JPWO2007043200A1 - T cell differentiation regulator - Google Patents

Abstract

The present invention provides a new type of drug that regulates T cell differentiation and canceration based on the molecular mechanism of signal transduction by pre-TCR. The present invention also provides a system that can easily detect interactions in the extracellular region between various cell surface proteins.

Description

  The present invention relates to a T cell differentiation regulator, a screening method for a T cell differentiation regulator, and a method for regulating T cell differentiation. The invention also relates to a system for detecting interactions in the extracellular region between cell surface proteins.

Interactions in the extracellular region between cell surface proteins often can play an important role in intracellular signaling systems that control cell proliferation, differentiation, survival, and the like.
For example, erythropoietin receptor (EPOR) is a cell surface receptor for erythropoietin (EPO), a factor that induces the differentiation and proliferation of erythroid progenitors, and EPOR binds EPO to its extracellular region. To dimerize and transmit EPO signals into cells to control the proliferation and differentiation of erythrocytes. Regarding the signal transduction mechanism by EPO / EPOR, Yoshimura et al. Reported that an EPOR having an extracellular region mutation that self-dimerizes without EPO requires IL-3 for proliferation (in this specification, (Referred to as Yoshimura et al., Nature, 348, 647-649 (1990)), which is capable of inducing the proliferation of BAF3 cells, which are referred to as “IL-3-dependent cells”. ).
In addition, when the thrombopoietin receptor (TPOR) involved in platelet proliferation is mutated to self-dimerize without its ligand, the proliferation of IL-3-dependent cells is suppressed in the absence of IL-3. (Onishi et al., Blood, 88, 1399-1406 (1996)).
On the other hand, in the development of early T cells, a pre-T cell antigen receptor (hereinafter also referred to as “pre-TCR”) plays an important role.
Generation of αβ T cells from hematopoietic stem cells occurs in the thymus. Early T cell progenitors in the thymus are cells lacking CD4 and CD8 expression (hereinafter also referred to as “DN cells”), which express pre-T cell antigen receptors.
pre-TCR is a complex composed of a T cell antigen receptor β chain (TCRβ), a pre-T cell antigen receptor α chain (pTα), and a CD3 molecule (CD3γ chain, CD3ε chain and CD3ζ chain). Expression differentiates DN cells with abundant TCRβ reconstitution into CD4 ⁺ CD8 ⁺ double positive cells (hereinafter also referred to as “DP cells”). This process is referred to as β selection (see Fehling et al., Nature, 375, 795-8 (1995)). Indeed, pre-TCR has been reported to cause CD4 and CD8 survival, proliferation, and expression; Tcra reconstitution; Tcrb locus allelic exclusion (Fehling et al., Nature, 375, 795-8). (1995)).
Many studies suggest that pre-TCR can transduce signals in a ligand-independent manner. For example, Irving et al. Report that an extracellular Ig-like domain is not required for signal transduction (see Irving et al., Science, 280, 905-8 (1998)). Saint-Ruf et al. Also show that in cell lines expressing pre-TCR, pre-TCR is present in raft and signals without ligation to exogenous ligands (Saint-Ruf). Et al., Nature, 406, 524-7 (2000)).
To date, it has been argued that the intracellular cysteine of pTα that contacts the membrane may be responsible for raft localization. However, it has been found that substitution of this cysteine with alanine does not impair pre-TCR function (see Aifantis et al., Nat. Immunol., 3, 483-8 (2002)). Furthermore, suitable pre-TCR functions include the cytoplasmic tail of pTα (see Aifantis et al., Nat. Immunol., 3,483-8 (2002)) and the extracellular domain (Borowski et al., J. Exp. Med., 199). 607-15 (2004)).
Haks et al. Have proposed a low activity threshold for DN cells as a ligand-independent signaling mechanism for pre-TCR (see Haks et al., J. Immunol. 170, 2853-61 (2003)). However, recent extensive analysis has shown that pTα is not just a substitute for TCRα, but rather that pTα has a pTα-specific signaling potential that differs from that of TCRα ( (See Borowski et al., J. Exp. Med., 199, 607-15 (2004); Huang et al., Eur. J. Immunol., 34, 1532-41 (2004)).
It has also been suggested that signals via pre-TCR trigger canceration in leukemia cells (Bellavia et al., Proc. Natl. Acad. Sci. USA, 99, 3788-3793 (2002)).
As described above, despite a wide variety of studies regarding the development of early T cells by pre-TCR, the molecular mechanism underlying the autonomous signal by pre-TCR is difficult to grasp and is still unclear. Absent.

The first object of the present invention is to clarify the molecular mechanism of signal transduction by pre-TCR and to provide a new type of drug that regulates T cell differentiation and canceration based on this mechanism. In order to elucidate the molecular mechanism of signal transduction by pre-TCR, the inventors focused on the structure and function of pTα, which is a component unique to pre-TCR. As a result, it was found that pTα spontaneously forms a self-dimer through electrostatic interaction with charged amino acid residues present in the extracellular region. Furthermore, inhibition of pTα self-oligomerization by substitution of these amino acid residues inhibited the normal transition from DN cells to DP cells. Therefore, the present inventors considered that pTα self-dimer formation is an essential molecular mechanism of pre-TCR autonomous signaling.
The second object of the present invention is to provide a system that can easily detect an interaction in the extracellular region between various cell surface proteins. When the present inventors introduce a nucleic acid encoding a chimeric protein containing the extracellular domain of a cell surface protein and the transmembrane domain and cytoplasmic domain of EPOR into an IL-3 dependent cell and express it, the extracellular protein is expressed. It was found that when the domains interact, the chimeric protein forms a dimer and induces the proliferation of the cells in the absence of IL-3. That is, it was found that the interaction between extracellular domains of cell surface proteins can be detected using IL-3-independent cell proliferation as an index by using the chimeric protein expression system of the present detection system.
As a result of further research based on the above findings, the present inventors have completed the present invention. That is, the present invention is as follows:
[1] A T cell differentiation regulator comprising a substance that regulates self-dimer formation of a pre-T cell antigen receptor α chain;
[2] The T cell differentiation regulator according to [1], wherein the substance is a substance that promotes self-dimer formation of a pre-T cell antigen receptor α chain;
[3] The T cell differentiation regulator according to [2], wherein the substance that promotes self-dimer formation of the pre-T cell antigen receptor α chain is a nucleic acid molecule encoding the pre T cell antigen receptor α chain;
[4] The T cell differentiation regulator according to [1], wherein the substance is a substance that suppresses self-dimer formation of a pre-T cell antigen receptor α chain;
[5] The substance that suppresses self-dimer formation of the pre-T cell antigen receptor α chain is an antisense nucleic acid, ribozyme, siRNA or antibody against the pre-T cell antigen receptor α chain; or pre-T cell antigen receptor α chain T cell differentiation regulator according to [4], which is a fragment of the extracellular domain of
[6] A method of regulating T cell differentiation, comprising a step of regulating self-dimer formation of a pre-T cell antigen receptor α chain;
[7] A screening method for a T cell differentiation regulator comprising the step of evaluating whether a test substance regulates the pre-T cell antigen receptor α chain self-dimer formation;
[8] Kit for screening for T cell differentiation regulator, expressing cells expressing chimeric protein of pTα and fluorescent substance, or expressing chimeric protein of pTα and erythropoietin receptor or thrombopoietin receptor A kit comprising IL-3 dependent cells;
[1A] A method for detecting an interaction in an extracellular region between cell surface proteins,
A nucleic acid molecule encoding a first chimeric protein comprising an extracellular domain of a first protein and a transmembrane and cytoplasmic domain of an erythropoietin receptor or thrombopoietin receptor, and an extracellular domain of a second protein IL-3 dependent cells, into which a nucleic acid molecule encoding a second chimeric protein, comprising a transmembrane domain and a cytoplasmic domain of erythropoietin receptor or thrombopoietin receptor has been introduced, A method comprising culturing under pressure and confirming the presence or absence of proliferation of the cells;
[2A] The method according to [1A] above, wherein the first protein and the second protein are the same type of protein;
[3A] The method according to [1A] above, wherein the first protein and the second protein are heterologous proteins;
[4A] a first chimeric protein comprising the extracellular domain of the first protein and the transmembrane and cytoplasmic domains of the erythropoietin receptor or thrombopoietin receptor; and the extracellular domain of the second protein; IL-3 dependent cells expressing a second chimeric protein comprising the transmembrane and cytoplasmic domains of erythropoietin receptor or thrombopoietin receptor;
[5A] The cell according to [4A] above, wherein the first protein and the second protein are the same type of protein;
[6A] The cell according to [4A] above, wherein the first protein and the second protein are heterologous proteins;
[7A] a chimeric protein comprising the extracellular domain of a cell surface protein and the transmembrane and cytoplasmic domains of erythropoietin receptor or thrombopoietin receptor;
[8A] A nucleic acid molecule encoding the chimeric protein according to [7A] above;
[9A] An expression vector comprising the nucleic acid molecule according to [8A] above; and [10A] a kit for detecting an interaction in an extracellular region between cell surface proteins, the following:
Nucleic acid molecules encoding erythropoietin receptor or thrombopoietin receptor or their transmembrane and cytoplasmic domains;
An expression vector; and a kit comprising IL-3-dependent cells.

FIG. 1a shows surface staining of reconstituted pre-TCR and αβTCR. TCRα ^null T cell hybridomas (TG40β) were infected with pMX-pTα / GFP-IRES-rCD2 or pMX-TCRα / GFP-IRES-rCD2 and sorted with anti-rCD2 using MACS. Cells were stained with APC-labeled anti-TCRβ and subjected to flow cytometry (left panel group and middle panel group). Cells were also analyzed by fluorescence microscopy. A representative image is shown as a deconvoluted fluorescence image (right panel group) (BZ8000, Keyence). The frequency of cells with more than 10 fluorescent spots was determined from multiscan images. The frequency was 2.7 ± 3.9% (TCRα / GFP) and 87.9 ± 1.7% (pTα / GFP).
FIG. 1b shows that the internalized pre-TCR is localized in the lysosome. Cells were treated with 50 nM LysoTracker Red DND-99 for 30 minutes and then analyzed by wide field fluorescence microscopy (IX-81, Olympus).
FIG. 1c shows the rapid and constitutive internalization of pre-TCR. Cells were prestained with PE-labeled anti-TCRβ, then incubated for 30 minutes at 37 ° C. and analyzed by confocal fluorescence microscopy (DMIRE2, Leica). The scale bar represents 5 μm.
FIG. 1d is a graph showing that preTCR tends to form oligomers on the cell surface.
FIG. 2a is a schematic diagram of the pTα / EPOR chimera and the TCRα / EPOR chimera.
FIG. 2b shows the expression of the EPOR chimera. BAF3 cell lines were infected with pTα / EPOR chimera or TCRα / EPOR chimera in pMX-IRES-GFP vector and the expression of each was analyzed by anti-EPOR immunoblot.
FIG. 2c shows the expression of the EPOR chimera. BAF3 cell lines were infected with pTα / EPOR chimera or TCRα / EPOR chimera in pMX-IRES-GFP vector and the expression of each was analyzed by anti-EPOR staining.
FIG. 2d shows the cell viability of each BAF3 transfectant after IL-3 depletion. Shown is a representative merged image of bright field and GFP 2 days after IL-3 depletion (upper panel group). Cell viability after IL-3 depletion was determined by counting propidium iodide (PI) negative cells by flow cytometry. The viability of GFP-cells (cells not expressing a chimera: ◯) or GFP ⁺ cells (cells expressing a chimera: ●) on each day is expressed as a relative percentage with the number of viable cells on day 0 as 100. The infection efficiency for each condition was 50% -80% in all experiments and 4 independent experiments that showed similar results.
FIG. 2e shows the generation of FRET in T cells co-expressing pTα / CFP and pTα / YFP. TG40β cells were transduced with pTα / YFP alone (left panel group), pTα / CFP and pTα / YFP (middle panel group), or pTα ^{R102 / 117A} CFP and pTα ^{R102 / 117A} / YFP (right panel group). The surface expression of pre-TCR was verified by anti-TCRβ staining of each of the three cell lines as described in FIG. 1a. The percentage of FRET positive cells (square gates) in YFP ^high cells (10,000 cells; black dots) is shown.
FIG. 3a shows the amino acid sequence of the extracellular domain of mouse pTα (SEQ ID NO: 7). The amino acid number of the mature protein is indicated.
FIG. 3b shows the substitution of charged amino acids within the extracellular domain of pTα. PTα / EPOR having the mutations (m1 to m19) shown in the figure was tested for growth promoting activity in BAF3 as shown in FIG. 2d. The value represents the relative activity (%) 2 days after IL-3 depletion, with WT pTα / GFP activity as 100.
FIG. 3c shows a three-dimensional view of the three-dimensional structural model of the pTα-TCRβ complex. Functionally important charged amino acids (D22, R24, R102 and R117) are represented by a ball and stick model.
FIG. 3d shows a three-dimensional view of the three-dimensional structural model of the pTα-TCRβ complex. The substitutable charged amino acids (D56, D67, E81, E82, E84 and E87) are represented by a ball and stick model.
FIG. 4a shows that R102 / R117 is essential for spontaneous internalization of pre-TCR. pTα ^WT / GFP and pTα ^{R102 / 117A} / GFP were introduced into TG40β cells and surface pre-TCR expression was analyzed using anti-TCRβ APC (grey histogram) and control Ab (white histogram).
FIG. 4b shows the frequency of cells with intracellular GFP vesicles. Cells were analyzed by fluorescence microscopy and multiscan images were used to count the number of cells with more than 10 bright vesicles. Data are the mean percent of 5 independent fields ± s. d.
FIG. 4c shows the BMT reconstitution assay. Sca-1 ⁺ pTα ^{− / −} BM cells were individually infected with WT pTα ^WT -IRES-rCD8 or pTα ^{R102 / 117A} -IRES-hCD2. rCD8 or hCD2 positive cells were sorted and individually injected into irradiated Rag2 ^{− / −} recipient mice. Three weeks after injection, thymocytes were analyzed for expression of CD4 / CD8 (upper panel group) and CD25 (lower panel group) in the hCD8 ⁺ population (middle panel group) or rCD2 ⁺ population (right panel group). Higher surface expression of pTα ^{R102 / 117A} compared to the surface expression of pTα ^WT was confirmed by staining with anti-pTα.
FIG. 4d shows a competitive BMT reconstitution assay. pTα ^WT -IRES-rCD2 or pTα ^R102 / 117A -IRES-hCD8 were infected ^{separately, Sca-I + pTα - /} - BM cells, were mixed at a ratio of 1: 1, and irradiated Rag2 ^{- / -} Recipient mice were injected simultaneously. Three weeks later, thymocytes were analyzed for CD4 / CD8 expression in the hCD8 ⁺ (WT) gate population or the rCD2 ⁺ (R102 / 117A) gate population. Data are representative 3 independent experiments with similar results.
FIG. 5 represents cell viability of BAF3 transfectants after IL-3 depletion. The viability of GFP ^- cells (cells not expressing the chimera: ◯) and GFP ⁺ cells (cells expressing the chimera: ●) on each day is expressed as a relative percentage with the number of viable cells on day 0 as 100.

The terms used in this specification will be described below.
As used herein, “nucleic acid molecule” means single-stranded or double-stranded DNA or RNA. As used herein, “nucleotide sequence” refers to the sequence of deoxyribonucleotides (represented by A, G, C, and T) or ribonucleotides (represented by A, G, C, and U), unless otherwise specified. Means an array. In the present specification, unless otherwise specified, the single-stranded nucleotide sequence represents the 5 ′ end on the left end and the 3 ′ end on the right end.
In this specification, unless otherwise specified, amino acid notation uses standard or three-letter abbreviations that are standard notation for amino acids. In the present specification, unless otherwise specified, the amino acid sequence represents the N-terminus (amino terminus) at the left end and the C-terminus (carboxyl terminus) at the right end.
As used herein, “T cell precursor” refers to thymocytes lacking expression of CD4 and CD8 (“CD4 ⁻ CD8 ⁻ Meaning “double negative thymocytes” or “DN cells”).
As used herein, “modulating T cell differentiation” refers to CD4 ⁻ CD8 ⁻ From double negative thymocytes (DN cells), CD4 ⁺ CD8 ⁺ It means promoting or suppressing the process of differentiation into double positive thymocytes (DP cells) (ie β selection).
In the present specification, “modulate pre-T cell antigen receptor α chain (pTα) self-dimer formation” means to promote or suppress self-dimerization of pTα on the cell surface of DN cells. To do.
As used in the present invention, the “pre-T cell antigen receptor α chain (pTα)” preferably means human-derived pTα or a protein substantially identical thereto.
Here, “substantially identical” means about 60% or more, preferably about 70% or more, more preferably about 80% or more, particularly preferably about 90% or more, with the amino acid sequence of human-derived pTα. Most preferably, it refers to an amino acid sequence having a homology of about 95% or more, wherein the protein having the amino acid sequence has substantially the same activity as pTα derived from human.
Here, “homology” refers to an optimal alignment when two amino acid sequences are aligned using a mathematical algorithm known in the art (preferably, the algorithm is a sequence for optimal alignment). The ratio of the same amino acid residues and similar amino acid residues to all overlapping amino acid residues in the case of introduction of a gap into one or both of the above.
“Similar amino acids” mean amino acids similar in physicochemical properties, such as aromatic amino acids, aliphatic amino acids, polar amino acids, basic amino acids, acidic amino acids, amino acids having hydroxyl groups, amino acids with small side chains, etc. Examples include amino acids that fall into the same group. Such substitutions with similar amino acids are expected not to change the protein phenotype (ie, conservative amino acid substitutions). Specific examples of conservative amino acid substitutions are well known in the art and are described in various literature (see, for example, Bowie et al., Science, 247: 1306-1310 (1990)).
Amino acid sequence homology can be calculated using NCBI BLAST, which is a homology calculation algorithm, under the following conditions (expectation value = 10, allow gap, matrix = BLOSUM62, filtering = OFF).
Other algorithms for determining amino acid sequence homology include, for example, Karlin et al., Proc. Natl. Acad. Sci. USA, 90: 5873-5877 (1993) [the algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) (Altschul et al., Nucleic Acids Res., 25: 3389-3402 (1997)) ] Needleman et al., J .; Mol. Biol. 48: 444-453 (1970) [the algorithm is incorporated into the GAP program in the GCG software package], Myers and Miller, CABIOS, 4: 11-17 (1988) [ The algorithm is incorporated into the ALIGN program (version 2.0) which is part of the CGC sequence alignment software package], Pearson et al., Proc. Natl. Acad. Sci. USA, 85: 2444-2448 (1988) [the algorithm is incorporated in the FASTA program in the GCG software package] and the like, and they can be preferably used as well.
Several splice variants are known for pTα, any of which may be used in the present invention.
The human pTα used in the present invention is preferably about 60% or more, preferably about 70% or more, more preferably about 80% or more, particularly preferably the amino acid sequence shown in GenPept accession number NP — 612153 (SEQ ID NO: 2). Is a protein having an amino acid sequence having a homology of about 90% or more, most preferably about 95% or more.
The protein substantially the same as human-derived pTα used in the present invention includes, for example, proteins having the following amino acid sequences and having substantially the same activity as human pTα. Is:
(1) One or more (preferably about 1 to 30, preferably about 1 to 10, more preferably 1 to 5) amino acids in the amino acid sequence of human pTα shown in SEQ ID NO: 2 A deleted amino acid sequence;
(2) One or more (preferably about 1 to 30, preferably about 1 to 10, more preferably 1 to 5) amino acids are added to the amino acid sequence of human pTα shown in SEQ ID NO: 2. Amino acid sequence;
(3) One or more (preferably about 1 to 30, preferably about 1 to 10, more preferably 1 to 5) amino acids are inserted into the amino acid sequence of human pTα shown in SEQ ID NO: 2. Amino acid sequence;
(4) One or more (preferably about 1 to 30, preferably about 1 to 10, more preferably 1 to 5) amino acids in the amino acid sequence of human pTα shown in SEQ ID NO: 2 An amino acid sequence substituted with another amino acid; or
(5) An amino acid sequence obtained by combining the above (1) to (4).
When the amino acid sequence is deleted, added, inserted or substituted, the position of the deletion, addition, insertion or substitution is not particularly limited as long as the activity of the protein is not impaired.
As for pTα, substantially the same activity includes an activity in which pTα forms a self-dimer and induces the transition from DN cells to DP cells (ie, β selection).
Here, “substantially the same quality” means that these properties are qualitatively equivalent. Accordingly, the quantitative factors such as the above-mentioned degree of activity are preferably equivalent, but may be different (for example, about 0.01 to about 100 times, preferably about 0.1 to about 10 times, more Preferably about 0.5 to about 2 times).
The pTα self-dimer formation can be confirmed and quantified by the method described in the screening method described later. The transition from DN cells to DP cells can be confirmed and quantified by detecting CD4 and CD8 molecules expressed on the cell surface using antibodies that specifically react with each of these molecules. Examples of the detection method of the antibody include a method using fluorescence (for example, Fluorescence Activated Cell Sorter (FACS) method), a method using enzyme reaction (for example, Enzyme-Linked Immunosorbent Assay (ELISA) method), radioisotope. The method of using is mentioned.
In the present specification, unless otherwise specified, the “extracellular domain” of a protein means the entire region (domain) existing outside the cell surface protein or any fragment thereof.
In the present specification, the “transmembrane domain” of a protein means the entire region (domain) penetrating the cell membrane of a cell surface protein or any fragment thereof, unless otherwise specified.
In the present specification, the “cytoplasmic domain” of a protein means the entire region (domain) present in the cytoplasm of a cell surface protein or any fragment thereof, unless otherwise specified.
In the present specification, “chimeric protein” (hereinafter, also simply referred to as “chimera”) means a fusion protein composed of two or more domains derived from different proteins, unless otherwise specified.
As used herein, “IL-3-dependent cells” means cells that require IL-3 for survival / proliferation (in other words, cells that cannot proliferate in the absence of IL-3). .
Hereinafter, embodiments of the present invention will be described.
In a first aspect, the present invention relates to a T cell differentiation regulator, a method for regulating T cell differentiation, and a screening method for a T cell differentiation regulator.
(T cell differentiation regulator and method for regulating T cell differentiation)
The present invention provides a T cell differentiation regulator comprising a substance that regulates pTα self-dimer formation. More specifically, the present invention provides a T cell differentiation promoting agent comprising a substance that promotes pTα self-dimer formation and a T cell differentiation inhibiting agent comprising a substance that inhibits pTα self-dimer formation. .
(T cell differentiation promoting agent)
In one embodiment, the T cell differentiation regulator of the present invention is a T cell differentiation promoting agent, which enhances pTα self-dimerization on the cell surface of a T cell precursor (ie, DN cell). Contains substances that promote Such substances can promote the transition from DN cells to DP cells (ie, β selection) by directly or indirectly promoting pTα self-dimer formation.
The substance that promotes pTα self-dimer formation is preferably a substance that can specifically act on the target molecule pTα in order to minimize the effect on other genes and / or proteins. . Examples of such a substance include a nucleic acid molecule encoding pTα and a substance obtained by a screening method described later.
“Nucleic acid molecule encoding pTα” means a nucleic acid molecule capable of expressing pTα in a cell when introduced into a DN cell. PTα expressed by the nucleic acid molecule can promote β selection between them or by forming a dimer with pTα native to the cell into which the nucleic acid molecule has been introduced.
Examples of the nucleic acid molecule encoding pTα include genomic DNA, mRNA, cDNA and the like. Nucleic acid molecules encoding pTα can be amplified by PCR (Polymerase Chain Reaction) method, RT-PCR (Reverse Transcriptase-Polymerase Chain Reaction) method using genomic DNA or cDNA as a template and appropriate primers .
Examples of the nucleic acid molecule encoding pTα include DNA containing the base sequence of the entire coding region of human pTα shown in GenBank accession number: NM — 138296 (SEQ ID NO: 1), or hybridizing with the DNA under highly stringent conditions. A protein containing the base sequence for soybean and the amino acid sequence of pTα shown in SEQ ID NO: 2 is substantially the same activity (by the interaction of amino acid residues in the extracellular region, DNA encoding a protein having activity to form).
Examples of DNA that can hybridize under highly stringent conditions include, for example, about 60% or more, preferably about 70% or more, more preferably about 80% or more, and particularly preferably about the base sequence shown in SEQ ID NO: 1. DNA containing a base sequence having 90% or more homology can be used.
In this specification, the homology of the base sequence is determined by using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Local Alignment Search Tool), and the following conditions: Expected value = 10; Allow gap; Filtering = ON; It can be calculated by match score = 1; mismatch score = −3.
As another algorithm for determining the homology of a base sequence, the above-mentioned algorithm for calculating homology of amino acid sequences is also preferably exemplified.
Hybridization can be performed according to a method known per se or a method analogous thereto, for example, the method described in Molecular Cloning, Second Edition (J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, hybridization can be performed according to the method described in the attached instruction manual. Hybridization can be preferably performed according to highly stringent conditions. As the high stringent conditions, for example, the sodium salt concentration is about 19 to about 40 mM, preferably about 19 to about 20 mM, and the temperature is about 50 to about 70 ° C., preferably about 60 to about 65 ° C. Etc. In particular, it is preferable that the sodium salt concentration is about 19 mM and the temperature is about 65 ° C.
Those skilled in the art can appropriately change the salt concentration of the hybridization solution, the temperature of the hybridization reaction, the probe concentration, the length of the probe, the number of mismatches, the time of the hybridization reaction, the salt concentration of the washing solution, the washing temperature, etc. Understand that it can be easily adjusted to the desired stringency.
The nucleic acid molecule encoding pTα is inserted into an appropriate expression vector, and then a T cell precursor (DN cell) according to a method known in the art (for example, the method described in Virology, 52, 456 (1973)). ).
An expression vector containing a nucleic acid molecule encoding pTα can be prepared, for example, by preparing a target fragment from a nucleic acid molecule encoding pTα and ligating the fragment downstream of an appropriate promoter in the expression vector. it can.
As an expression vector, an animal virus vector such as retrovirus or vaccinia virus (for example, IRES bicistronic expression vector, pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo, pME18S) and the like are used.
The promoter may be any suitable promoter corresponding to the host used for gene expression, such as LCK proximal promoter, SRα promoter, SV40 promoter, RSV-LTR promoter, CMV promoter, HSV-TK promoter, etc. Is used.
The expression vector may contain an enhancer, a splicing signal, a poly A addition signal, a selection marker or reporter gene, an SV40 origin of replication (SV40ori), and the like, as necessary.
Examples of the selection marker and reporter gene include a green fluorescent protein (GFP) gene, a luciferase gene, a β-galactosidase gene, a dihydrofolate reductase gene, an ampicillin resistance gene, and a neomycin resistance gene.
(T cell differentiation inhibitor)
In another embodiment, the T cell differentiation regulator of the present invention is a T cell differentiation inhibitor, which suppresses pTα self-dimerization on the cell surface of a T cell precursor (ie, DN cell). Contains substances that suppress Such a substance can suppress the transition from DN cells to DP cells (ie, β selection) by directly or indirectly suppressing pTα self-dimer formation.
The substance that suppresses pTα self-dimer formation is preferably a substance that can specifically act on the target molecule pTα in order to minimize the influence on other genes and / or proteins. . Examples of such substances include antisense nucleic acids, ribozymes, siRNAs and antibodies against pTα; fragments of the extracellular domain of pTα; and substances obtained by the screening methods described below.
Antisense nucleic acids, ribozymes and siRNAs against pTα act on nucleic acid molecules encoding pTα in T cell precursors, and can suppress the pTα expression itself in DN cells.
An antisense nucleic acid consists of a base sequence that can hybridize with a target mRNA (initial transcript) under physiological conditions, and is a protein or polypeptide encoded by the target mRNA (initial transcript) in a hybridized state. It can be a nucleic acid that can inhibit translation.
The type of the antisense nucleic acid may be DNA or RNA, or may be a DNA / RNA chimera. In addition, since the phosphodiester bond of a natural antisense nucleic acid is easily degraded by a nucleolytic enzyme present in cells, a thiophosphate type (P = O of phosphate bond) that is stable to enzymatic degradation is used. An antisense nucleic acid may be synthesized using a modified nucleotide such as 2′-O-methyl type.
Other important factors for the design of antisense nucleic acids include increasing water solubility and cell membrane permeability, but these can also be overcome by devising dosage forms such as using liposomes and microspheres. .
The length of the antisense nucleic acid is not particularly limited as long as it can specifically hybridize with the target mRNA or the initial transcription product. For example, the antisense nucleic acid is at least about 15 bases long and complementary to the entire sequence of the mRNA (initial transcription product). Such a sequence may be included. From the viewpoint of ease of synthesis, antigenicity problems, etc., an oligonucleotide consisting of preferably about 15 to about 30 bases is exemplified.
In addition, antisense nucleic acids not only hybridize with target mRNA or initial transcripts to inhibit translation, but also bind to target genes that are double-stranded DNAs to form triplexes into mRNAs. It may be capable of inhibiting the transcription of.
A ribozyme refers to a nucleic acid molecule (mainly RNA) having an enzymatic activity that cleaves a nucleic acid. In the present invention, it is intended that pTα mRNA or an initial transcription product can be specifically cleaved within the coding region (including an intron in the case of the initial transcription product).
Recently, since it has been clarified that oligo DNA having the base sequence of the enzyme active site also has nucleic acid cleavage activity, ribozyme includes DNA as long as it has sequence-specific nucleic acid cleavage activity. It shall be used as a concept.
The most versatile ribozyme is self-splicing RNA found in infectious RNA such as viroid, and hammerhead type and hairpin type are known.
The siRNA is a double-stranded oligo RNA corresponding to a partial sequence in the coding region of the target mRNA or initial transcript (including an intron portion in the case of the initial transcript). When a short double-stranded RNA is introduced into a cell, a phenomenon called RNA interference (RNAi), in which mRNA complementary to the RNA is degraded, has been known in nematodes, insects, plants, etc. Recently, it has been confirmed that this phenomenon also occurs in animal cells (Nature, 411 (6836): 494-498 (2001)), and has attracted attention as an alternative technique for ribozymes.
Antisense oligonucleotides and ribozymes, for example, determine the target sequence of mRNA or the initial transcript based on the cDNA sequence of pTα (eg, SEQ ID NO: 1), and commercially available DNA / RNA automatic synthesizers (Applied Biosystems) , Beckman, etc.) and can be prepared by synthesizing a sequence complementary thereto.
For example, the siRNA is synthesized by synthesizing a sense strand and an antisense strand with a DNA / RNA automatic synthesizer, denatured at about 90 to about 95 ° C. for about 1 minute in an appropriate annealing buffer, and then about 30 to about It can be prepared by annealing at 70 ° C. for about 1 to about 8 hours. In addition, longer double-stranded polynucleotides can be prepared by synthesizing complementary oligonucleotide strands so as to alternately overlap, annealing them, and then ligating with ligase.
Antibodies against pTα, and fragments of the extracellular domain of pTα, act on one or more of the amino acid residues involved in pTα self-dimerization (eg, 1, 2, 3 or 4), thereby causing pTα Self-dimer formation can be suppressed.
The “amino acid residue involved in pTα self-dimer formation” may be a charged amino acid residue present in a region (domain) existing outside pTα. For example, in the case of human pTα, amino acid residues involved in pTα self-dimer formation include the 38th Asp in the amino acid sequence of SEQ ID NO: 2, the 40th Lys; the 118th Arg; and the 133rd Arg.
Since these amino acids are highly conserved among species, when targeting non-human species, the corresponding amino acid residues may be targeted.
The antibody against pTα may be a polyclonal antibody or a monoclonal antibody as long as it can inhibit the dimer formation of pTα, and can be prepared by an immunological technique well known in the art as exemplified below. Furthermore, fragments of anti-pTα antibodies can also be used as long as they can inhibit pTα dimer formation. Examples of such antibody fragments include Fab and F (ab ′). ₂ , ScFv, minibody, and the like.
Polyclonal antibodies are administered, for example, about 2 to 4 times every 2 to 3 weeks subcutaneously or intraperitoneally in animals with a commercially available adjuvant (for example, complete or incomplete Freund's adjuvant) using pTα or a fragment thereof as an antigen ( The antibody titer of the partially collected serum is measured by a known antigen-antibody reaction and the increase is confirmed), and is obtained by collecting whole blood about 3 to about 10 days after the final immunization and purifying the antiserum. it can.
Examples of animals to which the antigen is administered include mammals such as rats, mice, rabbits, goats, guinea pigs, and hamsters.
When a fragment of pTα is used as the antigen, the fragment contains one or more of amino acid residues involved in pTα self-dimer formation (eg, 1, 2, 3 or 4).
A monoclonal antibody (mAb) can be prepared, for example, by a cell fusion method. For example, the above antigen is administered to mice subcutaneously or intraperitoneally 2-4 times together with a commercially available adjuvant, and about 3 days after the final administration, the spleen or lymph node is collected and white blood cells are collected. This leukocyte and myeloma cells (for example, NS-1, P3X63Ag8, etc.) are fused to obtain a hybridoma that produces a monoclonal antibody against the antigen.
This cell fusion is carried out by the PEG method [J. Immunol. Methods, 81 (2): 223-228 (1985)], or the voltage pulse method [Hybridoma, 7 (6): 627-633 (1988)]. A hybridoma producing a desired monoclonal antibody can be selected by detecting an antibody that specifically binds to an antigen from the culture supernatant using a well-known EIA or RIA method.
The hybridoma producing the monoclonal antibody can be cultured in vitro, or in vivo, such as mouse or rat, preferably mouse ascites, and the antibody can be obtained from the culture supernatant of the hybridoma and the ascites of the animal, respectively.
The anti-pTα antibody is preferably a chimeric antibody of humans and other animals (for example, mice), more preferably a humanized antibody, considering the effects and safety when used in humans. Particularly preferred is a human antibody.
As used herein, “chimeric antibody” refers to an antibody having a variable region (V region) derived from an immunized animal and a constant region (C region) derived from human, and “humanized antibody” refers to other regions except for CDRs. Refers to an antibody in which all are replaced with human antibodies.
The chimeric antibody or humanized antibody is fused with DNA encoding the C region of the antibody derived from human myeloma, for example, by cutting out the V region or CDR encoding sequence from the mouse monoclonal antibody gene prepared by the same method as described above. The obtained chimeric gene can be cloned into an appropriate expression vector, introduced into an appropriate host cell, and expressed to express the chimeric gene.
Although a fully human antibody can be produced from a human-human (or mouse) hybridoma, in order to provide a large amount of antibody stably and at low cost, a human antibody-producing animal or a phage display method is used. It is desirable to manufacture.
Examples of the human antibody-producing animal include XenoMouse (manufactured by Abgenix); Hu-Mab Mouse (manufactured by Medarex); and KM mouse (manufactured by Kirin Brewery).
Examples of the phage display library include a CAT library; an MRC library; a Dyax library; a Morphosys HuCAL library; a BioInvent library; a Crucell library, and the like.
A fragment of the extracellular domain of pTα has the ability to form an oligomer with the native pTα of DN cells, but cannot induce the transition from DN cells to DP cells (ie, β selection). Means any fragment of a region (domain). Such a fragment can inhibit the binding between native pTα by binding competitively with another native pTα to the native pTα of DN cells. Specifically, the fragment of the extracellular domain of pTα used in the present invention contains one or more amino acid residues (eg, 1, 2, 3 or 4) involved in self-dimerization, It is a fragment that cannot induce β selection even when it binds to the native pTα of DN cells.
Here, the amino acid residues involved in self-dimer formation in the fragment include the amino acid residues described above for human pTα, but these amino acid residues may be used as long as the dimer-forming ability is not lost. , May be substituted with similar amino acids (eg, Asp and Glu; conservative amino acid substitution between Arg and Lys).
The present invention also provides a method of modulating T cell differentiation by modulating pTα self-dimer formation in vitro or in vivo.
In one embodiment, the method relates to a method of modulating T cell differentiation by modulating pTα self-dimer formation in vitro, said method in the presence of a T cell differentiation regulator as described above. Culturing T cell precursors (ie, DN cells).
When using a nucleic acid molecule as a T cell differentiation regulator, the nucleic acid molecule can be used alone or after insertion into a suitable vector such as a plasmid or viral vector (eg, a retroviral vector) and then according to methods well known in the art. It can be introduced into T cell progenitors.
Moreover, when using protein as a T cell differentiation regulator, this protein can be mixed with a culture medium as it is. Alternatively, a nucleic acid molecule encoding the protein may be inserted alone or into an appropriate vector and then introduced into a cell according to a method well known in the art.
As a medium for culturing cells, for example, MEM medium, DMEM medium, RPMI 1640 medium, 199 medium and the like containing about 5 to 20% fetal bovine serum (FBS) are used.
The pH of the medium is preferably about 6-8. The culture is usually performed at about 30 ° C. to 40 ° C. for about 1 day to about 1 week, preferably about 1 day to about 3 days. You may perform ventilation | gas_flowing and stirring as needed.
In another embodiment, the method relates to a method of modulating T cell differentiation by modulating pTα self-dimerization in vivo, the method comprising administering the T cell differentiation regulator to a mammal. Administration.
Mammals include, for example, primates, laboratory animals, farm animals, pets, and the like, and are not particularly limited. Specifically, humans, monkeys, rats, mice, guinea pigs, rabbits, horses, cows, goats , Sheep, dogs, cats and the like. Preferably the mammal is a human.
When a nucleic acid molecule is used as a T cell differentiation regulator, it is well known in the art after inserting the nucleic acid molecule alone or into an appropriate vector such as a plasmid or viral vector (for example, those listed above as expression vectors). Can be administered to mammals according to the method described above.
In addition, when a protein is used as a T cell differentiation regulator, the protein itself can be administered to a mammal by a DDS (drug delivery system) technique known in the art by devising the dosage form. Alternatively, the nucleic acid molecule encoding the protein can be administered alone or after being inserted into an appropriate vector (for example, those listed above as expression vectors) and then administered according to methods well known in the art.
The T cell differentiation regulator of the present invention may further contain a pharmaceutically acceptable carrier. Examples of pharmaceutically acceptable carriers include excipients, diluents, extenders, disintegrants, stabilizers, preservatives, buffers, emulsifiers, thickeners, solubilizers, or other additives. . The T cell differentiation regulator of the present invention can be administered orally or parenterally by using one or more of the above carriers.
The dose of the T cell differentiation regulator varies depending on the administration subject, administration method, treatment time, type of active ingredient contained in the agent, etc., but is usually 10 μg per person per adult (with a body weight of 60 kg). To 1000 mg can be administered.
In the case of mammals other than humans, an amount obtained by converting the above value into the weight of the mammal can be administered. However, since the dose varies depending on various conditions, a dose smaller than the above dose may be sufficient, or a dose exceeding the above range may be required.
(Screening method for T cell differentiation regulator)
The present invention also provides a screening method for a T cell differentiation regulator. The screening method of the present invention includes evaluating whether a test substance modulates (promotes or suppresses) pTα self-dimer formation. Specifically, the evaluation can be performed by comparing the degree of pTα self-dimer formation in the presence and absence of the test substance.
The “test substance” used in this screening method may be any known compound or novel compound. The test substance is not particularly limited. For example, the test substance is prepared using nucleic acid, carbohydrate, lipid, protein, peptide, antibody, organic or inorganic low molecular weight compound, organic or inorganic high molecular weight compound, combinatorial chemistry technology. Compound libraries, random peptide libraries prepared by solid phase synthesis or phage display methods, natural components derived from microorganisms, animals and plants, and the like.
Self-dimerization of pTα can be detected and quantified, for example, by the following method:
a method using a chimeric protein of pTα and a fluorescent protein; and
A method using a cell expressing a chimeric protein of pTα and erythropoietin receptor (EPOR) or a cell expressing a chimeric protein of pTα and thrombopoietin receptor (TPOR).
(Screening method using chimeric protein of pTα and fluorescent protein)
Examples of a screening method using a chimeric protein of pTα and a fluorescent protein include total internal reflection fluorescence (TIRF) microscopic analysis; fluorescence resonance energy transfer (FRET) analysis.
The screening method using TIRF microscopic analysis can detect single and dimers of pTα by distinguishing them from the fluorescence intensity of the bright spot using cells expressing a chimera of pTα and a fluorescent protein.
Examples of the fluorescent protein used for this analysis include GFP, RFP, YFP, CFP, Kusabila-range, and the like.
The screening method using FRET analysis involves the first fluorescent protein (excitation light wavelength λ ₀ ; Fluorescence wavelength λ ₁ ) And pTα and a second fluorescent protein (excitation light wavelength λ ₁ ; Fluorescence wavelength λ ₂ ) And pTα chimeric protein, and the cell ₀ The wavelength λ indicating the formation of the dimer ₂ Can detect fluorescence.
Examples of the combination of the first and second fluorescent proteins used in this analysis include CFP and YFP.
As pTα used for the chimeric protein of pTα and fluorescent protein, human pTα is preferably used. As human pTα, for example, an amino acid sequence represented by the amino acid sequence represented by SEQ ID NO: 2 or a protein having an amino acid sequence substantially identical thereto (here, “substantially identical” Is synonymous).
Several splice variants are known for pTα, any of which may be used.
A cell expressing a chimeric protein of pTα and a fluorescent protein can be prepared by preparing a nucleic acid molecule encoding the chimeric protein and introducing the nucleic acid molecule into an appropriate cell.
A nucleic acid molecule encoding a chimeric protein of pTα and a fluorescent protein is prepared by using a nucleic acid molecule encoding pTα as well as a nucleic acid molecule encoding a desired fluorescent protein using a gene recombination technique (for example, PCR method) known in the art. For example).
Examples of the nucleic acid molecule (DNA or RNA) encoding pTα include genomic DNA, mRNA, cDNA and the like.
Examples of such a nucleic acid molecule include DNA containing the base sequence of the entire coding region of human pTα represented by GenBank accession number: NM — 138296 (SEQ ID NO: 1), or hybridizes with the DNA under highly stringent conditions. And a protein containing the amino acid sequence of pTα shown in SEQ ID NO: 2 to form a self-dimer by substantially the same activity (interaction of amino acid residues in the extracellular region). DNA encoding a protein having an activity of
Examples of DNA that can hybridize under highly stringent conditions include, for example, about 60% or more, preferably about 70% or more, more preferably about 80% or more, and particularly preferably about the base sequence shown in SEQ ID NO: 1. DNA containing a base sequence having 90% or more homology can be used.
Information on the base sequences of various fluorescent proteins can be obtained from publicly available information sources (eg, academic literature, patent literature, gene and protein databases (eg, GenBank, etc.)). Various fluorescent protein genes are commercially available from, for example, BD Bisciences Clontech.
An expression vector containing a nucleic acid molecule encoding a chimeric protein of pTα and a fluorescent protein is prepared, for example, by preparing a target fragment (target gene) from the nucleic acid molecule encoding the chimeric protein and placing the fragment in a suitable expression vector. It can be produced by ligating downstream of the promoter.
As the expression vector and promoter, animal virus vectors such as retrovirus and vaccinia virus (for example, IRES bicistronic expression vector, pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo, pME18S) are used. It is done.
When producing cells expressing two types of fluorescent proteins used for FRET analysis, nucleic acid molecules encoding a chimeric protein with the first fluorescent protein and nucleic acid molecules encoding the chimeric protein with the second fluorescent protein They may be inserted on the same vector or on separate vectors.
When inserted on the same vector, both nucleic acid molecules may be under the control of separate promoters, or may be under the control of the same promoter using an IRES bicistronic expression vector.
The promoter may be any promoter as long as it is appropriate for the host used for gene expression. For example, LCK proximal promoter, SRα promoter, SV40 promoter, RSV-LTR promoter, CMV promoter, HSV-TK promoter Etc. are used.
The expression vector may contain an enhancer, a splicing signal, a poly A addition signal, a selection marker or reporter gene, an SV40 origin of replication (SV40ori), and the like, as necessary.
Examples of the selectable marker and reporter gene include GFP gene, luciferase gene, β-galactosidase gene, dihydrofolate reductase gene, ampicillin resistance gene, and neomycin resistance gene.
The expression vector is preferably an IRES bicistronic expression vector in which the target gene is expressed from the same mRNA together with a selectable marker or reporter. Examples of the IRES bicistronic expression vector include pMX-IRES-GFP (Kitamura et al., Int. J. Hematol., 67, 351-9 (1998)), a vector marketed by Clontech, and the like. .
Gene introduction into a cell can be performed according to a method known in the art (for example, the method described in Virology, 52, 456 (1973)).
Preferred examples of cells into which a nucleic acid molecule encoding a chimeric protein of pTα and a fluorescent protein is introduced include cells that do not naturally express pTα (for example, TG40β, BW5147, etc.).
Confirmation of gene introduction into a cell can be performed, for example, by a method using the above selection marker and reporter.
As a medium for culturing cells, for example, MEM medium, DMEM medium, RPMI 1640 medium, 199 medium and the like containing about 5 to 20% fetal bovine serum (FBS) are used.
The pH of the medium is preferably about 6-8. The culture is usually performed at about 30 ° C. to 40 ° C. for about 1 day to about 1 week, preferably about 1 day to about 3 days. You may perform ventilation | gas_flowing and stirring as needed.
In TIRF microscopy analysis, cells were imaged using a total internal reflection fluorescence (TIRF) microscope (Biochem. Biophys. Res. Commun., 235, 47-53 (1997); Nature, 374, 555-9 (1995)). Can be done. Recording and analysis of the resulting images can be performed using AquaCosmos software (Hamamatsu Photonics) and the like. The fluorescence intensity can be determined according to the method described in Nature, 374, 555-9 (1995), for example.
In FRET analysis, fluorescence resonance energy transfer from a first fluorescent material to a second fluorescent material in a cell can be detected using, for example, flow cytometry.
(Screening method using a cell expressing a chimeric protein of pTα and EPOR or a cell expressing a chimeric protein of pTα and TPOR)
Erythropoietin receptor (EPOR) and thrombopoietin receptor (TPOR) are cells that require IL-3 for proliferation when forced to form a self-dimer by mutation (hereinafter referred to as “IL-3”). It has been reported that proliferation of "dependent cells" can be induced in the absence of IL-3 (Nature, 348, 647-649 (1990); Blood, 88, 1399-1406 (1996)). .
From this, IL-3-dependent cells in which a chimeric protein (hereinafter also referred to as “pTα / EPOR chimera”) containing the extracellular domain of pTα and the transmembrane domain and extracellular domain of EPOR are expressed, or pTα In the absence of IL-3, IL-3 dependent cells expressing a chimeric protein (hereinafter also referred to as “pTα / TPOR chimera”) including an extracellular domain, a transmembrane domain of TPOR and an extracellular domain are used. The formation of the pTα self-dimer can be evaluated using the proliferation of the cells as an index.
As pTα used for the chimeric protein, human pTα is preferably used. As an extracellular domain of human pTα, for example, an amino acid sequence represented by amino acid numbers 17 to 147 in the amino acid sequence represented by SEQ ID NO: 2 (full-length amino acid sequence of human pTα), or an amino acid sequence substantially identical thereto. (Where “substantially identical” has the same meaning as above).
Several splice variants are known for pTα, any of which may be used.
As the EPOR used for the chimeric protein, human EPOR is preferably used. Examples of the transmembrane domain and cytoplasmic domain of human EPOR include, for example, the amino acid sequence represented by amino acid numbers 251 to 508 in the amino acid sequence represented by GenPept accession number: AAA52403 (SEQ ID NO: 4) (full-length amino acid sequence of human EPOR), Alternatively, a protein having substantially the same amino acid sequence is used (here, “substantially identical” has the same meaning as above).
As the TPOR used for the chimeric protein, human TPOR is preferably used. Examples of the transmembrane domain and cytoplasmic domain of human TPOR include, for example, the amino acid sequence represented by amino acid numbers 468 to 610 in the amino acid sequence represented by GenPept accession number: NP_005364 (SEQ ID NO: 6) (full-length amino acid sequence of human TPOR), Alternatively, a protein having substantially the same amino acid sequence is used (here, “substantially identical” has the same meaning as above).
Preferably, EPOR or TPOR is generated due to these parts when all of the transmembrane domain and cytoplasmic domain are used as a protein constituting a chimera, but the chimeric protein forms a dimer. Any portion of these domains may be used as long as the activity (activity that induces proliferation of IL-3 dependent cells in the absence of IL-3) is not lost. Do not dimerize).
Moreover, although several splice variants are known for EPOR or TPOR, any of them may be used.
An IL-3-dependent cell that expresses a pTα / EPOR chimera or pTα / TPOR chimera can be prepared by preparing a nucleic acid molecule encoding the chimeric protein and introducing the nucleic acid molecule into an IL-3-dependent cell.
A nucleic acid molecule encoding a pTα / EPOR chimera or a pTα / TPOR chimera encodes a nucleic acid molecule encoding a fragment containing pTα or its extracellular domain, and a fragment containing EPOR or TPOR or their transmembrane and cytoplasmic domains A nucleic acid molecule can be used to produce a gene recombination technique known in the art (for example, a technique using a PCR method).
Examples of the nucleic acid molecule (DNA or RNA) encoding pTα include genomic DNA, mRNA, cDNA and the like. The extracellular domain of pTα can be amplified by PCR, RT-PCR, etc. using genomic DNA or cDNA as a template and appropriate primers.
Examples of the nucleic acid molecule encoding pTα include DNA containing the base sequence of the entire coding region of human pTα shown in GenBank accession number: NM — 138296 (SEQ ID NO: 1), or hybridizing with the DNA under highly stringent conditions. A protein containing the base sequence for soybean and the amino acid sequence of pTα shown in SEQ ID NO: 2 is substantially the same activity (by the interaction of amino acid residues in the extracellular region, DNA encoding a protein having activity to form).
Examples of DNA that can hybridize under highly stringent conditions include, for example, about 60% or more, preferably about 70% or more, more preferably about 80% or more, and particularly preferably about the base sequence shown in SEQ ID NO: 1. DNA containing a base sequence having 90% or more homology can be used.
Examples of nucleic acid molecules (DNA or RNA) encoding EPOR include genomic DNA, mRNA, cDNA and the like. The transmembrane domain and cytoplasmic domain of EPOR can be amplified by PCR, RT-PCR, etc. using genomic DNA or cDNA as a template and appropriate primers.
As DNA encoding EPOR, for example, DNA containing the base sequence of the entire coding region of human EPOR represented by GenBank accession number: M60459 (SEQ ID NO: 3), or hybridizing with the DNA under highly stringent conditions And substantially the same activity as that of the protein containing the amino acid sequence of EPOR shown in SEQ ID NO: 4 (by formation of a dimer, IL-3 dependent cells were allowed to be removed in the absence of IL-3. And DNA encoding a protein having an activity to proliferate).
Examples of the DNA that can hybridize under the highly stringent conditions include, for example, the base sequence shown in SEQ ID NO: 3, about 60% or more, preferably about 70% or more, more preferably about 80% or more, and particularly preferably DNA containing a base sequence having about 90% or more homology can be used.
Examples of nucleic acid molecules (DNA or RNA) encoding TPOR include genomic DNA, mRNA, cDNA and the like. The transmembrane domain and cytoplasmic domain of TPOR can be amplified by PCR, RT-PCR, etc. using genomic DNA or cDNA as a template and appropriate primers.
As DNA encoding TPOR, for example, DNA containing the base sequence of the entire coding region of human TPOR shown in GenBank registration number: NM_005373 (SEQ ID NO: 5), or hybridizing with the DNA under highly stringent conditions In the absence of IL-3 in the absence of IL-3. And DNA encoding a protein having an activity to proliferate).
The DNA that can hybridize under the above high stringency conditions is, for example, about 60% or more, preferably about 70% or more, more preferably about 80% or more, particularly preferably the nucleotide sequence shown in SEQ ID NO: 5. DNA containing a base sequence having about 90% or more homology can be used.
An expression vector containing a pTα / EPOR chimera or a nucleic acid molecule encoding a pTα / TPOR chimera can be prepared in the same manner as the above chimera of pTα and a fluorescent protein.
Gene introduction into IL-3-dependent cells can be performed according to a method known in the art (for example, the method described in Virology, 52, 456 (1973)).
Examples of IL-3 dependent cells include mouse pro B cell line Ba / F3 (BAF3), mouse mast cell line IC2, and mouse bone marrow cell line F-36P. Preferably, BAF3 can be used as an IL-3-dependent cell.
Confirmation of gene introduction into IL-3-dependent cells is performed by, for example, a method using a selection marker and a reporter as exemplified in the above chimera of pTα and fluorescent protein; blotting using an antibody against EPOR or TPOR; Or it can be carried out by any combination thereof.
Examples of the medium and conditions for culturing IL-3-dependent cells include the medium and conditions exemplified in the above chimera of pTα and fluorescent protein.
The presence or absence of interaction between the pTα portions of the pTα / EPOR chimera or pTα / TPOR chimera can be confirmed by the viability of IL-3 dependent cells into which the gene has been introduced in the absence of IL-3. Cell viability can be determined, for example, by counting propidium iodide (PI) negative cells by flow cytometry.
The present invention also provides a kit for detecting a substance that modulates pTα self-dimerization. The kit includes cells expressing a chimeric protein of pTα and a fluorescent substance described in the above screening method, or IL-3 dependent cells expressing a chimeric protein of pTα and EPOR or TPOR. The user can carry out the above screening method using the kit of the present invention.
In a second aspect, the present invention also relates to a system that can easily detect interactions in the extracellular region between various cell surface proteins (hereinafter sometimes abbreviated as “the detection system of the present invention”). The detection system of the present invention comprises a nucleic acid molecule encoding a first chimeric protein comprising the extracellular domain of the first protein and the transmembrane and cytoplasmic domains of the erythropoietin receptor or thrombopoietin receptor, and IL-3 dependent cells into which a nucleic acid molecule encoding a second chimeric protein, comprising the extracellular domain of 2 proteins and the transmembrane and cytoplasmic domains of erythropoietin receptor or thrombopoietin receptor are introduced , A method for detecting an interaction in the extracellular region between cell surface proteins, comprising a step of culturing in the absence of IL-3 and confirming the presence or absence of proliferation of the cells (hereinafter referred to as “the detection method of the present invention”). May be abbreviated as).
The detection system of the present invention also includes a first chimeric protein comprising the extracellular domain of the first protein and the transmembrane and cytoplasmic domains of the erythropoietin receptor or thrombopoietin receptor, and the second protein. IL-3 dependent cells expressing a second chimeric protein comprising an extracellular domain and a transmembrane and cytoplasmic domain of erythropoietin receptor or thrombopoietin receptor are provided.
The detection system of the present invention also provides a chimeric protein comprising the extracellular domain of a cell surface protein and the transmembrane and cytoplasmic domains of erythropoietin receptor or thrombopoietin receptor.
The chimeric protein used in the detection system of the present invention comprises an extracellular domain of a cell surface protein to be tested for protein-protein interactions, a transmembrane domain of erythropoietin receptor (EPOR) or thrombopoietin receptor (TPOR) and Consists of cytoplasmic domains.
In the detection system of the present invention, “first protein” and “second protein” refer to cell surface proteins that are tested for interactions in the extracellular region between proteins.
Here, the “first protein” and the “second protein” may be the same type of protein or different types of proteins. In the detection system of the present invention, the “first protein” or “second protein” or these are collectively referred to as “test protein”.
Any natural or artificial cell surface protein can be selected as the test protein in the detection system of the present invention. For example, since various cell surface receptors can play an important role in an intracellular signal transduction system that controls cell proliferation, differentiation, survival, etc., the protein constituting the receptor is a test protein in the detection system of the present invention. Can be.
As specific examples of the test protein in the detection system of the present invention, see pTα (for example, GenBank registration number: MN — 138296; GenPept registration number NP — 612153; Saint-Ruf, C. et al., Science, 266, 1208-1212, 1994 ); TCRα (eg, GenBank registration number: AY475220; see GenPept registration number: AAS48060); TCRβ (eg, GenBank registration number: AY475218; see GenPept registration number: AAS48058), etc. , Any protein predicted to be a transmembrane (membrane-bound) protein by a hydrophobicity plot (eg, Kyte-Doolittle hydrophobicity analysis).
In the detection system of the present invention, the “protein extracellular domain” means the entire region (domain) existing outside the cell surface protein or any fragment thereof.
In the detection system of the present invention, “the transmembrane domain and cytoplasmic domain of erythropoietin receptor (EPOR)” are preferably a region (domain) penetrating the cell membrane and a region (domain) existing in the cytoplasm of human EPOR. ), Or a protein substantially identical to the protein (hereinafter, sometimes abbreviated as “active domain of EPOR”).
Here, “substantially identical” means about 60% or more, preferably about 70% or more, more preferably about 80% or more, particularly preferably about 90% or more, with the amino acid sequence of the active domain of human EPOR. Preferably, it refers to a protein containing an amino acid sequence having a homology of about 95% or more and having substantially the same activity as the active domain of human EPOR.
As used herein, “homology” refers to an optimal alignment when two amino acid sequences are aligned using a mathematical algorithm known in the art (preferably the algorithm uses a sequence of sequences for optimal alignment). The percentage of identical and similar amino acid residues relative to all overlapping amino acid residues in which one or both of the gaps can be considered).
“Similar amino acids” mean amino acids similar in physicochemical properties, such as aromatic amino acids, aliphatic amino acids, polar amino acids, basic amino acids, acidic amino acids, amino acids having hydroxyl groups, amino acids with small side chains, etc. Examples include amino acids that fall into the same group. Such substitutions with similar amino acids are expected not to change the protein phenotype (ie, conservative amino acid substitutions). Specific examples of conservative amino acid substitutions are well known in the art and are described in various literature (see, for example, Bowie et al., Science, 247: 1306-1310 (1990)).
Amino acid sequence homology can be calculated using NCBI BLAST, which is a homology calculation algorithm, under the following conditions (expectation value = 10, allow gap, matrix = BLOSUM62, filtering = OFF). Other algorithms for determining amino acid sequence homology include, for example, Karlin et al., Proc. Natl. Acad. Sci. USA, 90: 5873-5877 (1993) [the algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) (Altschul et al., Nucleic Acids Res., 25: 3389-3402 (1997)) ] Needleman et al., J .; Mol. Biol. 48: 444-453 (1970) [the algorithm is incorporated into the GAP program in the GCG software package], Myers and Miller, CABIOS, 4: 11-17 (1988) [ The algorithm is incorporated into the ALIGN program (version 2.0) which is part of the CGC sequence alignment software package], Pearson et al., Proc. Natl. Acad. Sci. USA, 85: 2444-2448 (1988) [the algorithm is incorporated in the FASTA program in the GCG software package] and the like, and they can be preferably used as well.
Several splice variants are known for EPOR, any of which may be used.
Preferably, as an active domain of EPOR, an amino acid sequence represented by amino acid numbers 251 to 508 in an amino acid sequence represented by GenPept accession number: AAA52403 (that is, an amino acid sequence comprising the full-length ORF of human EPOR (SEQ ID NO: 4)) And a protein having an amino acid sequence having a homology of about 60% or more, preferably about 70% or more, more preferably about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more. .
“Activity substantially equivalent to the active domain of human-derived EPOR” refers to the activity of inducing the proliferation of IL-3-dependent cells expressing it in the absence of IL-3 by the formation of a dimer. Etc.
Here, “substantially the same quality” means that these properties are qualitatively equivalent. Accordingly, the quantitative factors such as the above-mentioned degree of activity are preferably equivalent, but may be different (for example, about 0.01 to about 100 times, preferably about 0.1 to about 10 times, more Preferably about 0.5 to about 2 times).
Moreover, as a protein substantially the same as the active domain of human-derived EPOR used in the detection system of the present invention, for example, a protein containing the following amino acid sequence, which is substantially the same as the active domain of human EPOR: Also included are proteins with the same quality of activity:
(1) 1 or 2 or more (preferably about 1 to 30, preferably about 1 to 10, more preferably 1 in the amino acid sequence represented by amino acid numbers 251 to 508 in the amino acid sequence of SEQ ID NO: 4 Amino acid sequence in which ~ 5) amino acids have been deleted;
(2) 1 or 2 or more (preferably about 1 to 30, preferably about 1 to 10, more preferably 1 to the amino acid sequence represented by amino acid numbers 251 to 508 in the amino acid sequence of SEQ ID NO: 4 Amino acid sequence to which (˜5) amino acids were added;
(3) 1 or 2 or more (preferably about 1 to 30, preferably about 1 to 10, more preferably 1 to the amino acid sequence represented by amino acid numbers 251 to 508 in the amino acid sequence of SEQ ID NO: 4 Amino acid sequence with ~ 5 amino acids inserted;
(4) 1 or 2 or more (preferably about 1 to 30, preferably about 1 to 10, more preferably 1) in the amino acid sequence represented by amino acid numbers 251 to 508 in the amino acid sequence of SEQ ID NO: 4 An amino acid sequence in which (~ 5) amino acids are replaced with other amino acids; or
(5) An amino acid sequence obtained by combining the above (1) to (4).
Here, “substantially the same quality of activity” has the same meaning as described above.
When the amino acid sequence is deleted, added, inserted or substituted, the position of the deletion, addition, insertion or substitution is particularly not limited unless the activity of the protein is impaired and self-dimerization occurs. It is not limited.
In the detection system of the present invention, “the transmembrane domain and cytoplasmic domain of thrombopoietin receptor (TPOR)” are preferably a region (domain) of human TPOR that penetrates the cell membrane and a region (domain) that exists in the cytoplasm. ), Or a protein substantially identical to the protein (hereinafter, sometimes abbreviated as “active domain of TPOR”).
Here, “substantially identical” means the amino acid sequence of the active domain of human TPOR, about 60% or more, preferably about 70% or more, more preferably about 80% or more, particularly preferably about 90% or more, most Preferably, it refers to a protein containing an amino acid sequence having a homology of about 95% or more and having substantially the same activity as the active domain of human TPOR (where “homology” has the same meaning as above) ).
Several splice variants are known for TPOR, any of which may be used.
Preferably, as an active domain of TPOR, an amino acid sequence represented by amino acid numbers 468 to 610 in an amino acid sequence represented by GenPept registration number: NP_005364 (that is, an amino acid sequence consisting of a full-length ORF of human TPOR (SEQ ID NO: 6)) And a protein having an amino acid sequence having a homology of about 60% or more, preferably about 70% or more, more preferably about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more. .
"Activity substantially equivalent to the active domain of human-derived TPOR" refers to the activity of inducing the proliferation of IL-3-dependent cells expressing it in the absence of IL-3 by the formation of a dimer. Etc.
Here, “substantially the same quality” means that these properties are qualitatively equivalent. Accordingly, the quantitative factors such as the above-mentioned degree of activity are preferably equivalent, but may be different (for example, about 0.01 to about 100 times, preferably about 0.1 to about 10 times, more Preferably about 0.5 to about 2 times).
The protein substantially identical to the human-derived TPOR active domain used in the detection system of the present invention is, for example, a protein containing the following amino acid sequence, which is substantially the same as the human TPOR active domain. Also included are proteins with the same quality of activity:
(1) In the amino acid sequence of SEQ ID NO: 6, 1 or 2 or more in the amino acid sequence represented by amino acid numbers 468 to 610 (preferably about 1 to 30, preferably about 1 to 10, more preferably 1 Amino acid sequence in which ~ 5) amino acids have been deleted;
(2) In the amino acid sequence of SEQ ID NO: 6, one or more amino acid sequences represented by amino acid numbers 468 to 610 (preferably about 1 to 30, preferably about 1 to 10, more preferably 1) Amino acid sequence to which (˜5) amino acids were added;
(3) In the amino acid sequence of SEQ ID NO: 6, one or more amino acid sequences represented by amino acid numbers 468 to 610 (preferably about 1 to 30, preferably about 1 to 10, more preferably 1) Amino acid sequence with ~ 5 amino acids inserted;
(4) In the amino acid sequence of SEQ ID NO: 6, one or more of the amino acid sequences represented by amino acid numbers 468 to 610 (preferably about 1 to 30, preferably about 1 to 10, more preferably 1 An amino acid sequence in which (~ 5) amino acids are replaced with other amino acids; or
(5) An amino acid sequence obtained by combining the above (1) to (4).
Here, “substantially the same quality of activity” has the same meaning as described above.
When the amino acid sequence is deleted, added, inserted or substituted, the position of the deletion, addition, insertion or substitution is particularly not limited unless the activity of the protein is impaired and self-dimerization occurs. It is not limited.
In the detection system of the present invention, EPOR or TPOR is preferably used as a protein constituting the chimeric protein used in the detection system, wherein all of its transmembrane domain and cytoplasmic domain are used as a dimer. Any of these domains, as long as the activity resulting from the domains derived from them is not lost (the activity that induces the proliferation of IL-3-dependent cells in the absence of IL-3) (However, this portion does not undergo autonomous dimerization).
The chimeric protein used in the detection system of the present invention may contain a part of the extracellular region in addition to the transmembrane domain and cytoplasmic domain of EPOR or TPOR.
The nucleic acid molecule encoding the chimeric protein used in the detection system of the present invention includes a nucleic acid molecule encoding a test protein or a fragment containing an extracellular domain thereof, and a fragment containing EPOR or TPOR or a transmembrane domain and a cytoplasmic domain thereof. Using a nucleic acid molecule to be encoded, it can be produced by a gene recombination technique known in the art (for example, a technique using PCR method).
Examples of the nucleic acid molecule (DNA or RNA) encoding the test protein include genomic DNA, mRNA, cDNA and the like. The extracellular domain of the test protein can be amplified by polymerase chain reaction (PCR) method, reverse transcriptase-polymerase chain reaction (RT-PCR) method using genomic DNA or cDNA as a template and appropriate primers. .
Information on the base sequences and amino acid sequences of various cell surface proteins or their extracellular domains that can be candidates for the test protein can be obtained from publicly available information sources (eg, academic literature, patent literature, gene and protein databases (eg, , GenBank, GenPept etc.)).
Examples of nucleic acid molecules (DNA or RNA) encoding EPOR include genomic DNA, mRNA, cDNA and the like. The transmembrane domain and cytoplasmic domain of EPOR can be amplified by PCR, RT-PCR, etc. using genomic DNA or cDNA as a template and appropriate primers.
As DNA encoding EPOR, for example, DNA containing the base sequence of the entire coding region of human EPOR represented by GenBank accession number: M60459 (SEQ ID NO: 3), or hybridizing with the DNA under highly stringent conditions And substantially the same activity as that of the protein containing the amino acid sequence of EPOR shown in SEQ ID NO: 4 (by formation of a dimer, IL-3 dependent cells were allowed to be removed in the absence of IL-3. And DNA encoding a protein having an activity to proliferate).
Examples of the DNA that can hybridize under the highly stringent conditions include, for example, the base sequence shown in SEQ ID NO: 3, about 60% or more, preferably about 70% or more, more preferably about 80% or more, and particularly preferably DNA containing a base sequence having about 90% or more homology can be used.
Examples of nucleic acid molecules (DNA or RNA) encoding TPOR include genomic DNA, mRNA, cDNA and the like. The transmembrane domain and cytoplasmic domain of TPOR can be amplified by PCR, RT-PCR, etc. using genomic DNA or cDNA as a template and appropriate primers.
As DNA encoding TPOR, for example, DNA containing the base sequence of the entire coding region of human TPOR shown in GenBank registration number: NM_005373 (SEQ ID NO: 5), or hybridizing with the DNA under highly stringent conditions In the absence of IL-3 in the absence of IL-3. And DNA encoding a protein having an activity to proliferate).
The DNA that can hybridize under the above high stringency conditions is, for example, about 60% or more, preferably about 70% or more, more preferably about 80% or more, particularly preferably the nucleotide sequence shown in SEQ ID NO: 5. DNA containing a base sequence having about 90% or more homology can be used. The homology of the base sequence was determined using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Alignment Search Tool), and the following conditions: Expected value = 10; Allow gap; Filtering = ON; Match score = 1; It is possible to calculate with mismatch score = −3.
As another algorithm for determining the homology of a base sequence, the above-mentioned algorithm for calculating homology of amino acid sequences is also preferably exemplified.
Hybridization can be performed according to a method known per se or a method analogous thereto, for example, the method described in Molecular Cloning, Second Edition (J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, hybridization can be performed according to the method described in the attached instruction manual. Hybridization can be preferably performed according to highly stringent conditions.
High stringent conditions include, for example, conditions where the sodium salt concentration is about 19 to about 40 mM, preferably about 19 to about 20 mM, and the temperature is about 50 to about 70 ° C., preferably about 60 to about 65 ° C. Can be mentioned. In particular, it is preferable that the sodium salt concentration is about 19 mM and the temperature is about 65 ° C.
Those skilled in the art can appropriately change the salt concentration of the hybridization solution, the temperature of the hybridization reaction, the probe concentration, the length of the probe, the number of mismatches, the time of the hybridization reaction, the salt concentration of the washing solution, the washing temperature, etc. Understand that it can be easily adjusted to the desired stringency.
An expression vector containing a nucleic acid molecule encoding a chimeric protein used in the detection system of the present invention is prepared, for example, by preparing a target fragment (target gene) from the nucleic acid molecule encoding the chimeric protein used in the detection system of the present invention. The fragment can be prepared by ligating downstream of the promoter in an appropriate expression vector.
As an expression vector, an animal virus vector such as retrovirus or vaccinia virus (for example, IRES bicistronic expression vector, pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo, pME18S) and the like are used.
The promoter may be any promoter as long as it is appropriate for the host used for gene expression. For example, LCK proximal promoter, SRα promoter, SV40 promoter, RSV-LTR promoter, CMV promoter, HSV-TK promoter Etc. are used.
The expression vector may contain an enhancer, a splicing signal, a poly A addition signal, a selection marker or reporter gene, an SV40 origin of replication (SV40ori), and the like, as necessary.
Examples of the selection marker and reporter gene include a green fluorescent protein (GFP) gene, a luciferase gene, a β-galactosidase gene, a dihydrofolate reductase gene, an ampicillin resistance gene, and a neomycin resistance gene.
The expression vector is preferably an IRES bicistronic expression vector in which the target gene is expressed from the same mRNA together with a selectable marker or reporter. Examples of the IRES bicistronic expression vector include pMX-IRES-GFP (Kitamura et al., Int. J. Hematol., 67, 351-9 (1998)), a vector marketed by Clontech, and the like. .
When the first protein and the second protein are heterogeneous, the nucleic acid molecule encoding the first chimeric protein and the nucleic acid molecule encoding the second chimeric protein may be inserted on the same vector. It may be inserted on a separate vector.
When inserted on the same vector, both nucleic acid molecules may be under the control of separate promoters, or may be under the control of the same promoter using the IRES bicistronic expression vector.
Gene introduction into IL-3-dependent cells can be performed according to a method known in the art (for example, the method described in Virology, 52, 456 (1973)).
Examples of IL-3 dependent cell cells include mouse pro B cell line Ba / F3 (also referred to herein as “BAF3”), mouse mast cell line IC2, and mouse bone marrow cell line F-36P. .
In the detection system of the present invention, preferably, BAF3 can be used as an IL-3-dependent cell.
Confirmation of gene transfer into IL-3-dependent cells can be performed, for example, by a method using the above selection marker and reporter, blotting using an antibody against EPOR or TPOR, or any combination thereof.
As a medium for culturing cells, for example, MEM medium, DMEM medium, RPMI 1640 medium, 199 medium and the like containing about 5 to 20% fetal bovine serum (FBS) are used.
The pH of the medium is preferably about 6-8. The culture is usually performed at about 30 ° C. to 40 ° C. for about 1 day to about 1 week, preferably about 1 day to about 3 days. You may perform ventilation | gas_flowing and stirring as needed.
If the first protein and the second protein can interact in the presence of a specific ligand, an appropriate concentration of the ligand can be added to the medium.
Thus, the detection system of the present invention also provides a screening method for cell surface proteins that are known to interact and whose ligands are unknown.
Alternatively, the detection system of the present invention also provides a screening method for agonists and antagonists of cell surface proteins whose ligands are known.
In the detection system of the present invention, the presence or absence of interaction between the first protein and the second protein in the extracellular region can be confirmed by the viability of the IL-3 dependent cells into which the gene has been introduced. Cell viability can be determined, for example, by counting propidium iodide (PI) negative cells by flow cytometry.
When the first protein and the second protein are heterogeneous, in addition to the interaction between the first protein and the second protein, the interaction between the first protein and / or the second protein Is also considered.
Therefore, the presence or absence of the interaction between the first protein and the second protein depends on whether the nucleic acid molecule encoding the first chimeric protein and the nucleic acid molecule encoding the second chimeric protein are IL-3-dependent. Viability in the absence of IL-3 when introduced into a cell, and survival when nucleic acid molecules encoding the first and second chimeric proteins are each independently introduced into an IL-3-dependent cell It is more desirable to examine the degree by comparing the degree.
The detection system of the present invention also provides a kit for detecting interactions in the extracellular region between cell surface proteins. The detection kit comprises a nucleic acid molecule encoding EPOR or TPOR or their transmembrane and cytoplasmic domains; an expression vector; and an IL-3-dependent cell.
If the user of this detection kit prepares a nucleic acid molecule encoding the cell surface protein to be tested or its extracellular domain, the detection kit can be used to reciprocally interact with each other in the extracellular region between the test proteins according to the above procedure. The presence or absence of action can be confirmed.
The present invention will be described more specifically with reference to the following examples. However, the examples are merely illustrative of the present invention and do not limit the scope of the present invention.

(Example 1)
(Method)
(mouse)
Rag2 with C57BL / 6 background ^{− / −} Mice were obtained from Taconic. pre-Tα ^{− / −} The mice were Provided by Dr. von Boehmer (Dana-Farber Cancer Institute, Harvard Medical School). All mice were maintained in a laminar flow clean room and given standard laboratory food and water as appropriate. All animal experiments were performed according to our institutional guidelines.
(Cells and reagents)
Hatocytochrome c-specific T cell hybridoma (2B4) and its α ⁻ β ⁻ The variant (TG40) was maintained in RPMI 1640 supplemented with 10% FCS. TG40 was infected with P14 TCRβ chain using the pMX-puro retroviral vector (TG40β).
Anti-CD4 mAb, anti-CD8 mAb, anti-TCRβ mAb, anti-CD25 mAb, and anti-hCD8 mAb were purchased from eBioscience.
Anti-pTα (2F5) mAb was obtained from BD Biosciences.
Anti-rCD2 mAb was obtained from CedarLane.
Anti-hEPOR mAb was obtained from Santa Cruz.
(Chimeric protein construction)
pTα / GFP was prepared by fusing GFP to the C-terminus of the pTα chain by the PCR method.
TCRα / GFP was prepared by fusing GFP to the C-terminus of P14 TCRα chain by PCR.
pTα / EPOR was generated by fusing the extracellular domain of pTα to the transmembrane and cytoplasmic domains of human erythropoietin receptor by PCR.
TCRα / EPOR was generated by fusing the extracellular domain of P14 TCRα to the transmembrane and cytoplasmic domains of human erythropoietin receptor by PCR.
Specifically, the extracellular domain of pTα was amplified using primer (1) and primer (2) containing a part of the transmembrane domain of EPOR using a plasmid containing the full length of pTα as a template. On the other hand, the extracellular domain of TCRα was amplified with primer (3) containing a part of the transmembrane domain of primer (1) and EPOR using a plasmid containing the full length of TCRα as a template.
EPOR transmembrane domain-cell amplified by amplification of pTα extracellular domain using primer (4) and primer (5) containing part of pTα extracellular domain using plasmid containing EPOR full length as template Annealed to the inner domain and amplified using primer (1) and primer (4) to obtain cDNA encoding the desired pTα / EPOR chimeric molecule. On the other hand, an amplified product of the extracellular domain of TCRα was amplified by primer (4) using a plasmid containing the full length of EPOR as a template and primer (6) containing a part of the extracellular domain of TCRα. It was annealed to the intracellular domain and amplified by primer (1) and primer (4) to obtain cDNA encoding the target TCRα / EPOR chimeric molecule.
The cDNA encoding the pTα / EPOR chimeric molecule and the cDNA encoding the TCRα / EPOR chimeric molecule were respectively subcloned into the pMX-IRES-GFP vector and subjected to the following analysis.
primer (1) GGTGGACCATCCCTCTAGACT (SEQ ID NO: 8)
primer (2) AGGGAGAGCGTCAGGATGAGTACCCTGCCGCTGTGTCCCCC (SEQ ID NO: 9)
primer (3) AGGGAGAGCGTCAGGATGAGCAGGTTTTGAAAGTTTAGGT (SEQ ID NO: 10)
primer (4) TAATACGACTCACTATAGG (SEQ ID NO: 11)
primer (5) GGGGGACACACGCGGCAGGTACTCATCCCTGACGCTCTCCCT (SEQ ID NO: 12)
primer (6) ACCTAAACTTTCAAAACCTGCTCATCCCTGACGCTCTCCCT (SEQ ID NO: 13)
pMX-IRES-rCD2 Provided by Dr. Kubo (Riken).
pMX-IRES-hCD8 was constructed by replacing the NcoI / SalI fragment of GFP in MX-IRES-GFP with a truncated human CD8α (Δ198-214) lacking the cytoplasmic region.
(marrow transplant)
For bone marrow transplantation (BMT), Rag2 ^{− / −} Mouse-derived Sca-1 ⁺ BM cells were sorted by MACS (Miltenyi) and 1 × 10 in RPMI 1640 supplemented with 10% FCS, 10 ng / ml IL-7 and 100 ng / ml SCF (Pepro Tech). ⁶ / Ml. Retrovirus-mediated gene transfer was performed according to the method described by Yamasaki et al., Blood, 103, 3093-101 (2004). On day 1 and 2, 10-fold concentrated retroviral supernatant was added and this was centrifuged at 2000 rpm for 1 hour at 32 ° C. 4 days after infection, hCD8 ⁺ Cells were sorted using MACS (Miltenyi) and irradiated (7 Gy) Rag2 ^{− / −} Mice were injected intravenously. Six weeks after BMT, thymocytes or splenocytes were removed from the mice and analyzed.
(Competitive BMT)
pTα ^{− / −} Mouse-derived Sca-1 ⁺ BM cells were treated with a retroviral vector encoding wild type pTα-IRES-hCD8 or pTα as described above. ^{R102 / 117A} -Infected with a retroviral vector encoding IRES-rCD2. 4 days after infection, hCD8 ⁺ Cells or rCD2 ⁺ Cells were sorted using MACS. 5 x 10 from each population ⁵ Cells were mixed and irradiated (4 Gy) Rag2 ^{− / −} Mice were injected. Three weeks after BMT, thymocytes were analyzed using FACS.
(Molecular modeling of pTα-β heterodimer complex)
The sequence of mouse pTα (Genbank accession number: NM — 011195) was obtained from the NCBI server. A partial sequence ranging from the 10th residue to the 119th residue of pTα was extracted, and its three-dimensional structure was predicted using a general method for homology modeling. The crystal structure of TCRα (PDB-entry: 1 nfd) (Wang et al., Embo. J., 17, 10-26 (1998)) was used as a template for creating a homology model. Protein Data Bank (PDB) (Berman et al. , Nucleic. Acid. Res., 28, 235-42 (2000)). The partial sequence of pTα was aligned with the template protein using NW alignment (Needleman et al., J. Mol. Biol., 48, 443-53 (1970)). In order to obtain proper alignment, gaps and Cys residues in pTα were manually moved towards the corresponding positions of the Cys residues of the template protein. Upon achieving proper alignment, the main chain atoms in the target protein were assigned to the corresponding residue coordination in the template protein of TCRα. Loop region insertions and deletions were modeled by searching the appropriate database from a fragment database created from fragments of proteins of known structure. Side chains were constructed on the pTα model backbone using the Metropolis Monte Carlo method. In order to relax the structure, a 500 ps molecular dynamics simulation was performed using molecular dynamics package AMBER8 (Cornell et al., Abstracts of the Papers of the American Chemical Society, 204, 40-Comp, 1992) 1-41 (1995)). The figure was created using ViewerLite (Accelrys).
(Single molecule analysis)
Cells were imaged using a total internal reflection fluorescence (TIRF) microscope (Tokunaga et al., Biochem. Biophys. Res. Commun., 235, 47-53 (1997); Funatsu et al., Nature, 374, 555-9 (1995)). Turned into. A beam from a solid state laser (488 nm, 20 mW, SAPPHIRE 488-20-OPS, COHERENT, CA) was introduced into an inverted microscope (IX-81, Olympus) for irradiation. Images were captured using an EB-CCD camera (C-7190-23, Hamamatsu Photonics). Image recording and analysis was performed using AquaCosmos software (Hamamatsu Photonics). Cells were analyzed in phenol red-free Eagle's MEM without folic acid and riboflavin on glass bottom dishes (Matsunami) coated with poly-L-lysine.
(Fluorescence resonance energy transfer (FRET))
CFP and YFP were analyzed by PCR using pECFP-C1 and pEYFP-C1 (BD Biosciences Clontech) as templates in the same manner as the pTα / GFP fusion protein described above. ^{R102 / 117A} And fused. TCRα ^null TG40β cells were reconstituted with retroviruses using these fluorescent proteins. For detection of FRET by flow cytometry, cells were analyzed for YFP (excitation 480 nm; emission 530 nm), CFP (excitation 407 nm; emission 510 nm) and FRET (excitation 407 nm; emission 535 nm) using FACSAria. FRET was expressed as YFP emission obtained by CFP excitation and plotted against YFP emission by YFP excitation.
(result)
(Constitutive internalization and lysosomal localization of pre-TCR)
Although pre-TCR has been proposed to act in a ligand-independent manner, the molecular mechanism underlying such autonomous signaling is not clear.
To address this issue, we used pTα and TCRα GFP fusion proteins (ie, chimeric proteins) to subcellular localization and dynamic transport of pre-TCR and αβTCR under the same cellular conditions ( dynamic trafficking) was visualized.
Fluorescently labeled pre-TCR and αβTCR were introduced into TCRα by introducing pTα / GFP and TCRα / GFP, respectively. ^null Reconstituted in a T cell hybridoma (TG40β).
Anti-TCRβ staining showed that the surface expression level of pre-TCR was significantly lower than that of αβTCR (FIG. 1a, left panel group and middle panel group), but the total GFP expression levels of these two strains were similar (FIG. 1a, central panel group). Consistent with these observations, a significant fraction of pTα / GFP but not TCRα / GFP was found in intracellular vesicular compartments (FIG. 1a, right panel group), which are Co-localized with lysosomal markers (FIG. 1b). The TCRβ chain surface labeled with anti-TCRβ mAb was co-localized with pTα / GFP after incubation at 37 ° C. for 30 minutes (FIG. 1c). This indicated that the pre-TCR complex was rapidly internalized from the cell surface. These observations suggested that pre-TCR can be bound autonomously.
The ability of the receptor complex containing pTα / GFP on the surface of TG40β cells or the receptor complex containing TCRα / GFP to be evaluated by TIRF microscopy as described above.
The number of GFP molecules within a single receptor cluster on the cell surface was assessed using pTα / GFP or TCRα / GFP. The fluorescence intensity of each single bright spot reflecting a single cluster of receptors on the cell surface was determined as described in Funatsu et al., Nature, 374, 555-9 (1995). The bright spots on the individual surfaces are analyzed and their fluorescence is represented as a frequency distribution histogram (FIG. 1d). The average fluorescence intensity of a single GFP molecule determined simultaneously from recombinant GFP is 1585 ± 56 a. u. (Arbitrary units). Clusters with high fluorescence intensity reflecting oligomers were observed only in cells expressing pTα / GFP (FIG. 1d, lower panel) and not observed in cells expressing TCRα / GFP (FIG. 1d, upper panel). ) Is noteworthy.
Consistent with the above, microscopic analysis at the monomolecular level of pTα / GFP on the cell surface suggested that the pre-TCR complex has the ability to form oligomers in the plasma membrane (Fig. 1d).
(PTα / EPOR chimera induces autonomous growth)
The inherent properties of the pre-TCR shown above are completely dependent on pTα. This is because the cellular status and other receptor components (TCRβ and CD3 complex) are consistent between these two cell lines. Thus, we focused on the structure and function of pTα and utilized a novel system that tests the oligomerization ability of pTα in the absence of ligand binding.
The extracellular domains of pTα and TCRα were fused to the transmembrane and cytoplasmic domains of human erythropoietin receptor (EPOR) (referred to as pTα / EPOR and TCRα / EPOR, respectively) (FIG. 2a). The expression of each chimeric receptor in the transduced BAF3 cells was confirmed by anti-EPOR immunoblot and staining (FIGS. 2b and 2c). BAF3 cells transduced with pTα / EPOR showed significant proliferation even in the absence of IL-3, whereas mock infection or TCRα / EPOR infection did not affect BAF3 proliferation ( FIG. 2d). These results indicated that the extracellular domain of pTα itself has the ability to spontaneously form oligomers.
FRET analysis using pTα / CFP and pTα / YFP also showed that pre-TCR has the ability to form oligomers on the cell surface (FIG. 2e).
(Specific charged residues of pTα are important for pTα / EPOR activity)
To elucidate the structural requirements for oligomerization of pTα, mutagenesis was performed utilizing cell growth induced by pTα / EPOR.
We focused on the charged amino acid residues conserved for human and mouse pTα (FIG. 3a). All of these amino acids of pTα were mutated individually and simultaneously and their effects on BAF3 proliferation were evaluated.
The inventors have found that D22, R24, R102, and R117 are important for pTα / EPOR function. This is because the alanine substitution of each of these residues abolished the activity supporting growth (Figure 3b, m5, m9-m11).
Replacement of R24 with a bulky amino acid residue (Q), a hydrophilic amino acid residue (S), or an acidic amino acid residue (E) completely abolishes pTα / EPOR activity (FIG. 3b, m12 -M14), on the other hand, replacement of R24, R102, and R117 with basic amino acid residues (K) maintained this activity (Figure 3b, m15-m19).
This suggests that the positive charge of these residues is important for activity. Similarly, the D22A mutation abrogated the activity, while the D22E mutation that retained a negative charge maintained the activity (FIG. 3b, m6). Taken together, these observations suggest that the charged amino acids at positions 22, 24, 102, and 117 are important for the pTα self-oligomerization properties.
In order to attempt to place these charged residues in the context of the three-dimensional structure of the pTα-TCRβ heterodimer, molecular modeling was performed to determine the crystal structure of the αβTCR heterodimer (Wang et al., Embo. J , 17, 10-26 (1998)) (details are as described above).
This model shows that functionally important amino acids D22, R24, R102, and R117 are located on the molecular surface of the pTα-TCRβ complex (FIG. 3c). This suggests that these residues are properly positioned to promote electrostatic interactions that lead to oligomer formation.
In sharp contrast, the other charged residues, E81, E82, E84, E87, D35, and D42, were shown to face TCRβ (FIG. 3d). This suggests that these residues are unlikely to be involved in pre-TCR self-oligomerization.
Consistent with this assumption, these residues were not essential for pTα / EPOR protein auto-oligomerization, although they may play a role in pTα-TCRβ complex formation in thymocytes.
(R102 / R117 of pTα is important for β selection in vivo)
It was investigated whether the above charged residues actually contribute to pre-TCR function. Among the four important charged residues, R102 and R117 are separated from the pTα-β interface in different directions, so that the pTα / GFP fusion protein (pTα with the R102 / 117A mutation). ^{R102 / 117A} / GFP) with TCRα ^null It was introduced into T cells and analyzed for internalization as described above.
pTα ^{R102 / 117A} Pre-TCR expression on the cell surface of cells expressing / GFP was significantly higher than that in wild type (WT) (FIG. 4a). Furthermore, intracellular vesicles containing pre-TCR reflecting constitutive internalization are significantly reduced by the R102 / 117A mutant (FIG. 4b). These results indicate that these charged residues are important for effective pre-TCR internalization.
We then analyzed the function of this mutant pTα in thymocyte development in vivo in a radiation BMT experiment.
pTα ^{− / −} PTα was added to mouse-derived BM cells. ^WT -IRES-hCD8 or pTα ^{R102 / 117A} -IRES-rCD2 transduced by retrovirus and irradiated Rag2 ^{− / −} Mice were injected. After 3 weeks, thymocytes from recipient mice were ⁺ Population or rCD2 ⁺ CD4 and CD8 expression in the population was analyzed (Figure 4c, upper panel group). Cells expressing WT pTα show effective DP translocation (DP cells are hCD8 ⁺ Representing 85.6% of thymocytes), while DP thymocytes are pTα ^{R102 / 117A} Expressing cells (rCD2 ⁺ ) Of 10.8%. Furthermore, another event associated with β selection, CD25 down-regulation, is pTαR. ^{R102 / 117A} Not pTα ^WT Expressing pTα ^{− / −} It was prominent in thymocytes derived from mice (Fig. 4c, lower panel group).
These results were also confirmed in competitive BMT experiments. pTα ^{− / −} In BM cells, pTα ^WT -IRES-hCD8 or pTα ^{R102 / 117A} -IRES-rCD2 was transduced separately, mixed in a 1: 1 ratio, and irradiated Rag2 ^{− / −} Recipient mice were injected. Again, the R102 / 117A mutant (rCD2 ⁺ Thymocytes expressing WT (hCD8 ⁺ ) Showed less effective DP transition. Therefore, R102 and / or R117 within the extracellular domain of pTα are thought to be important for traversing the β selection checkpoint (the physiological function of pre-TCR in vivo).
(Example 2)
Although pre-TCR has been proposed to act in a ligand-independent manner (Irving et al., Science, 280, 905-8 (1998)), the molecular mechanisms underlying such autonomous signaling Is not clear.
The inventors focused on pTα, a protein unique to pre-TCR, and utilized the system of the present invention to test the oligomerization ability of pTα.
BAF3 cells expressing a chimeric protein (FIG. 2a; hereinafter referred to as pTα / EPOR and TCRα / EPOR, respectively) in which the extracellular domain of pTα and the extracellular domain of TCRα are fused to the transmembrane domain and cytoplasmic domain of EPOR, respectively. Was made.
Using the plasmid containing the full length of pTα as a template, the extracellular domain of pTα was amplified using primer (1) and primer (2) containing a part of the transmembrane domain of EPOR. On the other hand, the extracellular domain of TCRα was amplified using primer (1) and primer (3) containing a part of the transmembrane domain of EPOR using a plasmid containing the full length of TCRα as a template.
EPOR transmembrane domain-cell amplified by amplification of pTα extracellular domain using primer (4) and primer (5) containing part of pTα extracellular domain using plasmid containing EPOR full length as template Annealed to the inner domain and amplified using primer (1) and primer (4) to obtain cDNA encoding the desired pTα / EPOR chimeric molecule. On the other hand, an amplified product of the extracellular domain of TCRα was amplified by primer (4) using a plasmid containing the full length of EPOR as a template and primer (6) containing a part of the extracellular domain of TCRα. It was annealed to the intracellular domain and amplified by primer (1) and primer (4) to obtain cDNA encoding the target TCRα / EPOR chimeric molecule.
The cDNA encoding the pTα / EPOR chimeric molecule and the cDNA encoding the TCRα / EPOR chimeric molecule were respectively subcloned into the pMX-IRES-GFP vector and subjected to the following analysis.
primer (1) GGTGGACCATCCCTCTAGACT (SEQ ID NO: 8)
primer (2) AGGGAGAGCGTCAGGATGAGTACCCTGCCGCTGTGTCCCCC (SEQ ID NO: 9)
primer (3) AGGGAGAGCGTCAGGATGAGCAGGTTTTGAAAGTTTAGGT (SEQ ID NO: 10)
primer (4) TAATACGACTCACTATAGG (SEQ ID NO: 11)
primer (5) GGGGGACACACGCGGCAGGTACTCATCCCTGACGCTCTCCCT (SEQ ID NO: 12)
primer (6) ACCTAAACTTTCAAAACCTGCTCATCCCTGACGCTCTCCCT (SEQ ID NO: 13)
pTα / EPOR and TCRα / EPOR in the pMX-IRES-GFP vector were transfected into BAF3 cells, respectively, and the expression of each chimeric receptor in BAF3 cell transfectants was compared with anti-EPOR immunoblot (FIG. 2b) and anti-EPOR. Confirmed by EPOR staining (Figure 2c).
Cell viability after IL-3 depletion was determined by counting propidium iodide (PI) negative cells by flow cytometry.
In FIG. 2d, GFP ⁻ Cells (cells that do not express chimera: ◯) or GFP ⁺ The viability of the cells (cells expressing the chimera: ●) is expressed as a relative percentage with the number of viable cells on day 0 as 100. The infection efficiency for each condition was 50% -80% in all experiments and 4 independent experiments that showed similar results.
Even in the absence of IL-3, BAF3 cells transduced with pTα / EPOR showed significant proliferation, whereas mock or TCRα / EPOR infection did not affect BAF3 proliferation (FIG. 2d).
The above results suggested that the extracellular domain of pTα itself has the ability to spontaneously form oligomers.
In addition, experiments were performed using CD8, which is a molecule known to exist as a homodimer due to the S—S bond of the extracellular domain.
BAF3 cells expressing a chimeric protein (hereinafter referred to as CD8 / EPOR) in which the extracellular domain of CD8 was fused to the transmembrane domain and cytoplasmic domain of EPOR were prepared.
Specifically, the extracellular domain of CD8 was amplified using primer (7) and primer (8) containing a part of the transmembrane domain of EPOR using a plasmid containing the full length of CD8 as a template. Amplified product of CD8 extracellular domain was amplified using primer (9) and primer (10) containing a part of the extracellular domain of CD8, using plasmid containing full length of EPOR as a template ~ cell The inner domain was annealed and amplified using primer (7) and primer (9) to obtain cDNA encoding the desired CD8 / EPOR chimeric molecule. The cDNA encoding the CD8 / EPOR chimeric molecule was subcloned into the pMX-IRES-GFP vector and subjected to the following analysis.
primer (7) GGTGGACCATCCCTCTAGACT (SEQ ID NO: 14)
primer (8) AGGGAGAGCGTCAGGATGGAGATCACAGGCGAAGTCCAATC (SEQ ID NO: 15)
primer (9) TTTGCGGCCGCTATAGAGCAAGCCACATAGC (SEQ ID NO: 16)
primer (10) GATTGGACTTCGCCCTGTGATCTCATCCCTGACGCTCTCCCT (SEQ ID NO: 17)
CD8 / EPOR in the pMX-IRES-GFP vector was transfected into BAF3 cells.
The degree of cell proliferation after IL-3 depletion was determined by counting propidium iodide (PI) negative cells by flow cytometry.
Figure 5 shows the GFP ⁺ Cells (cells expressing chimeras: ●) or GFP ⁻ The degree of cell proliferation of cells (cells not expressing a chimera: ◯) is expressed as a relative percentage with the number of viable cells on day 0 as 100. FIG. 5 shows that the CD8 / EPOR chimera induces cell proliferation.

The present invention provides agents with a novel mechanism of action that regulate T cell differentiation by regulating pTα self-dimerization. The present invention also provides a method for screening such a drug and a method for regulating T cell differentiation using such a drug.
The T cell differentiation regulator of the present invention is useful as an agent that regulates T cell differentiation by a novel mechanism of action both in vitro and in vivo. Such a T cell differentiation regulator is a pharmaceutical agent for preventing or treating a disease (for example, acute lymphocytic leukemia, chronic lymphocytic leukemia, etc.) characterized by abnormal differentiation of T cells or increase or decrease of T cells. As useful.
The present invention also provides a system that can easily detect interactions in the extracellular region between various cell surface proteins.
The present invention provides a system that can easily detect an interaction between proteins in an extracellular region. The detection system of the present invention is useful as a tool for analyzing molecular mechanisms in cellular events involving cell surface proteins (eg, cell differentiation, proliferation and survival).
This application is based on patent application Nos. 2005-288640 and 2005-289136 filed in Japan, the contents of which are incorporated in full herein.
[Sequence Listing]

Claims (18)

A T cell differentiation regulator comprising a substance that regulates self-dimer formation of a pre-T cell antigen receptor α chain. The T cell differentiation regulator according to claim 1, wherein the substance is a substance that promotes self-dimer formation of a pre-T cell antigen receptor α chain. The T cell differentiation regulator according to claim 2, wherein the substance that promotes self-dimer formation of the pre-T cell antigen receptor α chain is a nucleic acid molecule encoding the pre T cell antigen receptor α chain. The T cell differentiation regulator according to claim 1, wherein the substance is a substance that suppresses self-dimer formation of a pre-T cell antigen receptor α chain. The substance that suppresses self-dimer formation of the pre-T cell antigen receptor α chain is an antisense nucleic acid, ribozyme, siRNA or antibody against the pre-T cell antigen receptor α chain; or the extracellular of the pre-T cell antigen receptor α chain The T cell differentiation regulator according to claim 4, which is a fragment of a domain. A method of regulating T cell differentiation, comprising the step of regulating self-dimer formation of a pre-T cell antigen receptor α chain. A screening method for a T cell differentiation regulator, comprising a step of evaluating whether a test substance regulates self-dimer formation of a pre-T cell antigen receptor α chain. A kit for screening for a T cell differentiation regulator, cells expressing a chimeric protein of pTα and a fluorescent substance, or IL-expressing a chimeric protein of pTα and an erythropoietin receptor or thrombopoietin receptor A kit comprising 3-dependent cells. A method for detecting interactions in extracellular regions between cell surface proteins,
A nucleic acid molecule encoding a first chimeric protein comprising an extracellular domain of a first protein and a transmembrane and cytoplasmic domain of an erythropoietin receptor or thrombopoietin receptor, and an extracellular domain of a second protein IL-3 dependent cells, into which a nucleic acid molecule encoding a second chimeric protein, comprising a transmembrane domain and a cytoplasmic domain of erythropoietin receptor or thrombopoietin receptor has been introduced, A method comprising the step of cultivating under the conditions and confirming the presence or absence of proliferation of the cells. The method according to claim 9, wherein the first protein and the second protein are the same type of protein. The method according to claim 9, wherein the first protein and the second protein are heterologous proteins. A first chimeric protein comprising an extracellular domain of a first protein and a transmembrane and cytoplasmic domain of an erythropoietin receptor or thrombopoietin receptor; and an extracellular domain of a second protein and erythropoietin An IL-3-dependent cell expressing a second chimeric protein comprising a transmembrane domain and a cytoplasmic domain of a receptor or thrombopoietin receptor. The cell according to claim 12, wherein the first protein and the second protein are the same type of protein. The cell according to claim 12, wherein the first protein and the second protein are heterologous proteins. A chimeric protein comprising an extracellular domain of a cell surface protein and a transmembrane and cytoplasmic domain of an erythropoietin receptor or thrombopoietin receptor. A nucleic acid molecule encoding the chimeric protein according to claim 15. An expression vector comprising the nucleic acid molecule according to claim 16. A kit for detecting interactions in the extracellular region between cell surface proteins, comprising:
Nucleic acid molecules encoding erythropoietin receptor or thrombopoietin receptor or their transmembrane and cytoplasmic domains;
An expression vector; and a kit comprising IL-3-dependent cells.

Images