WO2007043200A1

WO2007043200A1 - T cell differentiation controller

Info

Publication number: WO2007043200A1
Application number: PCT/JP2006/305773
Authority: WO
Inventors: Sho Yamasaki; Takashi Saito
Original assignee: Riken
Priority date: 2005-09-30
Filing date: 2006-03-16
Publication date: 2007-04-19
Also published as: JPWO2007043200A1

Abstract

It is intended to provide a drug of a novel type which controls the differentiation and canceration of T cells based on the signal transduction molecular mechanism of pre-TCR. It is also intended to provide a system by which an interaction in extracellular regions among various cell surface proteins can be conveniently detected.

Description

Specification

T cell differentiation regulators

The present invention relates to a sputum cell differentiation regulator, a screening method for a sputum cell differentiation regulator, and a method for regulating sputum cell differentiation. The invention also relates to a system for detecting interactions in the extracellular region between cell surface proteins. Background art

Interactions in the extracellular region between cell surface proteins often can play an important role in intracellular signaling systems that control cell proliferation, differentiation, survival, and the like.

For example, erythropoietin receptor (E POR) is a cell surface receptor for erythropoietin (Ε ΡΟ), a factor that induces the differentiation and proliferation of erythroid progenitors, and E POR is located in the extracellular region. It dimerizes by binding and transmits シグナル伝達 signals into the cell, controlling the proliferation and differentiation of erythrocytes. Regarding the signal transduction mechanism by this EP ΡΟ ノ EP OR, Yo shi mu ra et al. Reported that EP OR with an extracellular region mutation that self-dimerized without EPO requires IL_3 for proliferation. Have been reported to be able to induce the proliferation of BAF 3 cells (referred to herein as “IL-3 dependent cells”) in the absence of IL-3 (Yoshimura et al., Nature, 348, 647-649 (1990)).

In addition, the Tobopopoietin Receptor (T POR), which is involved in platelet proliferation, is mediated by IL-3 dependent cell proliferation when mutated to self-dimerize without its ligand. It can be induced in the absence of (Onishi et al., Blood, 88, 1399-1406 (1996)).

On the other hand, the pre-T cell antigen receptor (hereinafter also referred to as “pre-TCR”) plays an important role in the development of early T cells. The development of αβ sputum cells from hematopoietic stem cells occurs in the thymus. Early Τ cell precursors in the thymus are cells lacking CD4 and CD8 expression (hereinafter also referred to as “DN cells”), which express the pre-T cell antigen receptor.

pre- TCR consists of T cell antigen receptor 0 chain (TCR] 3), pre T cell antigen receptor α chain (ρ Τ α), CD 3 molecule (CD 3 y chain, CD 3 E chain and C ϋ 3 The complex is composed of ζ chain), and its expression turns DN cells with abundant TCR j3 reconstitution into CD 4 + CD 8 + double positive cells (hereinafter also referred to as “DP cells”). Differentiate. This process is referred to as] 3 selection (see Fehling et al., Nature, 375, 795-8 (1995)). Indeed, pre-TCR has been reported to cause survival, proliferation, and expression of CD4 and CD8; T cra reconstitution, T crb locus allele exclusion (Fehling et al., Nature, 375, 795-8 (1 995)).

Many studies suggest that pr _TCR can transduce signals in a ligand-independent manner. For example, IrV1ng et al. Report that it is not required for extracellular Ig-like domain force signaling (see Irving et al., Science, 280, 905-8 (1998)). Saint_Ruf et al. Also show that in cell lines expressing pre-TCR, pre-TCR is present in rafts and signals without ligation to exogenous ligands ( Saint-Ruf et al., Nature, 406, 524-7 (2000)).

To date, it has been argued that the intracellular cysteine of the pT cell that contacts the membrane may be responsible for raft localization. It has been found that this substitution of cysteine with alanine does not impair pre-TCR function (see Aifantis et al., Nat. Immunol., 3, 483-8 (2002)). In addition, proper pre-TCR function includes the cytoplasmic tail of ρ Τ α (see Aifantis et al., Nat. Immunol., 3, 483-8 (2002)) and the extracellular domain (Borowski et al., J. Exp. Med., 199, 607-15 (2004)).

Haks et al. Proposed a ligand-independent signaling mechanism for pre-TCR. Proposed a low activity threshold for DN cells (see Haks et al., J. I. unol. 170, 2853-61 (2003)). However, recent extensive analysis has shown that ρ Τα is not just a substitute for TCR α, but rather ρ Τ α has a unique signaling potential that differs from that of TCR a. (See Borowski et al., J. Exp. Med., 199, 607-15 (2004); Huang et al., Eur. J. Immunol., 34, 1532-41 (2004)).

It has also been suggested that signals via pre-TCR trigger canceration in leukemia cells (Bellavia et al., Proc. Natl. Acad. Sci. USA, 99, 3788-3793 (2002)).

In this way, despite the wide variety of studies on pre-TCR-induced early T cell development, the molecular mechanisms underlying the pre-TCR-mediated autonomous signals are difficult to grasp and are still unclear. Absent. Disclosure of the invention

The first object of the present invention is to clarify the molecular mechanism of signal transduction by pre-TCR, and to provide a new type of drug that regulates T cell differentiation and canceration based on this mechanism. In order to clarify the molecular mechanism of signal transduction by pre_TCR, the present inventors focused on the structure and function of p Τ α, a component unique to Pre-TCR. . As a result, it was found that ρΤα spontaneously forms a self-dimer through electrostatic interaction with charged amino acid residues present in the extracellular region. In addition, inhibition of ρΤα auto-oligomerization by substitution of these amino acid residues inhibited normal transition from DN cells to DΡ cells. Based on this, the present inventors considered that the self-dimer formation of ρΤα is an essential molecular mechanism of p r e -TCR autonomous signaling.

The second object of the present invention is to provide a system that can easily detect an interaction between various cell surface proteins in the extracellular region. We have found that the extracellular domain of cell surface proteins and the transmembrane domain and cytoplasm of E POR When a nucleic acid encoding a chimeric protein containing a domain is introduced into an IL-13-dependent cell and expressed, when the extracellular domains interact with each other, the chimeric protein forms a dimer, It was found that the proliferation of the cells was induced in the absence of IL-3. That is, it was found that the interaction between extracellular domains of cell surface proteins can be detected using IL-3-independent cell proliferation as an index by using the chimeric protein expression system of this detection system.

As a result of further research based on the above findings, the present inventors have completed the present invention. That is, the present invention is as follows:

[1] A pre-tau cell antigen receptor _α- chain self-dimer-forming substance,

[2] The cell differentiation regulator according to [1], wherein the substance is a substance that promotes self-dimer formation of the pre-cell antigen receptor α chain;

[3] The cell differentiation regulation according to [2], wherein the substance that promotes self-dimer formation of the pre-cell antigen receptor α chain is a nucleic acid molecule encoding a pre-cell antigen receptor single chain. Agent;

[4] The agent for regulating the differentiation of sputum cells according to [1], wherein the substance is a substance that suppresses the self-dimer formation of the pre-splenocyte antigen receptor α chain;

[5] The substance inhibiting the self-dimer formation of the pre-cell antigen receptor α chain is an antisense nucleic acid, ribozyme, s 1 RN gene or antibody against the pre-cell antigen receptor chain; or pre-T cell antigen The agent for regulating differentiation of sputum cells according to [4], which is a fragment of the extracellular domain of the receptor α chain;

[6] a method for regulating sputum cell differentiation, comprising a step of regulating self-dimer formation of a pre-splenocyte antigen receptor α chain;

[7] A screening method for a sputum cell differentiation regulator comprising the step of evaluating whether a test substance regulates the pre-spread cell antigen receptor α chain self-dimer formation;

[8] A kit for screening an agent for regulating differentiation of Τ cells, wherein a cell expressing a chimeric protein of ρΤ α and a fluorescent substance, or ρ Τα and an Ellis mouth A kit comprising IL-13-dependent cells expressing a chimeric protein with a boyetin receptor or a tombopoietin receptor;

[1 A] A method for detecting an interaction in an extracellular region between cell surface proteins,

A nucleic acid molecule encoding a first chimeric protein comprising an extracellular domain of the first protein and a transmembrane domain and a cytoplasmic domain of an erythropoietin receptor or tombopoietin receptor; and

A nucleic acid molecule encoding a second chimeric protein comprising the extracellular domain of the second protein and the transmembrane domain and cytoplasmic domain of the erythropoietin receptor or topopoietin receptor

A method comprising culturing IL-13-dependent cells into which IL is introduced in the absence of IL-3 and confirming the presence or absence of proliferation of the cells;

[2A] The method according to [1A] above, wherein the first protein and the second protein are the same type of protein,

[3A] The method according to [1A] above, wherein the first protein and the second protein are heterologous proteins;

[4 A] a first chimeric protein comprising an extracellular domain of a first protein and a transmembrane and cytoplasmic domain of an erythropoietin receptor or thrombopoietin receptor; and

A second chimeric protein comprising the extracellular domain of the second protein and the transmembrane and cytoplasmic domains of the erythropoietin receptor or thrombopoietin receptor

IL-3 dependent cells that expressed

[5A] The cell according to [4A] above, wherein the first protein and the second protein are the same type of protein,

[6A] The cell according to [4A] above, wherein the first protein and the second protein are heterologous proteins; [7 A] a chimeric protein comprising an extracellular domain of a cell surface protein and a transmembrane domain and a cytoplasmic domain of an erythropoietin receptor or a tombopoietin receptor;

[8 A] a nucleic acid molecule encoding the chimeric protein according to [7A] above; [9 A] an expression vector comprising the nucleic acid molecule according to [8A] above; and

[1 OA] A kit for detecting interactions in the extracellular domain between cell surface proteins, including:

Nucleic acid molecules encoding erythropoietin receptor or thrombopoietin receptor or their transmembrane and cytoplasmic domains;

An expression vector; and

IL-3 dependent cells

Including a kit. Brief Description of Drawings

FIG. 1 a shows surface staining of reconstituted pre-TCR and α 0 TCR. Τ Infect CR a ^{nu 1 1} T cell hybridoma (TG 40 J3) with pMX—pT α / GFP-IRES—rCD2 or pMX—TCRaZGFP—IRES—rCD2 Then, it was sorted by anti-rCD2 using MAC S. Cells were stained with APC-labeled anti-TCR] 3 and subjected to flow cytometry (left panel group and center panel group). Cells were also analyzed by fluorescence microscopy. A representative image is shown as a deconvolved fluorescence image (right panel group) (BZ8000, Keyence). The frequency of cells with more than 10 fluorescent spots was determined from multiscan images. This frequency is 2.7 ± 3.9% (TCR a / GF P) and

8 7. 9 ± 1. 7% (p T a / G F P).

Figure 1b shows that the internalized pre-TCR is localized in the lysosome. The cells are treated with 50 nM Lyso T ra c ke rR e DND—

Treated with 99 for 30 minutes, then applied to a wide-field fluorescence microscope (IX-81, Olympus) More analyzed.

Figure 1c shows the rapid and constitutive internalization of pre-TCR. Cells were prestained with PE-labeled anti-TCRO, then incubated at 37 ° C for 30 minutes and analyzed by confocal fluorescence microscopy (DMIRE2, Leica). The scale bar represents 5 μπι.

FIG. Id is a graph showing that pre TCR tends to form oligomers on the cell surface.

FIG. 2a is a schematic diagram of a ρΤα / E POR chimera and a TCR / E POR chimera.

FIG. 2b shows the expression of the E P OR chimera. The BAF 3 cell line was infected with ρΤα / E POR chimera or TCRa / E POR chimera in pMX—IRES—GFP vector and the expression of each was analyzed by anti-E P OR immunoplot. Figure 2c shows the expression of the E P OR chimera. BAF 3 cell lines were infected with pTaZE POR chimera or TCRa / E POR chimera in pMX—IRES-GFP vector, and the expression of each was analyzed by anti-EPOR staining.

Figure 2d shows the cell viability of each B A F 3 transfectant after I L_3 wilt. Illustrated merged image of bright field and GFP after 2 B of IL-3 wilt (upper panel group). Cell viability after IL-3 wilt was determined by counting cells that were negative for iodide (P I) iodide by flow cytometry. The viability of GFP-cells (cells that do not express chimera. ○) or GFP + cells (cells that express chimera: 秦) on each day is expressed as a relative percentage with the number of live cells at 0 being 100. The infection efficiency for each condition was 50% to 80% in all experiments and in 4 independent experiments that showed similar results.

Figure 2e shows FRET production in T cells co-expressing pTa / CFP and pTa / YFP. TG 40] in 103 cells, p TaZYF P only (left panel group), p TaZCF P and p T α / YF P (middle panel group), or Ji ^{^{p T a R 1 ° 2/}} 11? ?ぉょび丁ひ ^^ ハ / 丫? (Right panel group) was transduced. p The surface expression of re-TCR was verified by anti-TCR] 3 staining of each of the three cell lines as described in Figure 1a. Shows the percentage of FR ET positive cells (square gates) in YF ^Ph ^h cells (10,000 cells; black dots). FIG. 3a shows the amino acid sequence of the extracellular domain of mouse ρΤα (SEQ ID NO: 7). The amino acid number of the mature protein is indicated.

FIG. 3b shows the substitution of charged amino acids in the extracellular domain of pΤα. PTa ZEPOOR having the mutations shown in the figure (ml to ml9) was tested for growth promoting activity in BAF3 as shown in Figure 2d. The value represents the relative activity (%) 2 days after I L-3 withering, with WT p T and ZGF P activity as 100.

Figure 3c shows a three-dimensional structural model of the pTa-TCR] 3 complex. Functionally important charged amino acids (D 22, R 24, R 102 and R 1 17) are represented by the ball and stick model.

FIG. 3d shows a three-dimensional structural model of the pTa-TCR] 3 complex. The replaceable charged amino acids (D56, D67, E81, E82, E84 and E87) are represented by a ball and stick model.

Figure 4a shows that R 102 R 1 1 7 is essential for the pre-TCR spontaneous internationalization. p T _α ^wτ ZGF P and p T _α ^{R102 / 117A} / ^/ GFP are introduced into TG40 cells, and surface pre- TCR expression, anti-TC R j3 APC (clay histogram) and control Ab (White histogram) was used for analysis.

Figure 4b shows the frequency of cells with intracellular GFP vesicles. Cells were analyzed by fluorescence microscopy and multiscan images were used to count the number of cells with more than 10 bright vesicles. The data is the average percent soil s.d of 5 independent fields of view.

Figure 4c shows the BMT reconfiguration assembly. Sca— 1 + ρ Τ α — ^{/ _} ΒΜ cells were individually infected with WT p T a ^WT — IRES — r CD 8 or p T a ^{R102 / 117 Α} — I RE S_h CD 2. r Select CD 8 or h CD 2 positive cells Then, and individually injected into irradiated R ag 2 -recipient mice. Three weeks after injection, thymocytes were collected from CD4 / CD8 (upper panel group) and CD25 (lower panel group) in the hCD8 + population (middle panel group) or rCD2 + group (right panel group). Expression was analyzed. The p T a ^WT surface expression and surface expression of high p Τ α ^{R 1 Q 2/1 17A} compares the was confirmed by staining with anti Rotauarufa.

Figure 4d shows a competitive BMT reconfiguration assembly. p T a ^WT — I RE S— r CD 2 or p T a ^{R102 / 117A} — I RE Sh CD 8 individually infected, Sea— 1 + p T cells—1: 1 And irradiated simultaneously into irradiated R ag 2 -mono recipient mice. Three weeks later, thymocytes were analyzed for expression of CD4ZCD8 in either the hCD8 + (WT) goot population or the rCD2 + (R1 02 / 1117A) goot population. Data are representative three independent experiments with similar results.

Figure 5 shows cell viability of BAF 3 transfectant after IL-3 wilt. The relative percentage of the viability of GFP-cells (cells that do not express chimera: ○) and GFP + cells (cells that express chimera. 參) on each day, with the number of viable cells on day 0 as 100 Expressed as a rate. BEST MODE FOR CARRYING OUT THE INVENTION

The terms used in this specification will be described below.

As used herein, “nucleic acid molecule” means single-stranded or double-stranded DNA or RNA. In the present specification, unless otherwise specified, the term “nucleotide sequence” refers to the sequence of deoxyribonucleotides (represented by A, G, C, and T) or ribonucleotides (A, G, C, And U). In the present specification, unless otherwise specified, a single-stranded nucleotide sequence represents the 5 ′ end at the left end and the 3 ′ end at the right end.

In this specification, unless otherwise specified, amino acid notation uses standard one-letter abbreviations or three-letter abbreviations for amino acids. In this specification Unless otherwise specified, the amino acid sequence represents the N-terminal (amino terminal) at the left end and the C-terminal (carboxyl terminal) at the right end.

In this specification, “T cell precursor” means thymocytes lacking the expression of CD 4 and CD 8 (also called “CD 4—CD 8—double negative thymocytes” or “DN cells”). To do.

As used herein, “modulating T cell differentiation” refers to the process of differentiation from CD4—CD 8-double negative thymocytes (DN cells) into CD 4 + CD 8+ double positive thymocytes (DP cells). (Ie, selection) means to promote or suppress.

In the present specification, “regulates pre-T cell antigen receptor α chain (ρ Τα) self-dimer formation” means to promote or suppress self-dimerization of ρ Τ at cell surface of DN cells. Means that.

As used in the present invention, “pre-cell antigen receptor α chain (ρΤα)” preferably means a human-derived ρΤα or a protein substantially identical thereto. Here, “substantially identical” means that the amino acid sequence of ρρα derived from human is about 60% or more, preferably about 70% or more, more preferably about 80% or more, and particularly preferably about 90%. The amino acid sequence having homology of about 95% or more, most preferably, is a sequence in which a protein having the amino acid sequence has substantially the same activity as human-derived ρΤα.

Here, “homology” means an optimal alignment when two amino acid sequences are aligned using a mathematical algorithm known in the art (preferably, the algorithm is used for optimal alignment). The ratio of the same amino acid residue and similar amino acid residues to all overlapping amino acid residues in the case of introducing a gap into one or both of the sequences).

“Similar amino acids” means amino acids that are similar in physicochemical properties, for example, aromatic amino acids, aliphatic amino acids, polar amino acids, basic amino acids, acidic Examples include amino acids, amino acids having a hydroxyl group, and amino acids classified into the same group such as amino acids with small side chains. Such substitutions with similar amino acids are expected not to change the protein phenotype (ie, conservative amino acid substitutions). Examples of conservative amino acid substitutions are well known in the art and have been described in various literature (see, for example, Bowie et al., Science, 247: 1306-1310 (1990)).

Amino acid sequence homology can be calculated using the homology calculation algorithm N C B I B L A S T under the following conditions (expected value = 10, allow gap, Matritas = BL0SUM62, filtering = 0FF).

Other algorithms for determining homology of amino acid sequences include, for example, the algorithm described in Karlin et al., Proc. Natl. Acad. Sci. USA, 90 · 5873-5877 (1993) [the algorithm is NBLAST and XBLAST programs (version 2.0) (Altschul et al., Nucleic Acids Res., 25: 3389-3402 (1997))], Needleman et al., J. Mol. Biol., 48: 444 -453 (1970) [The algorithm is incorporated into the GAP program in the GCG software package], Myers and Miller, CAB I OS, 4 · 11-17 (1988) [The algorithm is incorporated into the AL IGN program (version 2.0) which is part of the CGC sequence alignment software package], Pearson et al., Proc. Natl. Acad. Sci. USA, 85: 2444. -2448 (1988) Built into FASTA Purokuramu], etc. in the package, and the like, they can be used also preferably.

Several splice variant バリア are known for p p α, and any of them may be used in the present invention.

As humans used in the present invention, preferably, the amino acid sequence represented by GenPept accession number ΝΡ-6 12153 (SEQ ID NO: 2) is about 60% or more, preferably about 70% or more, more preferably Is a protein having an amino acid sequence having a homology of about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more. The

In addition, the protein substantially identical to the human-derived pTa used in the present invention is, for example, a protein containing the following amino acid sequence, which is substantially the same quality as human ρΤα. Also includes active proteins:

(1) 1 or 2 or more in the amino acid sequence of human ρΤα shown in SEQ ID NO: 2 (preferably about 1 to 30 pieces, preferably about 1 to 10 pieces, more preferably 1 ~ 5) amino acid sequences deleted of amino acids;

(2) One or more amino acids in the amino acid sequence of human ρΤα shown in SEQ ID NO: 2 (preferably about 1 to 30, preferably about 1 to 10, more preferably 1 to Amino acid sequence with 5 amino acids added;

(3) One or two or more amino acids in the human ρΤ sequence shown in SEQ ID NO: 2 (preferably about 1 to 30 pieces, preferably about 1 to 10 pieces, more preferably about 1 to 2 pieces) Amino acid sequence with 5 amino acids inserted;

(4) 1 or 2 or more in the amino acid sequence of human ρΤα represented by SEQ ID NO: 2 (preferably about 1 to 30 pieces, preferably about 1 to 10 pieces, more preferably 1 ~

Amino acid sequence in which 5 amino acids are replaced with other amino acids; or

(5) An amino acid sequence obtained by combining the above (1) to (4).

When the amino acid sequence is deleted, added, inserted or substituted, the position of the deleted, appended caro, inserted or substituted is not particularly limited as long as the activity of the protein is not impaired.

For ρ Τ α, the substantially homogeneous activity includes the activity of ρ Τ α forming a self-dimer and inducing the transition from DN cells to DP cells (ie, selection of 3). .

Here, “substantially the same quality” means that these properties are qualitatively equivalent. Accordingly, the quantitative factors such as the above-mentioned degree of activity are preferably equivalent, but may be different (eg, about 0.1 to about 100 times, preferably about 0.1 to about 1). 0 times, more preferably about 0.5 to about 2 times). The self-dimer formation of p T can be confirmed and quantified by the method described in the screening method described later. The transition from DN cells to DP cells can be confirmed and quantified by detecting CD4 molecules and CD8 molecules expressed on the cell surface using antibodies that specifically react with each of these molecules. Examples of the detection method of the antibody include a method using fluorescence (for example, Fluorescence Activated Cell Sorter (FACS) method) and a method using enzyme reaction (for example, Enzyme-Linked Immunosorbent As say (ELISA) method). The method using a radioisotope is mentioned.

In the present specification, unless otherwise specified, the “extracellular domain” of a protein means the entire region (domain) existing outside the cell surface protein or any fragment thereof.

In the present specification, unless otherwise specified, the “transmembrane domain” of a protein means the entire region (domain) penetrating the cell membrane of a cell surface protein or any fragment thereof.

In the present specification, unless otherwise specified, the “cytoplasmic domain” of a protein means the entire region (domain) present in the cytoplasm of a cell surface protein or any fragment thereof.

In the present specification, “chimeric protein” (hereinafter also simply referred to as “chimera”) means a fusion protein composed of two or more domains derived from different proteins, unless otherwise specified.

In the present specification, “IL-3 dependent cell” means a cell that requires IL-13 for survival and proliferation (in other words, a cell that cannot proliferate in the absence of IL-13). Hereinafter, embodiments of the present invention will be described.

In the first aspect, the present invention relates to a T cell differentiation regulator, a method for regulating T cell differentiation, and a screening method for a T cell differentiation regulator.

(T cell differentiation regulator and method for regulating T cell differentiation) The present invention provides a T cell differentiation modulating agents comprising an agent that modulates self dimerization of p T _alpha. More specifically, the present invention relates to a Τ cell differentiation promoting agent comprising a substance that promotes self-dimer formation of ρ 形成 α and a substance that suppresses ρΤα self-dimer formation. Provide the agent.

(Acupuncture cell differentiation promoter)

In one embodiment, the sputum cell differentiation regulator of the present invention is a sputum cell differentiation promoting agent, and the promoter is a self-dimer of ρ Τ α on the cell surface of a sputum cell precursor (ie, DN cell). Contains substances that promote body formation. Such substances can promote the transition from DN cells to D Ρ cells (ie, / 3 selection) by directly or indirectly promoting ρ Τ α self-dimerization. .

Substances that promote the formation of ρ Τ α self-dimer include substances that can specifically act on the target molecule Ρ Τ α in order to minimize the effect on other genes and / or proteins. It is desirable to be. Examples of such a substance include a nucleic acid molecule encoding Ρα and a substance obtained by a screening method described later.

“Nucleic acid molecule encoding ρΤ” refers to a nucleic acid molecule capable of expressing ρΤα in a cell when introduced into a DN cell. Ρ 発現 expressed by the nucleic acid molecule can promote selection by forming a dimer between them or ρΤα inherent to the cell into which the nucleic acid molecule has been introduced.

Examples of nucleic acid molecules encoding ρ Τ α include genomic DNA, mRNA, and cDNA. Nucleic acid molecules encoding pT are amplified by PCR (Polymerase Chain Reaction) fe or RT-PCR (Reverse Transcriptase-Polymerase Chain Reaction) using appropriate primers and genomic DNA or cDNA. can do.

Examples of the nucleic acid molecule encoding p Τ α include DN を containing the nucleotide sequence of the entire coding region of human p Τ _α shown in GenBank accession number: NM_138296 (SEQ ID NO: 1), or the DNA and hystrin Salt that hybridizes under mild conditions Substantially the same activity as the protein containing the base sequence and the amino acid sequence of p Τ α shown in SEQ ID NO: 2 (self-dimer by the interaction of amino acid residues in the extracellular region) DNA encoding a protein having a body-forming activity).

Examples of the DN できる that can hybridize under highly stringent conditions include, for example, the base sequence represented by SEQ ID NO: 1, about 60% or more, preferably about 70% or more, more preferably about 80% or more, Particularly preferably, DNA containing a base sequence having a homology of about 90% or more can be used.

In this specification, the homology of the nucleotide sequence is determined by using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Algment oe arch Tool), and the following conditions: Expected value = 1 0; Link = ON; Match score = 1; Mismatch score = _3.

As another algorithm for determining the homology of the base sequence, the above-described algorithm for calculating homology of amino acid sequence is also preferably exemplified.

Hybridization can be performed according to a method known per se or a method analogous thereto, for example, the method described in Molecular Clonings 2nd | jRy. Sambrook et al., Cold Spring Harbor Lab. Press, 1989), etc. . In addition, when using a commercially available library, hybridization can be performed according to the method described in the attached instruction manual. The hybridization can be performed preferably under highly stringent conditions. High stringent conditions include, for example, a sodium salt concentration of about 19 to about 4 O mM, preferably about 19 to about 2 O mM, and a temperature of about 50 to about 70 ° C, preferably Examples include conditions of about 60 to about 65 ° C. In particular, it is preferable that the sodium salt concentration is about 19 mM and the temperature is about 65 ° C.

The person skilled in the art will know the salt concentration of the hybridization solution, the temperature of the hybridization reaction, the probe concentration, the length of the probe, the number of mismatches, the hybridization Understand that it can be easily adjusted to the desired stringency by appropriately changing the duration of the reaction, the salt concentration of the washing solution, the washing temperature, etc.

The nucleic acid molecule encoding the pT gene is inserted into an appropriate expression vector, for example, and then transferred to a T cell precursor according to a method known in the art (for example, the method described in Virology, 52, 456 (1973)). It can be introduced into the body (DN cells).

For example, an expression vector containing a nucleic acid molecule encoding pT is prepared by preparing a fragment of interest from a nucleic acid molecule encoding ρρα and ligating the fragment downstream of an appropriate promoter in the expression vector. Can be produced. Examples of expression vectors include animal virus vectors such as retrovirus and vaccinia virus (for example, IRES bicystic expression vector, pA1-1-11, pXTl, pRc / CMV, pRc / RSV, pc DNA l / N eo, pME 1 8 S), etc. are used.

The promoter may be any suitable promoter corresponding to the host used for gene expression, such as LCK proximal promoter, SRa promoter, SV40 promoter, RSV- LTR promoter, CMV promoter, H SV—TK promoter or the like is used.

The expression vector may contain an enhancer, a splicing signal, a poly A addition signal, a selection marker or a reporter gene, an SV40 origin of replication (SV40r1), etc., as necessary.

Examples of the selection marker and reporter gene include a green fluorescent protein (GFP) gene, a luciferase gene, a 0-galactosidase gene, a dihydrofolate reductase gene, an ampicillin resistance gene, and a neomycin resistance gene.

(T cell differentiation inhibitor)

In another embodiment, the T cell differentiation regulator of the present invention is a T cell differentiation inhibitor, which suppresses pTα self-replication on the cell surface of a T cell precursor (ie, DN cell). Contains substances that suppress the formation of a mass. Such a substance is ρ Τα By directly or indirectly suppressing the formation of the monomer, the transition from DN cells to DP cells (ie / 3 selection) can be suppressed.

Substances that suppress the formation of pT self-dimer include substances that can act specifically on the target molecule ρ Τ α in order to minimize the effects on other genes and Ζ or proteins. It is desirable to be. Examples of such substances include antisense nucleic acids, ribozymes, s1 RNA and antibodies against ρΤα; fragments of the extracellular domain of ρΤα, and substances obtained by the screening method described below. It is done.

Antisense nucleic acid, ribozyme and slRNA against ρ Τ α act on the nucleic acid molecule encoding p Τ α in the T cell precursor, and can suppress the expression of ρ Τ in DN cells.

An antisense nucleic acid consists of a base sequence that can hybridize with a target mRNA (initial transcript) under physiological conditions, and is a protein or polypeptide encoded by the target mRNA (initial transcript) in a hybridized state. It can be a nucleic acid that can inhibit the translation of.

The type of antisense nucleic acid may be DNA, RNA, or a DNA_RNA chimera. In addition, natural antisense nucleic acids are easily decomposed by phosphodiester bonds by nucleolytic enzymes present in the cells, so the thiophosphate type (P = 0 of phosphate bonds) is stable to enzymatic degradation. May be synthesized using a modified nucleotide such as 2'-0-methyl type.

Other important factors in the design of antisense nucleic acids include increased water solubility and cell membrane permeability, which can be overcome by devising dosage forms such as the use of ribosomes and microspheres. it can.

The length of the antisense nucleic acid is not particularly limited as long as it can specifically hybridize with the target mRNA or the initial transcript. For example, the length of the antisense nucleic acid is at least about 15 bases, and the entire length of the mRNA (initial transcript) is long. Sequences that contain sequences complementary to It may be. From the viewpoint of ease of synthesis, antigenicity problems, etc., an oligonucleotide consisting of preferably about 15 to about 30 bases is exemplified.

In addition, antisense nucleic acids not only hybridize with target mRNA or initial transcripts to inhibit translation, but also bind to target genes that are double-stranded DNA to form triplex. It may be capable of inhibiting transcription to niRNA.

A ribozyme refers to a nucleic acid molecule (mainly RNA) having an enzymatic activity to cleave nucleic acid. In the present invention, it is intended that p 切断 α mRNA or an initial transcript can be specifically cleaved within the coding region (including an intron in the case of the initial transcript).

Recently, it has been clarified that oligo DNA having the base sequence of the enzyme active site also has a nucleic acid cleaving activity. Therefore, ribozyme includes DNA as long as it has a sequence-specific nucleic acid cleaving activity. As a concept to be used. The most versatile ribozyme is self-splicing RNA found in infectious RNAs such as virus, and the hammerhead type and hairpin type are known.

siRNA is a double-stranded oligo RNA corresponding to a partial distribution sequence (including an intron in the case of an initial transcript) within the coding region of a target mRNA or initial transcript. A phenomenon called so-called RNA interference (RNA i), in which a short double-stranded RNA is introduced into a cell and mRNA complementary to the RNA is degraded, has long been known in nematodes, insects, plants, etc. However, recently, it has been confirmed that this phenomenon also occurs in animal cells (Nature, 411 (6836): 494-498 (2001)), so it is attracting attention as an alternative to ribozyme.

Antisense oligo nucleotides and ribozymes are, for example, Dinghio. The target sequence of mRNA or initial transcript is determined based on the 0A sequence (eg, SEQ ID NO: 1) and complemented with a commercially available DNAZRNA automatic synthesizer (Applied Biosystems, Beckman, etc.) By synthesizing specific sequences Can be made.

For example, s 1 RNA can be synthesized by synthesizing a sense strand and an antisense strand with a DNAZRNA automatic synthesizer and denatured in an appropriate annealing buffer at about 90 to about 95 ° C. for about 1 minute, and then about 30 to It can be prepared by annealing at about 70 ° C for about 1 to about 8 hours. In addition, by synthesizing complementary oligonucleotide strands so as to overlap each other, annealing them, and then ligating with ligase, a longer double-stranded polynucleotide is prepared. You can also.

Antibodies to ρ Τ α, and fragments of the extracellular domain of ρ Τ α, may contain one or more of the amino acid residues involved in ρ Τ α self-dimerization (eg, 1, 2, 3 or 4 ) Can suppress the formation of self-dimer of ρ Τ α.

The “amino acid residue involved in the formation of a self-dimer of ρΤΤ” may be a charged amino acid residue existing in a region (domain) existing outside of ρΤα. For example, in the case of human ρ Τ α, amino acid residues involved in ρ Τ α self-dimer formation include the 38th Asp and 40th Lys in the amino acid sequence of SEQ ID NO: 2; 1 1 8th Arg, and 1 3 3rd Arg.

Since these amino acids are highly conserved among species, when targeting species other than human, the amino acid residues corresponding to the above may be targeted.

The antibody against ρΤα may be a polyclonal antibody or a monoclonal antibody as long as it can inhibit the formation of ρΤα dimer, and is prepared by an immunological technique well known in the art as exemplified below. be able to. Furthermore, anti-ρΤα antibody fragments can also be used as long as they can inhibit the formation of ρΤα dimers. Examples of such antibody fragments include Fab, F (ab ′) ₂ , ScFv, and mlnlbody.

Polyclonal antibodies can be used, for example, with pΤα or a fragment thereof as an antigen and a commercially available adjuvant (for example, complete or incomplete Freund's adjuvant) In addition, it is administered to the animal subcutaneously or intraperitoneally about 2 to 4 times every 2 to 3 weeks (measure the antibody titer of the partially collected serum by a known antigen-antibody reaction and confirm its rise) It can be obtained by collecting whole blood about 3 to about 10 days after the final immunization and purifying the antiserum.

Examples of animals to which the antigen is administered include mammals such as rats, mice, rabbits, goats, guinea pigs, and hamsters.

When a pΤα fragment is used as the antigen, the fragment contains one or more amino acid residues (eg, 1, 2, 3 or 4) involved in the formation of ρΤα self-dimer. Including.

A monoclonal antibody (m A b) can be prepared, for example, by a cell fusion method. For example, the above antigen is administered to mice subcutaneously or intraperitoneally 2-4 times with a commercially available adjuvant, and spleen or lymph nodes are collected approximately 3 days after the final administration, and leukocytes are collected. This leukocyte and myeloma cells (for example, NS-1, P 3 X 6 3 A g 8 and the like) are cell-fused to obtain a hybridoma that produces a monoclonal antibody against the antigen.

This cell fusion may be performed by the PEG method [J. Immunol. Methods, 81 (2): 223-228 (1985)], or the voltage pulse method [Hybridoma, 7 (6): 627-633 (1988) You may also go in. A hybridoma producing a desired monoclonal antibody can be selected by detecting an antibody that specifically binds to an antigen from the culture supernatant using a well-known EIA or RIA method.

The culture of the hybridoma producing the monoclonal antibody can be performed in vitro or in vivo, such as mouse or rat, preferably mouse ascites, and the antibody can be obtained from the culture supernatant of the hybridoma and the ascites of the animal, respectively. .

In view of the effects and safety when used in humans, the anti-pTc antibody is preferably a chimeric antibody of human and other animals (eg, mouse), and is a humanized antibody. Is more preferable, and a complete human antibody is particularly preferable. Here, “chimeric antibody” refers to an antibody having a variable region (V region) derived from an immunized animal and a constant region (C region) derived from human, and “human antibody” is other than CDR. An antibody in which all of these regions are replaced with human antibodies.

A chimeric antibody-humanized antibody, for example, excises a V region or CDR coding sequence from a mouse monoclonal antibody gene prepared by the same method as described above, and encodes a human myeloma-derived antibody C region. It can be obtained by cloning a chimeric gene fused with DNA into an appropriate expression vector, introducing it into an appropriate host cell and expressing the chimeric gene.

Although a complete human antibody can be produced from human (or mouse) hybridoma, in order to provide a large amount of antibody stably and at low cost, a human antibody-producing animal or phage It is desirable to manufacture using the display method.

Examples of human antibody-producing animals include XenoMouse (Abgenix); Huab Mouse (Medarex); KM Mouse (Kirin Brewery).

Examples of phage display libraries include CAT libraries; MRC libraries; Dyax libraries; Morphosys HuCAL libraries; Biolvent libraries; Crucel l libraries, and the like.

Fragment of extracellular domain of p Τ α has the ability to form an oligomer with DN cell's natural ρ Τ α, but induces the transition from DN cell to D Ρ cell (ie, 3 choices) It means any fragment of the extracellular domain (domain) of ρ ひ. Such fragments can inhibit the binding of native ρ Τ α to other native ρ Τ α by binding to the native ρ Τ α of DN cells. Specifically, the extracellular domain fragment of Ρ Τ α used in the present invention contains one or more amino acid residues involved in self-dimer formation (eg, 1, 2, 3 or 4). Including fragments that cannot induce 3 selection even when bound to the native ρΤα of DN cells.

Here, the amino acid residue involved in self-dimer formation in the fragment is human. force the amino acid residues include the p T _alpha These amino acid residues, two long as dimer forming ability is not lost, which may be substituted by a similar amino acid (eg if, A sp and G lu; Conservative amino acid substitution between Arg and Lys).

The present invention also provides a method of modulating Τ cell differentiation by modulating ρρα autodimer formation in vitro or in vivo.

In one embodiment, the method relates to a method of modulating sputum cell differentiation by modulating self-dimer formation of ρ Τα in the in vitro mouth, the method comprising the presence of the above-described sputum cell differentiation regulator Below, it includes culturing sputum cell precursors (ie, DN cells).

When a nucleic acid molecule is used as a cell differentiation regulator, the nucleic acid molecule can be used alone or after insertion into a suitable vector such as a plasmid or viral vector (for example, a retroviral vector) and then according to methods well known in the art. , Τ cell precursors.

When a protein is used as a τ cell differentiation regulator, the protein can be mixed with the medium as it is. Alternatively, a nucleic acid molecule encoding the protein may be inserted alone or into an appropriate vector, and then introduced into cells according to a method well known in the art.

As a medium for culturing cells, for example, MEM medium, DMEM medium, RPMI 1640 medium, 199 medium and the like containing about 5 to 20% fetal urine serum (FB S) are used.

The pH of the medium is preferably about 6-8. The culture is usually performed at about 30 ° C to 40 ° C for about 1 day to about 1 week, preferably about 1 day to about 3 hours. Ventilation and agitation may be performed as necessary.

In another embodiment, the method relates to a method of modulating sputum cell differentiation by modulating self-dimer formation of ρ Τα in vivo, the method comprising: Administration.

Examples of mammals include primates, laboratory animals, livestock, pets, etc. Specific examples include, but are not limited to, humans, monkeys, rats, mice, guinea pigs, rabbits, horses, mice, goats, hidges, nu, cats. Preferably, the mammal is human.

When using a nucleic acid molecule as a T cell differentiation regulator, after inserting the nucleic acid molecule alone or into an appropriate vector such as plasmid or viral vector (for example, those listed above as one expression vector), It can be administered to a mammal according to methods well known in the art.

In addition, when a protein is used as a T cell differentiation regulator, the protein itself can be administered to a mammal by a DDS (drug delivery system) technique known in the art by devising a dosage form. Alternatively, the nucleic acid molecule encoding the protein can be administered alone or after being inserted into an appropriate vector (for example, those listed as expression vectors above) and then administered according to methods well known in the art.

The T cell differentiation regulator of the present invention may further comprise a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include excipients, diluents, extenders, disintegrants, stabilizers, preservatives, buffers, emulsifiers, thickeners, solubilizers or other additives. . The T cell differentiation regulator of the present invention can be administered orally or parenterally by using one or more of the above carriers.

The dosage of a T cell differentiation regulator varies depending on the subject of administration, administration method, treatment time, type of active ingredient contained in the agent, etc., but is usually per adult (with a body weight of 6 O kg) A single dose can be administered in the range of lO jug to 100 O mg.

In the case of mammals other than humans, an amount obtained by converting the above value into the body weight of the mammal can be administered. However, since the dose varies depending on various conditions, a dose smaller than the above dose may be sufficient, and a dose exceeding the above range may be required.

(Screening method for T cell differentiation regulator) The present invention also provides a method for screening a T cell differentiation regulator. The screening method of the present invention includes evaluating whether a test substance modulates (promotes or suppresses) self-dimer formation of ρΤα. Specifically, the evaluation can be performed by comparing the degree of self-dimer formation of ρρα in the presence and absence of the test substance.

The “test substance” used in this screening method may be any known compound or new compound. The test substance is not particularly limited. For example, nucleic acid, carbohydrate, lipid, protein, peptide, antibody, organic or inorganic low molecular weight compound, organic or inorganic high molecular weight compound, combinatorial chemistry technique is used. Compound libraries prepared in this way, random peptide libraries prepared by solid-phase synthesis or phage display methods, or natural components derived from microorganisms, animals and plants.

ρΤα self-dimer formation can be detected and quantified, for example, by the following method:

a method using a chimeric protein of ρΤα and a fluorescent protein; and a cell expressing a chimeric protein of ρΤα and an erythropoietin receptor (E POR), or ρΤα and a thrombopoietin receptor (T POR) And a method using cells expressing a chimeric protein.

(Screening method using chimera protein of ρ Τ α and fluorescent protein) Screening method using chimera protein of ρ Τ α and fluorescent protein is, for example, Total Internal Reflection Fluorescence : TIRF) Microscopic analysis; Fluorescence Resonance Enargy Transfer (F RET) analysis.

The screening method using TIRRF microscopic analysis can detect ρ Τ ひ simple substance and dimer separately from the fluorescence intensity of the luminescent spot using cells expressing a chimera of ρ Τ α and fluorescent protein.

Fluorescent proteins used for this analysis include GFP, RFP, YFP, C FP, Kusabira-orange, etc. are mentioned.

The screening method using FRET analysis consists of the first fluorescent protein (excitation light wavelength I., fluorescence wavelength; LJ and pT human chimeric protein, the second fluorescence protein (excitation light wavelength, fluorescence wavelength L ₂ ) and ρΤ. Using cells expressing both the α and the chimeric protein, the cells can be irradiated with light of wavelength; I. Fluorescence of wavelength λ ₂ indicating the formation of the dimer can be detected.

Examples of combinations of the first and second fluorescent proteins used in this analysis include C F Ρ and YF Ρ.

As pTc used for the chimeric protein of ρΤα and fluorescent protein, human pT is preferably used. As the human ρΤα, for example, an amino acid sequence represented by the amino acid sequence represented by SEQ ID NO: 2 or a protein having substantially the same amino acid sequence is used (here, “substantially identical” The same as above).

Several splice variants are known for ρ Τ α, any of which may be used.

A cell expressing a chimeric protein of ρΤα and a fluorescent protein can be prepared by preparing a nucleic acid molecule encoding the chimeric protein and introducing the nucleic acid molecule into an appropriate cell.

A nucleic acid molecule that encodes a chimeric protein of ρ Τ α and a fluorescent protein is a nucleic acid molecule that encodes ρ Τ α and a nucleic acid molecule that encodes a desired fluorescent protein. For example, it can be produced by a technique using a PCR method.

Examples of nucleic acid molecules (DNA or RNA) encoding ρρα include genomic DNA, mRNA, cDNA, and the like.

Examples of such a nucleic acid molecule include DNA containing the base sequence of the entire coding region of human ρΤα shown in GenBank accession number: NM_138296 (SEQ ID NO: 1), or the DNA and the high stringency. Base sequences that hybridize under mild conditions And a protein containing the amino acid sequence of ρ Τ α shown in SEQ ID NO: 2 and substantially the same activity (the self-dimer is formed by the interaction of amino acid residues in the extracellular region) DNΑ that encodes a protein having a high activity). Examples of DNA that can hybridize under highly stringent conditions include, for example, about 60% or more, preferably about 70% or more, more preferably about 80% or more, of the base sequence shown in SEQ ID NO: 1. Particularly preferably, DNA containing a nucleotide sequence having a homology of about 90% or more can be used.

Information on the base sequences of various fluorescent proteins can be obtained from publicly available information sources (eg, academic literature, patent literature, gene and protein databases (eg, GenBank, etc.)). In addition, various fluorescent protein genes are commercially available from, for example, ί and BD Bisciences Clontech.

An expression vector containing a nucleic acid molecule that encodes a chimeric protein of pΤα and a fluorescent protein is prepared, for example, by preparing a target fragment (target gene) from the nucleic acid molecule encoding the chimeric protein. Can be produced by ligating downstream of the promoter in an appropriate expression vector.

Examples of expression vectors and promoters include animal virus vectors such as retrovirus and vaccinia virus (eg, IRES bicistronic expression vector, pA l—11, pXTl, pRcCMV, pRc / RSV, pc DNA

I / N eopME 1 8 S) is used.

When producing cells expressing two types of fluorescent proteins used for FRET analysis, a nucleic acid molecule encoding a chimeric protein with the first fluorescent protein,

The nucleic acid molecule encoding the chimeric protein with the two fluorescent proteins may be inserted on the same vector or on a separate vector.

When inserted on the same vector, both nucleic acid molecules may be under the control of separate promoters or may be under the control of the same promoter using an IRES bicistronic expression vector.

As a promoter, an appropriate promoter corresponding to the host used for gene expression is used. For example, LCK proximal promoter, SRa promoter, SV40 promoter, RSV-L TR promoter, CMV promoter motor, HSV-TK promoter, etc. are used.

The expression vector may contain an enhancer, a splicing signal, a poly A addition signal, a selection marker or a reporter gene, 340 origin of replication (3 V40 o r i), etc., as necessary.

Examples of the selection marker and reporter gene include a GFP gene, a luciferase gene, a J3-galactosidase gene, a dihydrofolate reductase gene, an ampicillin resistance gene, and a neomycin resistance gene.

The expression vector is preferably an IRES bicistronic expression vector in which the gene of interest is expressed from the same mRNA together with a selectable marker or reporter. Examples of IRES bicystic expression vectors are commercially available from pMX—IRES—GFP (Kitamura et al., Int. J. Hematol., 67, 351-9 (1998)), and CI ontech. A vector etc. are mentioned.

Gene introduction into a cell can be performed according to a method known in the art (for example, the method described in Virology, 52, 456 (1973)).

The cells you introduce a nucleic acid molecule encoding a chimeric protein with [rho Tauarufa and fluorescent proteins, preferably, cells which do not express native [rho T _alpha etc. (e.g., TG 40) 3, BW5 147 ) and the like .

Confirmation of gene transfer into a cell can be performed, for example, by a method using the above-described selection marker and reporter.

As a medium for culturing cells, for example, a MEM medium, DMEM medium, RPMI 1640 medium, and 199 medium containing about 5 to 20% fetal urine serum (FBS) are used.

The pH of the medium is preferably about 6-8. Culturing is usually performed at about 30 ° C to 40 ° C for about 1 day to about 1 week, preferably about 1 day to about 3 days. Ventilation and agitation may be performed as necessary. In the TI RF microscopy analysis, cells were measured using a total internal reflection fluorescence (TI RF) microscope (Biochem. Biophys. Res. Commun., 235, 47-53 (1997); Nature, 374, 555-9 (1995)). Can be imaged. Aq ua C osm recording and analysis of the resulting images

0 s software (Hamamatsu Photonics) can be used. The fluorescence intensity can be determined according to the method described in Nature, 374, 555-9 (1995), for example.

In FRET analysis, fluorescence resonance energy transfer from a first fluorescent material to a second fluorescent material in a cell can be detected, for example, using flow cytometry.

(Screening method using cells expressing a chimeric protein of p Τ α and E P OR or cells expressing a chimeric protein of ρ Τ α and TP OR)

Erythropoietin receptor (EPOR) and thrombopoietin receptor (TPOR) are cells that require IL-3 for growth when forced to form a self-dimer by mutation (hereinafter referred to as “IL_ The growth of 3 dependent cells)

It has been reported that it can be induced in the absence of 1 L-3 (Nature, 348, 647-649 (1990); Blood, 88, 1399-1406 (1996)).

Therefore, IL-3 expressing a chimeric protein containing the extracellular domain of p Τα, the transmembrane domain of E POR, and the extracellular domain (hereinafter also referred to as “p Ta / E POR chimera”). I L_ expressing a dependent protein or a chimeric protein containing the extracellular domain of ρ Τ α and the transmembrane domain and extracellular domain of TP OR (hereinafter also referred to as “P Τ α, Τ P OR chimera”) If 3-dependent cells are used, the formation of ρΤα self-dimer can be evaluated using the proliferation of the cells in the absence of IL-13 as an index.

As ρ Τ 用い used for the above chimeric protein, human ρ ΤΤ is preferably used. Examples of the extracellular domain of human ρ ΤΤ include, for example, the amino acid sequence shown by SEQ ID NO: 2 (full-length amino acid sequence of human ρ Τ _α ), amino acid sequence shown by amino acid numbers 17 to 147, or Proteins having substantially the same amino acid sequence are used (where “substantially identical” has the same meaning as above). There are several known splice variants for ρ Τ α. A deviation may be used.

As E P OR used for the chimeric protein, human E P OR is preferably used. As the transmembrane domain and cytoplasmic domain of human E POR, for example, in amino acid sequence represented by GenPept accession number AAA52403 (SEQ ID NO: 4) (full-length amino acid sequence of human EPOR), amino acid no. A protein having the amino acid sequence shown by 508 or a protein having substantially the same amino acid sequence is used (where “substantially identical” has the same meaning as above).

Preferably, human TP OR is used as the TP OR used in the chimeric protein. Examples of the transmembrane domain and cytoplasmic domain of human TPOR include amino acid numbers 468 to 61 in the amino acid sequence (full-length amino acid sequence of human TPOR) represented by GenPept accession number: NP_005364 (SEQ ID NO: 6). A protein having an amino acid sequence represented by 0 or a protein having substantially the same amino acid sequence is used (where “substantially identical” has the same meaning as above).

Preferably, EPOR or TPOR is derived from these parts when all of its transmembrane domain and cytoplasmic domain are used as a protein that constitutes the chimera, but the chimeric protein forms a dimer. Any part of these domains may be used as long as the resulting activity (the activity that induces the proliferation of IL-13-dependent cells in the absence of IL-13) is not lost. Do not autonomic dimerize).

Several splice variants are known for E POR or T POR, any of which may be used.

IL-3 dependent cells expressing a p TaZE POR chimera or pT α / T POR chimera create a nucleic acid molecule encoding the chimeric protein and introduce the nucleic acid molecule into an IL-13 dependent cell Can be produced.

Nucleic acid molecules encoding ρ Τ ZE POR chimera or ρ Τ α / TPOR chimera are nucleic acid molecules encoding p T nuclei or fragments containing the extracellular domain thereof, and E POR or TPOR or their transmembrane domains and cytoplasm Using a nucleic acid molecule encoding a fragment containing a domain, it can be produced by a gene recombination technique known in the art (for example, a technique using a PCR method).

Examples of nucleic acid molecules (DNDN or RNA) encoding pΤα include genomic DNA, mRNA, cDNA and the like. The extracellular domain of pTc can be amplified by the PCR method, RT-PCR method, etc. using genomic DNA or cDNA as a cage and using appropriate primers.

As a nucleic acid molecule encoding p Τ α, for example, DN A containing the base sequence of the entire coding region of human pT ct shown in GenBank accession number: 丽 _138296 (SEQ ID NO: 1), or the DN A And a protein containing a base sequence that hybridizes under highly stringent conditions and having the amino acid sequence of pT shown in SEQ ID NO: 2, substantially the same activity (residual amino acid residues in the extracellular region). DNA that encodes a protein having an activity of forming a self-dimer due to the interaction of the group can be mentioned.

Examples of the DN できる that can hybridize under highly stringent conditions include, for example, the base sequence represented by SEQ ID NO: 1, about 60% or more, preferably about 70% or more, more preferably about 80% or more, Particularly preferably, DNA containing a nucleotide sequence having a homology of about 90% or more can be used.

Examples of nucleic acid molecules (DNA or RNA) encoding E P OR include genomic DNA, mRNA, and cDNA. The transmembrane domain and cytoplasmic domain of EPOR can be amplified by the PCR method, the RT-PCR method, etc. using genomic DNA or cDNA as a saddle and appropriate primers.

Examples of DNA encoding EP OR include DNA containing the nucleotide sequence of the entire coding region of human EP OR shown in GenBank accession number: M60459 (SEQ ID NO: 3), or highly stringent with the DNA. It contains a nucleotide sequence that hybridizes under conditions, and has substantially the same activity as a protein containing the amino acid sequence of EPOR shown in SEQ ID NO: 4. DNA encoding a protein having an activity to grow in the absence of IL-13. The

Examples of the DNA that can hybridize under the high stringent conditions include, for example, the base sequence represented by SEQ ID NO: 3, about 60% or more, preferably about 70% or more, more preferably about 80% or more, Particularly preferably, DNA containing a base sequence having a homology of about 90% or more can be used.

Examples of nucleic acid molecules (DNA or RNA) encoding T POR include genomic DNA, mRNA, and cDNA. The transmembrane domain and cytoplasmic domain of TPOR can be amplified by PCR method, RT-PCR method, etc. using genomic DNA or cDNA as a cage and using appropriate primers.

Examples of DNA encoding TPOR include DNA containing the nucleotide sequence of the entire coding region of human T POR shown in GenBank accession number: N_005373 (SEQ ID NO: 5), or the DNA and high stringency. Contains a nucleotide sequence that hybridizes under mild conditions, and has substantially the same activity as the protein containing the amino acid sequence of TPOR shown in SEQ ID NO: 6. DNA encoding a protein having an activity of growing in the absence of IL_3).

Examples of DNA that can hybridize under conditions of high stringency include, for example, about 60% or more, preferably about 70% or more, more preferably about 80% or more, with the base sequence shown in SEQ ID NO: 5. Particularly preferably, DNA containing a nucleotide sequence having a homology of about 90% or more can be used.

An expression vector containing a nucleic acid molecule encoding a ρΤα E POR chimera or a ρΤα / T POR chimera can be prepared in the same manner as the above chimera of pTa and a fluorescent protein.

Gene transfer into IL-13-dependent cells can be performed according to a method known in the art (for example, the method described in Virology, 52, 456 (1973)).

Examples of IL-13-dependent cells include mouse pro B cell line Ba / F3 (BAF3), mouse mast cell line IC2, and mouse bone marrow cell line F-36P. Good Preferably, BAF 3 can be used as an IL_3 dependent cell.

Confirmation of gene transfer into IL-3-dependent cells can be achieved by, for example, using a selection marker and a reporter as exemplified in the chimera of ρΤα and fluorescent protein described above, using antibodies against E POR or T POR. It can be done with the plot used; or any combination thereof.

Examples of the medium and conditions for culturing IL-13-dependent cells include the medium and conditions exemplified in the above chimera of ρΤα and fluorescent protein. The presence or absence of interaction between ρ Τα / E POR chimera or pTaZTPOR chimera can be confirmed by the viability of the transfected IL-13-dependent cells in the absence of IL-13 . Cell viability can be determined, for example, by counting cells that are negative for iodide (Ρ) by flow cytometry.

The present invention also provides a kit for detecting a substance that modulates ρ 自己 α self-dimer formation. The kit includes a cell expressing a chimeric protein of ρΤα and a fluorescent substance described in the above screening method, or an IL-3-dependent cell expressing a chimeric protein of ρΤα and EPOR or TPOR. . The user can perform the above screening method using the kit of the present invention. In the second aspect, the present invention also relates to a system that can easily detect an interaction between various cell surface proteins in the extracellular region (hereinafter sometimes abbreviated as “the detection system of the present invention”). The detection system of the present invention comprises a nucleic acid molecule encoding a first chimeric protein comprising an extracellular domain of a first protein and a transmembrane domain and a cytoplasmic domain of an erythropoietin receptor or tombopoietin receptor, and IL-introduced with a nucleic acid molecule encoding a second chimeric protein comprising the extracellular domain of the second protein and the transmembrane domain and cytoplasmic domain of the erythropoietin receptor or tombopoietin receptor. 3 dependent cells are cultured in the absence of IL-13, Provided is a method for detecting an interaction in an extracellular region between cell surface proteins (hereinafter sometimes abbreviated as “the detection method of the present invention”), which comprises a step of confirming the presence or absence of cell growth.

The detection system of the present invention also includes a first chimeric protein comprising a extracellular domain of a first protein, a transmembrane domain and a cytoplasmic domain of an erythropoietin receptor or thrombopoietin receptor, and a second tan IL-13-dependent cells expressing a second chimeric protein comprising an extracellular domain of a protein and a transmembrane domain and a cytoplasmic domain of erythropoietin receptor or thrombopoietin receptor are provided.

The detection system of the present invention also provides a chimeric protein comprising an extracellular domain of a cell surface protein and a transmembrane domain and a cytoplasmic domain of an erythropoietin receptor or tombopoietin receptor.

The chimeric protein used in the detection system of the present invention comprises an extracellular domain of a cell surface protein to be tested for protein-protein interaction, and a transmembrane domain of the erythropoietin receptor (EPOR) or thrombopoietin receptor (TPOR). It consists of a domain and a cytoplasmic domain.

In the detection system of the present invention, “first protein” and “second protein” refer to cell surface proteins that are tested for interactions in the extracellular region between proteins.

Here, the “first protein” and the “second protein” may be the same type of protein or different types of proteins. In the detection system of the present invention, the “first protein” or the “second protein” or these are collectively referred to as “test protein”.

Any natural or human cell surface protein can be selected as a test protein in the detection system of the present invention. For example, since various cell surface receptors can play an important role in an intracellular signal transduction system that controls cell proliferation, differentiation, survival, etc., the protein constituting the receptor is the detection cis of the present invention. Can be a test protein.

Specific examples of the test protein in the detection system of the present invention include ρΤα (for example, GenBank accession number: MN_138296; GenPept accession number NP 612153; Saint-Ruf, C. et al., Science, 266, 1208- 1212, 1994); TCR a (eg GenBank registration number: AY475220, GenPept registration number. See AAS48060); TCR 3 (eg GenBank registration number: AY475218; GenPept registration number: see AAS48058) etc. Although not limited to these, any protein presumed to be a transmembrane (membrane-bound) protein by a hydrophobic plot (for example, Kyte-Dool ittle's hydrophobicity analysis) may be used.

In the detection system of the present invention, the “protein extracellular domain” means the entire region (domain) existing outside the cell surface protein or any fragment thereof.

In the detection system of the present invention, “the transmembrane domain and cytoplasmic domain of erythropoietin receptor (EPOR)” are preferably a region of human EPOR that penetrates the cell membrane (domain) and a region that exists in the cytoplasm ( Domain), or a protein substantially identical to the same (hereinafter, sometimes abbreviated as “active domain of EPOR”).

Here, “substantially the same” means that the amino acid sequence of the active domain of human EPOR is about 60% or more, preferably about 70% or more, more preferably about 80% or more, particularly preferably. A protein containing an amino acid sequence having a homology of about 90% or more, most preferably about 95% or more, and having substantially the same activity as the active domain of human EPOR.

As used herein, “homology” refers to an optimal alignment when two amino acid sequences are aligned using a mathematical algorithm known in the art (preferably, the algorithm uses the sequence for optimal alignment). The ratio of the same amino acid residue and similar amino acid residues to all overlapping amino acid residues in the case of introducing a gap in one or both of Taste.

`` Similar amino acids '' mean amino acids that are similar in physicochemical properties, such as aromatic amino acids, aliphatic amino acids, polar amino acids, basic amino acids, acidic amino acids, amino acids having hydroxyl groups, amino acids with small side chains, etc. Amino acids that fall into the same group. Such substitutions with similar amino acids are expected not to change the protein phenotype (ie, conservative amino acid substitutions). Examples of conservative amino acid substitutions are well known in the art and have been described in various literature (see, for example, Bowie et al., Science, 247: 1306-1310 (1990)).

The homology of the amino acid sequence can be calculated using the homology calculation algorithm N C B I B L A S T under the following conditions (expected value = 10, allow gap, Matritas = BL0SUM62, filtering = 0FF). Other algorithms for determining homology of amino acid sequences include, for example, alco and rhythm described in Karl in et al., Proc. Natl. Acad. Scl. USA, 90: 5873-5877 (1993) [ The alcoholism is incorporated into the NBLAS T and XBLAST programs (version 2.0) (Altschul et al., Nucleic Acids Res., 25: 3389-3402 (1997))], Needleman et al., J. Mol. Biol. , 48: 444-453 (1970) [the algorithm is incorporated into the GAP program in the GCG software package], Myers and Miller, CABIOS, 4: 11-17 (1988) [The algorithm is incorporated into the ALIGN program (version 2.0) which is part of the CGC sequence alignment software package], Pearson et al., Proc. Natl. Acad. Sci. USA, 85: Algorithm described in 2444-2448 (1988) [This Arco 'rhythm is a GCG software Apakke one built into di during FASTA Program], and the like, they can be used favorable Mashiku similarly.

Several splice variants are known for E P O R, any of which may be used.

Preferably, the active domain of EPOR is GenPept accession number AAA52403 (Ie, the amino acid sequence consisting of the full length OR F of human E POR (SEQ ID NO: 4)) and the amino acid sequence shown by amino acid numbers 25 1 to 508, about 60% or more, preferably about Examples include proteins having amino acid sequences having homology of 70% or more, more preferably about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more.

“Activity substantially the same as the active domain of human-derived E POR” refers to the formation of IL-13-dependent cells that express it in the absence of IL-13. Activity.

Here, “substantially the same quality” means that these properties are qualitatively equivalent. Accordingly, it is preferable that the quantitative factors such as the above-mentioned degree of activity are the same, but they may be different (for example, about 0.01 to about 100 times, preferably about 0.1 to about 1). 0 times, more preferably about 0.5 to about 2 times).

In addition, the protein substantially identical to the human E POR active domain used in the detection system of the present invention is, for example, a protein having the following amino acid sequence, and the human E POR activity: Also included are proteins that have substantially the same activity as the domain:

(1) In the amino acid sequence of SEQ ID NO: 4, one or more amino acid sequences represented by amino acid numbers 25 1 to 508 (preferably about 1 to 30, preferably about 1 to 10, (Preferably 1 to 5) an amino acid sequence in which amino acid is deleted; (2) in the amino acid sequence of SEQ ID NO: 4, one or more amino acid sequences represented by amino acid numbers 25 1 to 508 ( Preferably, about 1 to 30, preferably about 1 to 10, more preferably 1 to 5 amino acid sequences added;

(3) In the amino acid sequence of SEQ ID NO: 4, one or more amino acid sequences represented by amino acid numbers 25 1 to 508 (preferably about 1 to 30, preferably about 1 to 10, More preferably 1-5 amino acid sequences inserted with amino acids;

(4) In the amino acid sequence of SEQ ID NO: 4, amino acids 25 to 508 An amino acid sequence in which one or more amino acids in the amino acid sequence (preferably about 1 to 30, preferably about 1 to 10, more preferably 1 to 5) are substituted with other amino acids. Or

(5) An amino acid sequence obtained by combining the above (1) to (4).

Here, “substantially the same quality of activity” has the same meaning as above.

When the amino acid sequence is deleted, added, inserted or substituted, its deletion, force [1, the position of the insertion or substitution does not impair the activity of the protein and does not cause self-dimerization. As long as it is not particularly limited.

In the detection system of the present invention, “the transmembrane domain and cytoplasmic domain of thrombopoietin receptor (T POR)” are preferably a region of human TPOR that penetrates the cell membrane (domain) and a region that exists in the cytoplasm. (Domain) or a protein that is substantially the same (hereinafter sometimes abbreviated as “active domain of TPOR”).

Here, “substantially identical” means about 60% or more, preferably about 70% or more, more preferably about 80% or more, particularly preferably about 90%, with the amino acid sequence of the active domain of human TPOR. As mentioned above, most preferably a protein containing an amino acid sequence having a homology of about 95% or more and having substantially the same activity as the active domain of human TPOR. Is synonymous).

Several splice variants are known for TPOR, any of which may be used.

Preferably, as the active domain of TP OR, amino acid numbers 468-6 in the amino acid sequence represented by GenPept accession number: NP_005364 (ie, the amino acid sequence consisting of the full-length ORF of human TPOR (SEQ ID NO: 6)) It has about 60% or more, preferably about 70% or more, more preferably about 80% or more, particularly preferably about 90% or more, most preferably about 95% or more of homology with the amino acid sequence shown in 10. Examples include proteins having an amino acid sequence.

“Activity substantially equivalent to the active domain of human-derived TPOR” Examples include the activity of inducing the growth of IL-13-dependent cells that express it in the absence of IL-13.

The protein substantially identical to the human T POR active domain used in the detection system of the present invention is, for example, a protein comprising the following amino acid sequence, and the human T POR activity: Also included are proteins that have substantially the same activity as the domain:

(1) In the amino acid sequence of SEQ ID NO: 6, one or more amino acid sequences represented by amino acid numbers 468 to 6 10 (preferably about 1 to 30, preferably about 1 to 10, More preferably 1-5 amino acid sequences deleted of amino acids;

(2) In the amino acid sequence of SEQ ID NO: 6, one or more amino acid sequences represented by amino acid numbers 468 to 6 10 (preferably about 1 to 30, preferably 1)

About 10 or more preferably 1 to 5) an amino acid sequence to which an amino acid is added;

(3) In the amino acid sequence of SEQ ID NO: 6, one or more amino acid sequences represented by amino acid numbers 468 to 6 10 (preferably about 1 to 30, preferably about 1 to 10, More preferably 1-5 amino acid sequences inserted with amino acids;

(4) In the amino acid sequence of SEQ ID NO: 6, one or more amino acid sequences represented by amino acid numbers 468 to 6 10 (preferably about 1 to 30, preferably about 1 to 10) Or more preferably 1-5 amino acid sequences substituted with other amino acids; or

(5) An amino acid sequence obtained by combining the above (1) to (4).

If the amino acid sequence is deleted, added, inserted or substituted, the deletion, append The position of caro, insertion or substitution is not particularly limited as long as the activity of the protein is not impaired and self-dimerization is not caused.

In the detection system of the present invention, E POR or T POR is preferably used as a protein constituting the chimeric protein used in the detection system, wherein all of its transmembrane domain and cytoplasmic domain are used. As long as the activity resulting from the domains derived from them is not lost (the activity that induces the proliferation of IL-1-dependent cells in the absence of IL-13) It may be any part of these domains (provided that the part does not undergo autonomous dimerization).

The chimeric protein used in the detection system of the present invention may contain a part of the extracellular region in addition to the transmembrane domain and cytoplasmic domain of EPOR or TPOR.

A nucleic acid molecule encoding a chimeric protein used in the detection system of the present invention includes a nucleic acid molecule encoding a test protein or a fragment containing an extracellular domain thereof, and a fragment containing EPOR or TPOR or a transmembrane domain and a cytoplasmic domain thereof. Using the encoding nucleic acid molecule, it can be produced by a gene recombination technique known in the art (for example, a technique using a PCR method). Examples of the nucleic acid molecule (DNA or RNA) encoding the test protein include genomic DNA, mRNA, and cDNA. The extracellular domain of the test protein can be genomic DNA or cDNA, using appropriate primers, Polymerase Chain Reaction (PCR) method, Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) method, etc. Can be amplified.

Information on the base sequences and amino acid sequences of various cell surface proteins or their extracellular domains that can be candidates for the test protein can be found in publicly available information sources (eg academic literature, patent literature, gene and protein databases ( For example, it can be obtained from GenBank, GenPept, etc.).

As a nucleic acid molecule (DNA or RNA) encoding E POR, genomic DN A, mRNA, cDNA and the like. The transmembrane domain and cytoplasmic domain of EPOR can be amplified by PCR, RT-PCR, etc. using genomic DNA or cDNA as a cage and appropriate primers.

Examples of DNA encoding E POR include DNA containing the nucleotide sequence of the entire coding region of human E POR shown in GenBank accession number: M60459 (SEQ ID NO: 3), or conditions highly stringent with the DNA. It contains a base sequence that hybridizes underneath, and has substantially the same activity as the protein containing the amino acid sequence of E POR shown in SEQ ID NO: 4. (By forming a dimer, IL-3-dependent cells are And DNA encoding a protein having an activity of growing in the absence of (3).

Examples of the DNA that can be hybridized under the highly stringent conditions include, for example, the base sequence represented by SEQ ID NO: 3, about 60% or more, preferably about 70% or more, more preferably about 80% or more, and particularly preferably DNA containing a nucleotide sequence having about 90% or more homology can be used.

Examples of nucleic acid molecules (DNA or RNA) encoding T POR include genomic DNA, mRNA, and cDNA. The transmembrane and cytoplasmic domains of TPOR can be amplified by PCR, RT-PCR, etc. using genomic DNA or cDNA as a cage and appropriate primers.

Examples of DNA encoding TPOR include DNA containing the nucleotide sequence of the entire coding region of human TPOR shown in GenBank accession number: 删 —005373 (SEQ ID NO: 5), or high stringency with the DNA. Contains a base sequence that is hyper-prehydated under mild conditions, and is substantially the same activity as a protein containing the amino acid sequence of TP OR shown in SEQ ID NO: 6 (by dimer formation, IL-3-dependent cells DNA that encodes a protein having the ability to grow in the absence of IL-13.

Examples of DNA that can be hyper-precipitated under the above highly stringent conditions include, for example, about 60% or more, preferably about 70% of the nucleotide sequence shown in SEQ ID NO: More preferably, DNA containing a base sequence having a homology of about 80% or more, particularly preferably about 90% or more can be used. Nucleotide sequence homology is calculated using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Allocation Search Tool), with the following conditions: Expected value = 1 0; Allow gaps; Filtering = ON, Match Score = 1; mismatch score = 1-3.

Hybridization should be carried out according to a method known per se or a method analogous thereto, such as the method described in Molecular Clonings 2nd edition (J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989). Can do. When a commercially available library is used, hybridization can be performed according to the method described in the attached instruction manual. The hybridization can be performed preferably under highly stringent conditions.

High stringent conditions include, for example, a sodium salt concentration of about 19 to about 40 mM, preferably about 19 to about 20 mM, and a temperature of about 50 to about 70 ° C., preferably Examples include conditions of about 60 to about 65 ° C. In particular, it is preferable that the sodium salt concentration is about 19 mM and the temperature is about 65 ° C.

Those skilled in the art will know the salt concentration of the hybridization solution, the temperature of the hybridization reaction, the probe concentration, the length of the probe, the number of mismatches, the time of the hybridization reaction, the salt concentration of the washing solution, and the washing. Understand that it can be easily adjusted to the desired stringency by changing the temperature etc. as appropriate.

An expression vector containing a nucleic acid molecule encoding a chimeric protein used in the detection system of the present invention can be obtained by, for example, extracting a target fragment (target gene) from a nucleic acid molecule encoding a chimeric protein used in the detection system of the present invention. The fragment can be prepared and ligated downstream of the promoter in an appropriate expression vector. Expression vectors include animal virus vectors such as retrovirus and vaccinia virus (for example, IRES bicistronic expression vector, pA1-11-1, pXTl, pRcZCMV, pRc / RSV, pcDNAI / N eo, pME 1 8 S), etc. are used.

The promoter may be any promoter suitable for the host used for gene expression, such as LCK proximal promoter, SRa promoter, SV40 promoter, RSV—LTR promoter, CMV promoter, HSV—TK promoter or the like is used.

The expression vector may contain an enhancer, a splice sync signal, a poly A addition signal, a selectable marker or reporter gene, 340 origin of replication (3 V40 o r i), etc., as necessary.

Examples of the selection marker and reporter gene include a green fluorescent protein (GFP) gene, a luciferase gene, a 3-galactosidase gene, a dihydrofolate reductase gene, an ampicillin resistance gene, and a neomycin resistance gene.

As an expression vector, an IRES bicistronic expression vector, in which the gene of interest is expressed from the same mRNA together with a selection marker or a reporter, is preferred. Examples of I RE S bicistronic expression vectors include pMX—I RE S—GFP (Kitamura et al., Int. J. Hematol., 67, 351-9 (1998)), and commercially available from CI ontech. Vector.

When the first protein and the second protein are heterogeneous, the nucleic acid molecule encoding the first chimeric protein and the nucleic acid molecule encoding the second chimeric protein may be inserted on the same vector. It may be inserted on a separate vector. When inserted on the same vector, both nucleic acid molecules may be under the control of separate promoters, or they may be under the control of the same promoter using the above IRES bicistronic expression vector. it can.

Gene transfer into IL_3 dependent cells can be accomplished by methods known in the art (eg, Viro logy, 52, 456 (1973)).

Examples of IL-13-dependent cell cells include mouse pro B cell line Ba, F 3 (also referred to herein as “BAF 3”), mouse mast cell line IC 2, mouse bone marrow cell line F— 36 P is mentioned.

In the detection system of the present invention, preferably, BAF 3 can be used as an IL-3 dependent cell.

Confirmation of gene transfer into IL_3-dependent cells can be achieved by, for example, using the above-described selection marker and reporter, plotting using an antibody against E POR or T POR, or any combination thereof. Can be performed by:

As a medium for culturing cells, for example, MEM medium, DMEM medium, RPMI 1640 medium, and 199 medium containing about 5 to 20% fetal urine serum (FB S) are used.

The pH of the medium is preferably about 6-8. Culturing is usually performed at about 30 ° C to 40 ° C for about 1 day to about 1 week, preferably about 1 day to about 3 days. Ventilation and agitation may be performed as necessary.

If the first protein and the second protein can interact in the presence of a specific ligand, an appropriate concentration of the ligand can be added to the medium.

Thus, the detection system of the present invention also provides a screening method for cell surface proteins that are known to interact and whose ligands are unknown. Alternatively, the detection system of the present invention also provides a method for screening an antagonist of a cell surface protein or an antagonist whose ligand is known.

In the detection system of the present invention, the presence or absence of an interaction between the first protein and the second protein in the extracellular region can be confirmed by the viability of the IL-3-dependent cells into which the gene has been introduced. Cell viability can be determined, for example, by counting negative iodide (PI) -negative cells by flow cytometry. When the first protein and the second protein are heterogeneous, in addition to the interaction between the first protein and the second protein, the interaction between the first protein and the second protein Or an interaction between the second protein.

Therefore, the presence or absence of the interaction between the first protein and the second protein indicates that both the nucleic acid molecule encoding the first chimeric protein and the nucleic acid molecule encoding the second chimeric protein are IL-13 dependent. Viability in the absence of IL-13 when introduced into a cell, and survival when nucleic acid molecules encoding the first and second chimeric proteins are each introduced alone into an IL-3-dependent cell It is more desirable to consider the degree by comparing the degree.

The detection system of the present invention also provides a kit for detecting interactions in the extracellular region between cell surface proteins. The detection kit comprises an E POR or TPOR or nucleic acid molecule that codes for their transmembrane and cytoplasmic domains; an expression vector; and IL-13 dependent cells.

If the user of this detection kit prepares a nucleic acid molecule encoding the cell surface protein to be tested or its extracellular domain, the detection kit can be used in the extracellular region between the test proteins according to the above procedure. The presence or absence of interaction can be confirmed.

The present invention will be described more specifically with reference to the following examples. However, the examples are merely illustrative of the present invention and do not limit the scope of the present invention. Example

(Example 1)

(Method)

(Mouse)

R ag 2 — ^{/ _} mice with C 5 7 BL 6 knocks were obtained from Taconic. pre-T—Mice were provided by Dr. H. von Boehmer (Da na-Farber Cancer Institute, Harvard Medical School). All mice were maintained in a laminar flow clean room and given standard laboratory feed and water as appropriate. All animal experiments were conducted according to the guidelines of our facility. I went.

(Cells and reagents)

The cytochrome c-specific T cell hybridoma (2 B 4) and its a-J3-variant (TG40) were maintained in RPM 1 1 640 supplemented with 10% F CS. TG 40 was infected with the P 14 T CR] 3 chain using the pMX-pu ro retroviral vector (TG40] 3).

Anti-CD4 mAb, anti-CD 8 mAb, anti-TCR] 3 mAb, anti-CD 25 mAb, and anti-hCD 8 mAb were purchased from eBio science. Anti-p T a (2 F 5) mAb was obtained from BD B ι o s c i enc e s force. Anti-r CD 2 mAb was obtained from CedarLane force.

Anti-hE POR mAb was obtained from Santa cruz.

(Construction of chimeric protein)

pTaZGFP was prepared by fusing GFP to the C-terminus of pT strand by PCR.

TCR a / GFP was prepared by fusing GFP to the C terminus of the P 14 TCR a chain by PCR.

ρΤα / E POR was prepared by fusing the extracellular domain of pΤα to the transmembrane and cytoplasmic domains of the human erythropoietin receptor by PCR.

TCR a / E POR was prepared by fusing the extracellular domain of P 14 TCR a to the transmembrane and cytoplasmic domains of the human erythropoietin receptor by PCR.

Specifically, the plasmid containing the full length of p Τ α is shaped into a bowl and pr 1 me r (1) and pri me r (2) containing a part of the transmembrane domain of EP OR are changed to ρ Τ α. The extracellular domain was amplified. On the other hand, the extracellular domain of TCR α was amplified with ρ ri me r (1) and pri me r (3) containing a part of the transmembrane domain of EPOR. Amplify the extracellular domain of pTα using a plasmid containing the full length of E POR as a 铸 shape and primer (4) and primer (5) containing a portion of the extracellular domain of ρΤα. The target pT α / E POR chimera molecule is amplified using primer (1) and primer (4) after annealing to the transmembrane domain to intracellular domain of E POR amplified using The cDNA encoding was obtained. On the other hand, an amplified product of the extracellular domain of TCR a was converted into a pri me r (4) containing a plasmid containing the full length of EP OR as a saddle and pri me r (6) containing a part of the extracellular domain of TCR α. The cDNA encoding the target TCRaZ E POR chimera molecule is annealed from the transmembrane domain to the intracellular domain of E POR and amplified with pri me r (1) and pri me r (4). Obtained.

The cDNA encoding the ρΤα-EPOR chimeric molecule and the cDNA encoding the TCR α, Ε POR chimeric molecule were subcloned into the pMX—IRES—GF Petter, respectively, and subjected to the following analysis.

primer (1) GGTGGACCATCCTCTAGACT (SEQ ID NO: 8)

primer (2) AGGGAGAGCGTCAGGATGAGTACCTGCCGCTGTGTCCCCC (SEQ ID NO: 9) primer (3) AGGGAGAGCGTCAGGATGAGCAGGTTTTGAAAGTTTAGGT (SEQ ID NO: 10) primer (4) TAATACGACTCACTATAGGG (SEQ ID NO: 1 1)

primer (5) GGGGGACACAGCGGCAGGTACTCATCCTGACGCTCTCCCT (SEQ ID NO: 1 2) primer (6) ACCTAAACTTTCAAAACCTGCTCATCCTGACGCTCTCCCT (SEQ ID NO: 1 3)

pMX—I RE S—r CD 2 is M. Ku b. Provided by Dr. (R i k e n).

pMX-I RE S— hCD 8 is a truncated human CD 8 α (厶 1) that lacks the cytoplasmic region of the N co I / S a 1 I fragment of GFP in MX—I RE S—GFP. It was constructed by exchanging with 98-2 14).

(marrow transplant)

For bone marrow transplantation (ΒΜΤ), Sca— 1 + BM cells from Rag 2—no mice were selected by MAC S (M l 1 tenyl) and 10% FC S, 10 The cells were cultured at 1 × 10 I in R PM I 16 40 supplemented with ng / ml IL-7 and 100 ng gZm 1 SCF (Pepro Tech). Retrovirus-mediated gene transfer was performed according to the method described in Yamasaki et al., Blood, 103, 3093-101 (2004). On day 1 and 2, 10-fold concentrated retroviral supernatant was added and this was centrifuged at 32 ° C. and 2 000 rpm for 1 hour. Four days after infection, hCD8 + cells were sorted using MAC S (M i 1 tenyi) and injected intravenously into irradiated (7 Gy) Rag 2−z mice. Six weeks after BMT, thymocytes or splenocytes were removed from the mice and analyzed. (Competitive BMT)

p Τ mouse-derived S ca— 1 + BM cells were treated with a retrovirus vector encoding wild type p T a -I RE S—h CD 8 or p T a ^{R 10} 2/1 ^{1 7A} − IRES—r Infected with a retroviral vector encoding CD2. Four days after infection, hCD8 + cells or rCD2 + cells were selected using MACS. 5 × 10 ⁵ cells from each population were mixed and injected into irradiated (4 G y) R ag 2-z mice. Three weeks after BMT, thymocytes were analyzed using FACS.

(Molecular modeling of ρ Τ α _] 3 heterodimer complex)

The sequence of mouse ρΤα (Genbank accession number: ΝΜ_011195) was obtained from the NC BI server. A partial sequence ranging from the 10 th residue to the 1 1 9 th residue of pTct was extracted, and its three-dimensional structure was predicted using a general method for homology modeling. The crystal structure of TC R α (PDB—entry: 1 nfd) (Wang et al., Embo. J., 17, 10-26 (1998)) was used as a template for creating homology-moderates. Obtained from Bank (PDB) (Berman et al., Nucleic. Acid. Res., 28, 235-42 (2000)). The partial sequence of ρΤα was aligned with the template protein using NW alig nment (Needleman et al., J. Mol. Biol., 48, 443-53 (1970)). In order to obtain proper alignment, the gaps and Cys residues in ρ Τ a are paired with the Cys residue of the template protein. It was moved manually to the corresponding position. Once proper alignment was achieved, the main chain atom in the target protein was assigned to the corresponding residue coordination in the TCRα template protein. Loop region insertions and deletions were modeled by searching for the appropriate structure from a fragment database generated from fragments of proteins of known structure. Side chains were constructed on the pTα model backbone using the Metropolis Monte Car 1 o method. To relax the structure, a 5 OO ps molecular dynamics simulation was performed: mo 1 ecu 1 ardynamics knockout AMB ER 8 (Cornell et al., Abstracts of the Papers of the American Chemical Society, 204, 40-Comp (1992) Pearlman et al., Computer Physics Communications, 91, 1-41 (1995)). The figure was created using Viewer Lite (Accelrys).

(Single molecule analysis)

Cells were analyzed using a total internal reflection fluorescence (TIRF) microscope (Tokunaga et al., Biochem. Biophys. Res. Commun., 235, 47-53 (1997); Funatsu et al., Nature, 374, 555-9 (1995)). I made it into an image. A beam from a solid state laser (4 88 nm, 20 mW, SAPPHIRE 488-20-OP S, COHERENT, CA) was introduced into an inverted microscope (IX-81, Olympus) for illumination. Images were captured using an EB-CCD camera (C-7190-23, Hamamatsu Photonics). Image recording and analysis was performed using Aqua Cosmos software (Hamamatsu Photonics). Cells were analyzed in Polyphenol-free eagle's MEM with folic acid and riboflavin on a glass bottom dish (Matsunami) coated with poly-L-lysine.

(Fluorescence resonance energy transfer (FRET))

PCR with CFP and YFP using p ECF P_C l and p EYF PC 1 (BD Biosciences Clontech) as templates in the same manner as the above pTa / GFP fusion protein. And fused. TCR anu ^{1 1} TG 40] 3 cells were reconstituted with retroviruses using these fluorescent proteins. For detection of FR ET by flow cytometry, Cells were analyzed for YFP (excitation 480 nm, emission 530 nm), CFP (excitation 407 nm; emission 51 nm) and FRET (excitation 407 nm; emission 535 nm) using FACSA ria . FRET was expressed as YF Ρ emission obtained by CFP excitation, and this was plotted against YF Ρ emission by YF Ρ excitation. (result)

(Pre-TCR constitutive internalization and lysosomal localization) pre-TCR has been proposed to act in a ligand-independent manner. The molecular mechanism is not clear. To address this issue, we used pT and TCRα GFP fusion proteins (ie, chimeric proteins) in the same cellular context to pre-TCR and α] 3 TCR sub- Cell localization and dynamic trafficking were visualized.

Fluorescently labeled P re one TCR Oyobihi] 3 TCR, respectively, by introducing P and TCR alpha Bruno GF [rho, was reconstituted in TCR a ^{nu 1 1} T cell hybridoma (TG40 3).

Anti-TCR] 3 staining shows that the surface expression level of pre-TCR is significantly lower than that of a ^ TCR (Figure la, left panel group and middle panel group). The total GFP expression level of these two strains is It was similar (Figure la, central panel group). Consistent with these observations, not the TCR aZGF P, but a significant fractional force of ρ Τ α / GF P, found in the Hosozuki vesicle and J intracellular vesicular compartments (Fig. 1a, right panel group), these were co-localized with lysosomal markers (Figure lb). The TCR 3 chain surface labeled with anti-TCR J3 mAb co-localized with pTaZGFP after incubation at 37 ° C for 30 min (Figure 1c). This indicated that the pre-TCR complex is rapidly internalized from the cell surface. These observations suggested that pr _TCR can be autonomously coupled.

TG40] 3 receptor receptor complex containing TaZGF P on the surface of the cell, or T The ability of the receptor-complex containing CRa / GFP to self-oligomerize was evaluated by TI RF microscopy as described above.

The number of G F P molecules within a single receptor cluster on the cell surface was assessed using pTaZG F P or TCR P. The fluorescence intensity of each single bright spot reflecting a single cluster of receptors on the cell surface was determined as described in Funatsu et al., Nature, 374, 555-9 (1995). The bright spots on the individual surfaces are analyzed, and their fluorescence is represented as a frequency distribution histogram (Fig. 1d). The average fluorescence intensity of a single GFP molecule determined simultaneously from recombinant GFP was 1 585 ± 56 a.u. (arbitrary units). Clusters with high fluorescence intensity reflecting oligomers are only observed in cells expressing pTc / GFP (Figure 1d, bottom panel) and not observed in cells expressing TCRα-GFP. (Figure ld, upper panel) It is worth noting.

Consistent with the above, single molecule microscopic analysis of pTFP on the cell surface suggested that the pre_TCR complex has the ability to form oligomers in the plasma membrane (Figure 1). d).

(ρ Τα / E POR chimera induces autonomous growth)

The inherent properties of p r e— TCR shown above depend entirely on ρ ΤΤ. This is because the cellular status and other receptor component (TCR] 3 and CD3 complex) forces are consistent between these two cell lines. Therefore, we focused on the structure and function of pT and utilized a novel system to test the ability of orico-merization in the absence of pT ligand binding.

The extracellular domain of ρ CR α and TCR α were fused to the transmembrane and cytoplasmic domains of human erythropoietin receptor 1 (E POR) (referred to as ρ Τ α / Ε POR and TCR α, Ε POR, respectively) (Figure 2a). The expression of each chimeric receptor in transduced BAF3 cells was confirmed by anti-EP OR immunoblotting and staining (Fig. 2b, Fig. 2c). BAF 3 cells transduced with p Τ _α E POR showed significant proliferation, even in the absence of IL-13, while mock infection (m ock) or TCR α, Ε POR infection did not affect BAF 3 proliferation (Figure 2d). These results indicated that the extracellular domain of pT itself has the ability to spontaneously form oligomers.

FRET analysis using ρΤα / CFP and pTa / YFΡ also showed that pr e-TCR has the ability to form oligomers on the cell surface (Figure 2e). (Specific charged residues in pT are important for pT aZE POR activity) To elucidate the structural requirements for oligomerization of ρ Τ α, by ρ Τ α / Ε Ρ Ο R Mutagenesis was performed using the induced cell proliferation.

We focused on the charged amino acid residues conserved for human and mouse ρ α (Fig. 3a). All of these amino acids in p Τ α were mutated individually and simultaneously, and their effects on BAF 3 growth were evaluated.

The inventors have found that D 22, R 24, R 10 2, and R 1 17 are important for the ρρα, ΕΕOR function. This is because the alanine substitution of each of these residues abolished the activity supporting growth (Fig. 3b, m5, m9 — m11).

Substitution of R 24 with bulky amino acid residues (Q), hydrophilic amino acid residues (S), or acidic amino acid residues (E) completely abolishes p TaZE POR activity (Figure 3b) , Ml 2—ml 4), on the other hand, replacement of R 24, R 102, and R 117 with basic amino acid residues (K) maintained this activity (FIG. 3b, ml 5—ml). 9).

This suggests that the positive charge of these residues is important for activity. Similarly, D 22A mutation is abrogated activity, D 22 E mutation which holds a negative charge, maintaining the activity (FIG. 3 b, m 6) when ₀ together, these observations, 22, The charged amino acids at positions 24, 102, and 117 suggest that they are important for the self-oligomerization properties of ρΤα.

p T a-TCR] 3 in the context of the three-dimensional structure of the heterodimer, to attempt to place these charged residues, molecular modeling, a] 3 TCR heterodimer (Wang et al., Embo. J., 17, 10-26 (1998)) (the details are as described above).

This model shows that functionally important amino acids, D 22, R 24, R 102, and R 1 1 7 are located on the molecular surface of the α-TCR / 3 complex (Figure 3c) . This suggests that these residues are properly positioned to promote electrostatic interactions that lead to oligomer formation.

In sharp contrast, the other charged residues, E 8 1, E 82, E 84, E 87, D 35, and D 42, were shown to face TCR / 3 ( Figure 3d). This suggests that these residues are unlikely to participate in pre-TCR self-oligomerization.

Consistent with this hypothesis, these residues, despite may play a role in p T _a _TCR] 3 double coalescence formation in thymocytes, p T alpha, essential for self-oligomerization of E POR protein There wasn't.

(R 1 02 / R 1 1 7 of ρ Τ α is important for / 3 selection in vivo)

We examined whether these charged residues actually contribute to pre-TCR function. Among the four important charged residues, R 1 02 and R 1 1 7 are separated from the ρ Τ α—] 3 interface in different directions, so the R 1 02 "1 1 7 Α mutation P Ta, GF P fusion protein (p Ta ^{R 1} ° ^{2 / 117A} / GFP) with TCRc ^{nu l} 'is introduced into cells and, as above, And analyzed.

Pre-TCR expression on the cell surface of cells expressing pT a ^R1 ° ^{2/1 17A} ZGF かなり was significantly higher than that in wild-type (WT) (Figure 4a). Furthermore, intracellular vesicles containing pre-TCR that reflect constitutive internalization are significantly reduced by the R 10 2 1 1 7 A mutant (FIG. 4b). These results indicate that these charged residues are important for effective pre-TCR internalization.

We then performed thymocyte in vivo in a radiation BMT experiment. The function of this mutant pTα in development was analyzed.

ρ Τ α— ^{/ _} Mouse sputum cells were retrovirally transduced with pT a ^WT — I RE S — hCD 8 or p Ta ^{R102 / 117A} — I RE S — r CD 2 and irradiated R ag 2—z—injected into mice. Three weeks later, thymocytes from recipient mice were analyzed for CD4 and CD8 expression in the hCD8 + or rCD2 + population (Figure 4c, upper panel group). Cells expressing WT ρ Τ α showed effective DP translocation (DP cells represented 85.6% of h CD 8+ thymocytes), whereas DP thymocytes were p T _a ^R1 ° ^Represented only 10.8% of ^{2 / 117A} expressing cells ( ^rCD2 +). Furthermore,] 3 is another event associated selection and down-regulation of CD 25 is, p T express p T a R ^102, the ^117A without p T shed ^WT - was remarkable in mice thymocytes (Figure 4c, lower panel group).

These results were also confirmed in a competitive BMT experiment. p T ct — z One BM cell is transduced separately with p T a ^WT — I RE S — h CD 8 or p T c ^{R102 / 117A} — I RE S — r CD 2 at a 1: 1 ratio. Mixed and injected into irradiated R ag 2 − / − recipient mice. Again, thymocytes expressing the R 1 02Z 1 1 7 A mutant (r CD 2+) showed less effective DP translocation than WT (h CD 8 ⁺ ). Thus, R 102 and / or R 1 17 within the extracellular domain of p Τα are thought to be important for the traversal of the] 3 selection checkpoint (the pre-TCR biological function in vivo).

(Example 2)

pre- TCR has been proposed to act in a ligand-independent manner (Irving et al., Science, 280, 905-8 (1998)) Force The molecular mechanism underlying such autonomous signaling is It is not clear.

The inventors have used the system of the invention to test the ability of pT to oligomerize, focusing on pTo; a protein unique to pre-TCR. A chimeric protein in which the extracellular domain of pTα and the extracellular domain of TCRα were fused to the transmembrane and cytoplasmic domains of Ε Ρ OR, respectively (Fig. 2a; hereinafter, p Τ α / Ε P OR and BAF 3 cells expressing TCR α EP EP OR) were prepared.

Τ α α extracellular domain using pri me r (1) and pr 1 me r (2) containing a part of the transmembrane domain of E POR. Was amplified. On the other hand, the plasmid containing the full length of TCR α is made into a saddle shape, and pr 1 me r (1) and pri me r (3) containing a part of the transmembrane domain of EPOR are used to change the extracellular domain of TCR α. Amplified.

Using pri me r (4) and pri me r (5) containing a part of the extracellular domain of ρ Enlarged E POR transmembrane domain to intracellular domain, amplified using pri me r (1) and pri me r (4) to encode the desired p Τ α, Ε POR chimeric molecule Obtained cDNA. On the other hand, an amplified product of the extracellular domain of TCR a is converted into a pri me r (4) containing a plasmid containing the full length of EP OR as a pod and a pri me r (6) containing a part of the extracellular domain of TCR a. The amplified E POR transmembrane domain to the intracellular domain is annealed and amplified with pri me r (1) and pri me r (4) to obtain cDNA encoding the desired TCRE POR chimeric molecule. It was.

cDNA encoding ρΤα / E POR chimeric molecule and cDNA encoding TCRAZE POR chimeric molecule were each pMX_IRES_GFP Patterer ■ Subcloned and subjected to the following analysis.

primer (1) GGTGGACCATCCTCTAGACT (SEQ ID NO: 8)

primer (2) AGGGAGAGCGTCAGGATGAGTACCTGCCGCTGTGTCCCCC (SEQ ID NO: 9) primer (3) AGGGAGAGCGTCAGGATGAGCAGGTTTTGAAAGTTTAGGT (SEQ ID NO: 1 0) primer (4) TAATACGACTCACTATAGGG (SEQ ID NO: 1 1)

primer (5) GGGGGACACAGCGGCAGGTACTCATCCTGACGCTCTCCCT (SEQ ID NO: 1 2) primer (6) ACCTAAACTTTCAAAACCTGCTCATCCTGACGCTCTCCCT (SEQ ID NO: 1 3) The expression of each chimeric receptor was confirmed by anti-E POR immunoblotting (Fig. 2b) and anti-E POR staining (Fig. 2c).

Cell viability after IL-3 wilt was determined by counting cells that were negative for commercialized (P I) by flow cytometry.

Figure 2d shows the relative percentage of GFP-cells (cells that do not express chimera: ○) or GFP + cells (cells that express chimera 翁), with the number of viable cells on day 0 as 100 Represent as The infection efficiency for each condition was 50% to 80% in all experiments and 4 independent experiments that showed similar results.

Even in the absence of IL-3, BAF3 cells transfected with pTα / E POR show significant proliferation, whereas mock infection or TCR aZE POR infection does not proliferate BAF3 (Figure 2d).

The above results suggested that the extracellular domain of ρΤα itself has the ability to spontaneously form oligomers.

In addition, experiments were performed using CD 8, which is a molecule known to exist as a homodimer due to the S—S bond of the extracellular domain.

BAF 3 cells expressing a chimeric protein (hereinafter referred to as CD 8ZE POR) in which the extracellular domain of CD 8 was fused to the transmembrane domain and cytoplasmic domain of EPOR were prepared.

Specifically, the extracellular domain of CD 8 was changed to pr 1 me r (7) and primer (8) containing a part of the transmembrane domain of EPOR, using a plasmid containing the entire length of CD 8 as a saddle. Amplified. Amplified product of CD8 extracellular domain using pr 1 mer (9) and primer (10) containing part of CD 8 extracellular domain, using a plasmid containing the full length of E POR as a saddle. Annealed from the transmembrane domain to the intracellular domain of EPOR, and using pri me r (7) and primer (9) To obtain a cDNA encoding the desired CD8ZE POR chimeric molecule. The cDNA encoding the CD 8 / E POR chimeric molecule is converted into pMX—I RE S—G

Subcloned into the FP vector and subjected to the following analysis.

primer (7) GGTGGACCATCCTCTAGACT (SEQ ID NO: 14)

primer (8) AGGGAGAGCGTCAGGATGAGATCACAGGCGAAGTCCAATC (SEQ ID NO: 1 5) primer (9) TTTGCGGCCGCTAAGAGCAAGCCACATAGC (SEQ ID NO: 1 6)

primer (10) GATTGGACTTCGCCTGTGATCTCATCCTGACGCTCTCCCT (SEQ ID NO: 1 7)

CD8ZE POR in pMX—I RE S—GFP vector was transfected into BAF 3 cells.

The degree of cell proliferation after IL-13 death was determined by counting cells that were negative for iodide (P I) by flow cytometry.

Figure 5 shows the cell proliferation rate of GFP + cells (chimeric expressing cells: ·) or GFP-cells (cells that do not express chimeras · ○) as a relative percentage with the number of viable cells on day 0 as 100. To express. Figure 5 shows that the CD 8ZE POR chimera induces cell proliferation. Industrial applicability

The present invention provides agents with a novel mechanism of action that modulate T cell differentiation by regulating PT self-dimerization. The present invention also provides a method for screening such a drug and a method for regulating T cell differentiation using such a drug. The T cell differentiation regulator of the present invention is useful as an agent that regulates T cell differentiation by a novel mechanism of action both in vitro and in vivo. Such T cell differentiation regulators prevent or treat diseases characterized by abnormal T cell differentiation or T cell increase or decrease (eg, acute lymphocytic leukemia, chronic lymphocytic leukemia, etc.). It may be useful as a pharmaceutical.

In addition, the present invention provides a system that can easily detect an interaction in the extracellular region between various cell surface proteins. The present invention provides a system that can easily detect an interaction between proteins in the extracellular region. The detection system of the present invention is useful as a tool for analyzing molecular mechanisms in cell events involving cell surface proteins (eg, cell differentiation, proliferation and survival). This application is based on Japanese Patent Application Nos. 2005-288640 and 2005-289 1 36 filed in Japan, the contents of which are incorporated in full herein.

Claims

The scope of the claims

1. Pre-T cell antigen receptor α Cell differentiation regulator comprising a substance that regulates α-chain self-dimer formation.

2. The agent for regulating the differentiation of sputum cells according to claim 1, wherein the substance is a substance that promotes self-dimer formation of a pre-spinal cell antigen receptor α chain.

3. The cell differentiation regulator according to claim 2, wherein the substance that promotes self-dimerization of the pre-cell antigen receptor α chain is a nucleic acid molecule encoding a pre-cell antigen receptor chain. .

4. The sputum cell differentiation regulator according to claim 1, wherein the substance is a substance that suppresses self-dimer formation of a pre-splenocyte antigen receptor α chain.

5. The substance that suppresses self-dimerization of the pre-cell antigen receptor α chain is an antisense nucleic acid, ribozyme, s 1 R Ν cell or antibody; or pre-cell. The agent for regulating differentiation of sputum cells according to claim 4, which is a fragment of an extracellular domain of an antigen receptor α chain.

6. A method of regulating Τ cell differentiation, comprising the step of regulating self-dimerization of pre-Τ cell antigen receptor chain.

7. A screening method for a sputum cell differentiation regulator comprising the step of evaluating whether a test substance regulates the pre-spread cell antigen receptor α chain self-dimer formation.

8. A kit for screening an agent for regulating 細胞 cell differentiation, which is a cell expressing a chimeric protein with ρ Τ human phosphor, or p T c and erythro-poietin receptor or Topo-popoietin A kit comprising IL-13-dependent cells expressing a chimeric protein with a receptor.

9. A method for detecting interactions in the extracellular region between cell surface proteins,

An extracellular domain of a first protein and a transmembrane domain and a cytoplasmic domain of an erythropoietin receptor or tombopoietin receptor, A nucleic acid molecule encoding the first chimeric protein, and

A nucleic acid molecule encoding a second chimeric protein comprising the extracellular domain of the second protein and the transmembrane and cytoplasmic domains of the erythropoietin receptor or the tropopoietin receptor

A method comprising culturing IL-13-dependent cells into which IL is introduced in the absence of IL-13 and confirming the presence or absence of proliferation of the cells.

10. The method according to claim 9, wherein the first protein and the second protein are the same type of protein.

11. The method according to claim 9, wherein the first protein and the second protein are heterologous proteins.

1 2. a first chimeric protein comprising the extracellular domain of the first protein and the transmembrane and cytoplasmic domains of the erythropoietin receptor or tombopoietin receptor; and

Expressing IL-3 dependent cells.

1 3. The cell according to claim 12, wherein the first protein and the second protein are the same type of protein.

1 4. The cell according to claim 12, wherein the first protein and the second protein are heterologous proteins.

1 5. A chimeric protein comprising the extracellular domain of a cell surface protein and the transmembrane and cytoplasmic domains of erythropoietin receptor or thrombopoietin receptor.

1 6. A nucleic acid molecule encoding the chimeric protein according to claim 15.

1 7. An expression vector comprising the nucleic acid molecule according to claim 16.

1 8. Keys for detecting interactions in the extracellular region between cell surface proteins The following.

Erythropoietin receptor or thrombopoietin receptor Nucleic acid molecules encoding their transmembrane and cytoplasmic domains; expression vectors; and

IL-3 dependent cells

Including kits.