WO2007043200A1 - Contrôleur de différenciation de lymphocyte t - Google Patents

Contrôleur de différenciation de lymphocyte t Download PDF

Info

Publication number
WO2007043200A1
WO2007043200A1 PCT/JP2006/305773 JP2006305773W WO2007043200A1 WO 2007043200 A1 WO2007043200 A1 WO 2007043200A1 JP 2006305773 W JP2006305773 W JP 2006305773W WO 2007043200 A1 WO2007043200 A1 WO 2007043200A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
cell
receptor
cells
amino acid
Prior art date
Application number
PCT/JP2006/305773
Other languages
English (en)
Japanese (ja)
Inventor
Sho Yamasaki
Takashi Saito
Original Assignee
Riken
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Riken filed Critical Riken
Priority to JP2007539809A priority Critical patent/JPWO2007043200A1/ja
Publication of WO2007043200A1 publication Critical patent/WO2007043200A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5047—Cells of the immune system
    • G01N33/505—Cells of the immune system involving T-cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

  • the present invention relates to a sputum cell differentiation regulator, a screening method for a sputum cell differentiation regulator, and a method for regulating sputum cell differentiation.
  • the invention also relates to a system for detecting interactions in the extracellular region between cell surface proteins.
  • Interactions in the extracellular region between cell surface proteins often can play an important role in intracellular signaling systems that control cell proliferation, differentiation, survival, and the like.
  • E POR erythropoietin receptor
  • ⁇ ⁇ erythropoietin
  • ⁇ ⁇ erythropoietin
  • E POR is located in the extracellular region. It dimerizes by binding and transmits ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ signals into the cell, controlling the proliferation and differentiation of erythrocytes.
  • Yo shi mu ra et al. Reported that EP OR with an extracellular region mutation that self-dimerized without EPO requires IL_3 for proliferation. Have been reported to be able to induce the proliferation of BAF 3 cells (referred to herein as “IL-3 dependent cells”) in the absence of IL-3 (Yoshimura et al., Nature, 348, 647-649 (1990)).
  • T POR Tobopopoietin Receptor
  • pre-T cell antigen receptor plays an important role in the development of early T cells.
  • pre-TCR ⁇ sputum cells from hematopoietic stem cells.
  • DN cells cells lacking CD4 and CD8 expression
  • pre- TCR consists of T cell antigen receptor 0 chain (TCR] 3), pre T cell antigen receptor ⁇ chain ( ⁇ ⁇ ⁇ ), CD 3 molecule (CD 3 y chain, CD 3 E chain and C ⁇ 3
  • TCR T cell antigen receptor 0 chain
  • ⁇ ⁇ ⁇ pre T cell antigen receptor ⁇ chain
  • CD 3 molecule CD 3 molecule
  • DP cells double positive cells
  • pr _TCR can transduce signals in a ligand-independent manner. For example, IrV1ng et al. Report that it is not required for extracellular Ig-like domain force signaling (see Irving et al., Science, 280, 905-8 (1998)). Saint_Ruf et al. Also show that in cell lines expressing pre-TCR, pre-TCR is present in rafts and signals without ligation to exogenous ligands ( Saint-Ruf et al., Nature, 406, 524-7 (2000)).
  • Haks et al. Proposed a ligand-independent signaling mechanism for pre-TCR. Proposed a low activity threshold for DN cells (see Haks et al., J. I. unol. 170, 2853-61 (2003)).
  • ⁇ ⁇ is not just a substitute for TCR ⁇ , but rather ⁇ ⁇ ⁇ has a unique signaling potential that differs from that of TCR a.
  • the first object of the present invention is to clarify the molecular mechanism of signal transduction by pre-TCR, and to provide a new type of drug that regulates T cell differentiation and canceration based on this mechanism.
  • pre_TCR the present inventors focused on the structure and function of p ⁇ ⁇ , a component unique to Pre-TCR. .
  • ⁇ spontaneously forms a self-dimer through electrostatic interaction with charged amino acid residues present in the extracellular region.
  • inhibition of ⁇ auto-oligomerization by substitution of these amino acid residues inhibited normal transition from DN cells to D ⁇ cells.
  • the present inventors considered that the self-dimer formation of ⁇ is an essential molecular mechanism of p r e -TCR autonomous signaling.
  • the second object of the present invention is to provide a system that can easily detect an interaction between various cell surface proteins in the extracellular region.
  • the extracellular domain of cell surface proteins and the transmembrane domain and cytoplasm of E POR When a nucleic acid encoding a chimeric protein containing a domain is introduced into an IL-13-dependent cell and expressed, when the extracellular domains interact with each other, the chimeric protein forms a dimer, It was found that the proliferation of the cells was induced in the absence of IL-3. That is, it was found that the interaction between extracellular domains of cell surface proteins can be detected using IL-3-independent cell proliferation as an index by using the chimeric protein expression system of this detection system.
  • the present invention is as follows:
  • the substance inhibiting the self-dimer formation of the pre-cell antigen receptor ⁇ chain is an antisense nucleic acid, ribozyme, s 1 RN gene or antibody against the pre-cell antigen receptor chain; or pre-T cell antigen
  • a screening method for a sputum cell differentiation regulator comprising the step of evaluating whether a test substance regulates the pre-spread cell antigen receptor ⁇ chain self-dimer formation
  • kits for screening an agent for regulating differentiation of ⁇ cells wherein a cell expressing a chimeric protein of ⁇ ⁇ and a fluorescent substance, or ⁇ ⁇ and an Ellis mouth
  • a kit comprising IL-13-dependent cells expressing a chimeric protein with a boyetin receptor or a tombopoietin receptor;
  • [1 A] A method for detecting an interaction in an extracellular region between cell surface proteins
  • a nucleic acid molecule encoding a second chimeric protein comprising the extracellular domain of the second protein and the transmembrane domain and cytoplasmic domain of the erythropoietin receptor or topopoietin receptor
  • a method comprising culturing IL-13-dependent cells into which IL is introduced in the absence of IL-3 and confirming the presence or absence of proliferation of the cells;
  • a second chimeric protein comprising the extracellular domain of the second protein and the transmembrane and cytoplasmic domains of the erythropoietin receptor or thrombopoietin receptor
  • [6A] The cell according to [4A] above, wherein the first protein and the second protein are heterologous proteins;
  • [1 OA] A kit for detecting interactions in the extracellular domain between cell surface proteins, including:
  • FIG. 1 a shows surface staining of reconstituted pre-TCR and ⁇ 0 TCR.
  • ⁇ Infect CR a nu 1 1 T cell hybridoma (TG 40 J3) with pMX—pT ⁇ / GFP-IRES—rCD2 or pMX—TCRaZGFP—IRES—rCD2 Then, it was sorted by anti-rCD2 using MAC S.
  • Cells were stained with APC-labeled anti-TCR] 3 and subjected to flow cytometry (left panel group and center panel group). Cells were also analyzed by fluorescence microscopy. A representative image is shown as a deconvolved fluorescence image (right panel group) (BZ8000, Keyence). The frequency of cells with more than 10 fluorescent spots was determined from multiscan images. This frequency is 2.7 ⁇ 3.9% (TCR a / GF P) and
  • Figure 1b shows that the internalized pre-TCR is localized in the lysosome.
  • the cells are treated with 50 nM Lyso T ra c ke rR e DND—
  • Figure 1c shows the rapid and constitutive internalization of pre-TCR.
  • Cells were prestained with PE-labeled anti-TCRO, then incubated at 37 ° C for 30 minutes and analyzed by confocal fluorescence microscopy (DMIRE2, Leica).
  • DMIRE2 confocal fluorescence microscopy
  • FIG. Id is a graph showing that pre TCR tends to form oligomers on the cell surface.
  • FIG. 2a is a schematic diagram of a ⁇ / E POR chimera and a TCR / E POR chimera.
  • FIG. 2b shows the expression of the E P OR chimera.
  • the BAF 3 cell line was infected with ⁇ / E POR chimera or TCRa / E POR chimera in pMX—IRES—GFP vector and the expression of each was analyzed by anti-E P OR immunoplot.
  • Figure 2c shows the expression of the E P OR chimera.
  • BAF 3 cell lines were infected with pTaZE POR chimera or TCRa / E POR chimera in pMX—IRES-GFP vector, and the expression of each was analyzed by anti-EPOR staining.
  • Figure 2d shows the cell viability of each B A F 3 transfectant after I L_3 wilt. Illustrated merged image of bright field and GFP after 2 B of IL-3 wilt (upper panel group). Cell viability after IL-3 wilt was determined by counting cells that were negative for iodide (P I) iodide by flow cytometry. The viability of GFP-cells (cells that do not express chimera. ⁇ ) or GFP + cells (cells that express chimera: ⁇ ) on each day is expressed as a relative percentage with the number of live cells at 0 being 100. The infection efficiency for each condition was 50% to 80% in all experiments and in 4 independent experiments that showed similar results.
  • P I iodide
  • FIG. 2e shows FRET production in T cells co-expressing pTa / CFP and pTa / YFP.
  • TG 40 in 103 cells, p TaZYF P only (left panel group), p TaZCF P and p T ⁇ / YF P (middle panel group), or Ji p T a R 1 ° 2/ 11? ? ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ / ⁇ ? (Right panel group) was transduced.
  • p The surface expression of re-TCR was verified by anti-TCR] 3 staining of each of the three cell lines as described in Figure 1a. Shows the percentage of FR ET positive cells (square gates) in YF Ph h cells (10,000 cells; black dots).
  • FIG. 3a shows the amino acid sequence of the extracellular domain of mouse ⁇ (SEQ ID NO: 7). The amino acid number of the mature protein is indicated.
  • FIG. 3b shows the substitution of charged amino acids in the extracellular domain of p ⁇ .
  • PTa ZEPOOR having the mutations shown in the figure (ml to ml9) was tested for growth promoting activity in BAF3 as shown in Figure 2d.
  • the value represents the relative activity (%) 2 days after I L-3 withering, with WT p T and ZGF P activity as 100.
  • Figure 3c shows a three-dimensional structural model of the pTa-TCR] 3 complex.
  • Functionally important charged amino acids D 22, R 24, R 102 and R 1 17 are represented by the ball and stick model.
  • FIG. 3d shows a three-dimensional structural model of the pTa-TCR] 3 complex.
  • the replaceable charged amino acids (D56, D67, E81, E82, E84 and E87) are represented by a ball and stick model.
  • Figure 4a shows that R 102 R 1 1 7 is essential for the pre-TCR spontaneous internationalization.
  • p T ⁇ w ⁇ ZGF P and p T ⁇ R102 / 117A / / GFP are introduced into TG40 cells, and surface pre- TCR expression, anti-TC R j3 APC (clay histogram) and control Ab (White histogram) was used for analysis.
  • Figure 4b shows the frequency of cells with intracellular GFP vesicles.
  • Cells were analyzed by fluorescence microscopy and multiscan images were used to count the number of cells with more than 10 bright vesicles.
  • the data is the average percent soil s.d of 5 independent fields of view.
  • Figure 4c shows the BMT reconfiguration assembly. Sca— 1 + ⁇ ⁇ ⁇ — / _ ⁇ cells were individually infected with WT p T a WT — IRES — r CD 8 or p T a R102 / 117 ⁇ — I RE S_h CD 2. r Select CD 8 or h CD 2 positive cells Then, and individually injected into irradiated R ag 2 -recipient mice. Three weeks after injection, thymocytes were collected from CD4 / CD8 (upper panel group) and CD25 (lower panel group) in the hCD8 + population (middle panel group) or rCD2 + group (right panel group). Expression was analyzed. The p T a WT surface expression and surface expression of high p ⁇ ⁇ R 1 Q 2/1 17A compares the was confirmed by staining with anti Rotauarufa.
  • Figure 4d shows a competitive BMT reconfiguration assembly.
  • thymocytes were analyzed for expression of CD4ZCD8 in either the hCD8 + (WT) goot population or the rCD2 + (R1 02 / 1117A) goot population. Data are representative three independent experiments with similar results.
  • Figure 5 shows cell viability of BAF 3 transfectant after IL-3 wilt.
  • nucleic acid molecule means single-stranded or double-stranded DNA or RNA.
  • nucleotide sequence refers to the sequence of deoxyribonucleotides (represented by A, G, C, and T) or ribonucleotides (A, G, C, And U).
  • a single-stranded nucleotide sequence represents the 5 ′ end at the left end and the 3 ′ end at the right end.
  • amino acid notation uses standard one-letter abbreviations or three-letter abbreviations for amino acids.
  • amino acid sequence represents the N-terminal (amino terminal) at the left end and the C-terminal (carboxyl terminal) at the right end.
  • T cell precursor means thymocytes lacking the expression of CD 4 and CD 8 (also called “CD 4—CD 8—double negative thymocytes” or “DN cells”). To do.
  • modulating T cell differentiation refers to the process of differentiation from CD4—CD 8-double negative thymocytes (DN cells) into CD 4 + CD 8+ double positive thymocytes (DP cells). (Ie, selection) means to promote or suppress.
  • “regulates pre-T cell antigen receptor ⁇ chain ( ⁇ ⁇ ) self-dimer formation” means to promote or suppress self-dimerization of ⁇ ⁇ at cell surface of DN cells. Means that.
  • pre-cell antigen receptor ⁇ chain ( ⁇ ) preferably means a human-derived ⁇ or a protein substantially identical thereto.
  • substantially identical means that the amino acid sequence of ⁇ derived from human is about 60% or more, preferably about 70% or more, more preferably about 80% or more, and particularly preferably about 90%.
  • the amino acid sequence having homology of about 95% or more, most preferably, is a sequence in which a protein having the amino acid sequence has substantially the same activity as human-derived ⁇ .
  • homology means an optimal alignment when two amino acid sequences are aligned using a mathematical algorithm known in the art (preferably, the algorithm is used for optimal alignment). The ratio of the same amino acid residue and similar amino acid residues to all overlapping amino acid residues in the case of introducing a gap into one or both of the sequences).
  • Similar amino acids means amino acids that are similar in physicochemical properties, for example, aromatic amino acids, aliphatic amino acids, polar amino acids, basic amino acids, acidic Examples include amino acids, amino acids having a hydroxyl group, and amino acids classified into the same group such as amino acids with small side chains. Such substitutions with similar amino acids are expected not to change the protein phenotype (ie, conservative amino acid substitutions). Examples of conservative amino acid substitutions are well known in the art and have been described in various literature (see, for example, Bowie et al., Science, 247: 1306-1310 (1990)).
  • the amino acid sequence represented by GenPept accession number ⁇ -6 12153 is about 60% or more, preferably about 70% or more, more preferably Is a protein having an amino acid sequence having a homology of about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more.
  • the protein substantially identical to the human-derived pTa used in the present invention is, for example, a protein containing the following amino acid sequence, which is substantially the same quality as human ⁇ . Also includes active proteins:
  • amino acid sequence of human ⁇ shown in SEQ ID NO: 2 (preferably about 1 to 30 pieces, preferably about 1 to 10 pieces, more preferably 1 ⁇ 5) amino acid sequences deleted of amino acids;
  • amino acids in the amino acid sequence of human ⁇ shown in SEQ ID NO: 2 preferably about 1 to 30, preferably about 1 to 10, more preferably 1 to Amino acid sequence with 5 amino acids added;
  • the position of the deleted, appended caro, inserted or substituted is not particularly limited as long as the activity of the protein is not impaired.
  • the substantially homogeneous activity includes the activity of ⁇ ⁇ ⁇ forming a self-dimer and inducing the transition from DN cells to DP cells (ie, selection of 3). .
  • substantially the same quality means that these properties are qualitatively equivalent. Accordingly, the quantitative factors such as the above-mentioned degree of activity are preferably equivalent, but may be different (eg, about 0.1 to about 100 times, preferably about 0.1 to about 1). 0 times, more preferably about 0.5 to about 2 times).
  • the self-dimer formation of p T can be confirmed and quantified by the method described in the screening method described later.
  • the transition from DN cells to DP cells can be confirmed and quantified by detecting CD4 molecules and CD8 molecules expressed on the cell surface using antibodies that specifically react with each of these molecules.
  • Examples of the detection method of the antibody include a method using fluorescence (for example, Fluorescence Activated Cell Sorter (FACS) method) and a method using enzyme reaction (for example, Enzyme-Linked Immunosorbent As say (ELISA) method).
  • FACS Fluorescence Activated Cell Sorter
  • ELISA Enzyme-Linked Immunosorbent As say
  • extracellular domain of a protein means the entire region (domain) existing outside the cell surface protein or any fragment thereof.
  • transmembrane domain of a protein means the entire region (domain) penetrating the cell membrane of a cell surface protein or any fragment thereof.
  • cytoplasmic domain of a protein means the entire region (domain) present in the cytoplasm of a cell surface protein or any fragment thereof.
  • chimeric protein (hereinafter also simply referred to as “chimera”) means a fusion protein composed of two or more domains derived from different proteins, unless otherwise specified.
  • IL-3 dependent cell means a cell that requires IL-13 for survival and proliferation (in other words, a cell that cannot proliferate in the absence of IL-13).
  • the present invention relates to a T cell differentiation regulator, a method for regulating T cell differentiation, and a screening method for a T cell differentiation regulator.
  • the present invention provides a T cell differentiation modulating agents comprising an agent that modulates self dimerization of p T alpha. More specifically, the present invention relates to a ⁇ cell differentiation promoting agent comprising a substance that promotes self-dimer formation of ⁇ ⁇ ⁇ and a substance that suppresses ⁇ self-dimer formation. Provide the agent.
  • the sputum cell differentiation regulator of the present invention is a sputum cell differentiation promoting agent, and the promoter is a self-dimer of ⁇ ⁇ ⁇ on the cell surface of a sputum cell precursor (ie, DN cell).
  • a sputum cell precursor ie, DN cell.
  • DN cell a sputum cell precursor
  • Substances that promote the formation of ⁇ ⁇ ⁇ self-dimer include substances that can specifically act on the target molecule ⁇ ⁇ ⁇ in order to minimize the effect on other genes and / or proteins. It is desirable to be. Examples of such a substance include a nucleic acid molecule encoding ⁇ and a substance obtained by a screening method described later.
  • Nucleic acid molecule encoding ⁇ refers to a nucleic acid molecule capable of expressing ⁇ in a cell when introduced into a DN cell. ⁇ ⁇ ⁇ expressed by the nucleic acid molecule can promote selection by forming a dimer between them or ⁇ inherent to the cell into which the nucleic acid molecule has been introduced.
  • nucleic acid molecules encoding ⁇ ⁇ ⁇ include genomic DNA, mRNA, and cDNA.
  • Nucleic acid molecules encoding pT are amplified by PCR (Polymerase Chain Reaction) fe or RT-PCR (Reverse Transcriptase-Polymerase Chain Reaction) using appropriate primers and genomic DNA or cDNA. can do.
  • nucleic acid molecule encoding p ⁇ ⁇ examples include DN ⁇ containing the nucleotide sequence of the entire coding region of human p ⁇ ⁇ shown in GenBank accession number: NM_138296 (SEQ ID NO: 1), or the DNA and hystrin Salt that hybridizes under mild conditions Substantially the same activity as the protein containing the base sequence and the amino acid sequence of p ⁇ ⁇ shown in SEQ ID NO: 2 (self-dimer by the interaction of amino acid residues in the extracellular region) DNA encoding a protein having a body-forming activity).
  • Examples of the DN ⁇ ⁇ ⁇ that can hybridize under highly stringent conditions include, for example, the base sequence represented by SEQ ID NO: 1, about 60% or more, preferably about 70% or more, more preferably about 80% or more, Particularly preferably, DNA containing a base sequence having a homology of about 90% or more can be used.
  • NCBI BLAST National Center for Biotechnology Information Basic Local Algment oe arch Tool
  • the above-described algorithm for calculating homology of amino acid sequence is also preferably exemplified.
  • Hybridization can be performed according to a method known per se or a method analogous thereto, for example, the method described in Molecular Clonings 2nd
  • hybridization can be performed according to the method described in the attached instruction manual.
  • the hybridization can be performed preferably under highly stringent conditions.
  • High stringent conditions include, for example, a sodium salt concentration of about 19 to about 4 O mM, preferably about 19 to about 2 O mM, and a temperature of about 50 to about 70 ° C, preferably Examples include conditions of about 60 to about 65 ° C. In particular, it is preferable that the sodium salt concentration is about 19 mM and the temperature is about 65 ° C.
  • the salt concentration of the hybridization solution the temperature of the hybridization reaction, the probe concentration, the length of the probe, the number of mismatches, the hybridization Understand that it can be easily adjusted to the desired stringency by appropriately changing the duration of the reaction, the salt concentration of the washing solution, the washing temperature, etc.
  • the nucleic acid molecule encoding the pT gene is inserted into an appropriate expression vector, for example, and then transferred to a T cell precursor according to a method known in the art (for example, the method described in Virology, 52, 456 (1973)). It can be introduced into the body (DN cells).
  • an expression vector containing a nucleic acid molecule encoding pT is prepared by preparing a fragment of interest from a nucleic acid molecule encoding ⁇ and ligating the fragment downstream of an appropriate promoter in the expression vector.
  • expression vectors include animal virus vectors such as retrovirus and vaccinia virus (for example, IRES bicystic expression vector, pA1-1-11, pXTl, pRc / CMV, pRc / RSV, pc DNA l / N eo, pME 1 8 S), etc. are used.
  • the promoter may be any suitable promoter corresponding to the host used for gene expression, such as LCK proximal promoter, SRa promoter, SV40 promoter, RSV- LTR promoter, CMV promoter, H SV—TK promoter or the like is used.
  • the expression vector may contain an enhancer, a splicing signal, a poly A addition signal, a selection marker or a reporter gene, an SV40 origin of replication (SV40r1), etc., as necessary.
  • selection marker and reporter gene examples include a green fluorescent protein (GFP) gene, a luciferase gene, a 0-galactosidase gene, a dihydrofolate reductase gene, an ampicillin resistance gene, and a neomycin resistance gene.
  • GFP green fluorescent protein
  • the T cell differentiation regulator of the present invention is a T cell differentiation inhibitor, which suppresses pT ⁇ self-replication on the cell surface of a T cell precursor (ie, DN cell). Contains substances that suppress the formation of a mass. Such a substance is ⁇ ⁇ By directly or indirectly suppressing the formation of the monomer, the transition from DN cells to DP cells (ie / 3 selection) can be suppressed.
  • Substances that suppress the formation of pT self-dimer include substances that can act specifically on the target molecule ⁇ ⁇ ⁇ in order to minimize the effects on other genes and ⁇ or proteins. It is desirable to be. Examples of such substances include antisense nucleic acids, ribozymes, s1 RNA and antibodies against ⁇ ; fragments of the extracellular domain of ⁇ , and substances obtained by the screening method described below. It is done.
  • Antisense nucleic acid, ribozyme and slRNA against ⁇ ⁇ ⁇ act on the nucleic acid molecule encoding p ⁇ ⁇ in the T cell precursor, and can suppress the expression of ⁇ ⁇ in DN cells.
  • An antisense nucleic acid consists of a base sequence that can hybridize with a target mRNA (initial transcript) under physiological conditions, and is a protein or polypeptide encoded by the target mRNA (initial transcript) in a hybridized state. It can be a nucleic acid that can inhibit the translation of.
  • the type of antisense nucleic acid may be DNA, RNA, or a DNA_RNA chimera.
  • antisense nucleic acids include increased water solubility and cell membrane permeability, which can be overcome by devising dosage forms such as the use of ribosomes and microspheres. it can.
  • the length of the antisense nucleic acid is not particularly limited as long as it can specifically hybridize with the target mRNA or the initial transcript.
  • the length of the antisense nucleic acid is at least about 15 bases, and the entire length of the mRNA (initial transcript) is long. Sequences that contain sequences complementary to It may be. From the viewpoint of ease of synthesis, antigenicity problems, etc., an oligonucleotide consisting of preferably about 15 to about 30 bases is exemplified.
  • antisense nucleic acids not only hybridize with target mRNA or initial transcripts to inhibit translation, but also bind to target genes that are double-stranded DNA to form triplex. It may be capable of inhibiting transcription to niRNA.
  • a ribozyme refers to a nucleic acid molecule (mainly RNA) having an enzymatic activity to cleave nucleic acid.
  • RNA nucleic acid molecule
  • p ⁇ ⁇ mRNA or an initial transcript can be specifically cleaved within the coding region (including an intron in the case of the initial transcript).
  • ribozyme includes DNA as long as it has a sequence-specific nucleic acid cleaving activity.
  • the most versatile ribozyme is self-splicing RNA found in infectious RNAs such as virus, and the hammerhead type and hairpin type are known.
  • siRNA is a double-stranded oligo RNA corresponding to a partial distribution sequence (including an intron in the case of an initial transcript) within the coding region of a target mRNA or initial transcript.
  • RNA interference RNA interference
  • a short double-stranded RNA is introduced into a cell and mRNA complementary to the RNA is degraded, has long been known in nematodes, insects, plants, etc.
  • this phenomenon also occurs in animal cells (Nature, 411 (6836): 494-498 (2001)), so it is attracting attention as an alternative to ribozyme.
  • Antisense oligo nucleotides and ribozymes are, for example, Dinghio.
  • the target sequence of mRNA or initial transcript is determined based on the 0A sequence (eg, SEQ ID NO: 1) and complemented with a commercially available DNAZRNA automatic synthesizer (Applied Biosystems, Beckman, etc.) By synthesizing specific sequences Can be made.
  • s 1 RNA can be synthesized by synthesizing a sense strand and an antisense strand with a DNAZRNA automatic synthesizer and denatured in an appropriate annealing buffer at about 90 to about 95 ° C. for about 1 minute, and then about 30 to It can be prepared by annealing at about 70 ° C for about 1 to about 8 hours.
  • a longer double-stranded polynucleotide is prepared. You can also.
  • Antibodies to ⁇ ⁇ ⁇ , and fragments of the extracellular domain of ⁇ ⁇ ⁇ may contain one or more of the amino acid residues involved in ⁇ ⁇ ⁇ self-dimerization (eg, 1, 2, 3 or 4 ) Can suppress the formation of self-dimer of ⁇ ⁇ ⁇ .
  • amino acid residue involved in the formation of a self-dimer of ⁇ may be a charged amino acid residue existing in a region (domain) existing outside of ⁇ .
  • amino acid residues involved in ⁇ ⁇ ⁇ self-dimer formation include the 38th Asp and 40th Lys in the amino acid sequence of SEQ ID NO: 2; 1 1 8th Arg, and 1 3 3rd Arg.
  • amino acids are highly conserved among species, when targeting species other than human, the amino acid residues corresponding to the above may be targeted.
  • the antibody against ⁇ may be a polyclonal antibody or a monoclonal antibody as long as it can inhibit the formation of ⁇ dimer, and is prepared by an immunological technique well known in the art as exemplified below. be able to.
  • anti- ⁇ antibody fragments can also be used as long as they can inhibit the formation of ⁇ dimers. Examples of such antibody fragments include Fab, F (ab ′) 2 , ScFv, and mlnlbody.
  • Polyclonal antibodies can be used, for example, with p ⁇ or a fragment thereof as an antigen and a commercially available adjuvant (for example, complete or incomplete Freund's adjuvant)
  • a commercially available adjuvant for example, complete or incomplete Freund's adjuvant
  • it is administered to the animal subcutaneously or intraperitoneally about 2 to 4 times every 2 to 3 weeks (measure the antibody titer of the partially collected serum by a known antigen-antibody reaction and confirm its rise) It can be obtained by collecting whole blood about 3 to about 10 days after the final immunization and purifying the antiserum.
  • animals to which the antigen is administered include mammals such as rats, mice, rabbits, goats, guinea pigs, and hamsters.
  • the fragment When a p ⁇ fragment is used as the antigen, the fragment contains one or more amino acid residues (eg, 1, 2, 3 or 4) involved in the formation of ⁇ self-dimer. Including.
  • a monoclonal antibody (m A b) can be prepared, for example, by a cell fusion method.
  • the above antigen is administered to mice subcutaneously or intraperitoneally 2-4 times with a commercially available adjuvant, and spleen or lymph nodes are collected approximately 3 days after the final administration, and leukocytes are collected.
  • This leukocyte and myeloma cells (for example, NS-1, P 3 X 6 3 A g 8 and the like) are cell-fused to obtain a hybridoma that produces a monoclonal antibody against the antigen.
  • This cell fusion may be performed by the PEG method [J. Immunol. Methods, 81 (2): 223-228 (1985)], or the voltage pulse method [Hybridoma, 7 (6): 627-633 (1988) You may also go in.
  • a hybridoma producing a desired monoclonal antibody can be selected by detecting an antibody that specifically binds to an antigen from the culture supernatant using a well-known EIA or RIA method.
  • the culture of the hybridoma producing the monoclonal antibody can be performed in vitro or in vivo, such as mouse or rat, preferably mouse ascites, and the antibody can be obtained from the culture supernatant of the hybridoma and the ascites of the animal, respectively. .
  • the anti-pTc antibody is preferably a chimeric antibody of human and other animals (eg, mouse), and is a humanized antibody. Is more preferable, and a complete human antibody is particularly preferable.
  • chimeric antibody refers to an antibody having a variable region (V region) derived from an immunized animal and a constant region (C region) derived from human, and “human antibody” is other than CDR. An antibody in which all of these regions are replaced with human antibodies.
  • a chimeric antibody-humanized antibody for example, excises a V region or CDR coding sequence from a mouse monoclonal antibody gene prepared by the same method as described above, and encodes a human myeloma-derived antibody C region. It can be obtained by cloning a chimeric gene fused with DNA into an appropriate expression vector, introducing it into an appropriate host cell and expressing the chimeric gene.
  • human antibody-producing animal or phage It is desirable to manufacture using the display method.
  • human antibody-producing animals examples include XenoMouse (Abgenix); Huab Mouse (Medarex); KM Mouse (Kirin Brewery).
  • phage display libraries include CAT libraries; MRC libraries; Dyax libraries; Morphosys HuCAL libraries; Biolvent libraries; Crucel l libraries, and the like.
  • Fragment of extracellular domain of p ⁇ ⁇ has the ability to form an oligomer with DN cell's natural ⁇ ⁇ ⁇ , but induces the transition from DN cell to D ⁇ cell (ie, 3 choices) It means any fragment of the extracellular domain (domain) of ⁇ ⁇ . Such fragments can inhibit the binding of native ⁇ ⁇ ⁇ to other native ⁇ ⁇ ⁇ by binding to the native ⁇ ⁇ ⁇ of DN cells.
  • the extracellular domain fragment of ⁇ ⁇ ⁇ used in the present invention contains one or more amino acid residues involved in self-dimer formation (eg, 1, 2, 3 or 4). Including fragments that cannot induce 3 selection even when bound to the native ⁇ of DN cells.
  • amino acid residue involved in self-dimer formation in the fragment is human. force the amino acid residues include the p T alpha These amino acid residues, two long as dimer forming ability is not lost, which may be substituted by a similar amino acid (eg if, A sp and G lu; Conservative amino acid substitution between Arg and Lys).
  • the present invention also provides a method of modulating ⁇ cell differentiation by modulating ⁇ autodimer formation in vitro or in vivo.
  • the method relates to a method of modulating sputum cell differentiation by modulating self-dimer formation of ⁇ ⁇ in the in vitro mouth, the method comprising the presence of the above-described sputum cell differentiation regulator Below, it includes culturing sputum cell precursors (ie, DN cells).
  • nucleic acid molecule When a nucleic acid molecule is used as a cell differentiation regulator, the nucleic acid molecule can be used alone or after insertion into a suitable vector such as a plasmid or viral vector (for example, a retroviral vector) and then according to methods well known in the art. , ⁇ cell precursors.
  • a suitable vector such as a plasmid or viral vector (for example, a retroviral vector)
  • the protein when used as a ⁇ cell differentiation regulator, the protein can be mixed with the medium as it is.
  • a nucleic acid molecule encoding the protein may be inserted alone or into an appropriate vector, and then introduced into cells according to a method well known in the art.
  • MEM medium for example, MEM medium, DMEM medium, RPMI 1640 medium, 199 medium and the like containing about 5 to 20% fetal urine serum (FB S) are used.
  • FB S fetal urine serum
  • the pH of the medium is preferably about 6-8.
  • the culture is usually performed at about 30 ° C to 40 ° C for about 1 day to about 1 week, preferably about 1 day to about 3 hours. Ventilation and agitation may be performed as necessary.
  • the method relates to a method of modulating sputum cell differentiation by modulating self-dimer formation of ⁇ ⁇ in vivo, the method comprising: Administration.
  • mammals include primates, laboratory animals, livestock, pets, etc. Specific examples include, but are not limited to, humans, monkeys, rats, mice, guinea pigs, rabbits, horses, mice, goats, hidges, nu, cats. Preferably, the mammal is human.
  • nucleic acid molecule As a T cell differentiation regulator, after inserting the nucleic acid molecule alone or into an appropriate vector such as plasmid or viral vector (for example, those listed above as one expression vector), It can be administered to a mammal according to methods well known in the art.
  • an appropriate vector such as plasmid or viral vector (for example, those listed above as one expression vector)
  • the protein when used as a T cell differentiation regulator, the protein itself can be administered to a mammal by a DDS (drug delivery system) technique known in the art by devising a dosage form.
  • the nucleic acid molecule encoding the protein can be administered alone or after being inserted into an appropriate vector (for example, those listed as expression vectors above) and then administered according to methods well known in the art.
  • the T cell differentiation regulator of the present invention may further comprise a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers include excipients, diluents, extenders, disintegrants, stabilizers, preservatives, buffers, emulsifiers, thickeners, solubilizers or other additives. .
  • the T cell differentiation regulator of the present invention can be administered orally or parenterally by using one or more of the above carriers.
  • the dosage of a T cell differentiation regulator varies depending on the subject of administration, administration method, treatment time, type of active ingredient contained in the agent, etc., but is usually per adult (with a body weight of 6 O kg) A single dose can be administered in the range of lO jug to 100 O mg.
  • an amount obtained by converting the above value into the body weight of the mammal can be administered.
  • a dose smaller than the above dose may be sufficient, and a dose exceeding the above range may be required.
  • the present invention also provides a method for screening a T cell differentiation regulator.
  • the screening method of the present invention includes evaluating whether a test substance modulates (promotes or suppresses) self-dimer formation of ⁇ . Specifically, the evaluation can be performed by comparing the degree of self-dimer formation of ⁇ in the presence and absence of the test substance.
  • test substance used in this screening method may be any known compound or new compound.
  • the test substance is not particularly limited.
  • nucleic acid, carbohydrate, lipid, protein, peptide, antibody, organic or inorganic low molecular weight compound, organic or inorganic high molecular weight compound, combinatorial chemistry technique is used.
  • Compound libraries prepared in this way random peptide libraries prepared by solid-phase synthesis or phage display methods, or natural components derived from microorganisms, animals and plants.
  • ⁇ self-dimer formation can be detected and quantified, for example, by the following method:
  • a method using a chimeric protein of ⁇ and a fluorescent protein and a cell expressing a chimeric protein of ⁇ and an erythropoietin receptor (E POR), or ⁇ and a thrombopoietin receptor (T POR) And a method using cells expressing a chimeric protein.
  • E POR erythropoietin receptor
  • T POR thrombopoietin receptor
  • Screening method using chimera protein of ⁇ ⁇ ⁇ and fluorescent protein is, for example, Total Internal Reflection Fluorescence : TIRF) Microscopic analysis; Fluorescence Resonance Enargy Transfer (F RET) analysis.
  • the screening method using TIRRF microscopic analysis can detect ⁇ ⁇ ⁇ simple substance and dimer separately from the fluorescence intensity of the luminescent spot using cells expressing a chimera of ⁇ ⁇ ⁇ and fluorescent protein.
  • Fluorescent proteins used for this analysis include GFP, RFP, YFP, C FP, Kusabira-orange, etc. are mentioned.
  • the screening method using FRET analysis consists of the first fluorescent protein (excitation light wavelength I., fluorescence wavelength; LJ and pT human chimeric protein, the second fluorescence protein (excitation light wavelength, fluorescence wavelength L 2 ) and ⁇ .
  • the cells can be irradiated with light of wavelength; I. Fluorescence of wavelength ⁇ 2 indicating the formation of the dimer can be detected.
  • Examples of combinations of the first and second fluorescent proteins used in this analysis include C F ⁇ and YF ⁇ .
  • human pT is preferably used as the human ⁇ .
  • human ⁇ for example, an amino acid sequence represented by the amino acid sequence represented by SEQ ID NO: 2 or a protein having substantially the same amino acid sequence is used (here, “substantially identical” The same as above).
  • a cell expressing a chimeric protein of ⁇ and a fluorescent protein can be prepared by preparing a nucleic acid molecule encoding the chimeric protein and introducing the nucleic acid molecule into an appropriate cell.
  • a nucleic acid molecule that encodes a chimeric protein of ⁇ ⁇ ⁇ and a fluorescent protein is a nucleic acid molecule that encodes ⁇ ⁇ ⁇ and a nucleic acid molecule that encodes a desired fluorescent protein. For example, it can be produced by a technique using a PCR method.
  • nucleic acid molecules encoding ⁇ include genomic DNA, mRNA, cDNA, and the like.
  • nucleic acid molecule examples include DNA containing the base sequence of the entire coding region of human ⁇ shown in GenBank accession number: NM_138296 (SEQ ID NO: 1), or the DNA and the high stringency. Base sequences that hybridize under mild conditions And a protein containing the amino acid sequence of ⁇ ⁇ ⁇ shown in SEQ ID NO: 2 and substantially the same activity (the self-dimer is formed by the interaction of amino acid residues in the extracellular region) DN ⁇ that encodes a protein having a high activity).
  • DNA that can hybridize under highly stringent conditions include, for example, about 60% or more, preferably about 70% or more, more preferably about 80% or more, of the base sequence shown in SEQ ID NO: 1. Particularly preferably, DNA containing a nucleotide sequence having a homology of about 90% or more can be used.
  • An expression vector containing a nucleic acid molecule that encodes a chimeric protein of p ⁇ and a fluorescent protein is prepared, for example, by preparing a target fragment (target gene) from the nucleic acid molecule encoding the chimeric protein. Can be produced by ligating downstream of the promoter in an appropriate expression vector.
  • expression vectors and promoters include animal virus vectors such as retrovirus and vaccinia virus (eg, IRES bicistronic expression vector, pA l—11, pXTl, pRcCMV, pRc / RSV, pc DNA
  • animal virus vectors such as retrovirus and vaccinia virus (eg, IRES bicistronic expression vector, pA l—11, pXTl, pRcCMV, pRc / RSV, pc DNA
  • nucleic acid molecule encoding a chimeric protein with the first fluorescent protein
  • the nucleic acid molecule encoding the chimeric protein with the two fluorescent proteins may be inserted on the same vector or on a separate vector.
  • both nucleic acid molecules When inserted on the same vector, both nucleic acid molecules may be under the control of separate promoters or may be under the control of the same promoter using an IRES bicistronic expression vector.
  • an appropriate promoter corresponding to the host used for gene expression is used.
  • LCK proximal promoter SRa promoter
  • SV40 promoter SV40 promoter
  • RSV-L TR promoter SV40 promoter
  • CMV promoter motor HSV-TK promoter, etc.
  • the expression vector may contain an enhancer, a splicing signal, a poly A addition signal, a selection marker or a reporter gene, 340 origin of replication (3 V40 o r i), etc., as necessary.
  • selection marker and reporter gene examples include a GFP gene, a luciferase gene, a J3-galactosidase gene, a dihydrofolate reductase gene, an ampicillin resistance gene, and a neomycin resistance gene.
  • the expression vector is preferably an IRES bicistronic expression vector in which the gene of interest is expressed from the same mRNA together with a selectable marker or reporter.
  • IRES bicystic expression vectors are commercially available from pMX—IRES—GFP (Kitamura et al., Int. J. Hematol., 67, 351-9 (1998)), and CI ontech. A vector etc. are mentioned.
  • Gene introduction into a cell can be performed according to a method known in the art (for example, the method described in Virology, 52, 456 (1973)).
  • Confirmation of gene transfer into a cell can be performed, for example, by a method using the above-described selection marker and reporter.
  • a medium for culturing cells for example, a MEM medium, DMEM medium, RPMI 1640 medium, and 199 medium containing about 5 to 20% fetal urine serum (FBS) are used.
  • FBS fetal urine serum
  • the pH of the medium is preferably about 6-8. Culturing is usually performed at about 30 ° C to 40 ° C for about 1 day to about 1 week, preferably about 1 day to about 3 days. Ventilation and agitation may be performed as necessary. In the TI RF microscopy analysis, cells were measured using a total internal reflection fluorescence (TI RF) microscope (Biochem. Biophys. Res. Commun., 235, 47-53 (1997); Nature, 374, 555-9 (1995)). Can be imaged. Aq ua C osm recording and analysis of the resulting images
  • the fluorescence intensity can be determined according to the method described in Nature, 374, 555-9 (1995), for example.
  • fluorescence resonance energy transfer from a first fluorescent material to a second fluorescent material in a cell can be detected, for example, using flow cytometry.
  • EOR Erythropoietin receptor
  • TPOR thrombopoietin receptor
  • IL-3 expressing a chimeric protein containing the extracellular domain of p ⁇ , the transmembrane domain of E POR, and the extracellular domain (hereinafter also referred to as “p Ta / E POR chimera”).
  • I L_ expressing a dependent protein or a chimeric protein containing the extracellular domain of ⁇ ⁇ ⁇ and the transmembrane domain and extracellular domain of TP OR (hereinafter also referred to as “P ⁇ ⁇ , ⁇ P OR chimera”) If 3-dependent cells are used, the formation of ⁇ self-dimer can be evaluated using the proliferation of the cells in the absence of IL-13 as an index.
  • human ⁇ ⁇ is preferably used as ⁇ ⁇ ⁇ ⁇ used for the above chimeric protein.
  • Examples of the extracellular domain of human ⁇ ⁇ include, for example, the amino acid sequence shown by SEQ ID NO: 2 (full-length amino acid sequence of human ⁇ ⁇ ⁇ ), amino acid sequence shown by amino acid numbers 17 to 147, or Proteins having substantially the same amino acid sequence are used (where “substantially identical” has the same meaning as above).
  • SEQ ID NO: 2 full-length amino acid sequence of human ⁇ ⁇ ⁇
  • amino acid sequence shown by amino acid numbers 17 to 147 or Proteins having substantially the same amino acid sequence are used (where “substantially identical” has the same meaning as above).
  • human E P OR used for the chimeric protein human E P OR is preferably used.
  • the transmembrane domain and cytoplasmic domain of human E POR for example, in amino acid sequence represented by GenPept accession number AAA52403 (SEQ ID NO: 4) (full-length amino acid sequence of human EPOR), amino acid no.
  • a protein having the amino acid sequence shown by 508 or a protein having substantially the same amino acid sequence is used (where “substantially identical” has the same meaning as above).
  • human TP OR is used as the TP OR used in the chimeric protein.
  • Examples of the transmembrane domain and cytoplasmic domain of human TPOR include amino acid numbers 468 to 61 in the amino acid sequence (full-length amino acid sequence of human TPOR) represented by GenPept accession number: NP_005364 (SEQ ID NO: 6).
  • a protein having an amino acid sequence represented by 0 or a protein having substantially the same amino acid sequence is used (where “substantially identical” has the same meaning as above).
  • EPOR or TPOR is derived from these parts when all of its transmembrane domain and cytoplasmic domain are used as a protein that constitutes the chimera, but the chimeric protein forms a dimer. Any part of these domains may be used as long as the resulting activity (the activity that induces the proliferation of IL-13-dependent cells in the absence of IL-13) is not lost. Do not autonomic dimerize).
  • IL-3 dependent cells expressing a p TaZE POR chimera or pT ⁇ / T POR chimera create a nucleic acid molecule encoding the chimeric protein and introduce the nucleic acid molecule into an IL-13 dependent cell Can be produced.
  • Nucleic acid molecules encoding ⁇ ⁇ ZE POR chimera or ⁇ ⁇ ⁇ / TPOR chimera are nucleic acid molecules encoding p T nuclei or fragments containing the extracellular domain thereof, and E POR or TPOR or their transmembrane domains and cytoplasm Using a nucleic acid molecule encoding a fragment containing a domain, it can be produced by a gene recombination technique known in the art (for example, a technique using a PCR method).
  • nucleic acid molecules encoding p ⁇ include genomic DNA, mRNA, cDNA and the like.
  • the extracellular domain of pTc can be amplified by the PCR method, RT-PCR method, etc. using genomic DNA or cDNA as a cage and using appropriate primers.
  • nucleic acid molecule encoding p ⁇ ⁇ for example, DN A containing the base sequence of the entire coding region of human pT ct shown in GenBank accession number: ⁇ _138296 (SEQ ID NO: 1), or the DN A And a protein containing a base sequence that hybridizes under highly stringent conditions and having the amino acid sequence of pT shown in SEQ ID NO: 2, substantially the same activity (residual amino acid residues in the extracellular region).
  • DNA that encodes a protein having an activity of forming a self-dimer due to the interaction of the group can be mentioned.
  • Examples of the DN ⁇ ⁇ ⁇ that can hybridize under highly stringent conditions include, for example, the base sequence represented by SEQ ID NO: 1, about 60% or more, preferably about 70% or more, more preferably about 80% or more, Particularly preferably, DNA containing a nucleotide sequence having a homology of about 90% or more can be used.
  • nucleic acid molecules encoding E P OR include genomic DNA, mRNA, and cDNA.
  • the transmembrane domain and cytoplasmic domain of EPOR can be amplified by the PCR method, the RT-PCR method, etc. using genomic DNA or cDNA as a saddle and appropriate primers.
  • DNA encoding EP OR examples include DNA containing the nucleotide sequence of the entire coding region of human EP OR shown in GenBank accession number: M60459 (SEQ ID NO: 3), or highly stringent with the DNA. It contains a nucleotide sequence that hybridizes under conditions, and has substantially the same activity as a protein containing the amino acid sequence of EPOR shown in SEQ ID NO: 4. DNA encoding a protein having an activity to grow in the absence of IL-13.
  • Examples of the DNA that can hybridize under the high stringent conditions include, for example, the base sequence represented by SEQ ID NO: 3, about 60% or more, preferably about 70% or more, more preferably about 80% or more, Particularly preferably, DNA containing a base sequence having a homology of about 90% or more can be used.
  • nucleic acid molecules encoding T POR
  • genomic DNA examples include genomic DNA, mRNA, and cDNA.
  • the transmembrane domain and cytoplasmic domain of TPOR can be amplified by PCR method, RT-PCR method, etc. using genomic DNA or cDNA as a cage and using appropriate primers.
  • DNA encoding TPOR examples include DNA containing the nucleotide sequence of the entire coding region of human T POR shown in GenBank accession number: N_005373 (SEQ ID NO: 5), or the DNA and high stringency. Contains a nucleotide sequence that hybridizes under mild conditions, and has substantially the same activity as the protein containing the amino acid sequence of TPOR shown in SEQ ID NO: 6. DNA encoding a protein having an activity of growing in the absence of IL_3).
  • DNA that can hybridize under conditions of high stringency examples include, for example, about 60% or more, preferably about 70% or more, more preferably about 80% or more, with the base sequence shown in SEQ ID NO: 5. Particularly preferably, DNA containing a nucleotide sequence having a homology of about 90% or more can be used.
  • An expression vector containing a nucleic acid molecule encoding a ⁇ E POR chimera or a ⁇ / T POR chimera can be prepared in the same manner as the above chimera of pTa and a fluorescent protein.
  • Gene transfer into IL-13-dependent cells can be performed according to a method known in the art (for example, the method described in Virology, 52, 456 (1973)).
  • IL-13-dependent cells examples include mouse pro B cell line Ba / F3 (BAF3), mouse mast cell line IC2, and mouse bone marrow cell line F-36P.
  • BAF3 mouse pro B cell line Ba / F3
  • IC2 mouse mast cell line
  • F-36P mouse bone marrow cell line
  • BAF 3 can be used as an IL_3 dependent cell.
  • Confirmation of gene transfer into IL-3-dependent cells can be achieved by, for example, using a selection marker and a reporter as exemplified in the chimera of ⁇ and fluorescent protein described above, using antibodies against E POR or T POR. It can be done with the plot used; or any combination thereof.
  • Examples of the medium and conditions for culturing IL-13-dependent cells include the medium and conditions exemplified in the above chimera of ⁇ and fluorescent protein.
  • the presence or absence of interaction between ⁇ ⁇ / E POR chimera or pTaZTPOR chimera can be confirmed by the viability of the transfected IL-13-dependent cells in the absence of IL-13 .
  • Cell viability can be determined, for example, by counting cells that are negative for iodide ( ⁇ ) by flow cytometry.
  • the present invention also provides a kit for detecting a substance that modulates ⁇ ⁇ ⁇ self-dimer formation.
  • the kit includes a cell expressing a chimeric protein of ⁇ and a fluorescent substance described in the above screening method, or an IL-3-dependent cell expressing a chimeric protein of ⁇ and EPOR or TPOR. .
  • the user can perform the above screening method using the kit of the present invention.
  • the present invention also relates to a system that can easily detect an interaction between various cell surface proteins in the extracellular region (hereinafter sometimes abbreviated as “the detection system of the present invention”).
  • the detection system of the present invention comprises a nucleic acid molecule encoding a first chimeric protein comprising an extracellular domain of a first protein and a transmembrane domain and a cytoplasmic domain of an erythropoietin receptor or tombopoietin receptor, and IL-introduced with a nucleic acid molecule encoding a second chimeric protein comprising the extracellular domain of the second protein and the transmembrane domain and cytoplasmic domain of the erythropoietin receptor or tombopoietin receptor.
  • the detection method of the present invention comprises a step of confirming the presence or absence of cell growth.
  • the detection system of the present invention also includes a first chimeric protein comprising a extracellular domain of a first protein, a transmembrane domain and a cytoplasmic domain of an erythropoietin receptor or thrombopoietin receptor, and a second tan IL-13-dependent cells expressing a second chimeric protein comprising an extracellular domain of a protein and a transmembrane domain and a cytoplasmic domain of erythropoietin receptor or thrombopoietin receptor are provided.
  • the detection system of the present invention also provides a chimeric protein comprising an extracellular domain of a cell surface protein and a transmembrane domain and a cytoplasmic domain of an erythropoietin receptor or tombopoietin receptor.
  • the chimeric protein used in the detection system of the present invention comprises an extracellular domain of a cell surface protein to be tested for protein-protein interaction, and a transmembrane domain of the erythropoietin receptor (EPOR) or thrombopoietin receptor (TPOR). It consists of a domain and a cytoplasmic domain.
  • EPOR erythropoietin receptor
  • TPOR thrombopoietin receptor
  • first protein and second protein refer to cell surface proteins that are tested for interactions in the extracellular region between proteins.
  • first protein and the “second protein” may be the same type of protein or different types of proteins.
  • first protein and the “second protein” are collectively referred to as “test protein”.
  • any natural or human cell surface protein can be selected as a test protein in the detection system of the present invention.
  • the protein constituting the receptor is the detection cis of the present invention.
  • test protein in the detection system of the present invention include ⁇ (for example, GenBank accession number: MN_138296; GenPept accession number NP 612153; Saint-Ruf, C. et al., Science, 266, 1208- 1212, 1994); TCR a (eg GenBank registration number: AY475220, GenPept registration number. See AAS48060); TCR 3 (eg GenBank registration number: AY475218; GenPept registration number: see AAS48058) etc.
  • any protein presumed to be a transmembrane (membrane-bound) protein by a hydrophobic plot for example, Kyte-Dool ittle's hydrophobicity analysis may be used.
  • protein extracellular domain means the entire region (domain) existing outside the cell surface protein or any fragment thereof.
  • the transmembrane domain and cytoplasmic domain of erythropoietin receptor are preferably a region of human EPOR that penetrates the cell membrane (domain) and a region that exists in the cytoplasm ( Domain), or a protein substantially identical to the same (hereinafter, sometimes abbreviated as “active domain of EPOR”).
  • amino acid sequence of the active domain of human EPOR is about 60% or more, preferably about 70% or more, more preferably about 80% or more, particularly preferably.
  • homology refers to an optimal alignment when two amino acid sequences are aligned using a mathematical algorithm known in the art (preferably, the algorithm uses the sequence for optimal alignment). The ratio of the same amino acid residue and similar amino acid residues to all overlapping amino acid residues in the case of introducing a gap in one or both of Taste.
  • Similar amino acids '' mean amino acids that are similar in physicochemical properties, such as aromatic amino acids, aliphatic amino acids, polar amino acids, basic amino acids, acidic amino acids, amino acids having hydroxyl groups, amino acids with small side chains, etc. Amino acids that fall into the same group. Such substitutions with similar amino acids are expected not to change the protein phenotype (ie, conservative amino acid substitutions). Examples of conservative amino acid substitutions are well known in the art and have been described in various literature (see, for example, Bowie et al., Science, 247: 1306-1310 (1990)).
  • Other algorithms for determining homology of amino acid sequences include, for example, alco and rhythm described in Karl in et al., Proc. Natl. Acad. Scl. USA, 90: 5873-5877 (1993) [ The alcoholism is incorporated into the NBLAS T and XBLAST programs (version 2.0) (Altschul et al., Nucleic Acids Res., 25: 3389-3402 (1997))], Needleman et al., J. Mol. Biol.
  • the active domain of EPOR is GenPept accession number AAA52403 (Ie, the amino acid sequence consisting of the full length OR F of human E POR (SEQ ID NO: 4)) and the amino acid sequence shown by amino acid numbers 25 1 to 508, about 60% or more, preferably about Examples include proteins having amino acid sequences having homology of 70% or more, more preferably about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more.
  • Activity substantially the same as the active domain of human-derived E POR refers to the formation of IL-13-dependent cells that express it in the absence of IL-13. Activity.
  • substantially the same quality means that these properties are qualitatively equivalent. Accordingly, it is preferable that the quantitative factors such as the above-mentioned degree of activity are the same, but they may be different (for example, about 0.01 to about 100 times, preferably about 0.1 to about 1). 0 times, more preferably about 0.5 to about 2 times).
  • the protein substantially identical to the human E POR active domain used in the detection system of the present invention is, for example, a protein having the following amino acid sequence, and the human E POR activity: Also included are proteins that have substantially the same activity as the domain:
  • amino acid sequence of SEQ ID NO: 4 one or more amino acid sequences represented by amino acid numbers 25 1 to 508 (preferably about 1 to 30, preferably about 1 to 10, (Preferably 1 to 5) an amino acid sequence in which amino acid is deleted;
  • amino acid sequence of SEQ ID NO: 4 one or more amino acid sequences represented by amino acid numbers 25 1 to 508 ( Preferably, about 1 to 30, preferably about 1 to 10, more preferably 1 to 5 amino acid sequences added;
  • amino acid sequence of SEQ ID NO: 4 one or more amino acid sequences represented by amino acid numbers 25 1 to 508 (preferably about 1 to 30, preferably about 1 to 10, More preferably 1-5 amino acid sequences inserted with amino acids;
  • amino acids 25 to 508 An amino acid sequence in which one or more amino acids in the amino acid sequence (preferably about 1 to 30, preferably about 1 to 10, more preferably 1 to 5) are substituted with other amino acids. Or
  • the transmembrane domain and cytoplasmic domain of thrombopoietin receptor are preferably a region of human TPOR that penetrates the cell membrane (domain) and a region that exists in the cytoplasm. (Domain) or a protein that is substantially the same (hereinafter sometimes abbreviated as “active domain of TPOR”).
  • substantially identical means about 60% or more, preferably about 70% or more, more preferably about 80% or more, particularly preferably about 90%, with the amino acid sequence of the active domain of human TPOR.
  • amino acid numbers 468-6 in the amino acid sequence represented by GenPept accession number: NP_005364 ie, the amino acid sequence consisting of the full-length ORF of human TPOR (SEQ ID NO: 6)
  • NP_005364 the amino acid sequence consisting of the full-length ORF of human TPOR (SEQ ID NO: 6)
  • NP_005364 the amino acid sequence consisting of the full-length ORF of human TPOR (SEQ ID NO: 6)
  • NP_005364 the amino acid sequence consisting of the full-length ORF of human TPOR (SEQ ID NO: 6)
  • NP_005364 the amino acid sequence consisting of the full-length ORF of human TPOR (SEQ ID NO: 6)
  • It has about 60% or more, preferably about 70% or more, more preferably about 80% or more, particularly preferably about 90% or more, most preferably about 95% or more of homology with the amino acid sequence shown in 10.
  • proteins having an amino acid sequence include proteins
  • Activity substantially equivalent to the active domain of human-derived TPOR examples include the activity of inducing the growth of IL-13-dependent cells that express it in the absence of IL-13.
  • substantially the same quality means that these properties are qualitatively equivalent. Accordingly, it is preferable that the quantitative factors such as the above-mentioned degree of activity are the same, but they may be different (for example, about 0.01 to about 100 times, preferably about 0.1 to about 1). 0 times, more preferably about 0.5 to about 2 times).
  • the protein substantially identical to the human T POR active domain used in the detection system of the present invention is, for example, a protein comprising the following amino acid sequence, and the human T POR activity: Also included are proteins that have substantially the same activity as the domain:
  • amino acid sequence of SEQ ID NO: 6 one or more amino acid sequences represented by amino acid numbers 468 to 6 10 (preferably about 1 to 30, preferably about 1 to 10, More preferably 1-5 amino acid sequences deleted of amino acids;
  • amino acid sequence of SEQ ID NO: 6 one or more amino acid sequences represented by amino acid numbers 468 to 6 10 (preferably about 1 to 30, preferably 1)
  • amino acid sequence of SEQ ID NO: 6 one or more amino acid sequences represented by amino acid numbers 468 to 6 10 (preferably about 1 to 30, preferably about 1 to 10, More preferably 1-5 amino acid sequences inserted with amino acids;
  • amino acid sequence of SEQ ID NO: 6 one or more amino acid sequences represented by amino acid numbers 468 to 6 10 (preferably about 1 to 30, preferably about 1 to 10) Or more preferably 1-5 amino acid sequences substituted with other amino acids; or
  • the deletion, append The position of caro, insertion or substitution is not particularly limited as long as the activity of the protein is not impaired and self-dimerization is not caused.
  • E POR or T POR is preferably used as a protein constituting the chimeric protein used in the detection system, wherein all of its transmembrane domain and cytoplasmic domain are used. As long as the activity resulting from the domains derived from them is not lost (the activity that induces the proliferation of IL-1-dependent cells in the absence of IL-13) It may be any part of these domains (provided that the part does not undergo autonomous dimerization).
  • the chimeric protein used in the detection system of the present invention may contain a part of the extracellular region in addition to the transmembrane domain and cytoplasmic domain of EPOR or TPOR.
  • a nucleic acid molecule encoding a chimeric protein used in the detection system of the present invention includes a nucleic acid molecule encoding a test protein or a fragment containing an extracellular domain thereof, and a fragment containing EPOR or TPOR or a transmembrane domain and a cytoplasmic domain thereof.
  • the encoding nucleic acid molecule it can be produced by a gene recombination technique known in the art (for example, a technique using a PCR method).
  • Examples of the nucleic acid molecule (DNA or RNA) encoding the test protein include genomic DNA, mRNA, and cDNA.
  • the extracellular domain of the test protein can be genomic DNA or cDNA, using appropriate primers, Polymerase Chain Reaction (PCR) method, Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) method, etc. Can be amplified.
  • DNA or RNA As a nucleic acid molecule (DNA or RNA) encoding E POR, genomic DN A, mRNA, cDNA and the like.
  • the transmembrane domain and cytoplasmic domain of EPOR can be amplified by PCR, RT-PCR, etc. using genomic DNA or cDNA as a cage and appropriate primers.
  • DNA encoding E POR examples include DNA containing the nucleotide sequence of the entire coding region of human E POR shown in GenBank accession number: M60459 (SEQ ID NO: 3), or conditions highly stringent with the DNA. It contains a base sequence that hybridizes underneath, and has substantially the same activity as the protein containing the amino acid sequence of E POR shown in SEQ ID NO: 4. (By forming a dimer, IL-3-dependent cells are And DNA encoding a protein having an activity of growing in the absence of (3).
  • Examples of the DNA that can be hybridized under the highly stringent conditions include, for example, the base sequence represented by SEQ ID NO: 3, about 60% or more, preferably about 70% or more, more preferably about 80% or more, and particularly preferably DNA containing a nucleotide sequence having about 90% or more homology can be used.
  • nucleic acid molecules encoding T POR
  • genomic DNA examples include genomic DNA, mRNA, and cDNA.
  • the transmembrane and cytoplasmic domains of TPOR can be amplified by PCR, RT-PCR, etc. using genomic DNA or cDNA as a cage and appropriate primers.
  • DNA encoding TPOR examples include DNA containing the nucleotide sequence of the entire coding region of human TPOR shown in GenBank accession number: ⁇ —005373 (SEQ ID NO: 5), or high stringency with the DNA. Contains a base sequence that is hyper-prehydated under mild conditions, and is substantially the same activity as a protein containing the amino acid sequence of TP OR shown in SEQ ID NO: 6 (by dimer formation, IL-3-dependent cells DNA that encodes a protein having the ability to grow in the absence of IL-13.
  • NCBI BLAST National Center for Biotechnology Information Basic Allocation Search Tool
  • the above-described algorithm for calculating homology of amino acid sequence is also preferably exemplified.
  • Hybridization should be carried out according to a method known per se or a method analogous thereto, such as the method described in Molecular Clonings 2nd edition (J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989). Can do.
  • hybridization can be performed according to the method described in the attached instruction manual. The hybridization can be performed preferably under highly stringent conditions.
  • High stringent conditions include, for example, a sodium salt concentration of about 19 to about 40 mM, preferably about 19 to about 20 mM, and a temperature of about 50 to about 70 ° C., preferably Examples include conditions of about 60 to about 65 ° C. In particular, it is preferable that the sodium salt concentration is about 19 mM and the temperature is about 65 ° C.
  • the salt concentration of the hybridization solution the temperature of the hybridization reaction, the probe concentration, the length of the probe, the number of mismatches, the time of the hybridization reaction, the salt concentration of the washing solution, and the washing. Understand that it can be easily adjusted to the desired stringency by changing the temperature etc. as appropriate.
  • An expression vector containing a nucleic acid molecule encoding a chimeric protein used in the detection system of the present invention can be obtained by, for example, extracting a target fragment (target gene) from a nucleic acid molecule encoding a chimeric protein used in the detection system of the present invention.
  • the fragment can be prepared and ligated downstream of the promoter in an appropriate expression vector.
  • Expression vectors include animal virus vectors such as retrovirus and vaccinia virus (for example, IRES bicistronic expression vector, pA1-11-1, pXTl, pRcZCMV, pRc / RSV, pcDNAI / N eo, pME 1 8 S), etc. are used.
  • the promoter may be any promoter suitable for the host used for gene expression, such as LCK proximal promoter, SRa promoter, SV40 promoter, RSV—LTR promoter, CMV promoter, HSV—TK promoter or the like is used.
  • the expression vector may contain an enhancer, a splice sync signal, a poly A addition signal, a selectable marker or reporter gene, 340 origin of replication (3 V40 o r i), etc., as necessary.
  • selection marker and reporter gene examples include a green fluorescent protein (GFP) gene, a luciferase gene, a 3-galactosidase gene, a dihydrofolate reductase gene, an ampicillin resistance gene, and a neomycin resistance gene.
  • GFP green fluorescent protein
  • an IRES bicistronic expression vector in which the gene of interest is expressed from the same mRNA together with a selection marker or a reporter, is preferred.
  • I RE S bicistronic expression vectors include pMX—I RE S—GFP (Kitamura et al., Int. J. Hematol., 67, 351-9 (1998)), and commercially available from CI ontech. Vector.
  • the nucleic acid molecule encoding the first chimeric protein and the nucleic acid molecule encoding the second chimeric protein may be inserted on the same vector. It may be inserted on a separate vector. When inserted on the same vector, both nucleic acid molecules may be under the control of separate promoters, or they may be under the control of the same promoter using the above IRES bicistronic expression vector. it can.
  • Gene transfer into IL_3 dependent cells can be accomplished by methods known in the art (eg, Viro logy, 52, 456 (1973)).
  • IL-13-dependent cell cells examples include mouse pro B cell line Ba, F 3 (also referred to herein as “BAF 3”), mouse mast cell line IC 2, mouse bone marrow cell line F— 36 P is mentioned.
  • BAF 3 can be used as an IL-3 dependent cell.
  • Confirmation of gene transfer into IL_3-dependent cells can be achieved by, for example, using the above-described selection marker and reporter, plotting using an antibody against E POR or T POR, or any combination thereof. Can be performed by:
  • MEM medium for example, MEM medium, DMEM medium, RPMI 1640 medium, and 199 medium containing about 5 to 20% fetal urine serum (FB S) are used.
  • FB S fetal urine serum
  • the pH of the medium is preferably about 6-8. Culturing is usually performed at about 30 ° C to 40 ° C for about 1 day to about 1 week, preferably about 1 day to about 3 days. Ventilation and agitation may be performed as necessary.
  • first protein and the second protein can interact in the presence of a specific ligand, an appropriate concentration of the ligand can be added to the medium.
  • the detection system of the present invention also provides a screening method for cell surface proteins that are known to interact and whose ligands are unknown.
  • the detection system of the present invention also provides a method for screening an antagonist of a cell surface protein or an antagonist whose ligand is known.
  • the presence or absence of an interaction between the first protein and the second protein in the extracellular region can be confirmed by the viability of the IL-3-dependent cells into which the gene has been introduced.
  • Cell viability can be determined, for example, by counting negative iodide (PI) -negative cells by flow cytometry.
  • PI negative iodide
  • the presence or absence of the interaction between the first protein and the second protein indicates that both the nucleic acid molecule encoding the first chimeric protein and the nucleic acid molecule encoding the second chimeric protein are IL-13 dependent. Viability in the absence of IL-13 when introduced into a cell, and survival when nucleic acid molecules encoding the first and second chimeric proteins are each introduced alone into an IL-3-dependent cell It is more desirable to consider the degree by comparing the degree.
  • the detection system of the present invention also provides a kit for detecting interactions in the extracellular region between cell surface proteins.
  • the detection kit comprises an E POR or TPOR or nucleic acid molecule that codes for their transmembrane and cytoplasmic domains; an expression vector; and IL-13 dependent cells.
  • this detection kit can be used in the extracellular region between the test proteins according to the above procedure. The presence or absence of interaction can be confirmed.
  • mice with C 5 7 BL 6 knocks were obtained from Taconic. pre-T—Mice were provided by Dr. H. von Boehmer (Da na-Farber Cancer Institute, Harvard Medical School). All mice were maintained in a laminar flow clean room and given standard laboratory feed and water as appropriate. All animal experiments were conducted according to the guidelines of our facility. I went.
  • cytochrome c-specific T cell hybridoma (2 B 4) and its a-J3-variant (TG40) were maintained in RPM 1 1 640 supplemented with 10% F CS.
  • TG 40 was infected with the P 14 T CR] 3 chain using the pMX-pu ro retroviral vector (TG40] 3).
  • Anti-CD4 mAb, anti-CD 8 mAb, anti-TCR] 3 mAb, anti-CD 25 mAb, and anti-hCD 8 mAb were purchased from eBio science.
  • Anti-p T a (2 F 5) mAb was obtained from BD B ⁇ o s c i enc e s force.
  • Anti-r CD 2 mAb was obtained from CedarLane force.
  • Anti-hE POR mAb was obtained from Santa cruz.
  • pTaZGFP was prepared by fusing GFP to the C-terminus of pT strand by PCR.
  • TCR a / GFP was prepared by fusing GFP to the C terminus of the P 14 TCR a chain by PCR.
  • ⁇ / E POR was prepared by fusing the extracellular domain of p ⁇ to the transmembrane and cytoplasmic domains of the human erythropoietin receptor by PCR.
  • TCR a / E POR was prepared by fusing the extracellular domain of P 14 TCR a to the transmembrane and cytoplasmic domains of the human erythropoietin receptor by PCR.
  • the plasmid containing the full length of p ⁇ ⁇ is shaped into a bowl and pr 1 me r (1) and pri me r (2) containing a part of the transmembrane domain of EP OR are changed to ⁇ ⁇ ⁇ .
  • the extracellular domain was amplified.
  • the extracellular domain of TCR ⁇ was amplified with ⁇ ri me r (1) and pri me r (3) containing a part of the transmembrane domain of EPOR. Amplify the extracellular domain of pT ⁇ using a plasmid containing the full length of E POR as a ⁇ shape and primer (4) and primer (5) containing a portion of the extracellular domain of ⁇ .
  • the target pT ⁇ / E POR chimera molecule is amplified using primer (1) and primer (4) after annealing to the transmembrane domain to intracellular domain of E POR amplified using The cDNA encoding was obtained.
  • an amplified product of the extracellular domain of TCR a was converted into a pri me r (4) containing a plasmid containing the full length of EP OR as a saddle and pri me r (6) containing a part of the extracellular domain of TCR ⁇ .
  • the cDNA encoding the target TCRaZ E POR chimera molecule is annealed from the transmembrane domain to the intracellular domain of E POR and amplified with pri me r (1) and pri me r (4). Obtained.
  • the cDNA encoding the ⁇ -EPOR chimeric molecule and the cDNA encoding the TCR ⁇ , ⁇ POR chimeric molecule were subcloned into the pMX—IRES—GF Petter, respectively, and subjected to the following analysis.
  • primer 2 AGGGAGAGCGTCAGGATGAGTACCTGCCGCTGTGTCCCCC (SEQ ID NO: 9) primer (3) AGGGAGAGCGTCAGGATGAGCAGGTTTTGAAAGTTTAGGT (SEQ ID NO: 10) primer (4) TAATACGACTCACTATAGGG (SEQ ID NO: 1 1)
  • primer (5) GGGGGACACAGCGGCAGGTACTCATCCTGACGCTCTCCCT (SEQ ID NO: 1 2) primer (6) ACCTAAACTTTCAAAACCTGCTCATCCTGACGCTCTCCCT (SEQ ID NO: 1 3)
  • pMX—I RE S—r CD 2 is M. Ku b. Provided by Dr. (R i k e n).
  • pMX-I RE S— hCD 8 is a truncated human CD 8 ⁇ ( ⁇ 1) that lacks the cytoplasmic region of the N co I / S a 1 I fragment of GFP in MX—I RE S—GFP. It was constructed by exchanging with 98-2 14).
  • ⁇ For bone marrow transplantation ( ⁇ ), Sca— 1 + BM cells from Rag 2—no mice were selected by MAC S (M l 1 tenyl) and 10% FC S, 10 The cells were cultured at 1 ⁇ 10 I in R PM I 16 40 supplemented with ng / ml IL-7 and 100 ng gZm 1 SCF (Pepro Tech). Retrovirus-mediated gene transfer was performed according to the method described in Yamasaki et al., Blood, 103, 3093-101 (2004). On day 1 and 2, 10-fold concentrated retroviral supernatant was added and this was centrifuged at 32 ° C. and 2 000 rpm for 1 hour.
  • hCD8 + cells were sorted using MAC S (M i 1 tenyi) and injected intravenously into irradiated (7 Gy) Rag 2 ⁇ z mice.
  • MAC S M i 1 tenyi
  • thymocytes or splenocytes were removed from the mice and analyzed.
  • p ⁇ mouse-derived S ca— 1 + BM cells were treated with a retrovirus vector encoding wild type p T a -I RE S—h CD 8 or p T a R 10 2/1 1 7A ⁇ IRES—r Infected with a retroviral vector encoding CD2.
  • hCD8 + cells or rCD2 + cells were selected using MACS. 5 ⁇ 10 5 cells from each population were mixed and injected into irradiated (4 G y) R ag 2-z mice.
  • Three weeks after BMT, thymocytes were analyzed using FACS.
  • the sequence of mouse ⁇ (Genbank accession number: ⁇ _011195) was obtained from the NC BI server. A partial sequence ranging from the 10 th residue to the 1 1 9 th residue of pTct was extracted, and its three-dimensional structure was predicted using a general method for homology modeling.
  • the crystal structure of TC R ⁇ (PDB—entry: 1 nfd) (Wang et al., Embo. J., 17, 10-26 (1998)) was used as a template for creating homology-moderates. Obtained from Bank (PDB) (Berman et al., Nucleic. Acid. Res., 28, 235-42 (2000)).
  • the partial sequence of ⁇ was aligned with the template protein using NW alig nment (Needleman et al., J. Mol. Biol., 48, 443-53 (1970)). In order to obtain proper alignment, the gaps and Cys residues in ⁇ ⁇ a are paired with the Cys residue of the template protein. It was moved manually to the corresponding position. Once proper alignment was achieved, the main chain atom in the target protein was assigned to the corresponding residue coordination in the TCR ⁇ template protein. Loop region insertions and deletions were modeled by searching for the appropriate structure from a fragment database generated from fragments of proteins of known structure. Side chains were constructed on the pT ⁇ model backbone using the Metropolis Monte Car 1 o method.
  • pre-TCR constitutive internalization and lysosomal localization
  • pT and TCR ⁇ GFP fusion proteins ie, chimeric proteins
  • Anti-TCR] 3 staining shows that the surface expression level of pre-TCR is significantly lower than that of a ⁇ TCR ( Figure la, left panel group and middle panel group). The total GFP expression level of these two strains is It was similar ( Figure la, central panel group). Consistent with these observations, not the TCR aZGF P, but a significant fractional force of ⁇ ⁇ ⁇ / GF P, found in the Hosozuki vesicle and J intracellular vesicular compartments (Fig. 1a, right panel group), these were co-localized with lysosomal markers ( Figure lb).
  • TG40] 3 receptor receptor complex containing TaZGF P on the surface of the cell, or T The ability of the receptor-complex containing CRa / GFP to self-oligomerize was evaluated by TI RF microscopy as described above.
  • the number of G F P molecules within a single receptor cluster on the cell surface was assessed using pTaZG F P or TCR P.
  • the fluorescence intensity of each single bright spot reflecting a single cluster of receptors on the cell surface was determined as described in Funatsu et al., Nature, 374, 555-9 (1995).
  • the bright spots on the individual surfaces are analyzed, and their fluorescence is represented as a frequency distribution histogram (Fig. 1d).
  • the average fluorescence intensity of a single GFP molecule determined simultaneously from recombinant GFP was 1 585 ⁇ 56 a.u. (arbitrary units).
  • D 22, R 24, R 10 2, and R 1 17 are important for the ⁇ , ⁇ OR function. This is because the alanine substitution of each of these residues abolished the activity supporting growth (Fig. 3b, m5, m9 — m11).
  • R 1 02 and R 1 1 7 are separated from the ⁇ ⁇ ⁇ —] 3 interface in different directions, so the R 1 02 "1 1 7 ⁇ mutation P Ta, GF P fusion protein (p Ta R 1 ° 2 / 117A / GFP) with TCRc nu l 'is introduced into cells and, as above, And analyzed.
  • mice were retrovirally transduced with pT a WT — I RE S — hCD 8 or p Ta R102 / 117A — I RE S — r CD 2 and irradiated R ag 2—z—injected into mice.
  • thymocytes from recipient mice were analyzed for CD4 and CD8 expression in the hCD8 + or rCD2 + population ( Figure 4c, upper panel group).
  • the inventors have used the system of the invention to test the ability of pT to oligomerize, focusing on pTo; a protein unique to pre-TCR.
  • a chimeric protein in which the extracellular domain of pT ⁇ and the extracellular domain of TCR ⁇ were fused to the transmembrane and cytoplasmic domains of ⁇ ⁇ OR, respectively (Fig. 2a; hereinafter, p ⁇ ⁇ / ⁇ P OR and BAF 3 cells expressing TCR ⁇ EP EP OR) were prepared.
  • pri me r (4) and pri me r (5) containing a part of the extracellular domain of ⁇ Enlarged E POR transmembrane domain to intracellular domain amplified using pri me r (1) and pri me r (4) to encode the desired p ⁇ ⁇ , ⁇ POR chimeric molecule Obtained cDNA.
  • an amplified product of the extracellular domain of TCR a is converted into a pri me r (4) containing a plasmid containing the full length of EP OR as a pod and a pri me r (6) containing a part of the extracellular domain of TCR a.
  • the amplified E POR transmembrane domain to the intracellular domain is annealed and amplified with pri me r (1) and pri me r (4) to obtain cDNA encoding the desired TCRE POR chimeric molecule. It was.
  • cDNA encoding ⁇ / E POR chimeric molecule and cDNA encoding TCRAZE POR chimeric molecule were each pMX_IRES_GFP Patterer ⁇ Subcloned and subjected to the following analysis.
  • primer 2 AGGGAGAGCGTCAGGATGAGTACCTGCCGCTGTGTCCCCC (SEQ ID NO: 9) primer (3) AGGGAGAGCGTCAGGATGAGCAGGTTTTGAAAGTTTAGGT (SEQ ID NO: 1 0) primer (4) TAATACGACTCACTATAGGG (SEQ ID NO: 1 1)
  • Figure 2d shows the relative percentage of GFP-cells (cells that do not express chimera: ⁇ ) or GFP + cells (cells that express chimera ⁇ ), with the number of viable cells on day 0 as 100 Represent as The infection efficiency for each condition was 50% to 80% in all experiments and 4 independent experiments that showed similar results.
  • CD 8 is a molecule known to exist as a homodimer due to the S—S bond of the extracellular domain.
  • CD 8ZE POR a chimeric protein in which the extracellular domain of CD 8 was fused to the transmembrane domain and cytoplasmic domain of EPOR were prepared.
  • the extracellular domain of CD 8 was changed to pr 1 me r (7) and primer (8) containing a part of the transmembrane domain of EPOR, using a plasmid containing the entire length of CD 8 as a saddle. Amplified. Amplified product of CD8 extracellular domain using pr 1 mer (9) and primer (10) containing part of CD 8 extracellular domain, using a plasmid containing the full length of E POR as a saddle. Annealed from the transmembrane domain to the intracellular domain of EPOR, and using pri me r (7) and primer (9) To obtain a cDNA encoding the desired CD8ZE POR chimeric molecule. The cDNA encoding the CD 8 / E POR chimeric molecule is converted into pMX—I RE S—G
  • primer (8) AGGGAGAGCGTCAGGATGAGATCACAGGCGAAGTCCAATC (SEQ ID NO: 1 5) primer (9) TTTGCGGCCGCTAAGAGCAAGCCACATAGC (SEQ ID NO: 1 6)
  • CD8ZE POR in pMX—I RE S—GFP vector was transfected into BAF 3 cells.
  • the degree of cell proliferation after IL-13 death was determined by counting cells that were negative for iodide (P I) by flow cytometry.
  • Figure 5 shows the cell proliferation rate of GFP + cells (chimeric expressing cells: ⁇ ) or GFP-cells (cells that do not express chimeras ⁇ ⁇ ) as a relative percentage with the number of viable cells on day 0 as 100. To express. Figure 5 shows that the CD 8ZE POR chimera induces cell proliferation.
  • the present invention provides agents with a novel mechanism of action that modulate T cell differentiation by regulating PT self-dimerization.
  • the present invention also provides a method for screening such a drug and a method for regulating T cell differentiation using such a drug.
  • the T cell differentiation regulator of the present invention is useful as an agent that regulates T cell differentiation by a novel mechanism of action both in vitro and in vivo.
  • Such T cell differentiation regulators prevent or treat diseases characterized by abnormal T cell differentiation or T cell increase or decrease (eg, acute lymphocytic leukemia, chronic lymphocytic leukemia, etc.). It may be useful as a pharmaceutical.
  • the present invention provides a system that can easily detect an interaction in the extracellular region between various cell surface proteins.
  • the present invention provides a system that can easily detect an interaction between proteins in the extracellular region.
  • the detection system of the present invention is useful as a tool for analyzing molecular mechanisms in cell events involving cell surface proteins (eg, cell differentiation, proliferation and survival). This application is based on Japanese Patent Application Nos. 2005-288640 and 2005-289 1 36 filed in Japan, the contents of which are incorporated in full herein.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Hematology (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Urology & Nephrology (AREA)
  • Organic Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Oncology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biotechnology (AREA)
  • Toxicology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L’invention concerne un médicament d'un nouveau type qui contrôle la différenciation et la cancérisation de lymphocytes T basé sur le mécanisme moléculaire de transduction du signal de pré-TCR. Elle concerne aussi un système par lequel une interaction dans des régions extracellulaire de plusieurs protéines de surface de la cellule peut être facilement détectée.
PCT/JP2006/305773 2005-09-30 2006-03-16 Contrôleur de différenciation de lymphocyte t WO2007043200A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2007539809A JPWO2007043200A1 (ja) 2005-09-30 2006-03-16 Ｔ細胞分化調節剤

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
JP2005289136 2005-09-30
JP2005-289136 2005-09-30
JP2005288640 2005-09-30
JP2005-288640 2005-09-30

Publications (1)

Publication Number Publication Date
WO2007043200A1 true WO2007043200A1 (fr) 2007-04-19

Family

ID=37942465

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2006/305773 WO2007043200A1 (fr) 2005-09-30 2006-03-16 Contrôleur de différenciation de lymphocyte t

Country Status (2)

Country Link
JP (1) JPWO2007043200A1 (fr)
WO (1) WO2007043200A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2015525065A (ja) * 2012-05-25 2015-09-03 セレクティスＣｅｌｌｅｃｔｉｓ Ｔｃｒアルファ欠損ｔ細胞を増殖させるためのプレｔアルファまたはその機能性変種の使用
WO2021055895A1 (fr) * 2019-09-19 2021-03-25 Regeneron Pharmaceuticals, Inc. Conjugués anticorps-médicament anti-ptcra et leurs utilisations
US11077144B2 (en) 2013-05-13 2021-08-03 Cellectis CD19 specific chimeric antigen receptor and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH11285388A (ja) * 1998-04-03 1999-10-19 Jcr Pharmaceuticals Co Ltd キメラレセプター発現細胞とその用途

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH11285388A (ja) * 1998-04-03 1999-10-19 Jcr Pharmaceuticals Co Ltd キメラレセプター発現細胞とその用途

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
IRVING B.A. ET AL: "Thymocyte development in the absence of pre-T cell receptor extracellular immunoglobulin domains", SCIENCE, vol. 280, 1998, pages 905 - 908, XP003010994 *
ONISHI M. ET AL: "Identification of an oncogenic form of the thrombopoietin receptor MPL using retrovirus-mediated gene transfer", BLOOD, vol. 88, no. 4, 1996, pages 1399 - 1406, XP003010993 *
YAMASAKI S. ET AL: "Mechanistic basis of pre-T cell receptor-mediated autonomous signaling critical for thymocyte development", NATURE IMMUNOLOGY, vol. 7, no. 1, January 2006 (2006-01-01), pages 67 - 75, XP003010991 *
YOSHIMURA A. ET AL: "Point mutation in the exoplasmic domain of the erythropoietin receptor resulting in hormone-independent activation and tumorigenicity", NATURE, vol. 348, 1990, pages 647 - 649, XP003010992 *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10874693B2 (en) 2012-05-25 2020-12-29 Cellectis CD19 specific chimeric antigen receptor and uses thereof
JP2015525065A (ja) * 2012-05-25 2015-09-03 セレクティスＣｅｌｌｅｃｔｉｓ Ｔｃｒアルファ欠損ｔ細胞を増殖させるためのプレｔアルファまたはその機能性変種の使用
JP2018183167A (ja) * 2012-05-25 2018-11-22 セレクティスＣｅｌｌｅｃｔｉｓ 免疫療法のための同種および免疫抑制耐性ｔ細胞を操作するための方法
US10286007B2 (en) 2012-05-25 2019-05-14 Cellectis Use of pre T alpha or functional variant thereof for expanding TCR alpha deficient T cells
US10426795B2 (en) 2012-05-25 2019-10-01 Cellectis Use of preTalpha or functional variant thereof for expanding TCRalpha deficient T cells
US10517896B2 (en) 2012-05-25 2019-12-31 Cellectis Use of pre T alpha or functional variant thereof for expanding TCR alpha deficient T cells
JP2018011603A (ja) * 2012-05-25 2018-01-25 セレクティスＣｅｌｌｅｃｔｉｓ Ｔｃｒアルファ欠損ｔ細胞を増殖させるためのプレｔアルファまたはその機能性変種の使用
JP7257749B2 (ja) 2012-05-25 2023-04-14 セレクティス 免疫療法のための同種および免疫抑制耐性ｔ細胞を操作するための方法
US11274316B2 (en) 2012-05-25 2022-03-15 Cellectis Use of pre T alpha or functional variant thereof for expanding TCR alpha deficient T cells
US11414674B2 (en) 2012-05-25 2022-08-16 Cellectis Use of pre T alpha or functional variant thereof for expanding TCR alpha deficient T cells
US11007224B2 (en) 2012-05-25 2021-05-18 Cellectis CD19 specific chimeric antigen receptor and uses thereof
US11077144B2 (en) 2013-05-13 2021-08-03 Cellectis CD19 specific chimeric antigen receptor and uses thereof
WO2021055895A1 (fr) * 2019-09-19 2021-03-25 Regeneron Pharmaceuticals, Inc. Conjugués anticorps-médicament anti-ptcra et leurs utilisations
US11814428B2 (en) 2019-09-19 2023-11-14 Regeneron Pharmaceuticals, Inc. Anti-PTCRA antibody-drug conjugates and uses thereof

Also Published As

Publication number Publication date
JPWO2007043200A1 (ja) 2009-04-16

Similar Documents

Publication Publication Date Title
US7700101B2 (en) Reagents and method for modulating Dkk-mediated interactions
AU2002342734B2 (en) Reagents and methods for modulating Dkk-mediated interactions
Chang et al. Proteolytic cleavage of the EMR2 receptor requires both the extracellular stalk and the GPS motif
CN103990122A (zh) osteoprotegerin结合蛋白和受体
KR20180019521A (ko) 인간화된 sirpa-il15 녹인 마우스 및 이의 이용 방법
SK288559B6 (sk) Nukleová kyselina, polypeptid, expresný vektor a hostiteľská bunka; proteín viažuci osteoprotegerín a spôsob jeho prípravy, protilátka a liečivo na prevenciu alebo liečenie chorôb kostí
AU2002342734A1 (en) Reagents and methods for modulating Dkk-mediated interactions
WO2000055181A1 (fr) Methodes permettant de moduler la fixation et la migration des cellules
US11267874B2 (en) Sensor systems for target ligands and uses thereof
Parkin et al. Activity of Wnt-1 as a transmembrane protein.
KR100553300B1 (ko) 혈관신생 및 심혈관형성의 촉진 또는 억제 방법
CA2621764A1 (fr) Trimerisation de polypeptides
JP2781276B2 (ja) マーカーとしての細胞表面レセプターの使用による真核細胞のマーキング方法
JP4854174B2 (ja) ＮＦ−κＢの受容体活性化剤のアゴニストまたはアンタゴニストのスクリーニングアッセイ法
WO2007043200A1 (fr) Contrôleur de différenciation de lymphocyte t
JP6093946B2 (ja) Ｇタンパク質共役型受容体のシグナル伝達の検出方法
WO2004055055A1 (fr) Proteine transmembranaire amigo et utilisations de celle-ci
AU2004234532A1 (en) SPEX compositions and methods of use
TW201639879A (zh) 似胰島素生長因子２（ｉｇｆ２）之傳訊和調節
CN114630579A (zh) 胎儿/新生儿同种免疫性血小板减少症的鼠模型
JPWO2002031131A1 (ja) 新規ｐｌａ１
EP2265636B1 (fr) Mzb1, nouveau facteur des cellules b, et ses utilisations
EP1219638A2 (fr) Récepteurs couplés aux protéines-G et ayant de l'homologie avec le P2Y purinorécepteur 1 (P2Y1)
Heinz et al. Factor VIII-eGFP fusion proteins with preserved functional activity for the analysis of the early secretory pathway of factor VIII
US20030119771A1 (en) Modulators of bone homeostasis identified in a high-throughput screen

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2007539809

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06729740

Country of ref document: EP

Kind code of ref document: A1