 74, 96, 99, 103, 126, 135, 137, 138, 177, 190, 210, 212, 217, 218, 227, 239, 261, and 271 .
  • a machine readable media containing one or more metastatic tumor reference expression profiles and optionally, additional test results and subject information.
  • the invention provides a kit comprising a plurality of DETERMINANT detection reagents that detect the corresponding DETERMINANTS.
  • the detection reagent is for example antibodies or fragments thereof, oligonucleotides or aptamers.
  • the invention provides a DETERMINANT panel containing one or more DETERMINANTS that are indicative of a physiological or biochemical pathway associated metastasis or the progression of a tumor.
  • the physiological or biochemical pathway includes for example, [00017]
  • the invention provides a way of identifying a biomarker that is prognostic for a disease by identifying one or more genes that are differentially expressed in the disease compared to a control to produce a gene target list; and identifying one or more genes on the target list that is associated with a functional aspect of the progression of the disease.
  • the functional aspect is for example, cell migration, angiogenesis, extracellular matrix degradation or anoikis resistance.
  • the method includes identifying one or more genes on the gene target list that comprise an evolutionarily conserved change to produce a second gene target list.
  • the disease is for example cancer such as metastatic cancer.
  • Compounds that modulates the activity or expression of a DETERMINANT are identified by providing a cell expressing the DETERMINANT, contacting (e.g., in vivo, ex vivo or in vitro) the cell with a composition comprising a candidate compound; and determining whether the substance alters the expression of activity of the DETERMINANT. If the alteration observed in the presence of the compound is not observed when the cell is contacted with a composition devoid of the compound, the compound identified modulates the activity or expression of a DETERMINANT.
  • Cancer is treated in a subject be administering to the subject a compound that modulates the activity or expression of a DETERMINANT or by administering to the subject an agent that modulates the activity or expression of a compound that is modulated by a DETERMINANT.
  • the compound can be, e.g., (i) a DETERMINANT polypeptide; (ii) a nucleic acid encoding a DETERMINANT (iii) a nucleic acid that decreases the expression or activity of a nucleic acid that encodes DETERMINANT such as , and derivatives, fragments, analogs and homologs thereof (iv a polypeptide that decreases the expesssion or activity if a DETERMINANT such as an antibody specific for the DETERMINANT.
  • antibody includes monoclonal antibodies, polyclonal antibodies, multispecific antibodies ⁇ e.g., bispecif ⁇ c antibodies), humanized or human antibodies, Fv antibodies, diabodies and antibody fragments, so long as they exhibit the desired biological activity.
  • the compound is TGF ⁇ and the agent is a TGF ⁇ inhibitor.
  • Another example is CXCR4 and the agent is a CXCR4 antagonist.
  • Fig. 1 shows Melanocyte-specific MET expression promotes formation of cutaneous melanoma.
  • A Melanocytes were harvested from the indicated animals and adapted to culture. Total RNA was extracted from cultured melanocytes grown in the presence or absence of doxycycline (DOX), and expression of MET (Tg MET) was assayed by RT-PCR using transgene-specific primers.
  • DOX doxycycline
  • Tg MET MET expression of MET
  • R15 ribosomal protein R15 internal control
  • -RT no reverse transcriptase PCR control
  • B Primary tumors (T1-T6) were harvested from iMet animals on doxycycline and assessed for expression of the melanocytic markers Tyrosinase, TRPl and Dct by RT-PCR using gene-specific primers.
  • XB2 mouse keratinocyte cell line; Bl 6F10, mouse melanoma cell line; Rl 5, ribosomal protein Rl 5 internal control; -RT, no reverse transcriptase PCR control.
  • (C) Melanocyte- specific immunohistochemical staining of S 100 in a MET-induced primary melanoma, t, tumor; f, folicule; fm, folicular melanocytes; a, adipocytes.
  • D Immunohistochemical staining of total c-Met and phosphorylated c-Met in a MET-induced primary melanoma.
  • E RT-qPCR was performed to analyze HGF expression in MET-induced primary melanomas (T1-T6). Tumor expression data is normalized to expression in two Ink4a/Arf /" melanocyte cell lines.
  • FIG. 2. shows Met activation drives development of metastatic melanomas and promotes lung seeding.
  • A Boy den chambers were seeded with 5X10 4 iMet tumor cells (line BCO 14) in serum- free media. Chambers were placed in chemo-attractant (media containing 10% serum) without and with 50 ng/ml recombinant HGF and incubated for 24 hrs. Invasive cells were visualized by staining with crystal violet.
  • B H&E stained sections of a primary cutaneous spindle cell melanoma in the dorsal skin of an iMet transgenic mouse induced with doxycycline and distal metastases residing in lymph node adrenal gland and lung.
  • (C) 5x10 5 cells were injected in the tail vein of SCID and mice followed for formation of lung nodules, a correlate of metastatic seeding.
  • Left panel H&E stained section of nodule-free lung tissue harvested from SCID animals tail vein injected with an HRAS* melanoma cell line (0/4 mice);
  • Right panel H&E stained section of nodule-infiltrated lung tissue harvested from SCIDs tail vein-injected with the MET-driven BC014 cell line (iMet) (3/4 mice), t, tumor.
  • iMet MET-driven BC014 cell line
  • Fig. 3. shows multi-dimensional cross species genomic analyses coupled with a low-complexity functional genetic screen for cell invasion identifies metastasis determinants.
  • A Differentially expressed genes (1597 probe sets) by SAM analyses of expression profiles generated from iHRAS* and iMet cutaneous melanomas were intersected by ortholog mapping with genes resident within regions of amplifications and deletions in human metastatic melanoma, or with differentially expressed genes between human primary and metastatic melanoma to define 360 candidates.
  • D Histogram summary of the low-complexity genetic screen for pro- invasion genes. HMEL468 primed melanocytes were transduced with individual pro- metastasis candidate cDNA virus, followed by loading onto 96-well transwell invasion assay plates. Invasiveness was measured via florescence-mediated quantitation and values were normalized to empty vector control.
  • Fig 4 shows Automated Quantitative Analysis (AQUA") of protein expression for represenative determinants
  • A Fascinl (FSCNl) and
  • B HSFl performed on tissue micrraorrays (TMA) of nevi, primary and metastatic melanoma tumor specimens as described [Camp, R.L., Chung, G.
  • FIG. 5 shows (A) K-means hierarchal clustering and (B) Kaplan-Meier analysis for overall (top) and metastasis-free (bottom) survivals of two subclasses from above in a cohort of 295 Stage I-II breast cancers
  • N Engl J Med 347 (25), 1999-2009 (2002); van t Veer, LJ. et al Gene expression profiling predicts clinical outcome of breast cancer. Nature 415 (6871), 530-536 (2002)]
  • Fig. 6 show the in vitro anoikis screen methodology.
  • RIE Rat intestinal epithelial
  • ATP levels were measured for cell viability and given as a ratio of level at time 24hr/0hr.
  • C RIE express V5-mTrkB. RIE cells were infected and at 48hrs cell lysate was isolated and resolved by SDS-PAGE. Western blot analysis was done with ⁇ -V5 antibody.
  • Fig.7 shows various genes confer anoikis resistance to RIE cells.
  • RIE cells were infected with retrovirus expressing one of the candidate genes, plated on ultra-low cluster plates and viability of cells was measured24hrs post-plating. Values are given relative to Ohr viability. All readings were done in triplicate. Highlightedare readings of empty vector, BDNF or mTrkB (positive controls).
  • Fig. 8 shows the twenty candidate genes that conferred anoikis resistance to Rat Intestinal Epitheal (RIE) cells greater than two standard deviations from the median.
  • RIE Rat Intestinal Epitheal
  • Nine candidate genes HNRPR, CDC20, PRIM2A, HRSP12, ENY2, MGC14141, RECQL, STK3, and MX2
  • Fig. 9 Genes confer ability of RIE cells to attach after maintenance in suspension. RIE cells expressing a candidate gene were plated on ULC plates for 24hrs. Cells in suspension were transferred to adherent plates and 24hrs hours later attached cells were stained with crystal violet. Cell viability is given as 24hr/0hr. All readings were done in triplicate.
  • Fig. 10 shows metastasis determinants promote tumorigenicity
  • B Table summarizing data collected form determinant-driven tumorigenesis assays.
  • Fig. 11 illustrates that determinant HOXAl promotes cell invasion and lung seeding capacity..
  • E WMl 15 melanoma cells expressing either empty vector (EV) or HOXAl were injected subcutaneous Iy into nude mice and measured 46 days post- injection (F) Representative metastases of the lung isolated from a nude mouse bearing intradermally- injected WM115-H0XA1 cells
  • Fig 12 shows HOXA 1 -driven transcriptome analysis identified a Smad3 network defined by Ingenuity Pathway Analysis
  • a molecule network generated using Ingenuity Pathways Analysis (Ingenuity Systems Inc )
  • the network is displayed graphically as nodes (genes) and edges (the biological relationships between nodes)
  • Solid lines represent direct interactions and dashed lines represent indirect interactions
  • Red and green colors denote genes that were over-expressed or under- expressed in the transcriptome analysis, respectively
  • the shapes of the objects represent the functional families to which the proteins belong
  • B The indicated HOXAl -transduced cell lines were assessed for SMAD3 expression using RT-qPCR Values were calculated relative to GAPDH internal control and GFP experimental control Error bars represent standard error
  • Fig 14 Ink4a/Arf-/- mouse-derived melanocytes transduced with HRAS* (M3HRAS) over-expressing FSCNl or HOXAl exhibit (A) enhanced invasion through mat ⁇ gel in transwell invasion assays (B) enhanced subcutaneous tumor growth in nude mice and (C) increased lung nodule formation following intravenous tail vein injection into SCID mice Note that in C, the lung/body mass index difference for the FSCNl cohort is not significant due to the relative good health of those animals at the assay endpoint that was mandated by the extremely ill HOXAl cohort [00036]
  • Fig 18 WM321 1 melanoma cells stably-expressmg empty vector (ev), Geminin or Nedd9 (positive control) were assayed for invasion through mat ⁇ gel in transwell invasion assays (B) Immunoblot analysis of total cell lysates extracted from WM321 1 cells stably-expressing empty vector (ev), Geminin or Caveolml (negative control) Anti-phospho FAK and anti-phospho ERK represent activated FAK and ERK species, respectively (C) WM3211 cells stably-expressing empty vector (EV) or
  • the present invention relates to the identification of signatures associated with and determinants conferring subjects with a metastatic tumor or are at risk for developing a metastatic tumor
  • the anoikis resistant screen has defined nine (9) validated determinmants capable of conferring survival in suspension, without overlap with the invasion determinants. These determinants together or a subset of will cover major steps involved in metastatic dissemination
  • the invention provides methods for identifying subjects who have a metastatic tumor, or who at risk for experiencing a metastatic tumor by the detection of determinants associated with the metatstatic tumor, including those subjects
  • TP true positives
  • TN true negatives
  • FP false negatives
  • FN false negatives
  • Determinant in the context of the present invention encompasses, without limitation, proteins, nucleic acids, and metabolites, together with their polymorphisms, mutations, variants, modifications, subunits, fragments, protein-ligand complexes, and degradation products, protein-ligand complexes, elements, related metabolites, and other analytes or sample-derived measures. Determinants can also include mutated proteins or mutated nucleic acids. Determinants also encompass non-blood borne factors or non- analyte physiological markers of health status, such as "clinical parameters" defined herein, as well as “traditional laboratory risk factors”, also defined herein.
  • DETERMINANTS are summarized in Table 1 and are collectively referred to herein as, inter alia, "metastatic tumor-associated proteins", “DETERMINANT polypeptides", or “DETERMINANT proteins”
  • the corresponding nucleic acids encoding the polypeptides are referred to as “metastatic tumor-associated nucleic acids”, “metastatic tumor-associated genes”, “DETERMINANT nucleic acids”, or “DETERMINANT genes”
  • “DETERMINANT”, “metastatic tumor -associated proteins”, “metastatic tumor -associated nucleic acids” are meant to refer to any of the sequences disclosed herein
  • the corresponding metabolites of the DETERMINANT proteins or nucleic acids can also be measured, as well as any of the aforementioned traditional risk marker metabolites
  • Physiological markers of health status e g , such as age, family history, and other measurements commonly used as traditional risk factors
  • DETERMINANT physiology Calculated indices created from mathematically combining measurements of one or more, preferably two or more of the aforementioned classes of DETERMINANTS are referred to as “DETERMINANT indices”
  • “Clinical parameters” encompasses all non-sample or non-analyte biomarkers of subject health status or other characteristics, such as, without limitation, age (Age), ethnicity (RACE), gender (Sex), or family history (FamHX)
  • CEC Cerculating endothelial cell
  • CTC Cerculating tumor cell
  • FN is false negative, which for a disease state test means classifying a disease subject incorrectly as non-disease or normal
  • FP is false positive, which for a disease state test means classifying a normal subject incorrectly as having disease
  • a "formula,” “algorithm,” or “model” is any mathematical equation, algorithmic, analytical or programmed process, or statistical technique that takes one or more continuous or categorical inputs (herein called “parameters”) and calculates an output value, sometimes referred to as an "index” or “index value "
  • Non-limiting examples of “formulas” include sums, ratios, and regression operators, such as coefficients or exponents, biomarker value transformations and normalizations (including, without limitation, those normalization schemes based on clinical parameters, such as gender, age, or ethnicity), rules and guidelines, statistical classification models, and neural networks trained on historical populations
  • Of particular use in combining DETERMINANTS and other determinant are linear and non-linear equations and statistical classification analyses to determine the relationship between levels of DETERMINANTS detected in a subject sample and the subject's risk ofmetastatic disease
  • structural and synactic statistical classification algorithms, and methods of risk index construction, utilizing pattern recognition features, including established techniques such as
  • a "health economic utility function" is a formula that is derived from a combination of the expected probability of a range of clinical outcomes in an idealized applicable patient population, both before and after the introduction of a diagnostic or therapeutic intervention into the standard of care It encompasses estimates of the accuracy, effectiveness and performance characteristics of such intervention, and a cost and/or value measurement (a utility) associated with each outcome, which may be derived from actual health system costs of care (services, supplies, devices and drugs, etc ) and/or as an estimated acceptable value per quality adjusted life year (QALY) resulting in each outcome The sum, across all predicted outcomes, of the product of the predicted population size
  • Measuring or “measurement,” or alternatively “detecting” or “detection,” means assessing the presence, absence, quantity, activity or amount (which can be an effective amount) of either a given substance withm a clinical or subject-derived sample, including the derivation of qualitative or quantitative concentration levels of such substances, or otherwise evaluating the values or categorization of a subject's non-analyte clinical parameters
  • NPV neuropeptide-derived predictive value
  • TN/(TN + FN) or the true negative fraction of all negative test results It also is inherently impacted by the prevalence of the disease and pre-test probability of the population intended to be tested
  • alytical accuracy refers to the reproducibility and predictability of the measurement process itself, and may be summarized in such measurements as coefficients of variation, and tests of concordance and calibration of the same samples or controls with different times, users, equipment and/or reagents These and other considerations in evaluating new biomarkers are also summarized in Vasan, 2006
  • “Positive predictive value” or “PPV” is calculated by TP/(TP+FP) or the true positive fraction of all positive test results It is inherently impacted by the prevalence of the disease and pre-test probability of the population intended to be tested
  • “Risk” in the context of the present invention relates to the probability that an event will occur over a specific time period, as in the conversion tometastatic events, and can mean a subject's "absolute” risk or “relative” risk Absolute risk can be measured with reference to either actual observation post measurement for the relevant time cohort, or with reference to index values developed from statistically valid historical cohorts that have been followed for the relevant time period
  • Relative risk refers to the ratio of absolute risks of a subject compared either to the absolute risks of low risk cohorts or an average population risk, which can vary by how clinical risk factors are assessed Odds ratios, the proportion of positive events to negative events for a given test
  • Risk evaluation or “evaluation of risk” in the context of the present invention encompasses making a prediction of the probability, odds, or likelihood that an event or disease state may occur, the rate of occurrence of the event or conversion from one disease state to another, i e , from a primary tumor to a metastatic tumor or to one at risk of developing a metastatic, or from at risk of a primary metastatic event to a more secondary metastatic event Risk evaluation can also comprise prediction of future clinical parameters, traditional laboratory risk factor values, or other indices of cancer, either in absolute or relative terms in reference to a previously measured population The methods of the present invention may be used to make continuous or categorical measurements of the risk of a metastatic tumor thus diagnosing and defining the risk spectrum of a category of subjects defined as being at risk for metastatic tumor In the
  • a "subject" in the context of the present invention is preferably a mammal
  • the mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but are not limited to these examples. Mammals other than humans can be advantageously used as subjects that represent animal models of tumor metastasis.
  • a subject can be male or female.
  • a subject can be one who has been previously diagnosed or identified as having primary tumor or a metstatic tumor, and optionally has already undergone, or is undergoing, a therapeutic intervention for the tumor.
  • a subject can also be one who has not been previously diagnosed as having a metastatic tumor.
  • a subject can be one who exhibits one or more risk factors for a metastatic tumor.
  • TN is true negative, which for a disease state test means classifying a non- disease or normal subject correctly
  • Traditional laboratory risk factors correspond to biomarkers isolated or derived from subject samples and which are currently evaluated in the clinical laboratory and used in traditional global risk assessment algorithms.
  • Traditional laboratory risk factors for tumor metastasis include for example breslow thickness, ulceration. Proliferative index, tumor-infiltrating lymphocytes.
  • Other traditional laboratory risk factors for tumor metastasis are known to those skilled in the art.
  • the methods disclosed herein are used with subjects at risk for developing a metastatic tumor, subjects who may or may not have already been diagnosed with a metastatic tumor and subjects undergoing treatment and/or therapies for a primary tumor
  • the methods of the present invention can also be used to monitor or select a treatment regimen for a subject who has a primary tumor or a metastatic tumor, and to screen subjects who have not been previously diagnosed as having a metastatic tumor, such as subjects who exhibit risk factors for metastatis Preferably, the methods of the present invention are used to identify and/or diagnose subjects who are asymptomatic for a metastatic tumor. "Asymptomatic" means not exhibiting the traditional symptoms.
  • the methods of the present invention may also used to identify and/or diagnose subjects already at higher risk of developing a metastatic tumor based on solely on the traditional risk factors.
  • a subject having a metastatic tumor can be identified by measuring the amounts (including the presence or absence) of an effective number (which can be two or more) of DETERMINANTS in a subject-derived sample and the amounts are then compared to a reference value Alterations in the amounts and patterns of expression of biomarkers, such as proteins, polypeptides, nucleic acids and polynucleotides, polymorphisms of proteins, polypeptides, nucleic acids, and polynucleotides, mutated proteins, polypeptides, nucleic acids, and polynucleotides, or alterations in the molecular quantities of metabolites or other analytes in the subject sample compared to the reference value are then identified
  • biomarkers such as proteins, polypeptides, nucleic acids and polynucleotides, polymorphisms of proteins, polypeptides, nucleic acids, and polynucleotides, mutated proteins, polypeptides, nucleic acids, and polynucleot
  • a reference value can be relative to a number or value derived from population studies, including without limitation, such subjects having the same cancer, subject having the same or similar age range, subjects in the same or similar ethnic group, subjects having family histories of cancer, or relative to the starting sample of a subject undergoing treatment for a cancer
  • Such reference values can be derived from statistical analyses and/or risk prediction data of populations obtained from mathematical algorithms and computed indices of cancer metastasis
  • Reference DETERMINANT indices can also be constructed and used using algorithms and other methods of statistical and structural classification.
  • the reference value is the amount of DETERMINANTS in a control sample derived from one or more subjects who are not at risk or at low risk for developing metastatic tumor. In another embodiment of the
  • the reference value is the amount of DETERMINANTS in a control sample derived from one or more subjects who are asymptomatic and/or lack traditional risk factors for a metastatic tumor
  • such subjects are monitored and/or periodically retested for a diagnostically relevant period of time ("longitudinal studies") following such test to verify continued absence of a metastatic tumor (disease or event free survival)
  • Such period of time may be one year, two years, two to five years, five years, five to ten years, ten years, or ten or more years from the initial testing date for determination of the reference value
  • retrospective measurement of DETERMINANTS in properly banked historical subject samples may be used in establishing these reference values, thus shortening the study time required
  • a reference value can also comprise the amounts of DETERMINANTS derived from subjects who show an improvement in metastatic risk factors as a result of treatments and/or therapies for the cancer
  • a reference value can also comprise the amounts of DETERMINANTS derived from subjects who have confirmed disease by known
  • the reference value is an index value or a baseline value
  • An index value or baseline value is a composite sample of an effective amount of DETERMINANTS from one or more subjects who do not have metastatic tumor, or subjects who are asymptomatic a metastatic
  • a baseline value can also comprise the amounts of DETERMINANTS in a sample derived from a subject who has shown an improvement in metastatic tumor risk factors as a result of cancer treatments or therapies
  • the amounts of DETERMINANTS are similarly calculated and compared to the index value
  • subjects identified as having metastatic tumor, or being at increased risk of developing a metastatic tumor are chosen to receive a therapeutic regimen to slow the progression the cancer, or decrease or prevent the risk of developing a metastatic tumor
  • the progression of a metastatic tumor, or effectiveness of a cancer treatment regimen can be monitored by detecting a DETERMINANT in an effective amount (which may be two or more) of samples obtained from a subject over time and comparing the amount of DE
  • the cancer is considered to be progressive (or, alternatively, the treatment does not prevent progression) if the amount of DETERMINANT changes over time relative to the reference value, whereas the cancer is not progressive if the amount of DETERMINANTS remains constant over time (relative to the reference population, or "constant” as used herein)
  • the term "constant” as used in the context of the present invention is construed to include changes over time with respect to the reference value
  • the methods of the invention can be used to discriminate the aggressiveness/ and or accessing the stage of the tumor (e g Stage I, II, II or IV) This will allow patients to be stratified into high or low risk groups and treated accordingly
  • therapeutic or prophylactic agents suitable for administration to a particular subject can be identified by detecting a DETERMINANT in an effective amount (which may be two or more) in a sample obtained from a subject, exposing the subject-derived sample to a test compound that determines the amount (which may be two or more) of DETERMINANTS in the subject derived sample
  • treatments or therapeutic regimens for use in subjects having a cancer, or subjects at risk for developing metastatic tumor can be selected based on the amounts of DETERM ⁇ NANTS in samples obtained from the subjects and compared to a reference value
  • Two or more treatments or therapeutic regimens can be evaluated in parallel to determine which treatment or therapeutic regimen would be the most efficacious for use in a subject to delay onset, or slow progression of the cancer
  • the present invention further provides a method for screening for changes in marker expression associated with a metastatic tumor, by determining the amount (which may be two or more) of DETERMINANTS in a subject- derived sample, comparing the amounts of the DETERMINANTS in a reference sample, and identifying alterations in amounts in the subject sample compared to the reference sample [00086]
  • the present invention further provides a method of treating a patient with a tumor, by identifying a patient with a tumor where an effective amount of DETERMINANTS are altered in a clinically significant manner as measured in a sample
  • the invention provides a method of selecting a tumor patient in need of adjuvant treatment by assessing the ⁇ sk of metastasis in the patient by measuring an effective amount of DETERMINANTS where a clinically significant alteration two or more DETERMINANTS in a tumor sample from the patient indicates that the patient is in need of adjuvant treatment
  • the reference sample e g , a control sample
  • a similarity in the amount of the DETERMINANT in the test sample and the reference sample indicates that the treatment is efficacious
  • a difference in the amount of the DETERMINANT in the test sample and the reference sample indicates a less favorable clinical outcome or prognosis
  • Efficacious it is meant that the treatment leads to a decrease in the amount or activity of a DETERMINANT protein, nucleic acid, polymorphism, metabolite, or other analyte Assessment of the risk factors disclosed herein can be achieved using standard clinical protocols Efficacy can be determined in association with any known method for diagnosing, identifying, or treating anmetastatic disease
  • the present invention also provides DETERMINANT panels including one or more DETERMINANTS that are indicative of a general physiological pathway associated with a metastatic For example, one or more DETERMINANTS that can be used to exclude or distinguish between different disease states or sequelae associated with metastatis A single DETERMINANT may have several of the aforementioned characteristics according to the present invention, and may alternatively be used in
  • the present invention also comprises a kit with a detection reagent that binds to two or more DETERMINANT proteins, nucleic acids, polymorphisms, metabolites, or other analytes.
  • a detection reagent that binds to two or more DETERMINANT proteins, nucleic acids, polymorphisms, metabolites, or other analytes.
  • an array of detection reagents e.g , antibodies and/or oligonucleotides that can bind to two or more DETERMINANT proteins or nucleic acids, respectively.
  • the DETERMINANT are proteins and the array contains antibodies that bind an effective amount of DETERMINANTS 1-360 sufficient to measure a statistically significant alteration in DETERMINANT expression compared to a reference value.
  • the DETERMEMANTS are nucleic acids and the array contains oligonucleotides or aptamers that bind an effective amount of DETERMINANTS 1-360 sufficient to measure a statistically significant alteration in DETERMINANT expression compared to a reference value
  • the DETERMINANT are proteins and the array contains antibodies that bind an effective amount of DETERMINANTS 1-25, 41,61, 62, 63, 66, 74, 96, 99, 103, 126, 135, 137, 138, 177, 190, 210, 212, 217, 218, 227, 239, 261, and 271 sufficient to measure a statistically significant alteration in DETERMINANT expression compared to a reference value
  • the DETERMEMANTS are nucleic acids and the array contains oligonucleotides or aptamers that bind an effective amount of DETERMINANTS 1-25, 41 ,61 , 62, 63, 66, 74, 96, 99, 103, 126, 135, 137, 138, 177, 190, 210, 212, 217, 218, 227, 239, 261 , and 271 sufficient to measure a statistically significant alteration in DETERMINANT expression compared to
  • Also provided by the present invention is a method for treating one or more subjects at risk for developing a metasatic tumor by detecting the presence of altered amounts of an effective amount of DETERMINANTS present in a sample from the one or more subjects, and treating the one or more subjects with one or more cancer- modulating drugs until altered amounts or activity of the DETERMINANTS return to a baseline value measured in one or more subjects at low risk for developing a metastatic
  • Also provided by the present invention is a method for treating one or more subjects having metastatic tumor by detecting the presence of altered levels of an effective amount of DETERMINANTS present in a sample from the one or more subjects; and treating the one or more subjects with one or more cancer-modulatmg drugs until altered amounts or activity of the DETERMINANTS return to a baseline value measured in one or more subjects at low risk for developing metastatic tumor.
  • Also provided by the present invention is a method for evaluating changes in the risk of developing a metastatic tumor in a subject diagnosed with cancer, by detecting an effective amount of DETERMINANTS (which may be two or more) in a first sample from the subject at a first period of time, detecting the amounts of the DETERMINANTS in a second sample from the subject at a second period of time, and comparing the amounts of the DETERMINANTS detected at the first and second periods of time.
  • 00098] The invention allows the diagnosis and prognosis of a metatstatic tumor.
  • the risk of developing a metastatic tumor can be detected by measuring an effective amount of DETERMINANT proteins, nucleic acids, polymorphisms, metabolites, and other analytes (which may be two or more) in a test sample (e.g , a subject derived sample), and comparing the effective amounts to reference or index values, often utilizing mathematical algorithms or formula in order to combine information from results of multiple individual DETERMINANTS and from non-analyte clinical parameters into a single measurement or index.
  • Subjects identified as having an increased risk of an a metastatic tumor can optionally be selected to receive treatment regimens, such as administration of prophylactic or therapeutic compounds to prevent or delay the onset of a metastatic tumor.
  • the amount of the DETERMINANT protein, nucleic acid, polymorphism, metabolite, or other analyte can be measured in a test sample and compared to the "normal control level," utilizing techniques such as reference limits, discrimination limits, or risk defining thresholds to define cutoff points and abnormal values.
  • the "normal control level” means the level of one or more DETERMINANTS or combined
  • the normal control level can be a database of DETERMINANT patterns from previously tested subjects who did not develop a ametastatic tumor over a clinically relevant time horizon 1000100]
  • the present invention may be used to make continuous or categorical measurements of the risk of conversion to a metastatic tumor, thus diagnosing and defining the risk spectrum of a category of subjects defined as at risk for having a metastatic event
  • the methods of the present invention can be used to discriminate between normal and disease subject cohorts
  • the present invention may be used so as to discriminate those at risk for having a metastatic event from those having more rapidly progressing (or alternatively those with a shorter probable time horizon to anmetastatic event) to a metastatic event from those more slowly progressing (or with
  • Identifying the subject at risk of having a metastatic event enables the selection and initiation of various therapeutic interventions or treatment regimens in order to delay, reduce or prevent that subject's conversion to a metastatic disease state
  • Levels of an effective amount of DETERMINANT proteins, nucleic acids, polymorphisms, metabolites, or other analytes also allows for the course of treatment of a metastatic disease or metastatic event to be monitored
  • a biological sample can be provided from a subject undergoing treatment regimens, e g , drug treatments, for cancer If desired, biological samples are obtained from the subject at various time points before, during, or after treatment
  • the present invention can also be used to screen patient or subject populations in any number of settings
  • a health maintenance organization, public health entity or school health program can screen a group of subjects to identify those requiring interventions, as described above, or for the collection of epidemiological data Insurance companies (e g , health, life or disability) may screen applicants in the process of determining coverage or pricing, or existing clients for possible intervention
  • Data collected in such population screens, particularly when tied to any clinical progession to conditions like cancer or metastatic events, will be of value in the operations of, for example, health maintenance organizations, public health programs and insurance companies
  • Such data arrays or collections can be stored in machine-readable media and used in any number of health-related data management systems to
  • 29 be, for example, a personal computer, microcomputer, or workstation of conventional design
  • Each program can be implemented in a high level procedural or object oriented programming language to communicate with a computer system
  • the programs can be implemented in assembly or machine language, if desired
  • the language can be a compiled or interpreted language
  • Each such computer program can be stored on a storage media or device (e g , ROM or magnetic diskette or others as defined elsewhere in this disclosure) readable by a general or special purpose programmable computer, for configuring and operating the computer when the storage media or device is read by the computer to perform the procedures described herein
  • the health-related data management system of the invention may also be considered to be implemented as a computer-readable storage medium, configured with a computer program, where the storage medium so configured causes a computer to operate in a specific and predefined manner to perform various functions described herein
  • Levels of an effective amount of DETERMINANT proteins, nucleic acids, polymorphisms, metabolites, or other analytes can then be determined and compared to a reference value, e g a control subject or population whose metastatic state is known or an index value or baseline value
  • the reference sample or index value or baseline value may be taken or derived from one or more subjects who have been exposed to the treatment, or may be taken or derived from one or more subjects who are at low risk of developing cancer or a metstatic event, or may be taken or derived from subjects who have shown improvements in as a result of exposure to treatment
  • the reference sample or index value or baseline value may be taken or derived from one or more subjects who have not been exposed to the treatment
  • samples may be collected from subjects who have received initial treatment for caner or a metastatic event and subsequent treatment for cancer or a metastatic event to monitor the progress of the treatment
  • a reference value can also comprise a value derived from risk prediction algorithms or computed indices from population studies such as those disclosed herein 1000107
  • the DETERMINANTS disclosed herein can also be used to generate a "subject DETERMINANT profile" taken from subjects who have cancer or are at risk for having a metastatic event.
  • the subject DETERMINANT profiles can be compared to a reference DETERMINANT profile to diagnose or identify subjects at risk for developing cancer or a metastatic event, to monitor the progression of disease, as well as the rate of progression of disease, and to monitor the effectiveness of treatment modalities.
  • the reference and subject DETERMINANT profiles of the present invention can be contained in a machine-readable medium, such as but not limited to, analog tapes like those readable by a VCR, CD-ROM, DVD-ROM, USB flash media, among others
  • a machine-readable medium such as but not limited to, analog tapes like those readable by a VCR, CD-ROM, DVD-ROM, USB flash media, among others
  • Such machine -readable media can also contain additional test results, such as, without limitation, measurements of clinical parameters and traditional laboratory risk factors.
  • the machine-readable media can also comprise subject information such as medical history and any relevant family history.
  • the machine- readable media can also contain information relating to other disease-risk algorithms and computed indices such as those described herein.
  • Differences in the genetic makeup of subjects can result in differences in their relative abilities to metabolize various drugs, which may modulate the symptoms or risk factors of cancer or metastatic events.
  • Subjects that have cancer, or at risk for developing cancer or a metastatic event can vary in age, ethnicity, and other parameters Accordingly, use of the DETERMINANTS disclosed herein, both alone and together in combination with known genetic factors for drug metabolism, allow for a pre-determined level of predictability that a putative therapeutic or prophylactic to be tested in a selected subject will be suitable for treating or preventing cancer or a metastatic event in the subject.
  • a test sample from the subject can also be exposed to a therapeutic agent or a drug, and the level of one or more of DETERMINANT proteins, nucleic acids, polymorphisms, metabolites or other analytes can be determined.
  • the level of one or more DETERMINANTS can be compared to sample derived from the subject before and after treatment or exposure to a therapeutic agent or a drug, or can be compared to samples derived from one or more subjects who have shown improvements in risk factors (e g.,
  • a subject cell i e , a cell isolated from a subject
  • a candidate agent can be incubated in the presence of a candidate agent and the pattern of DETERMINANT expression in the test sample is measured and compared to a reference profile, e g , a metastatic disease reference expression profile or a non- disease reference expression profile or an index value or baseline value
  • the test agent can be any compound or composition or combination thereof, including, dietary supplements
  • the test agents are agents frequently used in cancer treatment regimens and are described herein
  • the aforementioned methods of the invention can be used to evaluate or monitor the progression and/or improvement of subjects who have been diagnosed with a cancer, and who have undergone surgical interventions [000112]
  • Performance and Accuracy Measures of the Invention [000113] The performance and thus absolute and relative clinical usefulness of the invention may be assessed in multiple ways as noted above Amongst the various assessments of performance, the invention is intended to provide accuracy in clinical diagnosis and prognosis The accuracy of a diagnostic or prognostic test, assay
  • an "acceptable degree of diagnostic accuracy” is herein defined as a test or assay (such as the test of the invention for determining the clinically significant presence of DETERMINANTS, which thereby indicates the presence of cancer and/or a risk of having a metastatic event) in which the AUC (area under the ROC curve for the test or assay) is at least 0 60, desirably at least 0 65, more desirably at least 0 70, preferably at least 0.75, more preferably at least 0 80, and most preferably at least 0 85 1000116]
  • a "very high degree of diagnostic accuracy” it is meant a test or assay in which the AUC (area under the ROC curve for the test or assay) is at least 0 75, 0 80, desirably at least 0 85, more desirably at least 0.875, preferably at least 0.90, more preferably at
  • the methods predict the presence or absence of a cancer, metastatic cancer or response to therapy with at least 75% accuracy, more preferably 80%, 85%, 90%, 95%, 97%, 98%, 99% or greater accuracy.
  • ROC and AUC can be misleading as to the clinical utility of a test in low disease prevalence tested populations (defined as those with less than 1 % rate of occurrences (incidence) per annum, or less than 10% cumulative prevalence over a specified time horizon)
  • absolute risk and relative risk ratios as defined elsewhere in this disclosure can be employed to determine the degree of clinical utility Populations of subjects to be tested can also be categorized into quartiles by the test's measurement values, where the top quartile (25% of the population) comprises the group of subjects with the highest relative risk for developing cancer or metastatic event, and the bottom quartile comprising the group of subjects having the lowest relative risk for developing cancer or a metastatic event
  • values derived from tests or assays having over 2 5 times the relative risk from top to bottom quartile in a low prevalence population are considered to have a "high degree of diagnostic accuracy," and those with five to seven times the relative risk for each quartile are considered to have a "very high degree of diagnostic accuracy " Nonetheless,
  • a health economic utility function is an yet another means of measuring the performance and clinical value of a given test, consisting of weighting the potential categorical test outcomes based on actual measures of clinical and economic value for each Health economic performance is closely related to accuracy, as a health economic utility function specifically assigns an economic value for the benefits of correct classification and the costs of misclassification of tested subjects As a performance
  • diagnostic accuracy is commonly used for continuous measures, when a disease category or risk category (such as those ati risk for having anmetastatic event) has not yet been clearly defined by the relevant medical societies and practice of medicine, where thresholds for therapeutic use are not yet established, or where there is no existing gold standard for diagnosis of the pre-disease
  • measures of diagnostic accuracy for a calculated index are typically based on curve fit and calibration between the predicted continuous value and the actual observed values (or a historical index calculated value) and utilize measures such as R squared, Hosmer- Lemeshow P- value statistics and confidence intervals.
  • ROC curve defining an acceptable AUC value, and determining the acceptable ranges in relative concentration of what constitutes an effective amount of the DETERMINANTS of the invention allows for one of skill in the art to use the DETERMINANTS to identify, diagnose, or prognose subjects with a pre-determmed level of predictability and performance.
  • biomarkers and methods of the present invention allow one of skill in the art to identify, diagnose, or otherwise assess those subjects who do not exhibit any symptoms of cancer or a metastatic event, but who nonetheless may be at risk for developing cancer or a metastatic event
  • biomarkers [000125] One thousand five hundred and ninety-three biomarkers have been identified as being found to have altered or modified presence or concentration levels in subjects who have metastatic disease.
  • Table I comprises the three hundred and sixty (360) overexpressed/amplified or downregulated/deleted phentotype driven evoluntionary-concernved DETERMINANTS of the present invention.
  • Table I comprises the three hundred and sixty (360) overexpressed/amplified or downregulated/deleted phentotype driven evoluntionary-concernved DETERMINANTS of the present invention.
  • DETERMINANTS encompasses all forms and variants, including but not limited to, polymorphisms, isoforms, mutants, derivatives, precursors including nucleic acids and pro-proteins, cleavage products, receptors (including soluble and transmembrane receptors), ligands,protein-ligand complexes, and post-translationally modified variants (such as cross-linking or glycosylation), fragments, and degradation products, as well as any multi-unit nucleic acid, protein, and glycoprotein structures comprised of any of the DETERMINANTS as constituent sub-units of the fully assembled structure.
  • DETERMINANTS come from a diverse set of physiological and biological pathways, including many which are not commonly accepted to be related to metastatic disease These groupings of different DETERMINANTS, even withm those high significance segments, may presage differing signals of the stage or rate of the progression of the disease Such distinct groupings of DETERMINANTS may allow a more biologically detailed and clinically useful signal from the DETERMINANTS as well as opportunities for pattern recognition within the DETERMINANT algorithms combining the multiple DETERMINANT signals [000130]
  • the present invention concerns, in one aspect, a subset of DETERMINANTS other DETERMINANTS and even biomarkers which are not listed in the above Table 1 , but related to these physiological and biological pathways, may prove to be useful given the signal and information provided from these studies To the extent that other biomarker pathway participants (i e , other biomarker participants in common pathways with those biomarkers contained within the list of DETERMINANTS in the above Table 1) are also relevant pathway participants in
  • biomarkers will be very highly correlated with the biomarkers listed as DETERMINANTS in Table 1 (for the purpose of this application, any two variables will be considered to be "very highly correlated" when they have a Coefficient of Determination (R ) of 0.5 or greater).
  • the present invention encompasses such functional and statistical equivalents to the aforementioned DETERMINANTS .
  • the statistical utility of such additional DETERMINANTS is substantially dependent on the cross-correlation between multiple biomarkers and any new biomarkers will often be required to operate within a panel in order to elaborate the meaning of the underlying biology.
  • One or more, preferably two or more of the listed DETERMINANTS can be detected in the practice of the present invention. For example, two (2), three (3), four (4), five (5), ten (10), fifteen (15), twenty (20), forty (40), fifty (50), seventy-five (75), one hundred (100), one hundred and twenty five (125), one hundred and fifty (150), one hundred and seventy-five (175), two hundred (200), two hundred and ten (210), two hundred and twenty (220), two hundred and thirty (230), two hundred and forty (240), two hundred and fifty (250), two hundred and sixty (260) or more, two hundred and seventy (270) or more, two hundred and eighty (280) or more, two hundred and ninety (290) or more, DETERMINANTS can be detected.
  • all 360 DETERMINANTS listed herein can be detected.
  • Preferred ranges from which the number of DETERMINANTS can be detected include ranges bounded by any minimum selected from between one and 360, particularly two, five, ten, twenty, fifty, seventy-five, one hundred, one hundred and twenty five, one hundred and fifty, one hundred and seventy-five, two hundred, two hundred and ten, two hundred and twenty, two hundred and thirty, two hundred and forty, two hundred and fifty, paired with any maximum up to the total known DETERMINANTS, particularly five, ten, twenty, fifty, and seventy-five.
  • Particularly preferred ranges include two to five (2-5), two to ten (2-10), two to fifty (2-50), two to seventy-five (2-75), two to one hundred (2-100), five to ten (5-10), five to twenty (5-20), five to fifty (5-50), five to seventy-five (5-75), five to one hundred (5-100), ten to twenty (10-20), ten to fifty (10- 50), ten to seventy-five (10-75), ten to one hundred (10-100), twenty to fifty (20-50), twenty to seventy- five (20-75), twenty to one hundred (20-100), fifty to seventy-five (50-
  • Groupings of DETERMINANTS can be included in “panels " A "panel” withm the context of the present invention means a group of biomarkers (whether they are DETERMINANTS, clinical parameters, or traditional laboratory risk factors) that includes more than one DETERMINANT
  • a panel can also comprise additional biomarkers, e g , clinical parameters, traditional laboratory risk factors, known to be present or associated with cancer or cancer metastatis, in combination with a selected group of the DETERMINANTS listed in Table 1
  • the suboptimal performance in terms of high false positive rates on a single biomarker measured alone may very well be an indicator that some important additional information is contained within the biomarker results - information which would not be elucidated absent the combination with a second biomarker and a mathematical formula.
  • formula such as statistical classification algorithms can be directly used to both select DETERMINANTS and to generate and tram the optimal formula necessary to combine the results from multiple DETERMINANTS into a single index
  • techniques such as forward (from zero potential explanatory parameters) and backwards selection (from all available potential explanatory parameters) are used, and information criteria, such as AIC or BIC, are used to quantify the tradeoff between the performance and diagnostic accuracy of the panel and the number of DETERMINANTS used
  • information criteria such as AIC or BIC
  • any formula may be used to combine DETERMINANT results into indices useful in the practice of the invention As indicated above, and without limitation, such indices may indicate, among the various other indications, the probability, likelihood, absolute or relative risk, time to or rate of conversion from one to another disease states, or make predictions of future biomarker measurements of metastatic disease This may be for a specific time period or horizon, or for remaining lifetime risk, or simply be provided as an index relative to another reference subject population [000143] Although various preferred formula are described here, several other model and formula types beyond those mentioned herein and in the definitions above are well known to one skilled in the art The actual model type or formula used may itself be selected from the field of potential models based on the performance and diagnostic accuracy characteristics of its results in a training population The specifics of the formula itself may commonly be derived from DETERMINANT results in the relevant training population Amongst other uses, such formula may be intended to map the
  • Preferred formulas include the broad class of statistical classification algorithms, and in particular the use of discriminant analysis.
  • the goal of discriminant analysis is to predict class membership from a previously identified set of features
  • LDA linear discriminant analysis
  • features can be identified for LDA using an eigengene based approach with different thresholds (ELDA) or a stepping algorithm based on a multivariate analysis of variance (MANOVA). Forward, backward, and stepwise algorithms can be performed that minimize the probability of no separation based on the Hotellmg-Lawley statistic.
  • ELDA Eigengene -based Linear Discriminant Analysis
  • the formula selects features (e.g. biomarkers) in a multivariate framework using a modified eigen analysis to identify features associated with the most important eigenvectors "Important" is defined as those eigenvectors that explain the most variance in the differences among samples that are trying to be classified relative to some threshold.
  • a support vector machine is a classification formula that attempts to find a hyperplane that separates two classes This hyperplane contains support vectors, data points that are exactly the margin distance away from the hyperplane In the likely event that no separating hyperplane exists in the current dimensions of the data, the dimensionality is expanded greatly by projecting the data into larger dimensions by taking non- linear functions of the original variables (Venables and Ripley, 2002). Although not required, filtering of features for SVM often improves prediction.
  • Features e.g., biomarkers
  • KW non-parametric Kruskal-Walhs
  • a random forest RF, Breiman, 2001
  • RPART recursive partitioning
  • a further modification is to adjust for smaller sub-populations of the study based on the output of the classifier or risk formula and defined and selected by their Clinical Parameters, such as age or sex 1000149] Combination with Clinical Parameters and Traditional Laboratory Risk Factors
  • any of the aforementioned Clinical Parameters may be used in the practice of the invention as aDETERMINANT input to a formula or as a pre selection criteria defining a relevant population to be measured using a particular DETERMINANT panel and formula
  • Clinical Parameters may also be useful in the biomarker normalization and pre-processing, or in DETERMINANT selection, panel construction, formula type selection and derivation, and formula result post-processing
  • a similar approach can be taken with the Traditional Laboratory Risk Factors, as either an input to a formula or as a pre-selection crite ⁇ um 1000151] Measurement of DETERMINANTS
  • the actual measurement of levels or amounts of the DETERMINANTS can be determined at the protein or nucleic acid level using any method known in the art For example, at the nucleic acid level, Northern and Southern hybridization analysis, as well as ⁇ bonuclease protection assays using probes which specifically recognize one or more of these sequences can be used to determine gene expression Alternatively, amounts of DETERMFNANTS can be measured using reverse-transc ⁇ ption-based PCR assays (RT- PCR), e g , using primers specific for the differentially expressed sequence of genes or by branch-chain RNA amplification and detection methods by Panomics, Inc Amounts of DETERMINANTS can also be determined at the protein level, e g , by measuring the levels of peptides encoded by the gene products described herein, or subcellular localization or activities thereof using technological platform such as for example AQUA Such methods are well known in the art and include, e g , immunoassays based on antibodies to proteins encoded by the genes,
  • the DETERMINANT proteins, polypeptides, mutations, and polymorphisms thereof can be detected in any suitable manner, but is typically detected by contacting a sample from the subject with an antibody which binds the DETERMINANT protein, polypeptide, mutation, or polymorphism and then detecting the presence or absence of a reaction product
  • the antibody may be monoclonal, polyclonal, chimeric, or a fragment of the foregoing, as discussed in detail above, and the step of detecting the reaction product may be carried out with any suitable immunoassay
  • the sample from the subject is typically a biological fluid as described above, and may be the same sample of biological fluid used to conduct the method described above
  • Immunoassays carried out in accordance with the present invention may be homogeneous assays or heterogeneous assays
  • the immunological reaction usually involves the specific antibody (e g , anti- DETERMINANT protein antibody), a labeled analyte, and the sample of interest
  • the signal arising from the Label is modified, directly or indirectly, upon the binding of the antibody to the labeled analyte
  • Immunochemical labels which may be employed include free radicals, radioisotopes, fluorescent dyes, enzymes, bacteriophages, or coenzymes
  • the reagents are usually the sample, the antibody, and means for producing a detectable signal Samples as described above may be used
  • the antibody can be immobilized on a support, such as a bead (such as protein A and protein G agarose beads), plate or slide, and contacted with the specimen suspected of containing the antigen in a liquid phase The support is then separated from the liquid phase and either the support phase or the liquid phase is examined for a detectable signal employing means for producing such signal
  • the signal is related to the presence of the analyte in the sample
  • Means for producing a detectable signal include the use of radioactive labels, fluorescent labels, or enzyme labels
  • an antibody which binds to that site can be conjugated to a detectable group and added to the liquid phase reaction solution before the separation step
  • the presence of the detectable group on the solid support indicates the presence of the antigen in the test sample
  • suitable immunoassays are examples of suitable immunoassays.
  • oligonucleotides 52 oligonucleotides, lmmunoblottmg, immunofluorescence methods, lmmunoprecipitation, chemilummescence methods, electrochemilummescence (ECL) or enzyme-linked immunoassays
  • Antibodies can also be useful for detecting post-translational modifications of DETERMFNANT proteins, polypeptides, mutations, and polymorphisms, such as tyrosine phosphorylation, threonine phosphorylation, serine phosphorylation, glycosylation (e g , O GIcNAc)
  • Such antibodies specifically detect the phosphorylated amino acids in a protein or proteins of interest, and can be used in lmmunoblottmg, immunofluorescence, and ELISA assays described herein
  • These antibodies are well- known to those skilled in the art, and commercially available Post-translational modifications can also be determined using metastable ions in reflector matrix-assisted
  • MALDI-TOF laser desorption lomzation-time of flight mass spectrometry
  • the activities can be determined in vitro using enzyme assays known in the art
  • enzyme assays include, without limitation, kinase assays, phosphatase assays, reductase assays, among many others
  • Modulation of the kinetics of enzyme activities can be determined by measuring the rate constant K M using known algorithms, such as the Hill plot, Michaelis-Menten equation, linear regression plots such as Lineweaver-Burk analysis, and Scatchard plot
  • sequences within the sequence database entries corresponding to DETERMINANT sequences, or within the sequences disclosed herein can be used to construct probes for detecting DETERMINANT RNA sequences in, e g , Northern blot hybridization analyses or methods which specifically, and, preferably, quantitatively amplify specific nucleic acid sequences
  • sequences can be used to construct primers for specifically amplifying the DETERMINANT sequences m, e g , amplification-based detection methods such as reverse-transcription based polymerase chain reaction (RT-PCR)
  • RT-PCR reverse-transcription based polymerase chain reaction
  • Expression of the genes disclosed herein can be measured at the RNA level using any method known in the art For example, Northern hybridization analysis using probes which specifically recognize one or more of these sequences can be used to determine gene expression Alternatively, expression can be measured using reverse- transc ⁇ ption-based PCR assays (RT-PCR), e g , using primers specific for the differentially expressed sequences RNA can also be quantified using, for example, other target amplification methods (e g , TMA, SDA, NASBA), or signal amplification methods (e g , bDNA), and the like
  • DETERMINANT protein and nucleic acid metabolites can be measured.
  • the term "metabolite” includes any chemical or biochemical product of a metabolic process, such as any compound produced by the processing, cleavage or consumption of a biological molecule (e g., a protein, nucleic acid, carbohydrate, or lipid).
  • Metabolites can be detected in a variety of ways known to one of skill in the art, including the refractive index spectroscopy (RI), ultra-violet spectroscopy (UV), fluorescence analysis, radiochemical analysis, near-mfrared spectroscopy (near-IR), nuclear magnetic resonance spectroscopy (NMR), light scattering analysis (LS), mass spectrometry, pyrolysis mass spectrometry, nephelometry, dispersive Raman spectroscopy, gas chromatography combined with mass spectrometry, liquid chromatography combined with mass spectrometry, matrix- assisted laser desorption ionization-time of flight (MALDI-TOF) combined with mass spectrometry, ion spray spectroscopy combined with mass spectrometry, capillary electrophoresis, NMR and IR detection.
  • RI refractive index spectroscopy
  • UV ultra-violet spectroscopy
  • fluorescence analysis radiochemical analysis
  • radiochemical analysis near-mfrared
  • DETERMINANT analytes can be measured using the above-mentioned detection methods, or other methods known to the skilled artisan.
  • circulating calcium ions Ca 2+
  • fluorescent dyes such as the Fluo series, Fura-2A, Rhod-2, among others.
  • Other DETERMINANT metabolites can be similarly detected using reagents that are specifically designed or tailored to detect such metabolites.
  • the invention also includes a DETERMINANT-detection reagent, e.g., nucleic acids that specifically identify one or more DETERMINANT nucleic acids by having homologous nucleic acid sequences, such as oligonucleotide sequences, complementary to a portion of the DETERMINANT nucleic acids or antibodies to proteins encoded by the DETERMINANT nucleic acids packaged together in the form of a kit.
  • the oligonucleotides can be fragments of the DETERMINANT genes.
  • the oligonucleotides can be 200, 150, 100, 50, 25, 10 or less nucleotides in length.
  • the kit may contain in separate containers a nucleic acid or antibody (either already bound to a solid matrix or packaged separately with reagents for binding them to the matrix), control formulations (positive and/or negative), and/or a detectable label such
  • DETERMINANT detection reagents can be immobilized on a solid matrix such as a porous strip to form at least one DETERMINANT detection site
  • the measurement or detection region of the porous strip may include a plurality of sites containing a nucleic acid
  • a test strip may also contain sites for negative and/or positive controls Alternatively, control sites can be located on a separate strip from the test strip
  • the different detection sites may contain different amounts of immobilized nucleic acids, e g , a higher amount in the first detection site and lesser amounts in subsequent sites Upon the addition of test sample,
  • Suitable sources for antibodies for the detection of DETERMINANTS includecommercially available sources such as, for example, Abazyme, Abnova, Affinity Biologicals, AntibodyShop, Biogenesis, Biosense Laboratories, Calbiochem, Cell Sciences, Chemicon International, Chemokme, Clontech, Cytolab, DAKO, Diagnostic BioSystems, eBioscience, Endocrine Technologies, Enzo Biochem, Eurogentec, Fusion Antibodies, Genesis Biotech, GloboZymes, Haematologic Technologies, Immunodetect,
  • nucleic acid probes e g , oligonucleotides, aptamers, siRNAs, antisense oligonucleotides, against any of the DETERMINANTS in Table 1.
  • MET transgenic mice were fed doxycycline in drinking water (2ug/ml in sucrose water) at weaning age and observed for spontaneous tumor development. A subset of animals (3-wks) were anesthetized
  • Cell culture Melanoma cell lines were derived from mouse tumors by digestion with collagenase + Hyaluronidase (2 mg/ml; Sigma) for 2 hours followed by cultivation with RPMI 1640 media (Gibco BRL) containing 10% FBS and 1% penicillin/streptomycin.
  • Melanocyte cultures were generated from newborn mouse epidermis as described and maintained in RPMI 1640 containing 5% FBS, 1% pemcillin/streptomycm, 200 pM cholera toxin, 200 nM 12-Otetradecanoylphorbol- 13- acetate (TPA).
  • Transgenic c-Met expression was induced in cultured cells by the addition of doxycyclme at 2 ug/ml.
  • M3 BRAF melanocytes, HMEL468 primed melanocytes, WM3211 and WMl 15 were maintained in RPMI 1640 containing 10% FBS, 1% penicillin/streptomycin.
  • HMEL468 identifies a subclone of PMEL/hTERT/CDK4(R24C)/p53DD/BRAF v600E cells as described in Garraway et al ⁇ [000173] Histological analysis and immunohistochemical staining.
  • mice were sacrificed according to institute guidelines and organs were fixed in 10% buffered formalin and paraffin embedded Tissue sections were stained with H&E to enable classification of the lesions and detection of tumor metastasis.
  • tumor samples were immunostamed with total c-Met and phospho c-Met (Tyrl349) antibodies from Cell Signaling Technology Tumors were immunostamed with SlOO antibody from Sigma
  • Ribosomal protein Rl 5 was used as an internal expression control
  • Primer sequences are as follows c-Met 5'-TCTGTTGCCATCCCAAGACAACATTGATGG 5 S '- AAATCTCTGGAGGAGGTTGG, HGF 5 '-CAAGGCCAAGGAGAAGGTTA, 5'- TTTGAAGTTCTCGGGAGTGA, Tyr 5 '-CCAGAAGCCAATGCACCTAT ⁇ '- AGCAATAACAGCTCCCACCA, TRPl 5'-ATTCTGGCCTCCAGTTACCA, 5' GGCTTCATTCTTGGTGCTTC, DCT 5'-AACAACCCTTCCACAGATGC, 5'- TCTCCATTAAGGGCGCATAG, Rl 5 5'-CTTCCGCAAGTTCACCTACC, reverse
  • 96-well viral production, transduction and transwell invasion assays Approximately 3xlO 4 293T cells were seeded in 100 ul per each well in 96-well flat bottom plates 24 hrs prior to transfection (-90% confluent) in DMEM + 10%FBS (antibiotic)
  • 150 ng viral backbone and 110 ng lentiviral packaging vectors were diluted to 15 ul using Opti MEM (Invitrogen)
  • the resulting vector mix was combined with 15 ul Opti-MEM containing 0 6 ul Liptofectamine2000 (Invitrogen), incubated RT for 20 mm and added to the 100 ul media covering the 293T cells
  • the media was replaced with DMEM + 10%FBS + P/S approximately 10 hrs post- transfection, and 4 viral supernatant collections were taken starting at 36 hrs post transfection and combined 150 ul viral supernatant containing 8 ug/ml polybrene was
  • Transwell invasion assays Standard 24-well invasion chambers (BD Biosciences) were utilized to assess invasiveness following the manufacture's suggestions Briefly, cells were trypsinized, rinsed twice with PBS, resuspended in serum-free RPMI 1640 media, and seeded at 7.5x10 4 cells/well for HMEL468, 2.OxIO 4 for WM321 1 and 5.0x10 for WMl 15.
  • Chambers were seeded in triplicate or quadruplicate and placed in 10% serum-containmg media as a chemo-attractant as well as in cell culture plates in duplicate as input controls Following 22 hrs incubation, chambers were fixed in 10% formalin, stained with crystal violet for manual counting or by pixel quantitation with Adobe Photoshop (Adobe). Data was normalized to input cells to control for differences in cell number (loading control).
  • a validated shRNA construct targeting SMAD3 pSUPER-shSMAD3
  • virus was generated using standard retrovirus production protocols
  • Control cells were transduced with non-targeting shRNA (pSUPER-shNT) in parallel for invasion comparison.
  • HMEL468 cells were stably transduced with either GFP or HOXAl virus.
  • cells were implanted in bi-fianks of CB-17-scid (C.B-Igh-lb/lcrJac-Prkdcscid; Taconic) mice at IXl O 6 cells/site subcutaneously.
  • CB-Igh-lb/lcrJac-Prkdcscid; Taconic mice IXl O 6 cells/site subcutaneously.
  • OXlO 5 cells were injected into the tail vein of CB- 17-scid mice. All animals were monitored for tumor development, followed by necropsy and tumor histological analysis.
  • TGF ⁇ reporter assay Cells were seeded at 2X10 5 cells per well in triplicate in 6 well plates 24 hours before transfection with the p3TPLux reporter (lug per well) and control reporter (Renilla, 20 ng per well). Following 24hrs of incubation, cells were
  • TGF ⁇ (20 ng/ml, R&D Systems) and were subjected to luciferase analysis (Promega) following manufacture's protocol using a Lumat LB9507 Lummometer to access reporter activation as indicated by the firefly/Renilla ratio p- values were calculated using two-tailed T test
  • RNA-based expression assay by Panomics technology As an alternative to protein-based expression analysis, QuantiGene Plex technology (Panomics) was also utilized o assess the RNA expression of PDs
  • the QuantiGene platform is based on the branched DNA technology, a sandwich nucleic acid hybridization assay that provides a unique approach for RNA detection and quantification by amplifying the reporter signal rather than the sequence (Flagella, M , Bui, S , Zheng, Z , Nguyen, C T , Zhang, A , Pastor, L , Ma, Y., Yang, W , Crawford, K.L., McMaster, G K.
  • EXAMPLE 2 IDENTIFICATION OF A PHENOTYPE-DR ⁇ VEN EVOLUTIONARILY CONSERVED METASTASIS SIGNATURE
  • GEM Genetically-engineered mouse
  • iMet melanoma cells show robust invasion activity in transwell chamber invasion assays in response to recombinant HGF (Fig. 2A). Consistent with activation of HGF-MET signaling in advanced metastatic melanoma in human , iMet melanomas in de novo transgenic animals uniformly metastasize to the lymph nodes in addition to occasional dissemination to the adrenal glands and lung parenchyma, each common sites of metastatic seeding in human melanoma and (Fig. 2B).
  • IPA Ingenuity Pathway Analysis
  • EXAMPLE 4 PROGRESSION-CORRELATION OF EXPRESSION IN HUMAN
  • TMAs tissue microarrays
  • EXAMPLE 5 METASTASIS DETERMINANTS ARE NON-LINEAGE SPECIFIC
  • breast cancer transcriptome dataset included probes for 19 of the 20 metastasis determinants, which were used as signature to stratify a cohort of 295 breast tumors by k-means unsupervised classification algorithm (Fig. 5A; Table 7).
  • EXAMPLE 6 IDENTIFCATION OF GENES THAT CONFER ANOIKIS RESISTANCE 1000199] Metastasis is a complex, multi-step process ( Gupta, G P , and Massague, J (2006) Cancer metastasis building a framework Cell 127, 679-69) In order for full metastasis to occur tumor cells must be able to proliferate at the primary tumor site, intravasate into the circulatory or lymphatic system, survive while in circulation, extravasate and form a secondary tumor To accomplish this, circulating tumor cells must be able to overcome anoikis, or apoptosis induced by loss of matrix attachment (Simpson, C D , Anyiwe, K , and Schimmer, A D (2008) Anoikis resistance and tumor metastasis Cancer Lett 272, 177-185) In order to identify genes that confer anoikis resistance to anoikis sensitive cells, we optimized an in vitro screen for anoikis sensitivity (Figure 6A) We hypothesized that
  • RIE rat intestinal epithelial
  • Figure 6B Douma, S , Van Laar, T., Zevenhoven, J., Meu Giveaway, R., Van Garderen, E., and Peeper, D. S. (2004) Suppression of anoikis and induction of metastasis by the neurotrophic receptor TrkB. Nature 430, 1034-1039.
  • RIE cells are immortalized but not transformed cell line. Cells undergoing anoikis initiate apoptotic pathways, while those that are viable upon loss of attachment demonstrate anoikis resistance. Therefore, we measured ATP generation, indicative of cellular metabolism, as a quantifiable and sensitive measure of cell viability.
  • 293T cells were plated on 6-well plates and co-transfected with MSCV/V5 containing one ORF and the packaging vector, pCL-Eco ( Figure 6A).
  • Cells were transfected with Lipofectamine 2000 (Invitrogen) and virus was harvested at multiple time points RIE cells were plated on 6-well and 24hr after plating were serially infected with 48hr and 72hr viral supernatant.
  • RIE were harvested 24hr after final infection and after generation of smgle-cell suspension, 7000 cells/well were plated m triplicate on 96-well ULC plates (time Ohr).
  • TrkB The neurotrophic receptor TrkB has been shown to confer anoikis resistance in vitro to anoikis sensitive cells and promote tumor formation and lung seeding in vivo (3)
  • TrkB murine TrkB
  • TrkB human ligand to TrkB
  • BDNF human ligand to TrkB
  • Figure 7 an average of 21% of genes conferred greater than 1
  • EXAMPLE 7 METASTASIS DETERMINANTS ARE ONCOGENIC 1000206. Since metastasis determinants are acquired early in the transformation process and pre-existing in primary tumors, it has been postulated that these metastasis genes might also be bona fide cancer genes that provide a proliferative advantage to the primary tumors . To address this, we asked whether these metastasis determinants could confer frank tumorigenicity to TERT-immortalized melanocytes, HMEL468.
  • metastasis determinants that are both active drivers of invasion and bona fide oncogenes.
  • metastasis determinants discovered in the context of melanoma, proved prognostic in early stage breast adenocarcinomas and showed progression- correlated expression in diverse non-melanoma tumor types.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Cell Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2009/048862 2008-06-26 2009-06-26 Signatures and determinants associated with metastasis methods of use thereof Ceased WO2009158620A2 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
AU2009262022A AU2009262022A1 (en) 2008-06-26 2009-06-26 Signatures and determinants associated with metastasis and methods of use thereof
MX2010014280A MX2010014280A (es) 2008-06-26 2009-06-26 Distintivos y determinantes asociados con metástasis y método para utilizarlos.
JP2011516713A JP2011526693A (ja) 2008-06-26 2009-06-26 転移に関連する徴候および決定因子、ならびにそれらの使用方法
BRPI0914734A BRPI0914734A2 (pt) 2008-06-26 2009-06-26 assinaturas e determinantes associados com metástase e métodos de uso dos mesmos
NZ590385A NZ590385A (en) 2008-06-26 2009-06-26 Signatures and determinants associated with metastasis and methods of use thereof
US13/001,203 US20110182881A1 (en) 2008-06-26 2009-06-26 Signature and determinants associated with metastasis and methods of use thereof
CA2728674A CA2728674A1 (en) 2008-06-26 2009-06-26 Signatures and determinants associated with metastasis methods of use thereof
CN2009801331437A CN102132160A (zh) 2008-06-26 2009-06-26 与转移有关的信号和决定子以及它们的使用方法及用途
EP09771151A EP2307886A2 (en) 2008-06-26 2009-06-26 Signatures and determinants associated with metastasis and methods of use thereof
IL210245A IL210245A0 (en) 2008-06-26 2010-12-23 Signatures and determinants associated with metastasis methods of use thereof yand
ZA2011/00225A ZA201100225B (en) 2008-06-26 2011-01-07 Signatures and determinants associated with metastasis and methods of use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US7593308P 2008-06-26 2008-06-26
US61/075,933 2008-06-26

Publications (2)

Publication Number Publication Date
WO2009158620A2 true WO2009158620A2 (en) 2009-12-30
WO2009158620A3 WO2009158620A3 (en) 2010-06-03

Family

ID=41445345

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2009/048862 Ceased WO2009158620A2 (en) 2008-06-26 2009-06-26 Signatures and determinants associated with metastasis methods of use thereof

Country Status (14)

Country Link
US (1) US20110182881A1 (https=)
EP (1) EP2307886A2 (https=)
JP (1) JP2011526693A (https=)
KR (1) KR20110036056A (https=)
CN (1) CN102132160A (https=)
AU (1) AU2009262022A1 (https=)
BR (1) BRPI0914734A2 (https=)
CA (1) CA2728674A1 (https=)
IL (1) IL210245A0 (https=)
MX (1) MX2010014280A (https=)
NZ (1) NZ590385A (https=)
RU (1) RU2011102743A (https=)
WO (1) WO2009158620A2 (https=)
ZA (1) ZA201100225B (https=)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013006495A3 (en) * 2011-07-01 2013-04-11 Dana-Farber Cancer Institute, Inc. Methods of predicting prognosis in cancer
US8722660B2 (en) 2010-02-17 2014-05-13 Takeda Pharmaceutical Company Limited Heterocyclic compound
WO2015132672A3 (en) * 2014-03-07 2015-12-17 University Health Network Methods and compositions for detection of targets involved in cancer metastasis
US9605319B2 (en) 2010-08-30 2017-03-28 Myriad Genetics, Inc. Gene signatures for cancer diagnosis and prognosis
US9976188B2 (en) 2009-01-07 2018-05-22 Myriad Genetics, Inc. Cancer biomarkers
US10876164B2 (en) 2012-11-16 2020-12-29 Myriad Genetics, Inc. Gene signatures for cancer prognosis
US10954568B2 (en) 2010-07-07 2021-03-23 Myriad Genetics, Inc. Gene signatures for cancer prognosis
US11174517B2 (en) 2014-05-13 2021-11-16 Myriad Genetics, Inc. Gene signatures for cancer prognosis

Families Citing this family (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100248269A1 (en) * 2009-03-30 2010-09-30 New York Blood Center Detection of fibrin and fibrinogen degradation products and associated methods of production and use for the detection and monitoring of cancer
RU2012157998A (ru) 2010-06-01 2014-07-20 Тодос Медикал Лтд. Диагностика рака
US8880457B2 (en) * 2010-11-05 2014-11-04 Allegheny-Singer Research Institute Method and system for recommending a decision based on combined entity modeling
US9719937B2 (en) 2011-05-11 2017-08-01 Todos Medical Ltd. Diagnosis of cancer
ES2930651T3 (es) 2011-09-06 2022-12-20 Becton Dickinson Co Métodos y composiciones para la detección citométrica de células tumorales circulantes en una muestra
JP6654897B2 (ja) 2012-08-31 2020-02-26 スローン − ケタリング・インスティテュート・フォー・キャンサー・リサーチ 粒子、方法およびその使用
JP6164678B2 (ja) * 2012-10-23 2017-07-19 国立研究開発法人科学技術振興機構 ネットワークエントロピーに基づく生体の状態遷移の予兆の検出を支援する検出装置、検出方法及び検出プログラム
JP6465811B2 (ja) 2012-12-19 2019-02-06 スローン − ケタリング・インスティテュート・フォー・キャンサー・リサーチ 多様式の粒子、方法およびその使用
CA2900686A1 (en) * 2013-02-20 2014-08-28 Sloan-Kettering Institute For Cancer Research Wide field raman imaging apparatus and associated methods
US20140271545A1 (en) 2013-03-14 2014-09-18 Castle Biosciences, Inc. Methods for predicting risk of metastasis in cutaneous melanoma
EP3004870B1 (en) 2013-05-28 2019-01-02 Todos Medical Ltd. Differential diagnosis of benign tumors
GB201317609D0 (en) 2013-10-04 2013-11-20 Cancer Rec Tech Ltd Inhibitor compounds
US10912947B2 (en) 2014-03-04 2021-02-09 Memorial Sloan Kettering Cancer Center Systems and methods for treatment of disease via application of mechanical force by controlled rotation of nanoparticles inside cells
US10688202B2 (en) 2014-07-28 2020-06-23 Memorial Sloan-Kettering Cancer Center Metal(loid) chalcogen nanoparticles as universal binders for medical isotopes
US11009467B2 (en) * 2015-02-17 2021-05-18 Siemens Healthcare Diagnostics Inc. Model-based methods and apparatus for classifying an interferent in specimens
GB201505658D0 (en) 2015-04-01 2015-05-13 Cancer Rec Tech Ltd Inhibitor compounds
US10919089B2 (en) 2015-07-01 2021-02-16 Memorial Sloan Kettering Cancer Center Anisotropic particles, methods and uses thereof
GB201617103D0 (en) 2016-10-07 2016-11-23 Cancer Research Technology Limited Compound
EP3532641A4 (en) * 2016-10-28 2020-06-17 Mao Ying Genetech Inc. METHOD FOR IDENTIFYING THE PRIMARY LOCATION OF METASTASING CANCER AND SYSTEM THEREFOR
TWI676688B (zh) * 2017-07-17 2019-11-11 茂英基因科技股份有限公司 辨識細胞種類型之方法及系統
CN109932510B (zh) * 2017-12-18 2022-07-12 天津云检医学检验所有限公司 一种宫颈癌生物标志物及其检测试剂盒
JP7580210B2 (ja) * 2020-06-15 2024-11-11 三菱重工業株式会社 予兆判定装置、予兆判定方法及びプログラム
CA3233047A1 (en) * 2021-09-20 2023-03-23 Droplet Biosciences, Inc. Methods for disease assessment using drain fluid
WO2023107329A1 (en) * 2021-12-08 2023-06-15 Mayo Foundation For Medical Education And Research Assessing and treating melanoma
CN116204890B (zh) * 2023-04-28 2023-07-21 浙江鹏信信息科技股份有限公司 一种自适应增强人工智能算法安全的算法组件库
CN117171678B (zh) * 2023-11-02 2024-01-12 北京建工环境修复股份有限公司 一种微生物修复过程中土壤微生物菌群调控方法及系统

Family Cites Families (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4230767A (en) * 1978-02-08 1980-10-28 Toyo Boseki Kabushiki Kaisha Heat sealable laminated propylene polymer packaging material
US4233402A (en) * 1978-04-05 1980-11-11 Syva Company Reagents and method employing channeling
US4275149A (en) * 1978-11-24 1981-06-23 Syva Company Macromolecular environment control in specific receptor assays
US4376110A (en) * 1980-08-04 1983-03-08 Hybritech, Incorporated Immunometric assays using monoclonal antibodies
US4659678A (en) * 1982-09-29 1987-04-21 Serono Diagnostics Limited Immunoassay of antigens
US4727022A (en) * 1984-03-14 1988-02-23 Syntex (U.S.A.) Inc. Methods for modulating ligand-receptor interactions and their application
US5018067A (en) * 1987-01-12 1991-05-21 Iameter Incorporated Apparatus and method for improved estimation of health resource consumption through use of diagnostic and/or procedure grouping and severity of illness indicators
US5744101A (en) * 1989-06-07 1998-04-28 Affymax Technologies N.V. Photolabile nucleoside protecting groups
US20020038227A1 (en) * 2000-02-25 2002-03-28 Fey Christopher T. Method for centralized health data management
WO2003025141A2 (en) * 2001-09-19 2003-03-27 Intergenetics Incorporated Genetic analysis for stratification of cancer risk
US7468032B2 (en) * 2002-12-18 2008-12-23 Cardiac Pacemakers, Inc. Advanced patient management for identifying, displaying and assisting with correlating health-related data
US20040122296A1 (en) * 2002-12-18 2004-06-24 John Hatlestad Advanced patient management for triaging health-related data
US20030232398A1 (en) * 2002-03-28 2003-12-18 Macmurray James P. Use of ROC plots of genetic risk factor to predict risk of sporadic breast cancer
US20050208500A1 (en) * 2003-03-04 2005-09-22 Erlander Mark G Signatures of ER status in breast cancer
CA2562310A1 (en) * 2004-04-30 2005-11-17 Yale University Methods and compositions for cancer diagnosis
EP1805676A1 (en) * 2004-09-22 2007-07-11 Tripath Imaging, Inc. Methods and computer program products for analysis and optimization of marker candidates for cancer prognosis
AU2006315348A1 (en) * 2005-11-16 2007-05-24 Beth Israel Deaconess Medical Center Method to assess breast cancer risk
US8445198B2 (en) * 2005-12-01 2013-05-21 Medical Prognosis Institute Methods, kits and devices for identifying biomarkers of treatment response and use thereof to predict treatment efficacy
US20090069196A1 (en) * 2006-03-22 2009-03-12 Mathias Gehrmann Prediction of Breast Cancer Response to Chemotherapy
AU2007292219B2 (en) * 2006-09-06 2014-04-24 The Regents Of The University Of California Molecular diagnosis and classification of malignant melanoma
KR20090071603A (ko) * 2006-09-19 2009-07-01 노파르티스 아게 Raf 억제제에 대한 표적 조절, 효능, 진단 및/또는 예후의 바이오마커
US20100248225A1 (en) * 2006-11-06 2010-09-30 Bankaitis-Davis Danute M Gene expression profiling for identification, monitoring and treatment of melanoma
EP2155897A2 (en) * 2007-03-30 2010-02-24 Source Precision Medicine, Inc. d/b/a Source MDX. Gene expression profiling for identification, monitoring, and treatment of prostate cancer
WO2009052573A1 (en) * 2007-10-23 2009-04-30 Clinical Genomics Pty. Ltd. A method of diagnosing neoplasms
AU2009213689B2 (en) * 2008-02-14 2014-11-20 Decode Genetics Ehf. Susceptibility variants for lung cancer
US20110053804A1 (en) * 2008-04-03 2011-03-03 Sloan-Kettering Institute For Cancer Research Gene Signatures for the Prognosis of Cancer
CA2724348A1 (en) * 2008-05-15 2009-11-19 University Of Southern California Genotype and expression analysis for use in predicting outcome and therapy selection
CA3043089A1 (en) * 2009-11-23 2011-05-26 Genomic Health, Inc. Methods to predict clinical outcome of cancer

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
None

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9976188B2 (en) 2009-01-07 2018-05-22 Myriad Genetics, Inc. Cancer biomarkers
US10519513B2 (en) 2009-01-07 2019-12-31 Myriad Genetics, Inc. Cancer Biomarkers
US8933069B2 (en) 2010-02-17 2015-01-13 Takeda Pharmaceutical Company Limited Heterocyclic compound
US9388195B2 (en) 2010-02-17 2016-07-12 Takeda Pharmaceutical Company Limited Heterocyclic compound
US9655900B2 (en) 2010-02-17 2017-05-23 Takeda Pharmaceutical Company Limited Heterocyclic compound
US8921354B2 (en) 2010-02-17 2014-12-30 Takeda Pharmaceutical Company Limited Heterocyclic compound
US8722660B2 (en) 2010-02-17 2014-05-13 Takeda Pharmaceutical Company Limited Heterocyclic compound
US10954568B2 (en) 2010-07-07 2021-03-23 Myriad Genetics, Inc. Gene signatures for cancer prognosis
US9605319B2 (en) 2010-08-30 2017-03-28 Myriad Genetics, Inc. Gene signatures for cancer diagnosis and prognosis
WO2013006495A3 (en) * 2011-07-01 2013-04-11 Dana-Farber Cancer Institute, Inc. Methods of predicting prognosis in cancer
US10876164B2 (en) 2012-11-16 2020-12-29 Myriad Genetics, Inc. Gene signatures for cancer prognosis
WO2015132672A3 (en) * 2014-03-07 2015-12-17 University Health Network Methods and compositions for detection of targets involved in cancer metastasis
US11174517B2 (en) 2014-05-13 2021-11-16 Myriad Genetics, Inc. Gene signatures for cancer prognosis

Also Published As

Publication number Publication date
EP2307886A2 (en) 2011-04-13
RU2011102743A (ru) 2012-08-10
US20110182881A1 (en) 2011-07-28
JP2011526693A (ja) 2011-10-13
WO2009158620A3 (en) 2010-06-03
MX2010014280A (es) 2011-05-23
CA2728674A1 (en) 2009-12-30
ZA201100225B (en) 2011-10-26
KR20110036056A (ko) 2011-04-06
CN102132160A (zh) 2011-07-20
AU2009262022A1 (en) 2009-12-30
IL210245A0 (en) 2011-03-31
NZ590385A (en) 2012-11-30
BRPI0914734A2 (pt) 2015-10-20

Similar Documents

Publication Publication Date Title
WO2009158620A2 (en) Signatures and determinants associated with metastasis methods of use thereof
US20200232988A1 (en) Signatures and determinants associated with prostate cancer progression and methods of use thereof
Lim et al. Overexpression of miR-196b and HOXA10 characterize a poor-prognosis gastric cancer subtype
US20140302042A1 (en) Methods of predicting prognosis in cancer
Yamano et al. Identification of cisplatin‐resistance related genes in head and neck squamous cell carcinoma
WO2010009337A9 (en) Signatures and pcdeterminants associated with prostate cancer and methods of use thereof
JP2019537108A (ja) 癌の分類および予後
CN116113712A (zh) 用于癌症的预后生物标志物
EP2721178B1 (en) Method for the prognosis of breast cancer based on expression markers
Caputo et al. Alterations in the preneoplastic breast microenvironment of BRCA1/2 mutation carriers revealed by spatial transcriptomics
US20120035069A1 (en) Prognosis of breast cancer patients by monitoring the expression of two genes
EP2550534B1 (en) Prognosis of oesophageal and gastro-oesophageal junctional cancer
CN118755834B (zh) 胃癌复发预测模型
WO2022082317A1 (en) Gene signature for predicting progression and progress of urinary cancers and methods of use thereof
Sawaguchi et al. High KCNJ14 expression is associated with an immunosuppressive tumor microenvironment and advanced pathological features: An RNA in situ hybridization-based analysis of colorectal carcinoma
KR20250081433A (ko) 난소암 항암제의 치료 반응성 예측용 바이오마커 조성물 및 이의 용도
Bilguun et al. Syntaxin binding protein 4 as a novel therapeutic target and an effective biomarker for better treatment selection in lung squamous cell carcinoma: A theranostic study
CN117568482A (zh) 用于胃癌预后的分子标记物及其应用
Class et al. Patent application title: METHOD FOR THE PROGNOSIS OF BREAST CANCER BASED ON THE EXPRESSION OF THE GENE PIN1 IN COMBINATION WITH MUTATIONS IN THE GENE TP53 Inventors: Giannino Del Sal (Trieste, IT) Marco Napoli (Palermo, IT) Javier Girardini Brovelli (Rosario, AR) Silvano Piazza (Latisana, IT) Alastair Thompson (Auchterarder, GB) Assignees: University of Dundee Universita Degli Studi di Trieste
Zhou et al. www. impactjournals. com/oncotarget
AU2015204286A1 (en) Prognosis of breast cancer patients by monitoring the expression of two genes

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200980133143.7

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09771151

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2728674

Country of ref document: CA

Ref document number: MX/A/2010/014280

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 210245

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2011516713

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 93/KOLNP/2011

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2009262022

Country of ref document: AU

Ref document number: 590385

Country of ref document: NZ

ENP Entry into the national phase

Ref document number: 20117001619

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2009771151

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2011102743

Country of ref document: RU

ENP Entry into the national phase

Ref document number: 2009262022

Country of ref document: AU

Date of ref document: 20090626

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 13001203

Country of ref document: US

ENP Entry into the national phase

Ref document number: PI0914734

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20101227