WO2009023800A1 - Transgenic chickens with an inactivated endogenous gene locus - Google Patents

Transgenic chickens with an inactivated endogenous gene locus Download PDF

Info

Publication number
WO2009023800A1
WO2009023800A1 PCT/US2008/073214 US2008073214W WO2009023800A1 WO 2009023800 A1 WO2009023800 A1 WO 2009023800A1 US 2008073214 W US2008073214 W US 2008073214W WO 2009023800 A1 WO2009023800 A1 WO 2009023800A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
cells
pgcs
chicken
transgene
Prior art date
Application number
PCT/US2008/073214
Other languages
English (en)
French (fr)
Inventor
Marie-Cecile Van De Lavoir
Philip Albert Leighton
Original Assignee
Origen Therapeutics
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Origen Therapeutics filed Critical Origen Therapeutics
Priority to AU2008286791A priority Critical patent/AU2008286791A1/en
Priority to JP2010521188A priority patent/JP5760159B2/ja
Priority to CN200880111586A priority patent/CN101868144A/zh
Priority to EP08797925A priority patent/EP2187732A4/en
Priority to CA2706224A priority patent/CA2706224A1/en
Publication of WO2009023800A1 publication Critical patent/WO2009023800A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276—Knock-out vertebrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/465—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from birds
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A01K2217/052—Animals comprising random inserted nucleic acids (transgenic) inducing gain of function
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/30—Bird
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/01—Animal expressing industrially exogenous proteins
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0393—Animal model comprising a reporter system for screening tests
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT

Definitions

  • Transgenic animals offer the potential for tremendous advances in the sustainable production of valuable pharmaceutical products, such as antibodies.
  • the production of transgenic animals involves significant technical hurdles that have only been overcome for a few species.
  • the ability to incorporate genetic modifications encoding exogenous proteins into the DNA of another species requires several distinct technologies that must be developed for each species.
  • One approach to alter the genetic and physical characteristics of an animal is to introduce cells into recipient embryos of the animal. These cells have the ability to contribute to the tissue of an animal born from the recipient embryo and to contribute to the genome of a transgenic offspring of a resulting animal.
  • the cells can be engineered with a transgene that contains the DNA that encodes an exogenous product such as a protein or an antibody.
  • the transgene contains the blueprint for the production of the protein and contains sufficient coding and regulatory elements to enable the expression of the protein in the tissue of the animal that is created from the insertion of the cells into a recipient embryo.
  • the expression is desired to be ubiquitous so that the expression occurs in all tissue types.
  • the expression must be limited to certain specific tissue types that facilitate collection of the expressed protein. For example, in cows, the expression of a protein in the milk enables the ready collection of the protein by simply collecting the milk of the cow and separating the exogenous protein. In chickens, the robust production of antibodies in the white of the egg also provides an attractive vehicle for the expression and collection of valuable proteins.
  • tissue specific expression is specific to the oviduct of a chicken
  • the expression yields antibodies having certain specific desirable chemical properties that increase the therapeutic utility of the antibodies when used in the treatment of a human patient.
  • genetically engineered chickens that selectively express antibodies in either egg white or egg yolk to facilitate isolation and collection of proteins with desirable chemical properties.
  • avian biological systems offer many advantages including efficient farm cultivation, rapid growth, and economical production. Further, the avian egg offers an ideal biological design, both for massive synthesis of antibodies and ease of isolation and collection of product. Furthermore, as described below in the context of the present invention, advantages of the transgenic chicken expression system, compared for example to vertebrate, plant, or bacterial cell systems, are readily demonstrated and can be applied to produce uniquely advantageous chemical properties for large quantities of antibody product. The goal of creating a transgenic chicken has been sought by scientists for many, many years.
  • transgenic chickens have not been created other than through the use of retroviral technology or direct injection technologies that suffer from inherent limitations on the size of a transgene that may be introduced into the DNA of the transgenic animal and/or lack of expression.
  • viral vectors are not amenable to applications that require site specific changes to the genome such as those provided by homologous recombination.
  • the animal's own endogenous genes could interfere with the production of valuable proteins resulting from introducing genetic constructs specially designed to express such proteins. Under such circumstances, the ideal solution would be to inactivate the animal's endogenous genes.
  • transgenic chickens having site-specific modifications resulting in the inactivation of an endogenous gene locus have not been described.
  • the introduction of site specific gene inactivations produces an animal that is lacking in endogenous gene function, and such an animal can be bred with a different animal that has complementary specific genetic modifications introduced into its genome. For example, a family of animals lacking a specific gene could be established, and, through breeding, combined with an animal containing a specific gene for a human.
  • transgene encoding tissue specific expression of any protein could be passed to a transgenic organism by several different techniques depending on the target cell and the specific construct used as the transgene. The same techniques can be used to perpetuate organisms having inactivated endogenous genes.
  • Whole genomes can be transferred by cell hybridization, intact chromosomes by microcells, subchromosomal segments by chromosome mediated gene transfer, and DNA fragments in the kilobase range by DNA mediated gene transfer (Klobutcher, L.A. and F.H. Ruddle, Annu. Rev. Biochem., 50: 533-554, 1981).
  • Intact chromosomes may be transferred by microcell-mediated chromosome transfer (MMCT) (Fournier, R.E. and F.H. Ruddle, Proc. Natl. Acad. Sci. U.S.A., 74: 319-323, 1977).
  • MMCT microcell-mediated chromosome transfer
  • the specific design of any such transgene carrying an exogenous gene or gene inactivation also must consider the content of the exogenous gene, the nature of any gene inactivation and the characteristics of the resulting phenotype in the animal.
  • transgenes that inactivate an endogenous locus or that enable tissue specific expression may threaten the pluripotency of the cells unless the transgenes are carefully designed.
  • suitable cell lines must be both stable in culture and must maintain pluripotency when the cell is transfected with a genetic construct that is large and complex enough to either inactivate a gene or to contain all of the elements necessary for tissue specific and high-level expression where desired.
  • the transgene may optionally be selectively expressed in specific individual tissue types in which the transgene is designed to be expressed. Depending on the genetic content of the transgene, the transgene may not be expressed in other tissues if the viability of the animal or the advantageous chemistry of the resulting protein is compromised.
  • Chicken primordial germ cells have been genetically modified using a retroviral vector within a few hours following isolation from Stage 11-15 embryos (Vick et al., (1993) Proc. R. Soc. Lond. B 251, 179 - 182).
  • the resulting modification is randomly integrated and the size of the transgene is generally limited to less than about 15 kb, usually less than 10 kb and most commonly less 8 kb and site-specific changes to the genome cannot be created using this technology, nor can transferred cells be selected to identify site specific modifications to the exclusion of random integration.
  • Stable genetic modifications requiring the insertion of greater than 15kb of exogenous DNA into the genome of cultured avian PGCs have not been previously reported .
  • any limitation on the size or site specificity of any DNA transgene or construct that may be stably introduced in a long-term PGC cell culture is a critical constraint on the ability to achieve valuable genetic modifications in the genome of PGCs in culture, and in turn, limits the types of genetic modifications that may be passed through the germline to offspring of the recipient embryo.
  • the introduction of an inactivation vector or an exogenous DNA sequence encoding a protein into the genome of a transgenic chicken is a highly desirable genetic modification. If a flock of such transgenic chickens could be created, large quantities of valuable proteins could be expressed in the chicken and collected in the egg.
  • the avian egg offers an ideal repository for biologically active proteins and provides a convenient milieu from which proteins can be isolated.
  • PGCs Primordial germ cells
  • ECCs embryonic germ cells
  • ESCs chicken embryonic stem cells
  • transgenic animals especially mice has been important for the elucidation of mammalian gene function.
  • the traditional approaches are random integration of the trans gene into the genome or targeted insertion of transgenes into a specific locus by homologous recombination.
  • Random insertion of transgenes has two disadvantages.
  • the first and major disadvantage is that many genes serve an essential function at various stages of development and elimination of transcription of these genes frequently causes embryonic mortality.
  • Embryonic mortality can be obviated using site-specific recombinases such as Cre-loxP or FIp-FRT under the control of promoters that confer tissue specificity and developmentally regulated gene expression.
  • site-specific recombination is used to inactivate a gene in discrete cells and/or at discrete times during development within the context of an otherwise normal animal (termed conditional gene modification).
  • Cre-loxP system was used to specifically inactivate the insulin receptor gene in the ⁇ cells to create an insulin secretory defect similar to that in Type 2 Diabetes (Kulkarni et al. 1999 Tissue- specific knockout of the insulin receptor in pancreatic beta cells creates an insulin secretory defect similar to that in type 2 diabetes.
  • the presence of the selection cassette can cause a number of problems, such as disruption of gene expression at neighboring loci due to strong transcription regulatory elements frequently present in the selection cassettes (Lerner et al. 1993 CD3 zeta/eta/theta locus is co linear with and transcribed antisense to the gene encoding the transcription factor Oct-1. J Immunol.
  • a positive selection cassette can be achieved by a using a site-specific recombinase under the control of a tissue specific promoter.
  • Cre is a recombinase that catalyzes recombination between two loxP sites that are 34 base pair DNA elements. When two loxP sites are integrated into the genome in the same orientation, recombination catalyzed by Cre excises the intervening DNA.
  • the loxP sites can be integrated into the transgene before it is randomly inserted into the genome or the loxP sites can be inserted into the genome at precise locations using targeting vectors. Following excision of intervening DNA, the flanking loxP sites are converted into a single loxP site. Mutant loxP sites are available that yield a product that is not well recognized following Cre excision.
  • FIp recombinase another member of the ⁇ intergrase superfamily of site-specific recombinases shares the same mechanism of DNA recombination with Cre recombinase. Similar to Cre, FIp recombinase recombines DNA at two defined 34 base pair target sites (FRT sites). Following excision of the intervening DNA, the flanking FRT sites are also converted into a single FRT site.
  • conditional knockout is expression of lethal products in cells that are to be ablated in a particular tissue at a precise stage of development.
  • Grieshammer et al. (1998 Muscle-specific cell ablation conditional upon Cre -mediated DNA recombination in transgenic mice leads to massive spinal and cranial motoneuron loss.
  • Dev Biol. 197:234-47 used the Cre-loxP system to express the Diphtheria toxin A fragment specifically in muscle cells to study skeletal muscle development in mice.
  • Ligand-regulated forms of Cre also have been developed with the goal of adding temporal control of the Cre- loxP system to allow a precise induction of genetic changes in vitro or in vivo late in embryogenesis and/or in adult tissues.
  • Chromosomal rearrangements are a major cause of inherited disease and fetal loss, and have been associated with the progression and maintenance of cancer (Ramirez-Solis et al. 1995 Chromosome engineering in mice. Nature 378:720-4; Rabbitts et al. 2001 Mouse models of human chromosomal translocations and approaches to cancer therapy. Blood Cells MoI Dis. 27: 249-59). Chromosomal translocations often result in abnormal gene fusions and, consequently, tumor specific mRNAs and proteins are attractive targets for gene therapy. Thus, the ability to engineer chromosomal rearrangements with specific breakpoints by using the site-specific recombinase has been used to make mouse models of human disease.
  • translocations corresponding to the human rearrangements t (8:21)(q22; q22) and t (9:11)(p22q23) have been induced successfully in the mouse (Buchholz et al. 2000 Alteration of Cre recombinase site specificity by substrate-linked protein evolution. Nat Biotechnol.19: 1047-52; Collins et al. 2000 Inter-chromosomal recombination of Mil and Af9 genes mediated by cre-loxP in mouse development. EMBO Rep.l : 127-32) in order to model acute leukemia.
  • Random chromosome deletions can be generated by inserting loxP sites at random locations in the genome and then expressing Cre recombinase (Zhu et al. 2007. Efficient generation of random chromosome deletions, Biotechniques 42, 572- 575).
  • One Cre recombinase mouse expressing Cre under the control of an engrailed-2 (En-2) genomic regulatory fragment that directs expression to the embryonic midbrain-hindbrain constriction region and an indicator/reporter mouse, harboring a transgene that "indicates" that recombination has occurred and provides a permanent record of this event by transforming it into a heritable lineage marker.
  • the indicator line has a loxP-stop of transcription/ translation-loxP-stop cassette driven by regulatory sequences from the widely expressed chick ⁇ actin gene. On crossing En2-Cre mice and the indicator mice the double transgenics carrying one copy of each transgene.
  • This invention includes transgenic chickens and technologies enabling genetic engineering of transgenic birds, and the long-term culture of PGCs used to create transgenic chickens harboring inactivated endogenous loci resulting from the homologous integration of targeting constructs into primordial germ cells.
  • These transgenic chickens have transgenes integrated into the genome of a chicken primordial germ cell by homologous recombination resulting in gene inactivation resulting from the deletion of at least a portion of an endogenous locus.
  • the invention includes the transgene construct, stable cultures of primordial germ cells bearing the transgene, sometimes referred to as a knockout vector, a targeting vector, a knockout construct, or the like, wherein the transgene designed for endogenous gene inactivation is stably incorporated into the genome of a primordial germ cell maintained in culture for enough time to achieve the recombination event and select transfected cells.
  • the invention also includes primordial germ cells and the resulting transgenic chickens whose genome has been modified by inactivating an endogenous locus, including but not limited to the site specific deletion of a portion of a gene necessary for endogenous gene expression.
  • the invention also includes the resulting transgenic chickens produced from site specific modification of the endogenous genome.
  • the invention also relates to antibodies produced in chickens having advantageous chemical properties that enhance their therapeutic utility in certain applications. Antibodies produced in chickens have a distinct pattern of chemical modifications compared to antibodies produced in vertebrate, plant, or bacterial cell systems such that when administered to a patient with the goal of binding a toxin to target tissue, such as tumors, the target tissue is treated with increased therapeutic efficacy.
  • long term cultures of PCGs are engineered with specially designed genetic constructs to introduce genetic modification into birds, including the insertion of transgenes that yield tissue specific expression of exogenous proteins.
  • transgenic birds carrying a combination of exogenous DNA encoding the expression of a protein, combined with transgenic chickens having an inactivated endogenous locus provide a uniquely advantageous population of animals expressing exogenous proteins.
  • Transgenic chickens having an inactivated endogenous locus also provide valuable animal models for the study of gene expression and for the selection of unique genetic functions that are not possible without the ability to inactivate a selected endogenous locus.
  • the inactivation of endogenous chicken loci may be performed at specific portions of the endogenous immunoglobulin locus including the V, D, or J regions to interrupt immunoglobulin gene rearrangement and to inactivate the endogenous antibody expression.
  • one embodiment of the present invention includes a transgenic chicken substantially lacking endogenous immunoglobulin gene expression, and endogenous immunoglobulin protein production, resulting from the site specific gene modification at a selected portion of the endogenous chicken immunoglobulin locus.
  • a transgene is constructed for the targeted inactivation of both the light chain and heavy chain encoding the endogenous immunoglobulin production.
  • Transgenic birds of the invention may also express the transgene-derived antibody in the oviduct and the antibody is deposited in large quantities in the egg.
  • exogenous antibody proteins are encoded by human DNA sequences expressed in a background lacking endogenous antibody production such that native human antibodies are expressed in the chicken oviduct in the absence of endogenous avian antibody production thereby creating the ability to collect exclusively human antibodies from the egg.
  • the present invention includes populations of birds exhibiting tissue specific expression of antibodies, transgene constructs that enable exogenous antibody expression, isolated compositions of antibodies produced in chickens and having specially defined chemical properties, and related methods for creation of the birds, production of the antibodies and their therapeutic use in humans.
  • the invention uses long term primordial cell cultures and special techniques to produce chimeric or transgenic birds derived from long term PGC cell cultures, wherein the genome of the PGCs have a stably integrated transgene expressing an exogenous protein such that progeny of the cultured cells contain the stably integrated transgene.
  • those modified donor cells produce birds that express the transgene into specific, selected somatic tissue of the resulting animals.
  • This invention also includes compositions of exogenous proteins expressed in transgenic chickens and having certain desirable chemical properties compared to vertebrate, plant, or bacterial cell systems.
  • these proteins, particularly antibodies have reduced concentrations of fucose, galactose, N-acetyl neuraminic acid, N-glycolylneuraminic acid and elevated concentrations of mannose.
  • Antibodies having some or all of these properties exhibit increased therapeutic utility when administered to a human.
  • these antibody compositions exhibit enhanced antibody-dependent cellular cytotoxicity (ADCC).
  • the methods of the invention include using transgenic chickens to enhance the therapeutic utility, based on the ADCC effect, of compositions of antibodies by expressing them in a transgenic chicken.
  • the invention also includes transgenic chickens expressing exogenous antibody, having the advantageous chemistry defined herein, in the oviduct tissue such that exogenous antibody is concentrated in defined quantities in the egg white.
  • the exogenous protein is a human sequence monoclonal antibody encoded by the transgene construct incorporated into the genome of a transgenic bird.
  • the human monoclonal antibody encoding polynucleotide sequence is contained within a transgene that is specifically constructed for expression in the oviduct and which contains appropriate promoters and regulatory sequences to facilitate tissue specific expression.
  • This invention also relates to long-term cultures of avian primordial germ cells (PGCs) and several additional inventions enabled by the creation of a long-term culture where avian PGCs proliferate and where PGC cultures can be extended through multiple passages to extend the viability of the culture beyond 40 days, 60 days, 80 days, 100 days, or longer.
  • PGCs of the invention proliferate in long term cultures and produce germline chimeras when injected into recipient embryos.
  • the invention also relates to the introduction of genetic material into the genome of PGCs to obtain a desired outcome.
  • genetic constructs surrounded by HS4 elements are incorporated into PGCs of the invention to ensure the production of the transgene product.
  • the genetic modifications are executed using integrase to direct insertion of the construct into repetitive elements of the chicken genome.
  • DNA encoding a selectable marker is inserted into a region of the chicken genome to prevent production of the gene product.
  • the ability to make conditional mutations in the chicken would be advantageous. For example, it may be possible to create chickens that are substantially derived from embryonic stem cells using an apoptosis inducing gene under the control of a ubiquitous promoter that is silenced by the presence of a stop codon flanked by loxP sites. When this line of chickens is crossed to a line of birds that carries a gene encoding Cre recombinase under the control of a promoter that is expressed in the area pellucida, the embryo will not develop. If embryonic stem cells are injected into the embryo co incidentally with the expression of the apoptosis inducing gene, the embryo may be substantially derived from embryonic stem cells.
  • transgenes that contain sequences encoding selectable markers may be flanked by loxP sites.
  • Transgenic birds carrying these transgenes may be crossed to birds expressing Cre recombinase under the control of a promoter that is expressed in the germline. Birds produced from this cross will hatch following excision of the selectable markers.
  • Figure IA PGCs maintained in culture for 54 days. Note that the cells are not attached and maintain a round morphology. Arrows indicate several dividing cells that are visible in this culture.
  • Figure IB Long term PGC cell cultures are shown to be stable when maintained in culture for at least 136 days. These cells are cultured on a feeder layer of irradiated STO cells.
  • Figure 2 Gene expression as determined by RT-PCR of the germ cell markers CVH (Vasa) and Dazl. Cells were in culture for 32 days. Lane 1 shows expression of both CVH and Dazl in an aliquot of PGCs. A second sample, in lane 2, did not have sufficient mRNA as determined by the absence of actin. CES cells were also analyzed; actin was expressed but the cES cells did not express CVH and Dazl was expressed only weakly.
  • Figure 3 Western analysis of sample PGC cultures numbered # 13 and # 16 maintained in culture for 166 days. Testis was used as positive control and liver as a negative control. Rabbit anti-chicken CVH IgG was used as the primary antibody.
  • FIG. 4 Telomeric Repeat Amplification Protocol (TRAP) Assay. Different dilutions of cell extracts of 2 different PGC cell lines (numbered # 13 & # 16) maintained in culture for 146 days. The positive control consisted of the transformed human kidney cell line 293 and the negative control was lysis buffer only with no template added. In the PGC and positive control lanes, repeat sequences are visible indicating the presence of telomerase.
  • TRIP Telomeric Repeat Amplification Protocol
  • Figure 5 A cEG cells derived from PGCs maintained in culture.
  • 5B Chicken embryonic stem cells. Note the small cells, big nucleus (light grey) and pronounced nucleolus in both cell types.
  • Figure 6 Southern analysis of cx-neo transgene in a line of primordial germ cells
  • Figure 7 FACS analysis of DT40 cells (negative control population), EG cells, ES cells and PGCs, stained with antibodies against chicken vasa homologue (CVH) and 1B3.
  • the DT40, ES and EG cells were negative for both markers while a large majority of PGCs stained for both CVH and 1B3.
  • the cell lines used were PGC 102; ES 439 and EG 455.
  • Figure 8 Southern analysis of the HS4- ⁇ -actin-neo transgene in 2 lines of primordial germ cell PGCs.
  • FIG. 9 Southern analysis of the HS4 beta-actin-eGFP-beta-actin-puro transgene in primordial germ cell (PGC) line TP 103.
  • PPC primordial germ cell
  • the plasmid control DNA was linearized with Notl .
  • An internal fragment was released by digesting the DNA with Kpnl.
  • TP 103 and the plasmid a fragment of the same size was released.
  • Digestion of genomic DNA of TP 103 with Ncol, Mfel, and Sphl should reveal bands that are larger than the corresponding lanes of digeted plasmid DNA. No band is seen in the lane of Mfel digested TP 103 genomic DNA, wihch may be due to the band being too large.
  • fragments have been released in the TP 103 genomic DNA that are substantially larger than the fragments released in the plasmid DNA, indicating that the transgene is incorporated into the genome of the TP 103 cell line.
  • Figure 10 Karyotype of G-09 showing all chromosomes to be diploid. In one copy of GGA 2, the majority of the p arm is either missing or translocated to another chromosome. The other copy of CGA 2 is normal. The cells are ZZ (male).
  • Figure 11 Section of testes, at 18 days of development, stained with DAPI. GFP positive germ cells are clearly visibly within the seminiferous tubules.
  • Figure 12 The DAPI stained panel shows a section through a seminiferous tubule of an El 8 testis. GFP expressing cells are located within the seminiferous tubules and stain with the anti-CVH antibody.
  • FIG. 13 Transgenic offspring that have developed to between Stage X (EG&K) and Stage 34 (H&H) from a chimera carrying PGCs that are stably transfected with a ⁇ -actin-GFP transgene. All of the tissues revealed in these photopgraphs reveal expression of GFP.
  • FIG. 14 Tissues from a chimera carrying PGCs that are stably transfected with a ⁇ - actin-GFP transgene prepared for histological examination.
  • the blue DAPI stain reveals the presence of nuclei and green fluoresence demonstrates that all of the tissues express the GFP transgene.
  • Figure 15 Southern blot analysis showing that a clonally-derived, transfected PGC line can contribute to the germline in chimeric chickens and differentiate into EG cells.
  • Upper panel Genomic DNAs from PGCs transfected with the HS4 bactin-eGFP-bactin-puro construct, three embryos derived from a chimeric rooster made with the transfected PGCs and EG cells derived from the transfected PGCs, were giested with restriction enzymes for detecting internal (Kpnl) and junction fragments (Ncol, Aflll) of the transgene insertion.
  • the digested DNA was separated on a 0.7% agarose gel, blotted to nylon membrane, and probed with radiolabeled eGFP sequences.
  • the sizes of the hybridizing fragments were identical in the PGCs, EG cells, and two embryos that showed green fluorescence (GFP+ embryos).
  • GFP+ embryos green fluorescence
  • WT embryo non- fluorescing embryo
  • Lower panel a schematic of the construct is shown, with the locations of the restriction sites indicated, and the expected restriction fragment sizes shown below. There are two Kpnl sites, resulting in a 5.3 kb fragment. Ncol and Aflll cut within the construct once, and therefore the restriction fragments observed are junction fragments joining the construct with the flanking genomic DNA at the insertion site.
  • Figure 16 A Diagrams of the random integration constructs used in this study. Two basic types of construct were used: selectable marker cassettes (drug-resistance markers and EGFP) driven by strong promoters, and similar constructs flanked by two sets of the HS4 insulator.
  • the promoters used were mouse PGK, chicken ⁇ -actin, ⁇ -actin plus CMV enhancer (CAG) or ERNI.
  • the constructs are as follows: a drug selectable market cassette consisting of a promoter driving expression of the neo or puro resistance gene (top line); addition of the CAG-EGFP gene (second line); insulated drug selectable markers alone (third line); the same insulated selectable marker cassettes with the addition of an EGFP gene (fourth line); and the CAG-EGFP CAG-neo constuction with loxP sites flanking the selectable markers and a proprietary gene of interest (box with asterisk).
  • the constructs were linearized with Not ⁇ before transfection, resulting in the vector configuration shown.
  • FIG 16B Diagrams of the integrase constructs used in this study. On the left is the attB-containing plasmid in which an attB site was added to the HS4- ⁇ -actin-puro construct above. On the right is the plasmid used to express the integrase in cells from the CAG promoter. Both plasmids were transfected as circular DNAs.
  • FIG. 17 Alignment of attB with the attL sequences obtained from transfected PGCs.
  • the junctions between the attB plasmid and genomic sequences in the PGC clones derived from integrase-mediated transfection are shown.
  • On the top line is the wild type attB site, with the core TTG which is normally the recombination crossover point underlined.
  • Below are shown the attL sequences from the integrase-mediated insertions in PGCs.
  • the PGC sequences were compared to attB. In the PGC sequences, the attB sequences donated by the plasmid are in lower case, and the genomic pseudo attP sequences are in upper case and bold.
  • Figure 18 A Alignment of the PO41-like repeats from PGC insertion sites with the PO41 consensus sequence.
  • the PGC flanking sequences from all of the clones inserted into PO41-like repeats were aligned with each other and with the PO41 consensus.
  • the first 21 nucleotides are the attB sequence donated by the vector (as indicated above the alignment), followed by the genomic flanking sequence from each clone. Nucleotides shared by at least half of the sequences are boxed in black.
  • FIG. 2OA On the top line is a diagram of the targeting vector for the chicken IgL gene, IgL pKO5. It is designed to replace the 2.3 kb J-C region of the IgL gene with a 3.1 kb HS4-ERNI-puro selectable marker flanked by the HS4 insulator. The two homology arms are 2.3 and 6.3 kb in length. At the 3' end, a ⁇ -actin-EGFP gene allows for screening puro- resistant clones for green fluorescence to enrich for targeted clones. The dashed line at the end is the pKO vector backbone (Stratagene).
  • On the middle line is a diagram of the wild type allele of the germline configuration of the IgL gene, with the single variable (V), joining (J) and constant (C) region genes.
  • the restriction sites used for Southern analysis of targeted clones are shown (S, Sad; B, BstEll) and the wild type fragment sizes with double arrowheads shown below.
  • On the lower line is the structure of the mutant allele in which the J and C regions have been deleted and replaced with HS4-ERNI-puro. The restriction map is shown, with the mutant fragment sizes shown below.
  • Figure 2OB Southern blot analysis of 4 clones.
  • clones 1 and 2 Four puromycin-resistant clones were analyzed, two of which were non-green (clones 1 and 2) and two of which were green (clones 3 and 4).
  • genomic DNA from the PGC clones was digested with Sad and hybridized with probe A to analyze targeting on the 5' side of the IgL gene.
  • DNA was digested with Bst ⁇ ll and hybridized with probe B for targeting on the 3 ' side of the IgL gene.
  • Clone 2 showed the expected sized fragments for a heterozygous, targeted clone.
  • FIG. 21 PCR of ERNI-puro which is a marker for inactivation of the immunoglobulin light chain gene in semen from GO roosters made with PGCs carrying the IgL knock-out. 10 ng of genomic DNA prepared from semen samples was used in PCR for the ERNI-puro selectable marker present in the IgL knockout allele. As a control, primers for the endogenous chicken beta-actin gene were included.
  • FIG. 22 ALDH3A2 expression in BN birds.
  • the upper panel shows the RT-PCR for ALDH3A2 on RNA isolated from two homozygous BN birds (BN/BN), one heterozygous BN bird (BN/+) and one wild-type bird (+/+).
  • a negative control of the RT- reaction -RT-control
  • the 544 and 680 bp bands indicate the presence of mRNA of aldehyde dehydrogenase without and with an unspliced intron between exon 5 and 6, respectively.
  • the 597 bp band in the lower panel confirms the presence of RNA in all samples.
  • the RT-PCR showed that ADH was expressed in heterozygous BN birds but not in homozygous BN birds, indicating that insertion of the transgene stopped transcription of this gene.
  • Figure 23 Sequence of the RT-PCR products from the wild-type allele at the aldehyde dehydrogenase 3 family member A2 transcripts.
  • Products A and B are derived from a transcripts without and with an unspliced intron of 136 bp between exon 5 and 6, respectively.
  • FIG. 24 Chickens carrying the UbC-loxP-stop-loxP-Reaper transgene.
  • A Southern blot analysis of 3 UbC-loxP-stop-loxP-Reaper transgenic lines (6-03, 6-51 and 9-51). Genomic DNA samples from Gl birds and the UbC-loxP-stop-loxP-Reaper vector were digested with SpHI or BcII. The digested DNA was separated on a 0.7% agarose gel, blotted to nylon membrane and hybridized to a radiolabeled Reaper specific probe to identify junction fragments. The sizes of the hybridizing fragments were larger for the genomic DNAs than for the vector indicating that the transgenes were integrated.
  • B Southern blot analysis of 3 UbC-loxP-stop-loxP-Reaper transgenic lines (6-03, 6-51 and 9-51). Genomic DNA samples from Gl birds and the UbC-loxP-stop-loxP-Reaper vector were digested with SpHI or BcII. The
  • UbC-loxP-stop-loxP-Reaper construct Schematic representation of the UbC-loxP-stop-loxP-Reaper construct.
  • the transgene consists of the UbC-promoter and the loxP-stop-loxP-Reaper transgene.
  • a SV40 polyadenylation signal (SV40) and a Blasticidin resistance cassette (bsd) were inserted 3' prime of UbC-loxP-stop-loxP -Reaper transgene.
  • the construct was flanked by a 5' and 3' LTR. The locations of the restrictions sites are indicated and the expected restrictions sizes are shown.
  • Figure 25 Chickens carrying the pLenti-ERNI-Cre transgene, A. Southern blot analysis of the 8 ERNI-Cre lines.
  • Genomic DNA samples were digested with BgIII.
  • the digested DNA was separated on a 0.7% agarose gel, blotted to nylon membrane and probed with a radiolabeled Cre.
  • the sizes of the hybridizing fragments were as expected 4.6 kb.
  • B Schematic representation of the ERNI-Cre transgene.
  • the transgene consists of ERNI promoter and the Cre transgene.
  • a SV40 polyadenylation signal (SV40) and a Blasticidin resistance cassette (bsd) were inserted 3' prime of ERNI-Cre transgene.
  • the construct was flanked by a 5' and 3' LTR. The locations of the BgIII restrictions sites are indicated and the expected restrictions size is shown.
  • Figure 26 FACS sorting of GFP positive and GFP negative cells from the Doc-2 cell line.
  • the two classes of cells were generated by transfecting the Doc-2 cell line with a circular plasmid containing the ERNI-Cre transgene which expresses Cre recombinase in PGCs.
  • the GFP negative cells are the result of excision of the sequence between the LoxP sites on the docking site vector that carries the CX-eGFP gene.
  • FIG. 27 Southern analysis of 2 chicks showing integration of the 10,652 bp transgene in the Doc-1 line of PGCs and chickens.
  • Genomic DNA from the DOCl PGC line (lanes marked P) and two chicks derived by breeding GO chimeras made with DOCl PGCs (lanes marked Cl and C2) was digested with either BgIII or EcoRI.
  • the digests were fractionated on an agarose gel, transferred to nylon membrane and hybridized to radiolabeled EGFP sequences.
  • This analysis detects junction fragments containing the docking site vector joined to the flanking genomic sequences at the site of integration of the vector. The size of these junction fragments varies depending on the site of integration and is diagnostic for each transgene insertion event in PGCs.
  • the BgIII fragment is approximately 12 kb, and the EcoRI fragment greater than 12 kb.
  • the fragment sizes are identical in PGCs and the chicks derived from them, showing that these chicks were derived from PGCs carrying the DOCl insertion.
  • Figure 28 Southern blot assay for Cre-mediated recombination of Reaper transgene by 10 different lines of pLenti-ERNI-Cre transgenic chickens.
  • the digested DNA was separated on a 0.7% agarose gel, blotted to nylon membrane and hybridized to a probe consisting of the Reaper gene and portions of the Lentiviral vector backbone (the blasticidin gene and SV40 sequences). This probe hybridizes equally to both full-length and recombined loxP -Reaper transgenes.
  • the ratio of the band intensities of the full-length (non-recombined) to recombined transgenes represents the activity of the Cre lines.
  • B Schematic presentation of the Cre-mediated recombination of the loxP-Reaper transgene.
  • the full-length loxP-Reaper transgene contains a 1.4 kb sequence, called a stop cassette, flanked by loxP sites in the same orientation. Recombination between the two loxP sites results in excision of the 1.4 kb intervening sequence from the chromosome, leaving behind a single loxP site. After excision, the recombined loxP -Reaper transgene is reduced in size by 1.4 kb. The locations of the probes and of the Sad restrictions sites are indicated and the expected restrictions sizes are shown.
  • Figure 29 Recombination of three different Reaper loxP cassette transgenes (6-03, 6- 51 and 9-51) by the Cre4 line.
  • A Southern blot analysis of transgenic embryos carrying only one copy of the loxP -Reaper transgene (R) or double transgenic embryos carrying one copy of the Cre4 transgene and one copy of the loxP-Reaper transgene (C+R) for 3 different loxP- Reaper lines (6-03, 6-51 and 9-51). Genomic DNA was digested with Sad.
  • the digested DNA was separated on a 0.7% agarose gel, blotted to nylon membrane and hybridized to a radiolabeled probe consisting of the Reaper gene and portions of the Lentiviral vector backbone (the blasticidin gene and SV40 sequences).
  • the sizes of the hybridizing fragments were as expected 2.8 kb for the full-length (unrecombined) loxP -Reaper fragment and 1.4 kb for the recombined loxP-Reaper fragment.
  • B Schematic presentation of the Cre-mediated recombination of the loxP-Reaper transgene.
  • the full-length loxP-Reaper transgene contains a 1.4 kb sequence, called a STOP cassette, flanked by loxP sites in the same orientation. Recombination between the two loxP sites results in excision of the 1.4 kb intervening sequence from the chromosome, leaving behind a single loxP site. After excision, the recombined loxP -Reaper transgene is reduced in size by 1.4 kb. The locations of the probes and of the Sad restrictions sites are indicated and the expected restrictions sizes are shown.
  • Figure 30 Southern analysis of the un-excised GFP positive Doc 2 cell line (Lane 1) and Doc 2 cells from which the cx-GFP-cx-neo sequences have been deleted (Lane 2). The cells were sorted by FACS analysis for expression of green fluorescence. Genomic DNA from the two populations of cells was prepared and digested with HindIII restriction enzyme and the DNA was hybridized with radiolabeled sequences from the puromycin resistance gene. A predicted fragment of 5521 bp was present in GFP positive (non-excised cells) cells and a predicted fragment of 1262 bp was present in the excised cells. This result indicates that Cre-lox recombination results in deletion of the CX-EGFP-CX-neo sequences lying between the two loxP sites in the docking site construct integrated in DOC2 cells.
  • Figure 31 Diagram of the IgL pKO5B targeting vector.
  • the top line indicates the construction of the targeting vec IgL pKO5B.
  • This line shows the vector construction for the 5' homology region including loxP and attP sites, as well as the 3' homology region.
  • the second line shows the relationship of the targeting vector to the chicken wild type IgL allele.
  • the third line shows the mutant allele created by the J and C genes deletion or gene disruption.
  • Figure 32 Southern blot analysis showing the IgL locus deletion in the KO-07 knockout clone.
  • Left hand panel The hybridization obtained for the 5 ' homology region when DNA from the five clonal PGC lines transfected with IgL pKO5B was digested with Sad and probed with a 0.5 kb SacI-BstEII fragment. Wild type IgL locus is approximately 10kb and the mutant fragment with the targeted deletion is approximately 4 kb.
  • Right hand panel The hybridization obtained for the 3' homology region with DNA from the same five clones. The genomic DNA was digested with BstEII and hybridized with a 3 ' 1.7 kb Nsil- Mfel fragment, which is also external to the targeting vector.
  • FIG. 33 Southern blot analysis showing IgL knockout was transmitted to 5 of 7 chicken embryos (embryos 2,3,4,6 and 7). Embryos 1 and 5 were wild type embryos that inherited the wild type IgL allele from the heterozygous, targeted KO-07 knockout PGCs.
  • chicken embryonic stem (cES) cells mean cells exhibiting an ES cell morphology and which contribute to somatic tissue in a recipient embryo derived from the area pellucida of Stage X (E-G&K) embryos (the approximate equivalent of the mouse blastocyst).
  • CES cells share several in vitro characteristics of mouse ES cells such as being SSEA-1+, EMA-1+ and telomerase+. ES cells have the capacity to colonize all of the somatic tissues.
  • primordial germ cells mean cells exhibiting a PGC morphology and which contribute exclusively to the germline in recipient embryos
  • PGCs may be derived from whole blood taken from Stage 12 - 17 (H&H) embryos.
  • a PGC phenotype may be established by: (1) the germline specific genes CVH and Dazl are strongly transcribed in this cell line, (2) the cells strongly express the CVH protein, (3) the cells do not contribute to somatic tissues when injected into a Stage X nor a Stage 12-17 (H&H) recipient embryo, (4) the cells give rise to EG cells (see below), or (5) the cells transmit the PGC genotype through the germline when injected into Stage 12-17 (H&H) embryos (Tajima et al. (1993) Theriogenology 40, 509-519; Naito et al., (1994) MoL Reprod. Dev., 39, 153-161; Naito et al., (1999) J Reprod. Fert. 117, 291-298).
  • chicken embryonic germ (cEG) cells means cells derived from PGCs which are analogous in function to murine EG cells.
  • the morphology of cEG cells is similar to that of cES cells and cEG cells contribute to somatic tissues when injected into a Stage X (E-G&K) recipient.
  • transgenic means an animal that encodes a transgene in its somatic and germ cells and is capable of passing the traits conferred by the transgene to its progeny.
  • transgenic also means an animal that contains a site selected, specific gene inactivation in the endogenous locus, including but not limited to the deletion of a finite gene segment in the endogenous locus, by use of a transgene or targeting construct that integrates into the genome of the primordial germ cell that results in gene inactivation through a gene literal deletion, a functional disruption, insertion of a stop codon, or non-sense sequences, attP site, or other artifact that yield a functionally inactivation of the locus through site specific gene modification. Because the existing retroviral technologies do not allow for site specific modification or the selection of transformed cells, the ability to sustain long-term cultures of PGC cells and to engineer site specific genetic modifications, such as gene inactivations, the term transgenic excludes retroviral systems.
  • transgenic avian lacks any endogenous gene corresponding to the endogenous gene target for total or partial deletion or other function disruption.
  • primordial germ cells have only been cultured on a short-term basis. Once the length in culture extends beyond a short number of days, these cells lose the ability to contribute exclusively to the germline.
  • PGCs maintained in culture using current culture techniques do not proliferate and multiply. In the absence of robust growth, the cultures are "terminal" and cannot be maintained indefinitely. Over time, these terminal cell cultures are degraded and the cells lose their unique PGC morphology and revert to embryonic germ (EG) cells.
  • EG embryonic germ
  • Embryonic germ cells acquire a different morphology from PGCs, lose their restriction to the germline, and gain the ability to contribute to somatic tissues when injected into early stages of embryonic development.
  • PGCs are uniquely attractive because they are known to be the progenitors of sperm and eggs.
  • the culture conditions must be sufficiently robust to allow the cells to grow from an individual genetically modified cell into a colony of 10 4 to 10 7 cells to be used for genetic analysis in vitro and for the production of chimeras.
  • These engineered PGCs would contribute exclusively to the nascent population of spermatogonia or oogonia (i.e., the sperm and eggs) in the resulting animals upon maturity.
  • the entirety of the somatic tissue would be derived from the recipient embryo and the germline would contain contributions from both the donor cells and the recipient embryos. Because of the mixed contribution to the germline, these animals are known as "germline chimeras.”
  • germline chimeras Because of the mixed contribution to the germline, these animals are known as "germline chimeras.”
  • the offspring of germline chimeras will be derived either from the donor cell or from the recipient embryo.
  • the germline in chickens is initiated as cells from the epiblast of a Stage X (E-G & K) embryo ingress into the nascent hypoblast (Kagami et al., (1997) MoI Reprod Dev 48, 501- 510; Petitte, (2002) J Poultry Sci 39, 205-228).
  • the hypoblast progresses anteriorly, the pre-primordial germ cells are swept forward into the germinal crescent where they can be identified as large glycogen laden cells.
  • the earliest identification of cells in the germline by these morphological criteria is approximately 8 hours after the beginning of incubation (Stage 4 using the staging system established by Hamburger and Hamilton, (1951) J Morph 88, 49- 92).
  • the primordial germ cells reside in the germinal crescent from Stage 4 (H&H) until they migrate through the vasculature during Stage 12-17 (H&H). At this time, the primordial germ cells are a small population of about 200 cells. From the vasculature, the primordial germ cells migrate into the genital ridge and are incorporated into the ovary or testes as the gonad differentiates (Swift, (1914) Am. J. Anat. 15, 483 - 516; Meyer, (1964) Dev. Biol. 10,154- 190; Fujimoto et al. (1976) Anat. Rec. 185,139 - 154).
  • primordial germ cells have not proliferated in culture for long periods without differentiating into EG cells. Long periods in culture are required in order to produce a sufficient number of cells to introduce a genetic modifications or inactivations by conventional electroporation or lipofection protocols. Typically, these protocols require 10 5 to 10 7 cells and therefore, production of these cells from a single precursor requires 17 to 24 doublings assuming that all cell divisions are (1) synchronous and (2) produce two viable daughter cells.
  • the introduction of a genetic modification into the genome of a cell is a rare event, typically occurring in one in 1 x 10 4 to 1 x 10 6 cells. Following genetic modification, the cells must be able to establish a colony from the single cell that carries and/or expresses the genetic modification.
  • the colony must be able to expand into a population of 10 5 to 10 7 cells that can be analyzed by PCR or Southern analysis to evaluate the fidelity of the transgene and provide a sufficient number of cells that are then injected into recipient Stage 13-15 (H&H) embryos. Therefore another 17 to 24 cell divisions are required to produce the populations of cells and in total 34 to 58 doublings are required to produce the population of genetically modified cells. Assuming that the cell cycle is 24 hours, a minimum of 34 days and in general 58 days in culture are required to produce genetically modified primordial germ cells for injection into Stage 13-15 (H&H) recipient embryos. The injected cells must then be able to colonize the germline, form functional gametes and develop into a new individual post fertilization.
  • the PGCs maintained in the culture described herein maintain a characteristic PGC morphology while maintained in culture.
  • the PGC morphology may be observed by direct observation, and the growth of cells in culture is assessed by common techniques to ensure that the cells proliferate in culture.
  • Cell cultures that proliferate are defined as non-terminal and are observed to have a greater number of cells in culture at the latter of 2 distinct time points.
  • the PGCs in the culture of the invention may have 1 X 10 5 or more cells in any particular culture and this number may be observed to increase over time. Accordingly, the invention includes a proliferating PGC culture that contains a larger number of cells after a period of days, weeks, or months compared to an earlier time point in the life of the culture.
  • the culture contains at least I X lO 5 cells and may be observed to have a higher number after any length of time growing in culture.
  • the PGCs may be observed to be the dominant species in the culture such that, when considering the minimal contribution made by non-chicken feeder cells, the proliferating component of the cell culture consists essentially of chicken primordial germ cells, to the substantial exclusion of other chicken- derived cells.
  • the culture also manifests the characteristic of allowing proliferation by passage such that samples or aliquots of cells from an existing culture can be separated and will exhibit robust growth when placed in new culture media.
  • the ability to passage a cell culture indicates that the cell culture is growing and proliferating and is non-terminal.
  • the cells of the invention demonstrate the ability to create germline chimeras after several passages and maintain a PGC morphology. As described herein, this proliferation is an essential feature of any cell culture suitable for stable integration of exogenous DNA sequences.
  • PGCs can be obtained by any known technique and grown in the culture conditions described herein. However, it is preferred that whole blood is removed from a stage 15 embryo and is placed directly in the culture media described below. This approach differs from other approaches described in the literature wherein PGCs are subjected to processing and separation steps prior to being placed in culture. Robust differential growth between
  • PGCs and other cells from whole blood that may initially coexist in the medium provides the large populations of PGCs in culture described here. Accordingly, PGCs derived directly from whole blood are grown in culture into large cell concentrations, can go through an unlimited number of passages, and exhibit robust growth and proliferation such that the PGCs in culture are essentially the only cells growing and proliferating.
  • One aspect of the present invention is the creation of large numbers, including greater than 3, greater than 4, greater than 5, 10, 15 and 20 germline chimeric transgenic animals all having genetically identical PGC-derived cells in their germline.
  • Another aspect of the invention is the creation of a population of germline chimeras having genetically identical PGC-derived cells in their germline that have, within the population, age differentials that reflect the use of the same long-term cell culture to create germline chimeras. The age differentials exceed the currently available ability to culture primordial germ cells over time and are as high as 190 days without freezing.
  • the present invention includes two or more germline chimeras having identical PGC-derived cells in their germline that differ in age by more than 40 days, 60 days, 80 days, 100 days, 190 days, etc., or any other integral value therein - without freezing the cells.
  • the invention also includes the existence of sexually mature germline chimeras having genetically identical PGC-derived cells in their germline, together with the existence of a non-terminal PGC culture used to create these germline chimeras and from which additional germline chimeras can be created.
  • the cells can also be cryo-preserved and thawed to create a long-term storage methodology for creating germline chimeras having a capability to produce offspring defined by the phenotype of the PGCs maintained in culture.
  • the capability to produce large numbers of germline chimeras also provides the ability to pass the PGC-derived genotype through to offspring of the germline chimera.
  • the present invention includes both populations of germline chimeras having genetically identical PGC-derived cells having an inactivated endogenous gene locus in the germline, but also offspring of the germline chimeras whose genotype and phenotype is entirely determined by the genotype of the PGCs grown in culture. Incorporation of a PGC- derived knockout phenotype in the germline has been observed.
  • the invention includes the offspring of a germline chimera created by germline transmission of a genotype of a primordial germ cell comprising an inactivated endogenous locus.
  • the invention includes each of the existence of a primordial germ cell culture containing PGCs comprised of a site specific gene inactivation, a germline chimera having the same primordial germ cells as part of its germline, and an offspring of the germline chimera having the knockout genotype and phenotype.
  • the ratio of donor-derived and recipient-derived PGCs in a recipient embryo can be altered to favor colonization of the germline in PGC-derived chimeras.
  • exposure to busulfan either greatly reduces or eliminates the population of primordial germ cells as they migrate from the germinal crescent to the gonadal ridge (Reynaud (1977a) Bull Soc. Zool. Francaise 102, 417-429; Reynaud (1981) Arch Anat. Micro. Morph. Exp. 70, 251 - 258; Aige-Gil and Simkiss (1991) Res. Vet. Sci. 50, 139 - 144).
  • Methods of the invention include: obtaining PGCs from a chicken, such as from the whole blood of a stage 15 embryo, placing the PGCs in culture, engineering the inactivation of an endogenous gene locus, proliferating the engineered PGCs to increase their number and enabling a number of passages, creating germline chimeras from long-term cultures of the engineered PGCs, and obtaining offspring of the germline chimeras having a genotype and phenotype that exhibits the gene inactivation engineered in PGCs.
  • the methods of the invention also include inserting a gene inactivation or gene "knockout" into a population of PGCs in culture to create stably transfected PGCs harboring an inactivated or functionally disrupted endogenous locus, selecting cells from this population that carry stably integrated transgenes, injecting the genetically modified cells carrying the stably integrated transgenes into a recipient embryo, developing the embryo into a germline chimera containing the inactivated locus in the germline, raising the germline chimera to sexual maturity and breeding the germline chimera to obtain transgenic offspring wherein the gene inactivation is derived from the cultured PGC.
  • the genetic modifications introduced into PGCs to achieve the gene inactivation may include, but are not restricted to, random integrations of transgenes into the genome, transgenes inserted into the promoter region of genes, transgenes inserted into repetitive elements in the genome, site specific changes to the genome that are introduced using integrase, site specific changes to the genome introduced by homologous recombination, and conditional mutations introduced into the genome by excising DNA that is flanked by lox sites or other sequences that are substrates for site specific recombination
  • chicken PGC cell lines have been derived from blood taken from Stage 14-16 (H&H) embryos that have a large, round morphology ( Figure 1).
  • PGCs are confirmed to be chicken PGCs by their morphology after long term culturing and their ability to yield PGC-derived offspring.
  • the PGC cultures express the germline-specific genes Dazl and CVH ( Figure 2) and the CVH protein is produced by the cells in culture ( Figure 3).
  • PGCs in culture also express telomerase ( Figure 4) indicating an immortal phenotype.
  • PGCs give rise to embryonic germ (EG) cells in the appropriate culture conditions ( Figure 5).
  • mouse and human PGCs will give rise to EG cells when treated in an analogous fashion.
  • Mouse EG cells will contribute to somatic tissues and chicken EG cells also contribute to somatic tissues as indicated by black feather pigmentation in chimeras.
  • Chicken PGCs have been genetically modified as indicated by Southern analysis ( Figure 6).
  • the CX promoter is stably integrated into the genome of a PGC and is used to facilitate expression of the gene encoding aminoglycoside phosphotransferase (APH) which is also integrated into the genome of a PGC and is used to confer resistance to neomycin added to culture media in order to select PGCs that have been genetically modified.
  • APH aminoglycoside phosphotransferase
  • KO-DMEM conditioned media were prepared by growing BRL cells to confluency in DMEM supplemented with 10% fetal bovine serum, 1% pen/strep; 2mM glutamine, ImM pyruvate, IX nucleosides, IX non-essential amino acids and O.lmM ⁇ -mercaptoethanol and containing 5% fetal bovine serum for three days. After 24 h, the medium was removed and a new batch of medium was conditioned for three days. This was repeated a third time and the three batches were combined to make the PGC culture medium.
  • one line of PGCs was grown in media comprised of 40% KO-DMEM conditioned media, 7.5% fetal bovine serum and 2.5% chicken serum. Under these conditions, the doubling time of the PGCs was approximately 24-36 hours.
  • the predominant cell type was fetal red blood cells.
  • the predominant cell type was that of a PGC.
  • Two PGC cell lines were derived from 18 cultures that were initiated from individual embryos.
  • PGCs have been in culture for over 9 months, maintain a round morphology, and remain unattached ( Figures IA &B). PGCs have been successfully thawed after cryopreservation in CO 2 independent medium containing 10% serum and 10% DMSO.
  • Example 2 Cultured PGCs express CVH and Dazl Expression of CVH, which is the chicken homologue of the germline specific gene VASA in Drosophila, is restricted to cells within the germline of chickens and is expressed by approximately 200 cells in the germinal crescent.
  • CVH expression is required for proper function of the germline in males; loss of CVH function causes infertility in male mice.
  • the mouse homolog of Drosophila Vasa is required for the development of male germ cells. Genes Dev 14, 841-53. (2000).
  • the expression of Dazl is restricted to the germline in frogs (Houston, D. W. & King, M. L. A critical role for Xdazl, a germ plasm- localized RNA, in the differentiation of primordial germ cells in Xenopus. Development 127, 447-56, 2000), axolotl (Johnson, A. D., Bachvarova, R. F., Drum, M. & Masi, T. Expression of axolotl DAZL RNA, a marker of germ plasm: widespread maternal RNA and onset of expression in germ cells approaching the gonad.
  • mice Schoens-Stassen, B. H., Saunders, P. T., Cooke, H. J. & de Rooij, D. G. Nature of the spermatogenic arrest in Dazl -/- mice. Biol Reprod 65, 771-776, 2001), rat (Hamra, F. K. et al. Production of transgenic rats by lentiviral transduction of male germ- line stem cells. Proc Natl Acad Sci U S A 99, 14931-6, 2002), and human (Lifschitz-Mercer, B. et al.
  • V-2 TTCTCTTGGGTTCCATTCTGC (SEQ ID NO.2) Dazl-1 GCTTGCATGCTTTTCCTGCT (SEQ ID NO.3)
  • Primers V-I and V-2 were used to amplify a 751 bp fragment from the CVH transcript.
  • Primers Dazl-1 and Dazl-2 were used to amplify a 536 bp fragment from the Dazl transcript.
  • Primers Act-RT-1 and Act-RT-R were used to amplify a 597 bp fragment from the endogenous chicken ⁇ -actin transcript. PCR reactions were performed with AmpliTaq Gold (Applied Biosystems) following the manufacturer's instructions ( Figure 2).
  • PGCs express the CVH protein Protein was extracted from freshly isolated PGCs using the T-Per tissue protein extraction kit (Pierce). Protein from cells was extracted by lysing the cells in 1% NP 4 O; 0.4% deoxycholated 66mM EDTA; lOmMJris, pH7.4. Samples were run on 4-15% Tris-HCL ready gel (Bio-Rad). After transfer onto a membrane, Western blots were performed with Super Signal West Pico Chemiluminescent Substrate kits (Pierce) as instructed.
  • Embryonic germ (EG) cells can be derived from cultures of PGCs
  • Chicken EG cells have been derived from PGCs by allowing the cells to attach to the plate, removing FGF, SCF and chicken serum, and culturing the cells under the same conditions used for ES cell culture (van de Lked et al., 2006 High Grade Somatic Chimeras from Chicken Embryonic Stem Cells, Mechanisms of Development 12, 31-41; van de Lizate and Mather-Love (2006) Chicken Embryonic Stem Cells; Culture and Chimera Production,
  • the morphology of the cEG cells is very similar to that of the cES cells ( Figure 5A,B).
  • Stage X E-G&K
  • cEG cells When cEG cells are injected into Stage X (E-G&K) embryos, they have the ability to colonize somatic tissues and make chimeras that, as juveniles, appear identical to chimeras made with cES cells Chicken EG cells are observed in both newly derived and clonally derived transgenic PGC lines. Southern analysis of EG cells derived from GFP positive PGCs demonstrate that EG cells originate from the PGCs ( Figure 15).
  • Table 1 Germline transmission of male primordial germ cells injected into the vasculature of Stage 14-15 (H&H) embryos.
  • PGCs may also be injected into the subgerminal cavity of stage X embryos. 1000 or 5000 PGCs were injected after 209 days of culture into irradiated embryos. Hatched male chicks were grown to sexual maturity and bred to test for germline transmission. In 3 out of 4 roosters tested germline transmission observed in varying frequency of 0.15 to 0.45%. This indicates that PGCs can colonize the germline when injected before gastrulation. Germline transmission of male PGCs has not been observed in 1,625 offspring of 14 female chimeras.
  • mice Female PGCs from Barred Rock embryos that were cultured 66 days were injected into Stage 13 - 16 (H&H) White Leghorn embryos and all hatched chicks were phenotypically White Leghorns. The hens were reared to sexual maturity and have been mated to Barred Rock roosters. Female PGCs transmitted through female chimeras at frequencies up to 69%. (Table 2). Table 2. Germline transmission of female primordial germ cells injected into the vasculature of Stage 14-15 (H&H) embryos.
  • Example 9 Primordial germ cells have been isolated from Stage 14-17 embryos and shown to contribute to the germline (see Examples 1-8). At this time, PGCs are circulating in the vascular system. Prior to formation of the vascular system, the PGCs were situated in the germinal crescent, which lies anterior to the embryo proper. The precursors of PGCs in the germinal crescent are not well understood but it is generally presumed that PGCs are derived from cells in the area pellucida of the Stage X (Eyal-Giladi and Kochav) embryo (Petitte, J.N. 2002. The Avian germline and Strategies for the Production of Transgenic Chickens. Journal of Poultry Science 39, 205-228).
  • PGC-A12 and PGC-Bl 1 Two male cell lines (PGC-A12 and PGC-Bl 1) were established and injected into recipient embryos as described in Example 6 after 45 and 36 days in culture respectively. Five male chimeras were produced from each cell line. As shown in Table 4, the Barred Rock phenotype was transmitted through the germline in 3 of the 10 males demonstrating that cells destined to become functional PGCs could be cultured in the medium that was provided.
  • the cells and DNA were resuspended in 800 ⁇ l of electroporation buffer and 8 square wave pulses of 672 volts and 100 ⁇ sec duration were applied. After ten minutes, the cells were resuspended in culture medium and aliquoted into 24-well plates. Two days after electroporation, 300 ⁇ g of neomycin were added per ml of medium to select cells that were expressing the cx-neo transgene. The cells were kept under selection for 19 days. After 19 days, the cells were taken off selection and expanded for analysis. A proportion of the PGCs was kept under 300 ⁇ g/ml for another 31 days demonstrating that the PGCs were functionally resistant to the antibiotic.
  • the cx-neo plasmid DNA was linearized with Notl and then digested with EcoRI or BamHI to produce a fragment that is slightly smaller (5 kb) than the intact plasmid which is shown by the HindIII digestion. Internal fragments of approximately 2 kb of the cx-neo plasmid were released by digestion with Styl or Ncol. A larger internal fragment of approximately 2.6 kb was released by digestion with EcoRI and Kpnl. Digestion of genomic DNA from the line of PGCs with EcoRI, BamHI and HindIII revealed bands that are larger than 6 kb illustrating that the cx-neo transgene was incorporated into the PGC genome.
  • the genome of primordial germ cells is generally believed to be in a quiescent state and therefore the chromatin may be in a highly condensed state. Extensive testing of conventional electroporation protocols suggest that special methods are needed to introduce genetic modifications into the genome of PGCs.
  • the transgenes may be surrounded with insulator elements derived from the chicken ⁇ -globin locus to enhance expression. The inclusion of the ⁇ -globin insulator elements routinely produces clones that can be grown, analyzed, and injected into recipient embryos.
  • the conventional promoters that are used to drive expression of antibiotic (e.g. neomycin, puromycin, hygromycin, his-D, blasticidin, zeocin, and gpt) resistance genes are expressed ubiquitously.
  • the promoters are derived from "housekeeping" genes such as ⁇ -actin, CMV, or ubiquitin. While constitutive promoters are useful because they are typically expressed at high levels in all cells, they continue to be expressed in most if not all tissues throughout the life of the chicken. In general, expression should be limited to only the tissue and stage of development during which expression is required. For selection of primordial germ cells, the period during which expression is required is their residence in vitro when the antibiotic is present in the media.
  • ERNI earsly response to neural induction
  • An ERNI is a gene that is selectively expressed during the early stages of development (e.g. Stage X (E-G&K)) and in culture, and therefore, this promoter is used to drive expression of antibiotic resistance genes to select PGCs carrying a genetic modification. Since ERNI is only expressed during the early stages of development, the genes that confer antibiotic resistance are not expressed in the mature animals.
  • ES, EG, DT40 (chicken B cell line) and PGCs were stained with anti-CVH, an antibody against the chicken vasa homologue and the 1B3 antibody (Halfter, W., Schurer, B., Hasselhorn, H. M., Christ, B., Gimpel, E., and Epperlein, H. H., An ovomucin-like protein on the surface of migrating primordial germ cells of the chick and rat. Development 122, 915-23. 1996)).
  • Expression of the CVH antibody is restricted to germ cells and therefore, the anti-CVH antibody is a reliable marker for them.
  • the 1B3 antigen recognizes an ovomucin-like protein present on the surface of chicken PGCs during their migration and colonization of the gonad.
  • Cells were washed in CMF/2% FBS, fixed in 4% paraformaldehyde for 5 minutes and washed again.
  • the cell aliquots to be stained for vasa were permeabilized with 0.1% TritonX-100 for 1-2 minutes.
  • Primary antibody was added for 20 minutes, cells were washed twice and incubated with a secondary antibody (Alexa 488 anti-rabbit IgG for CVH and control and Alexa 488 anti-rabbit IgM for 1B3) for 15 minutes.
  • a secondary antibody Alexa 488 anti-rabbit IgG for CVH and control and Alexa 488 anti-rabbit IgM for 1B3
  • Electroporation with a circular CX-GFP plasmid revealed that the rate of transient transfection in PGCs varied between 1-30%.
  • Using 8 Square wave pulses of 100 ⁇ sec and 800V we obtained a PGC cell line carrying a CX-neo construct, that was designated G-09. See Figure 6.
  • the integration of the construct was evaluated using Southern blot analysis. The isolation of this stably transfected line, however, was a non-recurring event.
  • stable transfection of PGCs was not achieved after electroporating 17x10 7 PGCs with linearized constructs in 37 transfection experiments using both square wave and exponential decay pulses. In each of these experiments, the number of PGCs varied from IxIO 6 to 1OxIO 6 .
  • Insulators are DNA sequences that separate active from inactive chromatin domains and insulate genes from the activating effects of nearby enhancers, or the silencing effects of nearby condensed chromatin.
  • the 5 ⁇ S4 insulator located 5' of the ⁇ -globin locus has been well characterized by Felsenfeld and colleagues (Burgess-Beusse, B., Farrell, C, Gaszner, M., Litt, M., Mutskov, V., Recillas-Targa, F., Simpson, M., West, A., and Felsenfeld, G. (2002)).
  • HS4-Bgl-R AAGATCTTCAGCCTAAAGCTTTTTCCCCGT (SEQ ID. NO. 8)
  • the PCR product was cloned into pGEM-T and sequenced. A tandem duplication of the HS4 site was made by digesting the HS4 in the pGEM clone with BamHI and BgIII to release the insert, and BgIII to linearize the vector. The HS4 fragment was ligated to the vector containing a copy of the HS4 insulator. Clones were screened and one was selected in which the two copies of HS4 are in the same orientation. This is called 2X HS4.
  • Example 14 Bulk Selection Using HS4 ⁇ -Actin-neo.
  • ⁇ -actin neo was obtained from Buerstedde (clone 574) and transferred into pBluescript. 2X HS4 was then cloned at both the 5' and 3' ends of ⁇ -actin neo to produce HS4- ⁇ -actin neo. Eight transfections were performed using this construct. For each transfection 5x10 6 PGCs were resuspended in 400 ⁇ l electroporation buffer (Specialty Media) and 20 ⁇ g of linearized DNA was added. One Exponential Decay (ED) pulse (200V, with 900-1 lOO ⁇ F) or eight Square Wave (SW) pulses (250-350V, lOO ⁇ sec) were given. After transfection, the cells were grown for several days before neomycin selection (300 ⁇ g/ml) was added. Each transfection was grown as a pool. Resistant cells were isolated from 5 of 8 transfections
  • the HS4- ⁇ -actin-neo plasmid DNA was linearized with Notl .
  • the PGC DNA and the linearized plasmid were digested with BamHI .
  • Both P84 and P85 show an internal fragment of 2.3 Kb in size.
  • a larger internal fragment of approximately 2.6 Kb was released by digestion with HindIIL Again this internal fragment is present in both the P84 and P85 digests.
  • Digestion of genomic DNA of P84 and P85 with EcoRl and BgIII should reveal bands larger than 2.9Kb if the transgenes are integrated into the genome. In P84 no junction fragments are seen, indicating that P84 is a composite of several different clones.
  • junction fragments of 4.5-5kb are present in the EcoRl digestion and a junction fragment of 5Kb is present in the BgIII digestion indicating that P85 is integrated into the genome and that the culture is comprised substantially from one clone.
  • This example shows the utility of insulators as a preferred element of a construct for reliable expression of selectable markers in primordial germ cells.
  • Example 15 Clonal Derivation of Genetically Modified PGCs
  • ⁇ -actin-eGFP was made.
  • the eGFP gene was released from CX-eGFP-CX-puro with Xmnl and Kpnl, ⁇ -actin was released from HS4- ⁇ -actin puro with EcoRI and Xmnl, and the two were cloned as a 3-way ligation into pBluescript digested with EcoRI and Kpnl to produce ⁇ -actin EGFP.
  • ⁇ -actin eGFP was released with BamHI and Kpnl (blunted with T4 DNA polymerase) and cloned into HS4- ⁇ -actin puro digested with BgIII and EcoRV.
  • ⁇ -actin puro was cloned into pBS containing two copies of 2X HS4 by ligating BamHI digested ⁇ -actin puro into BamHI/SAP treated 2X HS4 vector.
  • the PGC 13 cell line was electroporated with a plasmid carrying a cx-neo selectable marker. After exposure to neomycin a cell line was derived that was resistant to neomycin (G-09). The karyotype of this cell line was determined and all cells exhibited a deletion in the p-arm of chromosome 2 (Table 5 and Figure 10). These data demonstrate that G-09 was clonally derived from a PGC carrying a signature deletion in the p-arm of chromosome 2. Table 5 : Chromosomal analysis of G-09 cell line.
  • ERNI is expressed from the pre-primitive streak stage in the chicken embryo and is an early response gene to signals from Hensen's node Streit, A., Powell, A. J., Papanayotou, C, Sirulnik, A., and Stern, C. D. (2000). Initiation of neural induction by FGF signalling before gastrulation. Nature 406, 74-8. Furthermore ERNI is expressed in chicken ES cells Acloque, H., Risson, V., Birot, A., Kunita, R., Pain, B., and Samarut, J. (2001). Identification of a new gene family specifically expressed in chicken embryonic stem cells and early embryo. Mech Dev 103, 79-91.
  • the ERNI gene (also called cENS-1) has an unusual structure in which a single long open reading frame is flanked by a 486 bp direct repeat, in addition to unique 5' and 3' UTR sequences. Based on the idea that this structure is reminiscent of a retroviral LTR- like structure, Acloque et al. 2001 assayed different portions of the cDNA sequence for promoter/enhancer activity and found that a region of the unique sequence in the 3' UTR acts as a promoter. PCR primers were designed essentially as described (Acloque et al., 2001) to amplify an 822 bp fragment of the 3' UTR of the ERNI gene.
  • ERNI sequences After amplification of the ERNI sequences, they were cloned upstream of the neomycin-resistance gene, with an SV40 polyA site, to generate ERNI -neo (1.8 kb). The 2X HS4 insulator was then cloned on either side of the ERNI -neo selectable marker cassette.
  • PGCs were transfected with HS4- ⁇ actin-GFP and injected into the vasculature of Stage 13-15 (H&H) embryos.
  • H&H Stage 13-15
  • gonads were retrieved, fixed, sectioned and stained with the CVH antibody to identify the germ cells.
  • the stained sections were then analyzed for the presence of GFP positive cells in the gonads.
  • GFP positive germ cells were found in both male ( Figure 11) and female gonads. Examination of histological preparations of brain, heart muscle and liver of these embryos showed only four green cells in one slide. These data demonstrate that a few cultured PGCs are found in ectopic locations but that the vast majority of cultured PGCs preferentially colonize the germline.
  • the sections were stained with the anti-CVH antibody. As can be seen in Figure 12, the GFP positive cells also stain for the CVH protein, indicating that the GFP positive cells are germ cells.
  • GFP positive cells are present in this section and the DAPI/GFP panel shows that these GFP positive cells are located within the seminiferous tubule.
  • germ cells are stained with the anti-CVH antibody they exhibit a intense red stained ring that delineates the cytoplasm of the germ cells.
  • the DAPI/CVH panel shows that these cells are located within the seminiferous tubule.
  • the last panel shows that the GFP positive cells also stain for CVH and that the seminiferous tubules contains CVH positive germ cells that are GFP negative.
  • Example 18 Germline transmission of genetically modified PGCs.
  • Barred Rock PGCs transfected with one of the following transgenes: ⁇ actin-neo, ⁇ actin-eGFP- ⁇ actin-puro, or cx-eGFP-cx-puro were injected into the vasculature of Stage 13- 14 (H&H) embryos. The chicks were hatched, the roosters were grown to sexual maturity and bred to Barred Rock hens to determine germline transmission of the transgene. All black offspring were PGC derived and were tested for the presence of the transgene (Table 6). The rate of germline transmission was calculated by dividing the number of black chicks by the total number of chicks that were scored for feather color (Table 6). Table 6: Germline transmission of genetically modified primordial germ cells. Cell line Parental Age of Construct Roosters # offspring % germline cell line cells tested
  • Black offspring from matings between chimeric roosters carrying Barred Rock PGCs that were genetically modified to include one of ⁇ actin-neo, ⁇ actin-GFP, or cx-GFP were analyzed for the presence of the transgene. As shown in Table 7 the transgene is inherited by approximately 50 % of the PGC offspring, indicating Mendelian inheritance. Table 7. Mendelian segregation of the transgene.
  • Example 20 Ubiquitous expression of transgenes in offspring of chimeras carrying genetically modified PGCs
  • Tissues from pancreas, skin, lung, brain, ovary, kidney, bursa, duodenum, breast, heart, liver, and spleen of 1 to 2 week-old chicks demonstrated that expression remained ubiquitous in animals post hatching (Figure 14).
  • Genomic DNA was extracted from transfected PGC lines and digested with a restriction enzyme that either did not cut the transgene, or one that cut once in the HS4 element. The DNA was self-ligated and transformed into E. coli. The cells were plated on ampicillin plates to isolate colonies containing the amp gene from the plasmid joined to genomic sequences flanking the vector.
  • the plasmids were purified and sequenced from 31 of the HS4-construct transfected PGC lines. We performed BLAT (UCSC Chicken Genome Browser Gateway) and BLAST (NCBI) searches to map the genomic locations of each of the insertions. Strikingly, 25 of the 31 HS4-containing constructs were inserted into CpG islands, which are commonly found near promoter regions, especially those of housekeeping genes. Of the insertions in CpG islands, genes could be found associated with most of them (23/25), either a known gene or a novel gene as defined by ESTs (Table 8).
  • CpG islands often extend from several hundred base pairs upstream of the transcription start site, through the first exon, and into the first intron, and insertions were found in all of these regions. There was no bias in the transcriptional orientation of the vector relative to the endogenous gene. Many of these genes are predicted to be expressed in PGCs, based on their known functions as housekeeping genes, such as isocitrate dehydrogenase, aldehyde dehyodrogenase, and a mitochondrial solute carrier. Seven of the insertions were in novel genes, as defined by ESTs. Five of these ESTs were originally cloned from gonad or PGC libraries, suggesting that these genes may also be expressed in our PGC cell lines.
  • phiC31 integrase system catalyzes site-specific recombination between an attB site and an attP site to insert foreign DNA into the chicken genome. Recombination between phiC31 attB and attP sites is irreversible, so that insertion of a circular construct bearing an attB site into the genome is stable and does not get looped out, even in the continued presence of integrase.
  • Xenopus Allen and Weeks 2005 Nature Methods 2, 975-9.
  • Transgenic Xenopus laevis embryos can be generated using phiC31 integrase.), mouse (Olivares et al. 2002 Nature Biotechnology 20, 1124-8.
  • Site-specific genomic integration produces therapeutic Factor IX levels in mice; Belteki et al 2003 Nature Biotechnology 21,321-4. Site-specific cassette exchange and germline transmission with mouse ES cells expressing phiC31 integrase) and human cells (Groth et al 2000 Proc Natl Acad Sci U S A. 97,5995-6000. A phage integrase directs efficient site-specific integration in human cells; Thyagarajan et al 2001, MoI Cell Biol. 21, 3926-34.
  • phiC31 integrase can mediate integration of attB-containing plasmids into the unmodified genome, indicating that the genomes of these species contain pseudo-attP sites with sufficient sequence homology to the bacterial attP site to be recognized by the integrase. It has also been shown that the incoming plasmid must carry an attB site rather than an attP site for efficient integration (Belteki et al 2003; Thyagarajan 2001).
  • AttB site was added to insulated HS4 ⁇ -actin EGFP ⁇ -actin puro (HS4 BGBP) construct, resulting in attB HS4 BGBP.
  • the integrase construct used in this study is shown to include the att-B containing plasmid in which the att-B site was added to the HS4 ⁇ - actin EGFP ⁇ -actin puro construct.
  • the plasmid used to express the integrase in cells from the CAG promoter is shown. Two versions of the integrase were made, one with an SV40 nuclear localization signal and one without.
  • the attB HS4 BGBP and CAG-integrase plasmid DNAs were co-transfected as circular plasmids into PGCs.
  • a large increase in colony formation was observed as compared to the non-integrase, linearized HS4 BGBP, from approximately 0.3 colony per 10 6 cells with 20 ug of linear DNA to 5-10 colonies per 10 6 cells with only 5 ug of DNA, representing a greater than 20-fold increase in colonies per DNA.
  • the NLS version of the integrase yielded slightly fewer colonies compared to the non-NLS version.
  • the junctions between the vector and the genomic insertion sites in 12 of our integrase PGC lines were cloned and sequenced. Plasmid rescue was performed as above for the non-integrase lines. We observed a dramatic decrease in the efficiency of cloning the junction fragments; the number of E. coli colonies obtained went from an average of 69 colonies per transformation for the non-integrase PGC lines to 3.1 colonies from integrase-mediated PGC lines per transformation.
  • the junctions between the attB plasmid and genomic sequences in the PGC clones derived from integrase-mediated transfection are shown.
  • On the top line is the wild type attB site, with the core TTG which is normally the recombination crossover point is underlined SEQ ID No: 9, and below are the attL sequences from the integrase- mediated insertions SEQ ID Nos: 10-21.
  • the PGC sequences were compared to attB SEQ ID No: 9.
  • the attB sequences donated by the plasmid are in lower case, and the genomic pseudo attP sequences are in upper case and bold.
  • An attL sequence composed of about half of the attB sequence on the plasmid was found in each case joined to a pseudo attP site within the genome, suggesting that the integrase mediated the recombination reaction.
  • Recombination between the plasmid-borne attB and the genome was not precise and did not usually take place at the core TTG nucleotides of attB.
  • BLAT and BLAST searches mapped the genomic locations of each of the insertions. Strikingly, seven out of the eleven insertions that could be mapped occurred in repetitive DNA sequences.
  • Nucleotides shared by more than half of the sequences are boxed in black. Alignments of the sequences indicated that two of the PGC lines (2-47 SEQ ID No: 23 and 18-5-36-2 SEQ ID No: 22) carried insertions of attB HS4 BGBP at the same genomic site. The two insertions are independent, as shown by the fact that the nucleotide sequence at the attB-pseudo attP junction is different between the two. Another sequence (18-3-12 SEQ ID No: 24) was identical to the first two except for a 20 bp insertion.
  • flanking genomic fragments were in the 10-12 kb size range; when the two ends of these fragments were sequenced, both were repetitive, suggesting that the overall size of the repeat was large.
  • PO41 sequences represent a large, preferred target in the chicken genome for the phiC31 integrase.
  • the remaining 4 integrase-mediated insertions were in unique DNA sequences.
  • One of the sequences (19-1-1 SEQ ID No: 12) was in an intergenic region of unique sequence on chromosome 21, and one (1-41 SEQ ID No: 10) was inserted in the promoter region of the chicken ortholoque of the WiIm' s tumor (WTl) gene on chromosome 5.
  • One sequence (5-7 SEQ ID No: 11) was on chromosome 1 in multiple places, which could represent a local gene family or low-copy number repeat.
  • a targeting vector was designed to replace the J and C regions of the immunoglobulin light chain gene with an HS4 ERNI-puro selection cassette when inserted into the endogenous locus by homologous recombination ( Figure 19).
  • the ERNI promoter (driving the puromycin cassette) is specifically expressed in early embryos (Acloque et al
  • the top line is a diagram of the targeting vector for the chicken IgL gene, IgL KO5. It is designed to replace the 2.3 kb) J-C region of the IgL gene with a 3.1 kB HS4 ERNI-puro selectable marker (shown as I and HS4 insulator). The two homology arms are 2.3 and 6.3 kB in length. At the 3' end a ⁇ -actin EGFP allows for screening puro-resistant clones for green fluorescence to enrich for targeted clones. The dashed line at the end is the pKO vector backbone (Stratagene).
  • On the middle line is a diagram of the wild type allele of the germline configuration of the IgL gene, with the single variable (V), joining (J) and constant (C) region genes.
  • the restriction sites used for Southern analysis of targeted clones are shown (S, Sad; B, BstEI ⁇ ) and the wild type fragment sizes with double arrowheads shown below.
  • On the lower line is the structure of the mutant allele in which the J and C regions have been deleted and replaced with the HS4 ERNI-puro.
  • the restriction map is shown, with the mutant fragment sizes shown below.
  • the probes used in Southern analysis were both external to the targeting vector and their positions are shown. Four clones were isolated from 21 transfections, using a total of 1.05 x 10 8 cells and
  • Example 25 GO chimeras carrying the J-C knock out vector.
  • PGCs carrying the J-C knock-out described in Example 24 were injected into the vasculature of Stage 13-15 (H&H) White Leghorn recipient embryos. Phenotypically, the hatched chicks resembled White Leghorns. Males were reared to sexual maturity and semen was collected by abdominal massage.
  • a PCR analysis using forward primers ERNI-133F: 5'-TTGCTCAAGCCCCCAGGAATGTCA-S ' SEQ ID NO: 32 and reverse primers Puro-8R: 5 '-CGAGGCGCACCGTGGGCTTGTA-S ' SEQ ID NO: 33 is shown in Figure 21. Referring to Figure 21, amplified DNA of the expected 248 bp size was present in semen from at least two of the GO chimeras indicating that the genetically modified primordial germ cells had entered the germline.
  • Example 26 Insertion of ⁇ -actin-neo into the aldehyde dehydrogenase locus PGCs from parental cell line 13 were grown and 5x10 6 cells in 400 ⁇ l were electroporated with 20 ⁇ g of a linearized ⁇ -actin-neo construct, using an exponential decay pulse of 198V and 900 ⁇ F and plated into 48- lcm 2 wells to obtain single clones. The cells were grown in the presence of neomycin resulting in the growth of neomycin resistant clones that were transferred to new wells to be expanded.
  • the cells were analyzed by Southern analysis to establish stable integration of the transgene and sequencing showed that the construct was integrated in chromosome 19 in the promoter region of the aldehyde dehydrogenase gene, an enzyme involved in aldehyde metabolism.
  • PGCs carrying the ⁇ -actin-neo construct were grown and injected into Stage 13-16
  • H&H human embryos
  • the embryos were hatched and 4 roosters were grown to sexual maturity and tested for germline transmission.
  • the germline transmission rate of the roosters was 0, 0, 0.5 and 0.5%, respectively.
  • Heterozygous offspring from one of these roosters were grown to sexual maturity and mated to obtain homozygous offspring.
  • Table 10 Offspring from breeding heterozygous chickens carrying ⁇ -actin-neo (BN).
  • the homozygous roosters were grown to sexual maturity to test for fertility. Five roosters were bred to wild type hens and fertility, embryonic death and hatching percentages were calculated (Table 11). Although the fertility of 2 roosters was relatively low, the semen production of these birds was poor and therefore the number of sperm per insemination was also low. The fertility of two of the birds was very good (>90%) and the fertility of one bird was intermediate. The hatchability of fertile eggs from all birds was within the normal range. Taken together, these data indicate that the reproductive function of BN/BN birds was normal. Table 11 : Fertility of homozygous BN roosters early
  • mRNA was prepared from blood from two BN/BN homozygous birds, one BN/+ heterozygous bird and one wild-type bird (+/+) with Oligotex Direct mRNA Kit (Qiagen).
  • cDNA was then synthesized from 5 ml RNA using the Thermo-Script RT-PCR system for First Strand cDNA Synthesis (Invitrogen). 1 ml of cDNA was used in the subsequent PCR reaction using the following primers:
  • ALDH3A2-3 and A2-4 primers SEQ ID Nos: 34, 35 amplified a 544 and a 680 bp PCR product for the aldehyde dehydrogenase 3 family member A2 transcript.
  • Actin RT-I and RT- 2 primers SEQ ID Nos: 36, 37were used to amplify a 597 bp PCR product for the Actin transcript.
  • aldehyde dehydrogenase 3 family member A2 transcripts were detected in the heterozygous (BN/+) and wild-type bird (+/+), but not in the homozygous BN bird (BN/BN) indicating that the insertion of the ⁇ actin-neo transgene generated an insertional knock-out of the aldehyde dehydrogenase 3 gene that does not have a morphological phenotype. Confirmation that the primers amplified the aldehyde dehydrogenase 3 family member
  • A2 transcript was obtained by sequencing the 544 bp and 680 bp PCR products.
  • the 544 bp product is entirely contained within the 680 bp PCR product which also contains an unspliced intron of 136 bp between exon 5 and 6 ( Figure 23). Comparison of these sequences with those of the published chicken genome showed that they are identical.
  • Example 27 Insertion of ⁇ -actin-gfp-b ⁇ -actin-puro into an unknown EST
  • PGCs from parental cell line 54 were grown and 5x10 6 cells were electroporated with 20 ⁇ g of a linearized ⁇ -actin-GFP- ⁇ -actin-puro construct and plated into 48- lcm 2 wells to obtain single clones.
  • the cells were grown in the presence of puromycin resulting in the growth of only puromycin resistant clones. Resistant clones were transferred to new wells to be expanded.
  • the cells were analyzed by Southern analysis to establish stable integration of the transgene and sequencing showed that the construct was integrated in chromosome 8 in a novel gene (EST C0769951).
  • PGCs construct were grown and injected into the vasculature of Stage 13-16 (H)H recipient embryos.
  • the embryos were hatched and 8 roosters were grown to sexual maturity at tested for germline transmission.
  • the germline transmission rate of the roosters was 0, 1, 11, 12, 13, 16, 28 and 92% , respectively.
  • Heterozygous offspring from these roosters was grown to sexual maturity and mated to obtain homozygous offspring (Table 12).
  • Table 12 Offspring from breeding heterozygous chickens carrying ⁇ actin-GFP- ⁇ actin-puro (BGBP). genotype all dead & died ⁇ lday died before sexual offspring maturity rooster hen w/w tg/w tg/tg w/w tg/w tg/tg w/w tg/w tg/tg/tg
  • transgenes inserted into a pre-determined location rather than uncontrolled, random insertion.
  • the ability to insert transgenes into a known location in the genome has further potential advantages over random insertion.
  • Transgenes inserted for the purpose of over-expression of a protein product can be inserted into a location that is known to permit high levels of expression and does not undergo silencing by encroaching heterochromatin.
  • the insertion of the transgene can be predicted to cause no harmful effects to the animal or cell line, either in the heterozygous or homozygous state. It thus becomes unnecessary to screen large numbers of different random insertions to find one with high levels of expression and that does not interrupt an important endogenous gene.
  • Example 28 Creation of transgenic birds carrying a conditional apoptosis-inducing gene (Reaper).
  • the Reaper transgene (loxP-stop-loxP -Reaper construct) was generated as follows.
  • the Reaper cDNA was cloned by RT-PCR using D. melanogaster embryo poly (A)+ RNA and REAPER Fl (CAC CAG AAC AAA GTG AAC GA SEQ ID No: 38) and REAPER F2 (TGT TTG ACA AAA AAT TGA TGC ) primers SEQ ID No: 39.
  • the Reaper cDNA was inserted into the RI site of the CX-backbone generating the CX-Reaper construct.
  • a Kpnl site was inserted into the Reaper cDNA 3' prime of the start codon by site directed mutagenesis.
  • a 1.5 kb loxP-stop-loxP cassette from pBS302 was cloned into the Kpnl site to generate the CX-LoxP-stop-loxP-Reaper.
  • the loxP-stop-loxP-Reaper fragment was inserted into the pENTRB2 clone (Invitrogen) using the RI and Notl sites.
  • the loxP-stop-loxP-Reaper fragment was then recombined into the pLenti6/UbC/V5-DEST (pLenti Gateway vector Invitrogen) creating the UbC-loxP-stop-loxP-Reaper construct.
  • the ViraPower lentiviral expression system (Invitrogen) was used and high lentiviral titers up to 4.8 x 109 cfu/ml were generated.
  • a virus production 293 T cells were co-transfected with the UbC-loxP-stop-loxP -Reaper construct and a virapower packaging mix including a VSV-G encoding plasmid using Lipofectamine. The viral supernatant was collected 24 hours after transfection and was concentrated by centrifugation. The viral titer was determined by transducing HT 1080 cells with the viral supernatant. High titers were produced to ensure high transduction and germline transmission efficiency.
  • Genomic DNA from individual birds was analyzed by Southern blot analysis. Genomic samples and the UbC-loxP-stop-loxP-Reaper vector (control) were digested with Sphl or BcII. The digested DNA was separated on a 0.7% agarose gel, blotted to nylon membrane and probed with a radiolabeled Reaper specific probe to identify junction fragments. As shown in Figure 24, the sizes of the hybridizing genomic fragments were larger than the control indicating that the transgene was integrated. The hybridizing genomic fragments for the 6-03, 6-51 and 9-51 lines had different sizes indicating that 6-03, 6-51 and 9-51 are independent lines.
  • Example 29 Creation of chickens carrying Cre-recombinase
  • Cre recombinase To express Cre recombinase in chickens, a transgene was built in which the Cre gene was placed under the transcriptional control of the chicken ERNI promoter.
  • the ERNI gene also known as cENS-1
  • stage X the stage of the newly laid egg, when the embryo is a undifferentiated sheet of cells prior to gastrulation
  • the Cre transgene was thus designed to be expressed in early embryos where it would catalyze recombination of loxP sites of the loxP -Reaper transgenes or other loxP-containing transgenes placed in the genome. Since Cre would be expressed at an early stage, the resulting chicken that develops should carry recombined transgenes in every germ layer and every cell of its body.
  • a Lentiviral vector approach was taken.
  • a lentiviral transgene was constructed based on the Invitrogen pLenti6-V5 Dest Lentiviral vector.
  • the Lentiviral vector elements of pLenti6-V5 Dest were combined with the ERNI-Cre gene to produce the pLenti-ERNI-Cre construct.
  • Lentivirus was produced and used to infect early embryos, where it stably integrated into the genome. Approximately 20 transgenic founder birds were produced carrying the pLenti-ERNI-Cre transgene.
  • the chicken ERNI promoter was PCR amplified with the following primers; ERNI -738: 5 '-ATGCGTCGACGTGGATGTTTATTAGGAAGC-S ' SEQ ID NO: 40 ERNI +83: 5 '-ATGCGCTAGCTGGCAGAGAACCCCT-S ' SEQ ID No: 41
  • the 822 bp PCR product was cloned into pGEM T-easy (Promega) and sequenced.
  • the ERNI promoter was then released from the vector by digestion with SacII (subsequently blunted with T4 DNA polymerase) and Spel.
  • the CMV promoter was removed from the lentiviral vector pLenti ⁇ V5-Dest (Invitrogen) by digestion with CIaI (subsequently blunted with T4 DNA polymerase) and Spel.
  • the ERNI promoter was then ligated to the pLenti ⁇ V5- Dest lentiviral vector backbone, replacing the CMV promoter therein with the ERNI promoter, resulting in pLenti-ERNI.
  • the Cre gene was PCR amplified with an SV40 nuclear localization sequence on the N-terminus and convenient restriction sites for cloning (BgIII on the 5 ' end and EcoRI on the 3' end) with the following primers:
  • Cre-C 5'-CCG CCG GAG ATC TTA ATG CCC AAG AAG AAG AGG AAG CTG TCC
  • Cre-Rl 5'-TCGAATTCGAATCGCCATCTTCCAGCAGGCG-S' SEQ ID NO: 43
  • the 1040 bp PCR product was digested with BgIII and EcoRI and gel purified.
  • the shuttle vector pENTR 2B (Invitrogen) was digested with BamHI and EcoRI and the vector backbone was gel purified.
  • the Cre PCR product was ligated to the pENTR 2B vector and clones obtained. Clones were sequenced to determine that the Cre gene was as expected and had not acquired any mutations during PCR amplification.
  • the LR clonase reaction (Invitrogen) was performed using the pENTR 2B-Cre clone as the source of the Cre gene and the pLenti-ERNI vector as the recipient.
  • the final construct was thus obtained, pLenti-ERNI-Cre (8408 bp), which was used to produce lentivirus carrying the ERNI-Cre transgene.
  • pLenti-ERNI-Cre The pLenti-ERNI-Cre lentivirus was produced in 293FT cells.
  • the infectious titer of each batch of lentivirus stock was determined on HT 1080 cells by serially diluting the viral stock 10 "4 to 10 "8 and adding to cultures of HT 1080 with 1 ul polybrene. Two days after addition of the lentivirus, blasticidin selection (5 ug/ml) was initiated. Culture medium was replaced every two days as the cells died from blasticidin toxicity. Ten days after initiating blasticidin selection, colonies were stained with crystal violet and counted and the titre calculated. Titres of 10 8 to 2x10 9 were obtained. To infect chicken embryos with the virus 1.5 ul of concentrated viral solution was injected into the subgerminal cavity of stage X embryos.
  • Genomic DNA from chickens that had been identified first by PCR to carry the Cre transgene was extracted and digested with an enzyme that cuts in the viral 5 ' and 3 ' LTR sequences (BgIII) so that the full-length intact transgene would be observed. Birds with different, independent insertions of the transgene were chosen for analysis. Genomic DNA was digested with BgIII enzyme, transfered to nylon membrane, and probed with radiolabeled Cre gene.
  • Figure 25 shows a representative Southern of 8 ERNI-Cre lines.
  • Example 30 Establishment of cells lines allowing site-specific integration of a transgene.
  • homologous recombination gene targeting
  • site-specific recombination into a recognition site such as attP.
  • Homologous recombination is inefficient in most vertebrate cell types and usually requires screening many clones to identify one or a few that have the desired insertion.
  • Site-specific recombination is a high-fidelity, highly efficient process that can be used to insert foreign DNA into predetermined sites without screening a large number of clones.
  • Site-specific insertion depends on the use of phiC31 integrase to insert an attB- containing construct into a unique attP site placed in the genome, or into a pseudo-attP site.
  • the attP site To use an authentic attP site placed into the genome as a docking site, the attP site must be placed into a preferred, pre-determined location. The attP site is placed into such a preferred location in the genome by random insertion or by homologous recombination.
  • recognition site is placed in the genome by random insertion, then the location of insertion must be validated to ensure that an important gene has not been disrupted.
  • a recognition site placed into the genome then serves as the "docking site" for insertion of transgenes using phiC31 integrase.
  • a selectable marker system is used to select for the correct insertion.
  • the docking site is designed such that the attP site is adjacent to a drug selectable marker (such as the puromycin resistance gene) without a promoter. Cells carrying the docking site are thus sensitive to drug selection with puromycin.
  • the transgene to be inserted into the docking site contains a promoter adjacent to its attB site, but no selectable marker. Insertion of the transgene into the docking site places the promoter upstream of the selectable marker, activating its transcription and conferring puromycin resistance. Insertion of the transgene into other locations in the genome do not lead to drug resistance and such insertions are eliminated by drug selection.
  • the attP docking site construct consists of an attP site placed adjacent to a promoter- less drug selectable marker, such as puromycin resistance. Since the puromycin resistance gene is not expressed, another selectable maker, such as the ⁇ -actin promoter driving the neomycin selectable marker, must also be included. An EGFP gene can also be included.
  • a promoter- less drug selectable marker such as puromycin resistance. Since the puromycin resistance gene is not expressed, another selectable maker, such as the ⁇ -actin promoter driving the neomycin selectable marker, must also be included. An EGFP gene can also be included.
  • Flanking each side of these elements are two copies of the ⁇ -globin HS4 insulator to insulate the construct from neighboring chromatin.
  • loxP sites are placed flanking these elements. All of these portions of the construct serve as the vehicle for delivery of the authentic attP site into the genome.
  • the order of DNA elements is: HS4; attP; promoterless puromycin resistance gene; loxP; ⁇ - actin or CAG promoter; EGFP; ⁇ -actin or CAG promoter; neomycin resistance gene; HS4; plasmid backbone (pBluescript).
  • the construct is linearized and transfected into cultured PGCs, and drug resistant colonies are obtained. These colonies are expanded for further analysis. Since it is important to know where in the genome the docking site is situated, the chromosomal insertion site of the docking site construct in each clone is determined. Flanking genomic DNA is obtained and sequenced and compared to the chicken genome database. The majority of the clones are found to insert in CpG islands, which are regions of the genome normally associated with promoter regions of genes, especially of housekeeping or ubiquitous genes. Furthermore, most of the insertions are determined to be in promoter regions, first exons, or first introns of genes. Thus many of the insertions are predicted to disrupt the function of these genes (see Example 29; Table 8) .
  • These genes are either known genes or predicted genes based on expressed sequence tag (EST) sequences.
  • Preferred cell lines are those, which appear not to disrupt a gene, such as DOCl or DOC33.
  • the C AG-EGFP-C AG-neo portion of the docking site can be deleted by Cre-lox recombination. After Cre-lox recombination, all that remains in the docking site is the HS4 insulators, the attP site, and the promoterless puro gene. This reduces the number of foreign proteins that are produced in the cells and transgenic chickens, which may have an effect on their health, particularly when expressed ubiquitously from a strong promoter such as CAG or ⁇ -actin.
  • the Cre-lox recombination can be performed in cell culture, by transient transfection of the docking site clone with a circular Cre-expression vector. After several days, the culture is monitored for loss of EGFP expression caused by excision of the CAG-EGFP gene. About 50% of the cells no longer express EGFP, and these cells can be sorted by flow cytometry to purify them (Figure 26).
  • Cre recombination can be performed by crossing the transgenic chickens carrying the docking site construct to chickens carrying the ERNI-Cre transgene (Cre4 birds).
  • the resulting homozygous chickens may be healthy and fertile despite having an insertion in a gene.
  • An example of such a line is the TP85 line (also called BN; see Example 26), with an insertion in the gene encoding aldehyde dehydrogenase 3 family member A2 on chicken chromsome 19.
  • the construct was an HS4-insulated ⁇ -actin neo transgene, and it inserted into the promoter region within about 10 bp of the transcription start site of the gene. Birds homozygous for the insertion are healthy and fertile.
  • Example 31 Establishment of a Docking cell line consisting of more than 10.5kb of Expressed DNA
  • the Doc-1 cell line carries a transgene consisting of HS4; attP; promoterless puromycin resistance gene; loxP; CAG promoter; EGFP; CAG promoter; neomycin resistance gene; HS4 (see Example 29).
  • the construct was linearized and transfected into cultured PGCs, and drug resistant colonies were obtained. These colonies were expanded for further analysis.
  • the Doc-1 cell line was injected into recipient embryos and GO chimeric chicks were hatched.
  • the roosters were grown to sexual maturity and their sperm was analyzed by FACS analysis for the presence of GFP positive sperm. Two roosters were selected for breeding and germline transmission rates were 3 and 8%. Blood was taken from GFP positive chicks and analyzed by Southern analysis that confirmed the presence of the docking site
  • Example 32 Targeted insertion of a docking site
  • Example 33 Site-specific insertion into a cell line carrying a docking site
  • a circular construct containing an attB site is constructed.
  • the attB-containing construct is similar to that used in the Example above, with the important difference that there is no selectable marker.
  • a promoter such as the ERNI promoter
  • a promoter is placed adjacent to the attB site, such that upon integration into the docking site, the promoter is placed in a position to drive expression of the selectable marker in the docking site.
  • the promoter-attB backbone can be used to select for insertion into the attP- promoterless puro docking site.
  • the attB construct carries other genes of interest, such as tissue-specific promoters driving expression of genes encoding pharmaceutical proteins such as antibodies.
  • the functionality of the docking site and efficiency of integration in a docking site were tested in a PGC cell line containing the docking site. 5x10 6 cells were co-transfected with 0.5 ⁇ g of a construct containing Erni-attB and 0.5 ⁇ g of a circular construct expressing integrase. After electroporation, the cells were replated into 48- lcm 2 wells to obtain single colonies. In 42 of 48 wells, colonies were observed.
  • One primer was in the ERNI sequence and one primer was in the puromycin sequence, and amplification can only occur if the ERNI promoter has integrated upstream of the puromycin gene.
  • Three primer sets were used and all produced positive results: ERNI-37F + puro-8R product size 152 bp
  • the 10 Cre lines with intact pLenti-ERNI-Cre transgenes were tested for Cre recombinase activity.
  • the ERNI promoter was expected to drive high-level expression of the Cre recombinase in early embryos, transgenes can be silenced if they happen to integrate into an unfavorable region of the genome (a phenomenon known as 'position effect'). Therefore it was important to determine the activity of Cre recombinase in all of our Cre lines in order to select a line or lines with the desired level of activity.
  • Cre To determine the level of activity of our Cre transgenes, the ability of Cre to catalyze recombination of a loxP-Reaper transgene in doubly transgenic embryos carrying one copy of the Cre transgene and one copy of the loxP transgene was analyzed by Southern blot.
  • the loxP-Reaper transgene contains a 1.4 kb sequence, called a STOP cassette, flanked by loxP sites in the same orientation. Recombination between the two loxP sites results in excision of the 1.4 kb intervening sequence from the chromosome, leaving behind a single loxP site. The intervening sequence is then lost since it is no longer linked to a chromosome.
  • the loxP-Reaper transgene is reduced in size by 1.4 kb.
  • a Southern blot assay was developed in which the reduction in size of the loxP -Reaper transgene is used to measure the Cre recombinase activity. Digestion with the restriction enzyme Sad produces a full-length (unrecombined) loxP-Reaper fragment of approximately 2.8 kb when hybridized to a probe consisting of the Reaper gene and portions of the Lentiviral vector backbone (the blasticidin gene and SV40 sequences). Upon Cre-mediated recombination and excision of the 1.4 kb STOP sequence, the Reaper Sad fragment is reduced in size to approximately 1.4 kb when hybridized to the same probe. The probe hybridizes to sequences that are not affected by Cre recombination, and thus it hybridizes equally to both full-length and recombined loxP-Reaper transgenes.
  • the ratio of the band intensities of the full-length (non-recombined) and the recombined transgenes is determined. If Cre is not active, then little or no recombined Reaper is observed, and only the full-length is observed. If Cre is moderately active, then both Sad fragments are observed, indicating that recombination occurred in some cells but not other cells. If Cre is very active, then only the recombined Reaper band is observed because the loxP-Reaper transgene has been recombined in every cell.
  • Cre activity in the 11 lines tested was quite variable between lines, and in some cases within lines as well. Only one line out of 11 catalyzed 100% recombination of the loxP-Reaper transgene (the Cre4 line). In this line, every embryo tested (18 out of 18) displayed 100% recombination. In other lines, recombination levels ranged from about 5% up to about 80%. For several of these lines (Crel, Cre2, Crel 1 and Cre20) there was significant variability from embryo to embryo in the level of recombination. For example, Crel 1 and Cre20 catalyzed only about 10% recombination in some embryos but up to 60% in others.
  • Cre4 may express very high levels of Cre protein but only in early development, catalyzing 100% recombination.
  • Example 35 Successful recombination of three chicken lines carrying different reaper insertions.
  • Cre4 line was crossed to three different loxP-Reaper lines (called 6-03, 6-51 and 9-51). The Cre4 line was chosen because it previously showed 100% recombination. Embryos were selected that inherited one of the loxP-Reaper transgenes and a copy of the Cre4 transgene.
  • the loxP-Reaper transgene contains a 1.4 kb sequence, called a STOP cassette, flanked by loxP sites in the same orientation. Recombination between the two loxP sites results in excision of the 1.4 kb intervening sequence from the chromosome, leaving behind a single loxP site. The intervening sequence is then lost since it is no longer linked to a chromosome.
  • the loxP-Reaper transgene is reduced in size by 1.4 kb.
  • a Southern blot assay was developed in which the reduction in size of the loxP-Reaper transgene is used to measure the Cre recombinase activity. Digestion with the restriction enzyme Sad produces a full- length (unrecombined) loxP -Reaper fragment of approximately 2.8 kb when hybridized to a probe consisting of the Reaper gene and portions of the Lentiviral vector backbone (the blasticidin gene and SV40 sequences). Upon Cre-mediated recombination and excision of the 1.4 kb STOP sequence, the Reaper Sad fragment is reduced in size to approximately 1.4 kb when hybridized to the same probe.
  • the probe hybridizes to sequences that are not affected by Cre recombination, and thus it hybridizes equally to both full-length and recombined loxP- Reaper transgenes.
  • Cre-lox recombination the ratio of the band intensities of the full-length (non-recombined) to recombined transgenes is determined. If Cre4 is capable of excising the STOP cassette in all three Reaper lines, then only the recombined Reaper band is observed because the loxP -Reaper transgene has been recombined in every cell. The results shown in Figure 29 indicate that all three Reaper lines undergo 100% excision of the STOP cassette in the presence of the Cre4 transgene.
  • Example 37 Cre-mediated excision of EGFP and neo from docking site integrated in the chicken genome.
  • Cre recombination can be performed in vitro in cultured PGCs, as well as in transgenic birds.
  • the cells are transiently transfected with a Cre expression vector.
  • DOC2 cells were used for transfection with a Cre expression vector.
  • This PGC line carries the docking site construct integrated in chromosome 21 in a CpG island linked to Prkz and several ESTs. All of the cells in the starting DOC2 culture were green fluorescent, since they carry the CX-EGFP gene in the docking site construct.
  • Two Cre expression vectors were used: pBS185, with the Cre gene under the transcriptional control of the human CMV promoter, or an ERNI-Cre construct in which the ERNI promoter drives Cre expression.
  • the Cre expression constructs were transiently transfected into the DOC2 cells. After several days, the cultures were monitored for loss of green fluorescence, which was taken as an indicator that cells had taken up the Cre construct, expressed Cre, and Cre had caused excision of the sequences between the loxP sites on the docking site vector, including CX- EGFP-CX-neo. After Cre transfection, the culture consisted of green and non-green cells. To purify the two populations, the culture was sorted on the basis of green fluorescence by flow cytometry. Several million cells of each population (green and non-green) were collected. To prove that the EGFP gene had been excised in the non-green population of cells,
  • Genomic DNA from the two populations of cells (green and non-green) was prepared and digested with HindIII restriction enzyme.
  • the DNA was fractionated on an agarose gel, transferred to nylon membrane and hybridized with radiolabeled sequences from the puromycin resistance gene that is present in the docking site.
  • the puro gene is in a region of the docking site construct that is not excised by Cre-lox recombination, and thus the puro probe will detect fragments in genomic DNA from both DOC2-excised and non-excised cells.
  • the predicted size HindIII fragments were: EGFP+ (non-excised), 5521 bp; EGFP- (excised), 1262 bp.
  • Example 38 Preparation of IgL pKO5B targeting vector .
  • a targeting vector was prepared that deleted the endogenous J and C regions of the locus upon targeted integration (Figure 31).
  • the vector was the same as IgL pKO5 previously described, except the selectable markers have been changed.
  • the 5' homology region on the vector consisted of a 2327 bp fragment in the vicinity of the IgL V region, and the 3' homology region consisted of a 6346 bp fragment from downstream of the C region.
  • the homology arms were cloned from isogenic DNA obtained from the cell line used in targeting transfections.
  • the targeting construct contained one or more ways to disrupt expression, such as stop codon, nonsense sequences, attP site or combinations thereof.
  • the vector also contained selectable marker genes and site-specific recombination sites.
  • HS4 ERNI-neo the 804 bp neomycin resistance gene was placed under the transcriptional control of the 800 bp ERNI promoter for expression in PGCs. ERNI expression in the chicken is limited to very early embryos and thus the selectable marker should not be expressed in adult chickens.
  • the 250 bp core HS4 insulator element from the chicken ⁇ - globin locus was tandemly duplicated and the duplicated insulator was placed on both sides of the ERNI-neo selectable marker.
  • a single loxP site (for Cre -mediated recombination) was cloned upstream of the HS4-ERNI-neo.
  • loxP ATAACTTCGTATAGCATACATTATACGAAGTTAT (SEQ ID. NO. 47) attP-puro: the 600 bp puro gene was linked to a 43 bp attP site (for phiC31 -mediated recombination), with no promoter. attP-puro was then cloned downstream of HS4-ERNI-neo. Together, the loxP-HS4-ERNI-neo-attP-puro selectable marker cassette is 4089 bp.
  • attP ACGCCCCCAACTGAGAGAACTCAAAGGTTACCCCAGTTGGGGC (SEQ ID. No. 48)
  • 5' homology arm a 2327 bp fragment was generated by ligating a 1994 bp NcoI-BamHI fragment from the PGC35 IgL Sad clone + a 333 bp Notl-Ncol PCR product amplified from PGC 35 genomic DNA (with the primers 5'-NotI TTCTTGCGGCCGCAGGGAGCCATAGCCTGCTCCCATCATGCCC (SEQ ID. NO. 49) and 3'-NcoI, AGAGGAGCCCAGGCCATGGCGGAAT) (SEQ ID. No. 50)
  • the PCR fragment contained the overlapping genomic Ncol site to join the two fragments together.
  • the resulting 2327 bp fragment was released with Notl and BamHI for cloning into the pKO vector backbone, upstream of the HS4 ERNI-puro.
  • the Notl site was not present in the genome but added by PCR.
  • 3' homology arm a 6346 kb Spel - BgIII fragment was generated by ligation of the following three fragments together: a Spel - EcoRI fragment from the Sad genomic clone, plus an EcoRI - ApaLI clone from EcoRI-Mfel genomic clone, plus a 300 bp ApaLI - BgIII PCR fragment amplified from the EcoRI -Mfel clone (the the primers 5 ' ApaL AGTGCAGCTGCAGTGCACGGTA (SEQ ID. NO. 51) and 3'-BgIII
  • TTCTTAGATCTGTGACAAGCAGTCTCCGGTTAACA SEQ ID. NO. 52
  • the BgIII site was not present in the genome but added by PCR.
  • the 3 ' homology arm was cloned into the pKO vector backbone in between the HS4 ERNI-puro and the HS4 b-actin EGFP.
  • HS4 b-actin EGFP the 1.3 kb chicken b-actin promoter was used to drive expression of the
  • the final IgL pKO5B targeting vector has a size of 17,681 bp and was linearized with Notl before transfection into PGCs.
  • Example 39 Transfection of PGCs and generation of KO-07 IgL knockout PGC cell line
  • Amaxa nucleofector pulse A33 (Amaxa).
  • Nine clones were obtained, of which 4 were GFP- positive and not further pursued.
  • the five non-GFP expressing clones were expanded for
  • Example 40 Southern Blot Analysis For the 5' side of homologous recombination, genomic DNA from the five clonal
  • PGC lines transfected with IgL pKO5B was digested with Sad restriction enzyme and fractionated on 0.7% agarose gels. DNA was transferred to Nylon membrane and hybridized with a probe from the chicken IgL locus upstream from the regions used as the homology arms (i.e. an external probe). The probe is a 0.5 kb SacI-BstEII fragment and detects a wild type fragment of approximately 10 kb and a mutant fragment of approximately 4 kb.
  • genomic DNA was digested with BstEII and the blot was hybridized with a 3' 1.7 kb Nsil-Mfel fragment, also external to the targeting vector.
  • Example 41 Production of germline chimeras 3000 PGCs were injected per embryo at Stage 15-16 (Hamburger&Hamilton) into the dorsal aorta. Embryos were incubated in surrogate shells. Hatched chicks were grown up to sexual maturity.
  • Chimeric roosters were mated to wild type Barred Rock hens by artificial insemination. Semen was collected from 9 roosters and used to inseminate hens. Six of the roosters transmitted the black feather phenotype to offspring, indicating germline transmission of the IgL knockout PGCs (Table 1). One of the roosters (IV75-41) transmitted at a rate over 50%.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Environmental Sciences (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Toxicology (AREA)
  • Mycology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Husbandry (AREA)
  • Immunology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2008/073214 2007-08-14 2008-08-14 Transgenic chickens with an inactivated endogenous gene locus WO2009023800A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
AU2008286791A AU2008286791A1 (en) 2007-08-14 2008-08-14 Transgenic chickens with an inactivated endogenous gene locus
JP2010521188A JP5760159B2 (ja) 2007-08-14 2008-08-14 不活化された内因性遺伝子座を有するトランスジェニックニワトリ
CN200880111586A CN101868144A (zh) 2007-08-14 2008-08-14 具有失活的内源基因座的转基因鸡
EP08797925A EP2187732A4 (en) 2007-08-14 2008-08-14 TRANSGENIC CHICKEN WITH INACTIVED ENDOGENIC GENLOCUS
CA2706224A CA2706224A1 (en) 2007-08-14 2008-08-14 Transgenic chickens comprising an inactivated endogenous immunoglobulin light chain gene and methods to produce such chickens using genetically modified primordial germ cells

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US96489107P 2007-08-14 2007-08-14
US60/964,891 2007-08-14

Publications (1)

Publication Number Publication Date
WO2009023800A1 true WO2009023800A1 (en) 2009-02-19

Family

ID=40351167

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/073214 WO2009023800A1 (en) 2007-08-14 2008-08-14 Transgenic chickens with an inactivated endogenous gene locus

Country Status (7)

Country Link
EP (1) EP2187732A4 (ja)
JP (3) JP5760159B2 (ja)
KR (1) KR101563017B1 (ja)
CN (1) CN101868144A (ja)
AU (1) AU2008286791A1 (ja)
CA (1) CA2706224A1 (ja)
WO (1) WO2009023800A1 (ja)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2713712A2 (en) * 2011-05-24 2014-04-09 Crystal Bioscience Inc. Transgenic chicken comprising an inactivated immunoglobulin gene
EP2839016A1 (en) * 2012-04-20 2015-02-25 Commonwealth Scientific and Industrial Research Organisation Cell transfection method
CN113692225A (zh) * 2019-03-05 2021-11-23 以色列农业和农村发展部农业研究组织(范卡尼中心) 经基因组编辑的鸟类
CN115120382A (zh) * 2022-05-26 2022-09-30 广东省农业科学院动物科学研究所 一种鸡生殖前体细胞移植受体的制备方法

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR112018003778A2 (pt) * 2015-08-27 2018-09-25 Crystal Bioscience Inc animal transgênico para produção de anticorpos que apresenta uma cadeia leve comum
KR20200088805A (ko) * 2017-09-19 2020-07-23 더 스테이트 오브 이스라엘, 미니스트리 오브 애그리컬처 & 루럴 디벨로프먼트, 애그리컬처럴 리서치 오거니제이션, (에이.알.오.), 볼카니 센터 게놈-편집 조류
CN110484549B (zh) * 2018-04-20 2023-10-03 北京大学 基因组靶向修饰方法
WO2023127903A1 (ja) * 2021-12-28 2023-07-06 国立大学法人北海道大学 始原生殖細胞が富化された胚を調製する方法
CN115191404B (zh) * 2022-07-28 2023-04-21 四川省畜牧科学研究院 提高黄羽肉鸡后代公鸡比例的新品种选育方法

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060075513A1 (en) * 1997-10-16 2006-04-06 Avigenics, Inc. Avian transgenesis and exogenous proteins
US20060236418A1 (en) * 2003-02-26 2006-10-19 Babraham Institute Genetically modified non-human mammals and cells

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1852925A (zh) * 2003-07-15 2006-10-25 人类多克隆治疗公司 人源化免疫球蛋白基因座
US20060206952A1 (en) * 2005-02-01 2006-09-14 Origen Therapeutics, Inc. Transgenic chickens

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060075513A1 (en) * 1997-10-16 2006-04-06 Avigenics, Inc. Avian transgenesis and exogenous proteins
US20060236418A1 (en) * 2003-02-26 2006-10-19 Babraham Institute Genetically modified non-human mammals and cells

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
MOZDZIAK ET AL.: "Status of Transgenic Chicken Models for Developmental Biology", DEVELOPMENTAL DYNYAMICS, vol. 229, no. 3, March 2004 (2004-03-01), pages 414 - 421, XP008131587 *
See also references of EP2187732A4 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2713712A2 (en) * 2011-05-24 2014-04-09 Crystal Bioscience Inc. Transgenic chicken comprising an inactivated immunoglobulin gene
EP2713712A4 (en) * 2011-05-24 2014-12-24 Crystal Bioscience Inc TRANSGENIC CHICKENS WITH AN INACTIVATED IMMUNOGLOBULIN GEN
US9380769B2 (en) 2011-05-24 2016-07-05 Crystal Bioscience Inc. Transgenic chicken comprising an inactivated immunoglobulin gene
US9809642B2 (en) 2011-05-24 2017-11-07 Crystal Bioscience Inc. Transgenic chicken comprising an inactivated immunoglobulin gene
US10689433B2 (en) 2011-05-24 2020-06-23 Crystal Bioscience Inc. Transgenic chicken comprising an inactivated immunoglobulin gene
US11542319B2 (en) 2011-05-24 2023-01-03 Crystal Bioscience Inc. Transgenic chicken comprising an inactivated immunoglobulin gene
EP2839016A1 (en) * 2012-04-20 2015-02-25 Commonwealth Scientific and Industrial Research Organisation Cell transfection method
EP2839016B1 (en) * 2012-04-20 2018-10-03 Commonwealth Scientific and Industrial Research Organisation Cell transfection method
CN113692225A (zh) * 2019-03-05 2021-11-23 以色列农业和农村发展部农业研究组织(范卡尼中心) 经基因组编辑的鸟类
CN113692225B (zh) * 2019-03-05 2023-04-18 以色列农业和农村发展部农业研究组织(范卡尼中心) 经基因组编辑的鸟类
CN115120382A (zh) * 2022-05-26 2022-09-30 广东省农业科学院动物科学研究所 一种鸡生殖前体细胞移植受体的制备方法

Also Published As

Publication number Publication date
KR20100088125A (ko) 2010-08-06
JP5760159B2 (ja) 2015-08-05
KR101563017B1 (ko) 2015-10-23
JP6004290B2 (ja) 2016-10-05
EP2187732A4 (en) 2012-11-07
AU2008286791A1 (en) 2009-02-19
JP2016129519A (ja) 2016-07-21
CN101868144A (zh) 2010-10-20
JP2014239702A (ja) 2014-12-25
EP2187732A1 (en) 2010-05-26
JP2010536346A (ja) 2010-12-02
CA2706224A1 (en) 2009-02-19

Similar Documents

Publication Publication Date Title
JP6004290B2 (ja) 不活化された内因性遺伝子座を有するトランスジェニックニワトリ
US20170223938A1 (en) Transgenic chickens with an inactivated endogenous gene locus
US20170152526A1 (en) Engineering of humanized car t-cell and platelets by genetic complementation
US20170086431A1 (en) Germline transmission of chicken primordial germ cells (pgcs)
US11542319B2 (en) Transgenic chicken comprising an inactivated immunoglobulin gene
JP2017513510A (ja) ブタにおける多重遺伝子編集
JP6644276B2 (ja) 家禽始原生殖細胞の遺伝子改変方法、遺伝子改変された家禽始原生殖細胞、遺伝子改変家禽の生産方法及び家禽卵
US20240052304A1 (en) Sterile avian embryos, production and uses thereof
WO2003081992A2 (en) The functional disruption of avian immunoglobulin genes
US20210037797A1 (en) Inducible disease models methods of making them and use in tissue complementation
EP3367784A1 (en) Engineering of humanized kidney by genetic complementation
Wang et al. Transgenesis and genome editing in chickens
WO2024003907A1 (en) Totally sterile population of avian embryos, production and uses thereof
EA043573B1 (ru) Птицы с отредактированным геномом

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200880111586.1

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08797925

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2010521188

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 203944

Country of ref document: IL

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 583906

Country of ref document: NZ

Ref document number: 2008286791

Country of ref document: AU

Ref document number: 2008797925

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20107005724

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2706224

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2008286791

Country of ref document: AU

Date of ref document: 20080814

Kind code of ref document: A