WO2006002161A2 - Modulators of odorant receptors - Google Patents

Modulators of odorant receptors Download PDF

Info

Publication number
WO2006002161A2
WO2006002161A2 PCT/US2005/021921 US2005021921W WO2006002161A2 WO 2006002161 A2 WO2006002161 A2 WO 2006002161A2 US 2005021921 W US2005021921 W US 2005021921W WO 2006002161 A2 WO2006002161 A2 WO 2006002161A2
Authority
WO
WIPO (PCT)
Prior art keywords
rtpl
rtp
reep
cell
polypeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2005/021921
Other languages
English (en)
French (fr)
Other versions
WO2006002161A3 (en
Inventor
Hiroaki Matsunami
Momoka Matsunami
Harumi Saito
Hanyi Zhuang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Duke University
Original Assignee
Duke University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Duke University filed Critical Duke University
Priority to AU2005258061A priority Critical patent/AU2005258061C1/en
Priority to EP05792749A priority patent/EP1771582A4/en
Priority to CN2005800275380A priority patent/CN101087879B/zh
Priority to HK08106475.3A priority patent/HK1116217B/xx
Priority to CA2571080A priority patent/CA2571080C/en
Priority to JP2007516837A priority patent/JP5022217B2/ja
Publication of WO2006002161A2 publication Critical patent/WO2006002161A2/en
Anticipated expiration legal-status Critical
Publication of WO2006002161A3 publication Critical patent/WO2006002161A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/02Nasal agents, e.g. decongestants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/02Drugs for disorders of the nervous system for peripheral neuropathies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/16Otologicals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • C07K14/4705Regulators; Modulating activity stimulating, promoting or activating activity
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5041Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects involving analysis of members of signalling pathways
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5058Neurological cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/74Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2503/00Use of cells in diagnostics
    • C12N2503/02Drug screening
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/72Assays involving receptors, cell surface antigens or cell surface determinants for hormones
    • G01N2333/726G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/04Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)

Definitions

  • the present invention relates to polypeptides capable of promoting odorant receptor cell surface localization and odorant receptor functional expression.
  • the present invention further provides assays for the detection of ligands specific for various odorant receptors. Additionally, the present invention provides methods of screening for odorant receptor accessory protein polymorphisms and mutations associated with disease states, as well as methods of screening for therapeutic agents, ligands, and modulators of such proteins.
  • Olfactory dysfunction arises from a variety of causes and profoundly influences a patient's quality of life. Approximately 2 million Americans experience some type of olfactory dysfunction. Studies show that olfactory dysfunction affects at least 1% of the population under the age of 65 years, and well over 50% of the population older than 65 years.
  • the sense of smell determines the flavor of foods and beverages and serves as an early warning system for the detection of environmental hazards, such as spoiled food, leaking natural gas, smoke, or airborne pollutants. The losses or distortions of smell sensation can adversely influence food preference, food intake and appetite.
  • Olfactory disorders are classified as follows: 1) anosmia: inability to detect qualitative olfactory sensations (e.g., absence of smell function), 2) partial anosmia: ability to perceive some, but not all, odorants, 3) hyposmia or microsmia: decreased sensitivity to odorants, 4) hyperosmia: abnormally acute smell function, 5) dysosmia (cacosmia or parosmia): distorted or perverted smell perception or odorant stimulation, 6) phantosmia: dysosmic sensation perceived in the absence of an odor stimulus (a.k.a.
  • Olfactory dysfunction is further classified as 1) conductive or transport impairments from obstruction of nasal passages (e.g., chronic nasal inflammation, polyposis, etc.), 2) sensorineural impairments from damage to neuroepithelium (e.g., viral infection, airborne toxins, etc.), 3) central olfactory neural impairment from central nervous system damage (e.g., tumors, masses impacting on olfactory tract, neurodegenerative disorders, etc.). These categories are not mutually exclusive.
  • viruses can cause damage to the olfactory neuroepithelium and they may also be transported into the central nervous system via the olfactory nerve causing damage to the central elements of the olfactory system.
  • Smelling abilities are initially determined by neurons in the olfactory epithelium, the olfactory sensory neurons (hereinafter “olfactory neurons).
  • olfactory neurons odorant receptor (hereinafter "OR") proteins, members of the G-protein coupled receptor (hereinafter “GPCR”) superfamily, are synthesized in the endoplasmic reticulum, transported, and eventually concentrated at the cell surface membrane of the cilia at the tip of the dendrite.
  • OR odorant receptor
  • GPCR G-protein coupled receptor
  • OR proteins are also present at axon terminals (see, e.g., Mombaerts, P., (1996) Cell 87, 675-686; Wang, F., et al. (1998) Cell 93, 47-60; each herein incorporated by reference in their entireties).
  • odorants are transduced by as many as 1000 different ORs encoded by a multigene family (see, e.g., Axel, R. (1995) Sci Am 1273, 154- 159; Buck, L., and Axel, R. (1991) Cell 65, 175-187; Firestein, S.
  • Each olfactory neuron expresses only one type of the OR, forming the cellular basis of odorant discrimination by olfactory neurons (see, e.g., Lewcock, J. W., and Reed, R. R.
  • the present invention relates to polypeptides capable of promoting odorant receptor cell surface localization and odorant receptor functional expression.
  • the present invention further provides assays for the detection of ligands specific for various odorant receptors. Additionally, the present invention provides methods of screening for odorant receptor accessory protein polymorphisms and mutations associated with disease states, as well as methods of screening for therapeutic agents, ligands, and modulators of such proteins.
  • the present invention provides a method for identifying an odorant receptor ligand, comprising the steps of a) providing i) a cell line or cell membranes thereof comprising an odorant receptor and a reporting agent, and ii) a test compound; b) exposing the test compound to the cell line; and c) measuring the activity of the reporting agent.
  • the cell line expresses REEPl, RTPl, RTP2, RTPl-A, RTPl-B, RTPl-C, RTPl-D, and RTPl-E, RTPl-Al, RTPl-Dl, RTP-D2, and RTP1-D3.
  • the cell line is a heterologous cell line or a natural cell line.
  • the cell line is a 293T cell line
  • the odorant receptor is a human odorant receptor
  • the test compound is an odiferous molecule
  • the reporting agent is regulated by a cAMP responsive element
  • the cell line further comprises G ⁇ o if- hi other embodiments
  • the odorant receptor is a murine odorant receptor
  • the odorant receptor is a synthetic odorant receptor
  • the odorant receptor comprises S6/79, S18, S46, S50, MOR23-1, MOR31-4, M0R31 -6, MOR32-5 and/or MOR32- 11.
  • the reporting agent is an illuminating agent, hi even other embodiments, the illuminating agent is luciferase.
  • the method further comprises the step of detecting the presence or absence of an odorant receptor ligand based upon the reporting agent activity.
  • the present invention provides a cell line expressing an odorant receptor, wherein the expression is localized to the cell surface.
  • the cell line comprises a heterologous gene, hi preferred embodiments, the heterologous gene comprises one or more of REEPl, RTPl, and RTP2.
  • the cell line is a 293T cell line, hi some embodiments, the odorant receptor is a human odorant receptor, hi preferred embodiments, the odorant receptor is tagged with a reporting agent, hi some embodiments, the reporting agent is an illuminating reporting agent, hi some embodiments, the illuminating reporting agent comprises glutathione-S- transferase (GST), c-myc, 6-histidine (6X-His), green fluorescent protein (GFP), maltose binding protein (MBP), influenza A virus haemagglutinin (HA), ⁇ -galactosidase, or GAL4.
  • the cell line further comprises G ⁇ o i f expression.
  • the odorant receptor is a murine odorant receptor, hi some embodiments, the odorant receptor is a synthetic odorant receptor, hi preferred embodiments, the odorant receptor comprises S6/79, S 18, S46, S50, MOR23-1, MOR31-4, MOR31-6, MOR32-5 and MOR32-11.
  • the present invention further provides an isolated nucleic acid comprising a sequence encoding a protein comprising SEQ ID NOs: 21, 27, 33, 34, 37, 38, and 41-50, and variants thereof that are at least 80% identical to SEQ ID NOs: 21, 27, 33, 34, 37, 38, and 41-50.
  • the sequence is operably linked to a heterologous promoter.
  • the sequence is contained within a vector, hi preferred embodiments, the vector is within a host cell.
  • the present invention also provides isolated and purified nucleic acid sequences that hybridize under conditions of high stringency to a nucleic acid comprising SEQ ID NOs: 1, 7, 13, 14, 17 and/or 18.
  • the sequence is operably linked to a heterologous promoter.
  • the sequence is contained within a vector, hi some embodiments, the host vector is within a host cell, hi further preferred embodiments, the host vector is expressed in a host cell, hi preferred embodiments, the host cell is located in an organism, wherein the organism is a non-human animal, hi preferred embodiments, the present invention provides a polynucleotide sequence comprising at least fifteen (e.g., 15, 18, 20, 21, 25, 50, 100, 1000, ...) nucleotides capable of hybridizing under stringent conditions to the isolated nucleotide sequence.
  • the present invention provides a polypeptide encoded by a nucleic acid selected from the group consisting of SEQ ID NOs: 1, 7, 13, 14, 17 and 18 and variants thereof that are at least 80% identical to SEQ ID NOs: 1, 7, 13, 14, 17 and 18.
  • the protein is at least 90% identical to SEQ ID NOs: 1, 7, 13, 14, 17 and 18.
  • the protein is at least 95% identical to SEQ ID NOs: 1, 7, 13, 14, 17 and 18.
  • the present invention provides a composition comprising a nucleic acid that inhibits the binding of at least a portion of a nucleic acid selected from the group consisting of SEQ ID NOs: 1, 7, 13, 14, 17 and 18 to their complementary sequences.
  • the present invention provides a method for detection of a variant REEP polypeptide in a subject, comprising providing a biological sample from a subject, wherein the biological sample comprises a REEP polypeptide; and detecting the presence or absence of a variant REEP polypeptide in the biological sample
  • the biological sample is selected from the group consisting of a blood sample, a tissue sample, a urine sample, and an amniotic fluid sample
  • the subject is selected from the group consisting of an embryo, a fetus, a newborn animal, and a young animal.
  • the animal is a human.
  • the detecting comprises differential antibody binding.
  • the detection comprises a Western blot.
  • the variant REEP polypeptide is a variant REEPl polypeptide.
  • the detecting comprises detecting a REEPl nucleic acid sequence.
  • the present invention provides a method for detection of a variant RTP polypeptide in a subject, comprising providing a biological sample from a subject, wherein the biological sample comprises a RTP polypeptide; and detecting the presence or absence of a variant RTP polypeptide in the biological sample, hi preferred embodiments, the biological sample is selected from the group consisting of a blood sample, a tissue sample, a urine sample, and an amniotic fluid sample.
  • the subject is selected from the group consisting of an embryo, a fetus, a newborn animal, and a young animal.
  • the animal is a human
  • the detecting comprises differential antibody binding.
  • the detection comprises a Western blot
  • the variant RTP polypeptide is a variant RTPl and/or RTP2 polypeptide
  • the detecting comprises detecting a RTPl and/or RTP2 nucleic acid sequence
  • the RTPl variant is selected from the group consisting of RTPl-Al, RTPl-Dl, and RTP1-D3.
  • the present invention provides a kit comprising a reagent for detecting the presence or absence of a variant REEP polypeptide in a biological sample.
  • the kit further comprises instruction for using the kit for the detecting the presence or absence of a variant REEP polypeptide in a biological sample, hi preferred embodiments, the REEP polypeptide is a REEPl polypeptide, hi other embodiments, the REEP polypeptide is selected from the group consisting of REEP1-6.
  • the instructions comprise instructions required by the U.S. Food and Drug Agency for in vitro diagnostic kits.
  • the reagent is one or more antibodies
  • the biological sample is selected from the group consisting of a blood sample, a tissue sample, a urine sample, and an amniotic fluid sample.
  • the reagents are configured to detect a REEPl nucleic acid sequence.
  • the present invention provides a kit comprising a reagent for detecting the presence or absence of a variant RTP polypeptide in a biological sample, hi some embodiments, the kit further comprises instruction for using the kit for the detecting the presence or absence of a variant RTP polypeptide in a biological sample.
  • the RTP polypeptide is a RTPl and/or RTP2 polypeptide, hi other embodiments, the RTP polypeptide is selected from the group consisting of RTP 1-4.
  • the instructions comprise instructions required by the U.S. Food and Drug Agency for in vitro diagnostic kits, hi preferred embodiments, the reagent is one or more antibodies.
  • the biological sample is selected from the group consisting of a blood sample, a tissue sample, a urine sample, and an amniotic fluid sample
  • the reagents are configured to detect a RTPl and/or RTP2 nucleic acid sequence
  • the RTPl polypeptide is a variant RTPl polypeptide selected from the group consisting of RTPl-Al, RTPl-Dl, and RTPl- D3.
  • the present invention provides a method for screening compounds, comprising providing a sample expressing a heterologous REEP polypeptide and a test compound; and exposing the sample to the test compound and detecting a biological effect
  • the REEP polypeptide is selected from the group consisting of REEP 1-6.
  • the sample comprises a cell
  • the sample comprises a tissue.
  • the sample is found in a subject
  • the biological effect comprises a change in activity of REEP.
  • the biological effect comprises a change in expression of REEP.
  • the present invention provides a method for screening compounds, comprising providing a sample expressing a heterologous RTP polypeptide and a test compound; and exposing the sample to the test compound and detecting a biological effect.
  • the RTP polypeptide is selected from the group consisting of RTP1-4 and RTPl-Al, RTPl-Dl, and RTP1-D3.
  • the sample comprises a cell, hi preferred embodiments, the sample comprises a tissue, hi preferred embodiments, the sample is found in a subject, hi some embodiments, the biological effect comprises a change in activity of RTP. In some embodiments, the biological effect comprises a change in expression of RTP.
  • FIGURES shows a screening strategy for identifying molecules that promote cell- surface expression of odorant receptors.
  • REEPl was obtained from Digital Differential Display analysis.
  • RTPl was obtained from SAGE libraries.
  • Figure 2 shows REEP and/or RTP promote cell-surface expression of odorant receptors in 293T Cells.
  • FIG. 3 shows that REEP and/or RTP do not promote cell-surface expression of VR4 and mT2R5 in 293T Cells.
  • cDNAs encoding VR4 and mT2R5 were transfected with or without REEP 1 , RTP 1 and/or RTP2.
  • REEP 1 , RTP 1 and/or RTP2 were transfected with or without REEP 1 , RTP 1 and/or RTP2.
  • REEP 1 RNA sequence encoding VR4 and mT2R5
  • RTP 1 and/or RTP2R5 Unlike ORs, increased cell-surface staining was not seen in cells expressing these proteins.
  • BFP expression is shown to demonstrate high (-70%) transfection efficiency of VR4 transfected cells.
  • cell-surface fluorescent signals are seen as distinctive punctate staining. Scale bar equals to 50um.
  • Figure 4 presents fluorescent hisogram data for REEPl, RTPl, and RTP2 expression with odorant receptor (A) olfr62 and (B) mT2R5.
  • Figure 5 shows the REEP and the RTP families.
  • A Deduced amino acid sequences of REEPl . Solid bar indicates putative transmembrane region (TM). The first TM region could function as a signal peptide.
  • B Unrooted phylogenetic tree of REEP family members. At least 6 REEP family members (REEP 1-6) were identified on the mouse genome. Yeast YOPlP, barley HVA22, and human DPI are homologous to REEP proteins.
  • C Deduced amino acid sequences of RTPl and RTP2.
  • Solid bar indicates putative transmembrane domain. Shaded amino acids are conserved between RTPl and RTP2. There are two more members (RTP3 and4) on the mouse genome.
  • Figure 6 shows expression of REEPl, RTPl and RTP2.
  • A Northern blot analysis. Total RNA was used for northern blotting analysis. Olfactory epithelium, vomeronasal organ, and brain showed ⁇ 3.6kb bands corresponding to REEPl rnRNA. Only olfactory epithelium and vomeronasal organ RNAs showed ⁇ 3.5kb and ⁇ 2.6kb bands corresponding RTPl and RTP2 mRNA, respectively. Ethidium bromide staining for 18S rRNA is shown as a control.
  • FIG. 7 shows association of odorant Receptors with REEPl and RTPl.
  • A Control western blot analysis indicating expression of HA-tagged MOR203-1, Flag-tagged REEPl, RTPl and ICAPl in 293T cells.
  • B When Flag- RTPl or Flag-REEPl was precipitated, HA-MOR203-1 proteins were co-precipitated (Lanes 1 and 2). However, when Flag- ICAP-I (a negative control protein) was precipitated, HA-MOR203-1 proteins were not detected (Lane 3).
  • C When HA-MOR203-1 was precipitated, Flag-REEPl and Flag-RTPl were co-purified when co-expressed (Lanes 1 and 2).
  • Negative control protein (Flag-ICAP-1) was not co-precipitated (Lane 3). Asterisks indicate nonspecific Ig proteins.
  • D Little cell-surface expression was observed when RTPl was transfected in 293T cells. However, when RTPl and an odorant receptor (OREG) were co-transfected, more RTPl staining signal was observed.
  • E A small amount of cell-surface signal was observed when REEPl was transfected in 293T cells. Co expression of an OR (olfr62) did not change the expression of REEPl. Scale bars equal to 50um.
  • Figure 8 shows that expression of REEPl, RTPl or RTP 2 enhances odorant receptor activation.
  • A Diagram showing cAMP responsive element (CRE) and luciferase was used to monitor activation of ORs. Activation of ORs increases cAMP, which enhances the expression of luciferase reporter gene through the CRE.
  • luciferase activity to 30OuM of vanillin (OREG) or decanoic acid (OR-S46) was regarded as 1 in each expression condition.
  • E cAMP assays. Enhanced cAMP production to various concentrations of eugenol in Hana3 A cells when OREG was transfected.
  • FIG. 9 shows RT-PCR analysis of Hana3A cells; + indicates PCR products using cDNA samples from Hana3 A cells as template DNA; - indicates negative controls without reverse transcriptase; M indicates DNA marker.
  • Figure 10 shows cell-surface expression of odorant receptors in Hana3A and 293T cells. cDNAs encoding three ORs (OREG, olfr62 and OR-S46) were transfected into Hana3A cells or 293T cells. Increased cell-surface staining was seen in Hana3A cells.
  • FIG. 11 shows recognition profiles of odorant receptors to odorants.
  • Figure 12 shows cell-surface expression of 8 odorant receptors in Hana3A cells. Scale bar equals to 50um.
  • Figure 13 shows models for the roles of REEP and/or RTP in odorant receptor expression.
  • Figure 14 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 1) and amino acid sequence (SEQ ID NO: 21) for murine REEPl.
  • Figure 15 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 2) and amino acid sequence (SEQ ID NO: 22) for murine REEP2.
  • Figure 16 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 3) and amino acid sequence (SEQ ID NO: 23) for murine REEP3.
  • Figure 17 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 4) and amino acid sequence (SEQ ID NO: 24) for murine REEP4.
  • Figure 18 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 5) and amino acid sequence (SEQ ID NO: 25) for murine REEP5.
  • Figure 19 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 6) and amino acid sequence (SEQ ID NO: 26) for murine REEP6.
  • Figure 20 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 7) and amino acid sequence (SEQ ID NO: 27) for human REEPl.
  • Figure 21 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 8) and amino acid sequence (SEQ ID NO: 28) for human REEP2.
  • Figure 22 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 9) and amino acid sequence (SEQ ID NO: 29) for human REEP3.
  • Figure 23 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 10) and amino acid sequence (SEQ ID NO: 30) for human REEP4.
  • Figure 24 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 11) and amino acid sequence (SEQ ID NO : 31 ) for human REEP5.
  • Figure 25 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 12) and amino acid sequence (SEQ ID NO: 32) for human REEP6.
  • Figure 26 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 13) and amino acid sequence (SEQ ID NO: 33) for murine RTPl .
  • Figure 27 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 14) and amino acid sequence (SEQ ID NO: 34) for murine RTP2.
  • Figure 28 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 15) and amino acid sequence (SEQ ID NO: 35) for murine RTP3.
  • Figure 29 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 16) and amino acid sequence (SEQ ID NO: 36) for murine RTP4.
  • Figure 30 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 17) and amino acid sequence (SEQ ID NO: 37) for human RTPl.
  • Figure 31 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 18) and amino acid sequence (SEQ ID NO: 38) for human RTP2.
  • Figure 32 shows the nucleic acid (mRNA) sequence (SEQ ED NO: 19) and amino acid sequence (SEQ ID NO: 39) for human RTP3.
  • Figure 33 shows the nucleic acid (mRNA) sequence (SEQ ID NO: 20) and amino acid sequence (SEQ ID NO: 40) for human RTP4.
  • Figure 34 shows the activation patterns of human odorant receptors in response to odiferous agent exposure.
  • Figure 35 schematically shows amino acid segments of RTPl-A, RTPl-B, RTPl-C, RTPl-D, and RTPl-E in comparison to RTPl.
  • Figure 36 shows the murine amino acid sequence for RTPl-A (SEQ ID NO: 41).
  • Figure 37 shows the murine amino acid sequence for RTPl-B (SEQ ID NO: 42).
  • Figure 38 shows the murine amino acid sequence for RTPl-C (SEQ ID NO: 43).
  • Figure 39 shows the murine amino acid sequence for RTPl-D (SEQ ID NO: 44).
  • Figure 40 shows the murine amino acid sequence for RTPl-E (SEQ ID NO: 45).
  • Figure 41 shows cell-surface expression of OLFR62 in Hana3A and 293T cells.
  • FIG. 42 schematically shows a luciferase assay used to monitor the activity of OLFR62 activity.
  • cAMP responsive element (CRE) and luciferase was used to monitor activation of OLFR62. Activation of OLFR62 increases cAMP, which enhances the expression of luciferase reporter gene through the CRE.
  • Figure 43 shows OLFR62 activity as indicated by luciferase expression in Hana3 A cells and 293T cells expressing RTPl, RTPl-A 5 RTPl-B, RTPl-C, RTPl-D, RTPl-E 5 and control pCI.
  • Figure 44 schematically shows the amino acid segments of RTPl-Al 5 RTPl-Dl 5 RTP1-D2, and RTP1-D3 in comparison to RTPl-A and RTPl-D 5 respectively.
  • Figure 45 shows the murine amino acid sequence for RTPl-Al (SEQ ID NO: 46), and the human amino acid sequence for RTPl-Al (SEQ ID NO: 47).
  • Figure 46 shows the murine amino acid sequence for RTPl-Dl (SEQ ID NO: 48).
  • Figure 47 shows the murine amino acid sequence for RTP-D2 (SEQ ID NO: 49).
  • Figure 48 shows the murine amino acid sequence for RTP-D3 (SEQ ID NO: 50).
  • Figure 49 shows cell-surface expression of OLFR62 in 293T cells. cDNAs encoding RTPl 5 RTPl-Al 5 RTPl-Dl 5 RTP1-D2, and RTP1-D3, and control pCI were transfected into 293T cells. Increased cell-surface staining was seen in 239T cells expressing RTPl-Al 5 RTPl-Dl and RTPl-D3.
  • Figure 50 shows OLFR62, OREG 5 S6, and 23-1 activity as indicated by luciferase expression in 293T cells expressing RTPl 5 RTPl-Al 5 RTPl-Dl 5 RTP1-D2, and RTP1-D3, and control pCI.
  • Figure 51 shows OLFR62, OREG, S6, and 23-1 activity as indicated by luciferase expression in Hana3A cells expressing RTPl, RTPl-Al, RTPl-Dl, RTP1-D2, and RTPl- D3, and control pCI.
  • Figure 52 shows cell-surface expression of OLFR62, OREG, MOR203-1, S6, and 23-1 in 293T cells co-transfected with either RTPl, RTPl-Al or control pCI. cDNAs encoding RTPl, RTPl-Al, and control pCI were transfected into cells.
  • Figure 53 schematically shows the amino acid segments of RTPl-Al-A (Chimera 1), RTP1-A1-D2 (Chimera 2), RTPl-Al-Dl (Chimera 3), RTP4-A1-A (Chimera 4), RTP4- A1-D2 (Chimera 5), and RTP4-A1-D1 (Chimera 6).
  • Figure 54 shows cell-surface expression of an OR in cells expressing RTPl 5 RTP4, Chimera 1, Chimera 2, Chimera 3, Chimera 4, Chimera 5, Chimera 6, and control pCI.
  • cDNAs encoding RTPl, RTP4, RTPl-Al, Chimera 1, Chimera 2, Chimera 3, Chimera 4, Chimera 5, Chimera 6, and control pCI were transfected into 293T cells.
  • Figure 55 shows OLFR62, OREG, S6, and 23-1 activity as indicated by luciferase expression in 293T cells expressing RTP 1 , RTP4, RTP 1 -Al , RTP 1 -D 1 , RTP 1 -D2, Chimera 1, Chimera 2, Chimera 3, Chimera 4, Chimera 5, Chimera 6, and control pCI.
  • Figure 56 shows detection of RTPl, RTPl-A, RTPl-B, RTPl-C, RTPl-Al, RTPl- D, Chimera 4, Chimera 5, RTP1-D3, RTPl-Dl, Chimera 6, and RTP4 using anti-RTPl.
  • REEP when used in reference to proteins or nucleic acid refers to a REEP protein or nucleic acid encoding a REEP protein of the present invention.
  • the term REEP encompasses both proteins that are identical to wild-type REEPs (e.g., REEPl, REEP2, REEP3, REEP4, REEP5, and REEP6) and those that are derived from wild-type REEP (e.g. variants of REEP polypeptides of the present invention).
  • the "REEP” is a wild type murine REEP nucleic acid (rnRNA) (e.g., SEQ ID NOs: 1-6) or a polypeptide encoded by the wild type murine REEP amino acid sequence (e.g., SEQ ID NOs:21-26).
  • the "REEP” is a wild type human REEP nucleic acid (rnRNA) (e.g., SEQ ID NOs: 7-12) or a polypeptide encoded by a wild type human REEP amino acid sequence (e.g., SEQ ID NOs: 27-32).
  • REEP proteins or nucleic acids examples include, but are not limited to, REEPl, REEP2, REEP3, REEP4, REEP5 and REEP6.
  • RTP when used in reference to proteins or nucleic acid refers to a RTP protein or nucleic acid encoding a RTP protein of the present invention.
  • the term RTP encompasses both proteins that are identical to wild-type RTPs (e.g.,RTPl, RTP2, RTP3, and RTP4) and those that are derived from wild-type RTP (e.g.
  • RTPl-A, RTPl-B, RTPl-C, RTPl-D, RTPl-E, RTPl-Al, RTPl-Dl, RTP-D2, RTP-D3, or chimeric genes constructed with portions of RTPl coding regions e.g., RTPl-Al-A (Chimera 1), RTPl- A1-D2 (Chimera 2), RTPl-Al-Dl (Chimera 3), RTP4-A1-A (Chimera 4), RTP4-A1-D2 (Chimera 5), and RTP4-A1-D1 (Chimera 6)).
  • the "RTP" is a wild type murine RTP nucleic acid (mRNA) (e.g., SEQ ID NOs: 13-16) or a polypeptide encoded by the wild type or variant murine RTP amino acid sequence (e.g., SEQ ID NOs: 33-36, 41-50).
  • the "RTP” is a wild type human RTP nucleic acid (mRNA) (e.g., SEQ ID NOs: 17-20) or a polypeptide encoded by a wild type human RTP amino acid sequence (e.g., SEQ ID NOs: 37-40).
  • RTP proteins or nucleic acids include, but are not limited to, RTPl, RTP2, RTP3, RTP4, RTPl-A, RTPl-B, RTPl- C, RTPl-D, RTPl-E, RTPl-Al, RTPl-Dl, RTP-D2, RTP-D3, RTPl-Al-A (Chimera 1), RTP1-A1-D2 (Chimera 2), RTPl-Al-Dl (Chimera 3), RTP4-A1-A (Chimera 4), RTP4-A1- D2 (Chimera 5), and RTP4-A1-D1 (Chimera 6).
  • odorant receptor refers to odorant receptors generated from olfactory sensory neurons. Examples of odorant receptors include, but are not limited to, S6/79, S18, S46, S50, MOR23-1, MOR31-4, MOR31-6, MOR32-5 and MOR32-11.
  • odorant receptor cell surface localization or equivalent terms refer to the molecular transport of an odorant receptor to a cell surface membrane. Examples of cell surface localization includes, but is not limited to, localization to cilia at the tip of a dendrite, and localization to an axon terminal.
  • odorant receptor functional expression refers to an odorant receptor's ability to interact with an odorant receptor ligand (e.g., an odiferous molecule).
  • odorant receptor ligand e.g., an odiferous molecule.
  • olfactory disorder refers to a disorder, dysfunction or disease resulting in a diminished olfactory sensation (e.g., smell aberration).
  • olfactory disorders, dysfunctions and/or diseases include, but are not limited to, head trauma, upper respiratory infections, tumors of the anterior cranial fossa, Kallmann syndrome, Foster Kennedy syndrome, Parkinson's disease, Alzheimer's disease, Huntington chorea, and exposure to toxic chemicals or infections. Diminished olfactory sensation is classified as anosmia - absence of smell sensation; hyposmia - decreased smell sensation; dysosmia - distortion of smell sensation; cacosmia - sensation of a bad or foul smell; and parosmia - sensation of smell in the absence of appropriate stimulus.
  • REEP 1 when used in reference to a protein or nucleic acid refers to a REEPl protein or nucleic acid encoding a REEPl protein of the present invention.
  • REEPl encompasses both proteins that are identical to wild-type REEPl and those that are derived from wild type REEPl (e.g., variants of REEPl polypeptides of the present invention) or chimeric genes constructed with portions of REEPl coding regions).
  • the "REEPl " is a wild type murine REEPl nucleic acid (mRNA) (SEQ ID NO: 1) or polypeptide encoded by the wild type murine amino acid sequence (SEQ ID NO: 21).
  • the "REEPl” is a wild type human REEPl nucleic acid (mRNA) (SEQ ID NO: 7) or polypeptide encoded by the wild type human REEP 1 amino acid sequence (SEQ ID NO: 27). In other embodiments, the "REEPl” is a variant or mutant nucleic acid or amino acid.
  • RTPl when used in reference to a protein or nucleic acid refers to a RTPl protein or nucleic acid encoding a RTPl protein of the present invention.
  • RTPl encompasses both proteins that are identical to wild-type RTPl and those that are derived from wild type RTPl (e.g., variants of RTPl polypeptides of the present invention including but not limited to RTP 1 -A, RTP 1 -B, RTP 1 -C, RTP 1 -D, RTP 1 -E, RTPl-Al, RTPl-Dl, RTP-D2, RTP-D3) or chimeric genes constructed with portions of RTPl coding regions (e.g., RTPl-Al-A (Chimera 1), RTP1-A1-D2 (Chimera 2), RTPl-Al- Dl (Chimera 3), RTP4-A1-A (Chimera 4), RTP4-A1-D2 (Chimera 5), and RTP4-A1-D1 (Chimera 6)).
  • RTPl-Al-A Choimera 1
  • RTP1-A1-D2 Chimera 2
  • the "RTPl” is a wild type murine RTPl nucleic acid (mRNA) (SEQ ID NO: 13) or polypeptide encoded by the wild type murine amino acid sequence (SEQ ID NO: 33). In other embodiments, the "RTPl” is a wild type human RTPl nucleic acid (mRNA) (SEQ ID NO: 17) or polypeptide encoded by the wild type human RTP 1 amino acid sequence (SEQ ID NO: 37). In other embodiments, the "RTPl” is a variant or mutant nucleic acid or amino acid.
  • RTP2 when used in reference to a protein or nucleic acid refers to a RTP2 protein or nucleic acid encoding a RTP2 protein of the present invention.
  • the term RTP2 encompasses both proteins that are identical to wild-type RTP2 and those that are derived from wild type RTP2 (e.g., variants of RTP2 polypeptides of the present invention) or chimeric genes constructed with portions of RTP2 coding regions).
  • the "RTP2" is a wild type murine RTP2 nucleic acid (mRNA) (SEQ ID NO: 14) or polypeptide encoded by the wild type murine amino acid sequence (SEQ ID NO: 34).
  • the "RTP2" is a wild type human RTP2 nucleic acid (mRNA) (SEQ ID NO: 18) or polypeptide encoded by the wild type human REEP 1 amino acid sequence (SEQ ID NO: 38). In other embodiments, the "RTP2" is a variant or mutant nucleic acid or amino acid.
  • the terms “subject” and “patient” refer to any animal, such as a mammal like a dog, cat, bird, livestock, and preferably a human. Specific examples of “subjects” and “patients” include, but are not limited to, individuals with an olfactory disorder, and individuals with olfactory disorder-related characteristics or symptoms.
  • symptoms of an olfactory disorder and “characteristics of an olfactory disorder” include, but are not limited to, a diminished olfactory sensation (e.g., smell aberration).
  • the phrase “under conditions such that the symptoms are reduced” refers to any degree of qualitative or quantitative reduction in detectable symptoms of olfactory disorders, including but not limited to, a detectable impact on the rate of recovery from disease, or the reduction of at least one symptom of an olfactory disorder.
  • siRNAs refers to short interfering RNAs. Methods for the use of siRNAs are described in U.S. Patent App. No.: 20030148519/A1 (herein incorporated by reference).
  • siRNAs comprise a duplex, or double-stranded region, of about 18-25 nucleotides long; often siRNAs contain from about two to four unpaired nucleotides at the 3' end of each strand. At least one strand of the duplex or double-stranded region of a siRNA is substantially homologous to or substantially complementary to a target RNA molecule.
  • the strand complementary to a target RNA molecule is the "antisense strand;" the strand homologous to the target RNA molecule is the "sense strand,” and is also complementary to the siRNA antisense strand.
  • siRNAs may also contain additional sequences; non-limiting examples of such sequences include linking sequences, or loops, as well as stem and other folded structures.
  • siRNAs appear to function as key intermediaries in triggering RNA interference in invertebrates and in vertebrates, and in triggering sequence-specific RNA degradation during posttranscriptional gene silencing in plants.
  • RNA interference or “RNAi” refers to the silencing or decreasing of gene expression by siRNAs. It is the process of sequence-specific, post-transcriptional gene silencing in animals and plants, initiated by siRNA that is homologous in its duplex region to the sequence of the silenced gene.
  • the gene may be endogenous or exogenous to the organism, present integrated into a chromosome or present in a transfection vector that is not integrated into the genome. The expression of the gene is either completely or partially inhibited.
  • RNAi may also be considered to inhibit the function of a target RNA; the function of the target RNA may be complete or partial.
  • the terms "instructions for using said kit for said detecting the presence or absence of a variant REEPl nucleic acid or polypeptide in said biological sample,” “instructions for using said kit for said detecting the presence or absence of a variant RTPl nucleic acid or polypeptide in said biological sample,” “instructions for using said kit for said detecting the presence or absence of a variant RTP2 nucleic acid or polypeptide in said biological sample” include instructions for using the reagents contained in the kit for the detection of variant and wild type REEP and/or RTP nucleic acids or polypeptides.
  • the term "gene” refers to a nucleic acid (e.g., DNA) sequence that comprises coding sequences necessary for the production of a polypeptide, RNA (e.g., including but not limited to, mRNA, tRNA and rRNA) or precursor (e.g., REEPl, RTPl or RTP2).
  • RNA e.g., including but not limited to, mRNA, tRNA and rRNA
  • precursor e.g., REEPl, RTPl or RTP2
  • the polypeptide, RNA, or precursor can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, etc.) of the full-length or fragment are retained.
  • the term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 5 1 and 3' ends for a distance of about 1 kb on either end such that the gene corresponds to the length of the full-length mRNA.
  • the sequences that are located 5' of the coding region and which are present on the mRNA are referred to as 5' untranslated sequences.
  • the sequences that are located 3' or downstream of the coding region and that are present on the mRNA are referred to as 3' untranslated sequences.
  • the term "gene" encompasses both cDNA and genomic forms of a gene.
  • a genomic form or clone of a gene contains the coding region interrupted with non- coding sequences termed "introns” or “intervening regions” or “intervening sequences.”
  • Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or “spliced out” from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript.
  • mRNA messenger RNA
  • REEPl gene refers to the full-length respective REEP and/or RTP nucleotide sequence ⁇ e.g., contained in SEQ ID NOs:l, 2 and 3).
  • RTPl-A, RTPl-B, RTPl-C, RTPl-D, and RTPl-E fragments of the REEP and/or RTP sequences
  • RTPl-Al-A Chimera 1
  • RTPl- Al -D2 Chimera 2
  • RTP 1 -Al -D 1 Chimera 3
  • RTP4-A1 -A Chimera 4
  • RTP4-A1 -D2 Chimera 5
  • RTP4-A1-D1 mutants of the REEP and/or RTP sequences, as well as other domains within the full-length REEP and/or RTP nucleotide sequences.
  • REEPl nucleotide sequence encompasses DNA sequences, cDNA sequences, RNA ⁇ e.g., niRNA sequences, and associated regulatory sequences.
  • amino acid sequence is recited herein to refer to an amino acid sequence of a naturally occurring protein molecule
  • amino acid sequence and like terms, such as “polypeptide” or “protein” are not meant to limit the amino acid sequence to the complete, native amino acid sequence associated with the recited protein molecule.
  • genomic forms of a gene may also include sequences located on both the 5 1 and 3' end of the sequences that are present on the RNA transcript. These sequences are referred to as “flanking" sequences or regions (these flanking sequences are located 5 ' or 3' to the non-translated sequences present on the mRNA transcript).
  • the 5' flanking region may contain regulatory sequences such as promoters and enhancers that control or influence the transcription of the gene.
  • the 3' flanking region may contain sequences that direct the termination of transcription, post-transcriptional cleavage and polyadenylation.
  • wild-type refers to a gene or gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source. A wild-type gene is that which is most frequently observed in a population and is thus arbitrarily designed the "normal” or "wild-type” form of the gene.
  • mutant refers to a gene or gene product that displays modifications in sequence and/or functional properties ⁇ i.e., altered characteristics) when compared to the wild-type gene or gene product. It is noted that naturally-occurring mutants can be isolated; these are identified by the fact that they have altered characteristics when compared to the wild-type gene or gene product.
  • nucleic acid molecule encoding refers to the order or sequence of deoxyribonucleotides along a strand of deoxyribonucleic acid.
  • DNA molecules are said to have "5 1 ends” and “3 1 ends” because mononucleotides are reacted to make oligonucleotides or polynucleotides in a manner such that the 5' phosphate of one mononucleotide pentose ring is attached to the 3' oxygen of its neighbor in one direction via a phosphodiester linkage.
  • an end of an oligonucleotides or polynucleotide referred to as the "5' end” if its 5' phosphate is not linked to the 3' oxygen of a mononucleotide pentose ring and as the "3' end” if its 3' oxygen is not linked to a 5' phosphate of a subsequent mononucleotide pentose ring.
  • a nucleic acid sequence even if internal to a larger oligonucleotide or polynucleotide, also may be said to have 5' and 3' ends.
  • an oligonucleotide having a nucleotide sequence encoding a gene and “polynucleotide having a nucleotide sequence encoding a gene,” means a nucleic acid sequence comprising the coding region of a gene or, in other words, the nucleic acid sequence that encodes a gene product.
  • the coding region may be present in a cDNA, genomic DNA, or RNA form.
  • the oligonucleotide or polynucleotide may be single-stranded ⁇ i.e., the sense strand) or double-stranded.
  • Suitable control elements such as enhancers/promoters, splice junctions, polyadenylation signals, etc. may be placed in close proximity to the coding region of the gene if needed to permit proper initiation of transcription and/or correct processing of the primary RNA transcript.
  • the coding region utilized in the expression vectors of the present invention may contain endogenous enhancers/promoters, splice junctions, intervening sequences, polyadenylation signals, etc. or a combination of both endogenous and exogenous control elements.
  • the term "regulatory element” refers to a genetic element that controls some aspect of the expression of nucleic acid sequences.
  • a promoter is a regulatory element that facilitates the initiation of transcription of an operably linked coding region.
  • Other regulatory elements include splicing signals, polyadenylation signals, termination signals, etc.
  • the terms "complementary” or “complementarity” are used in reference to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules. For example, for the sequence 5'-"A-G-T-3',” is complementary to the sequence 3'- "T-C-A-5 1 .” Complementarity may be "partial,” in which only some of the nucleic acids' bases are matched according to the base pairing rules.
  • nucleic acids there may be “complete” or “total” complementarity between the nucleic acids.
  • the degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids.
  • Complementarity can include the formation of base pairs between any type of nucleotides, including non-natural bases, modified bases, synthetic bases and the like.
  • homoology refers to a degree of complementarity. There may be partial homology or complete homology (i.e., identity).
  • a partially complementary sequence is one that at least partially inhibits a completely complementary sequence from hybridizing to a target nucleic acid and is referred to using the functional term "substantially homologous.”
  • the inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or Northern blot, solution hybridization and the like) under conditions of low stringency.
  • a substantially homologous sequence or probe will compete for and inhibit the binding (i.e., the hybridization) of a completely homologous to a target under conditions of low stringency.
  • low stringency conditions are such that non-specific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction.
  • the absence of non-specific binding may be tested by the use of a second target that lacks even a partial degree of complementarity (e.g., less than about 30% identity); in the absence of non-specific binding the probe will not hybridize to the second non-complementary target.
  • low stringency conditions factors such as the length and nature (DNA, RNA, base composition) of the probe and nature of the target (DNA, RNA, base composition, present in solution or immobilized, etc.) and the concentration of the salts and other components (e.g., the presence or absence of formamide, dextran sulfate, polyethylene glycol) are considered and the hybridization solution may be varied to generate conditions of low stringency hybridization different from, but equivalent to, the above listed conditions.
  • conditions that promote hybridization under conditions of high stringency e.g., increasing the temperature of the hybridization and/or wash steps, the use of formamide in the hybridization solution, etc.).
  • substantially homologous refers to any probe that can hybridize to either or both strands of the double-stranded nucleic acid sequence under conditions of low stringency as described above.
  • a gene may produce multiple RNA species that are generated by differential splicing of the primary RNA transcript.
  • cDNAs that are splice variants of the same gene will contain regions of sequence identity or complete homology (representing the presence of the same exon or portion of the same exon on both cDNAs) and regions of complete non- identity (for example, representing the presence of exon "A” on cDNA 1 wherein cDNA 2 contains exon "B” instead).
  • the two cDNAs contain regions of sequence identity they will both hybridize to a probe derived from the entire gene or portions of the gene containing sequences found on both cDNAs; the two splice variants are therefore substantially homologous to such a probe and to each other.
  • substantially homologous refers to any probe that can hybridize (i.e., it is the complement of) the single-stranded nucleic acid sequence under conditions of low stringency as described above.
  • the term "competes for binding” is used in reference to a first polypeptide with an activity which binds to the same substrate as does a second polypeptide with an activity, where the second polypeptide is a variant of the first polypeptide or a related or dissimilar polypeptide.
  • the efficiency e.g., kinetics or thermodynamics
  • the efficiency of binding by the first polypeptide may be the same as or greater than or less than the efficiency substrate binding by the second polypeptide.
  • the equilibrium binding constant (K D ) for binding to the substrate may be different for the two polypeptides.
  • K m refers to the Michaelis-Menton constant for an enzyme and is defined as the concentration of the specific substrate at which a given enzyme yields one- half its maximum velocity in an enzyme catalyzed reaction.
  • hybridization is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization ⁇ i.e., the strength of the association between the nucleic acids) is impacted by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, the T m of the formed hybrid, and the G: C ratio within the nucleic acids.
  • T m is used in reference to the "melting temperature.”
  • the melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands.
  • stringency is used in reference to the conditions of temperature, iom ' c strength, and the presence of other compounds such as organic solvents, under which nucleic acid hybridizations are conducted. Those skilled in the art will recognize that “stringency” conditions may be altered by varying the parameters just described either individually or in concert. With “high stringency” conditions, nucleic acid base pairing will occur only between nucleic acid fragments that have a high frequency of complementary base sequences (e.g., hybridization under "high stringency” conditions may occur between homologs with about 85-100% identity, preferably about 70-100% identity).
  • nucleic acid base pairing will occur between nucleic acids with an intermediate frequency of complementary base sequences (e.g., hybridization under "medium stringency” conditions may occur between homologs with about 50-70% identity).
  • intermediate stringency e.g., hybridization under "medium stringency” conditions may occur between homologs with about 50-70% identity.
  • conditions of "weak” or “low” stringency are often required with nucleic acids that are derived from organisms that are genetically diverse, as the frequency of complementary sequences is usually less.
  • High stringency conditions when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42°C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH 2 PO 4 H 2 O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5X Denhardt's reagent and 100 ⁇ g/ml denatured salmon sperm DNA followed by washing in a solution comprising 0.1X SSPE, 1.0% SDS at 42 0 C when a probe of about 500 nucleotides in length is employed.
  • “Medium stringency conditions” when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42 0 C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH 2 PC ⁇ H 2 O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5X Denhardt's reagent and 100 ⁇ g/ml denatured salmon sperm DNA followed by washing in a solution comprising 1.0X SSPE, 1.0% SDS at 42°C when a probe of about 500 nucleotides in length is employed.
  • Low stringency conditions comprise conditions equivalent to binding or hybridization at 42°C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH 2 PO4 H 2 O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.1% SDS, 5X Denhardt's reagent [50X Denhardt's contains per 500 ml: 5 g Ficoll (Type 400, Pharamcia), 5 g BSA (Fraction V; Sigma)] and 100 ⁇ g/ml denatured salmon sperm DNA followed by washing in a solution comprising 5X SSPE, 0.1% SDS at 42°C when a probe of about 500 nucleotides in length is employed.
  • the present invention is not limited to the hybridization of probes of about 500 nucleotides in length.
  • the present invention contemplates the use of probes between approximately 10 nucleotides up to several thousand (e.g., at least 5000) nucleotides in length.
  • stringency conditions may be altered for probes of other sizes (See e.g., Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization [1985] and Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY [1989]).
  • reference sequence is a defined sequence used as a basis for a sequence comparison; a reference sequence may be a subset of a larger sequence, for example, as a segment of a full-length cDNA sequence given in a sequence listing or may comprise a complete gene sequence. Generally, a reference sequence is at least 20 nucleotides in length, frequently at least 25 nucleotides in length, and often at least 50 nucleotides in length.
  • two polynucleotides may each (1) comprise a sequence (i.e., a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) may further comprise a sequence that is divergent between the two polynucleotides
  • sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity.
  • a “comparison window”, as used herein, refers to a conceptual segment of at least 20 contiguous nucleotide positions wherein a polynucleotide sequence may be compared to a reference sequence of at least 20 contiguous nucleotides and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • Optimal alignment of sequences for aligning a comparison window may be conducted by the local homology algorithm of Smith and Waterman [Smith and Waterman, Adv. Appl. Math.
  • sequence identity means that two polynucleotide sequences are identical (i.e., on a nucleotide-by-nucleotide basis) over the window of comparison.
  • percentage of sequence identity is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
  • substantially identical denotes a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence that has at least 85 percent sequence identity, preferably at least 90 to 95 percent sequence identity, more usually at least 99 percent sequence identity as compared to a reference sequence over a comparison window of at least 20 nucleotide positions, frequently over a window of at least 25-50 nucleotides, wherein the percentage of sequence identity is calculated by comparing the reference sequence to the polynucleotide sequence which may include deletions or additions which total 20 percent or less of the reference sequence over the window of comparison.
  • the reference sequence may be a subset of a larger sequence, for example, as a segment of the full-length sequences of the compositions claimed in the present invention (e.g., REEPl, RTPl or RTP2).
  • the term "substantial identity" means that two peptide sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default gap weights, share at least 80 percent sequence identity, preferably at least 90 percent sequence identity, more preferably at least 95 percent sequence identity or more (e.g., 99 percent sequence identity).
  • residue positions that are not identical differ by conservative amino acid substitutions.
  • Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains.
  • a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine.
  • Preferred conservative amino acids substitution groups are: valine-leucine- isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine- glutamine.
  • fragment refers to a polypeptide that has an amino- terminal and/or carboxy-terminal deletion as compared to the native protein, but where the remaining amino acid sequence is identical to the corresponding positions in the amino acid sequence deduced from a full-length cDNA sequence.
  • Fragments typically are at least 4 amino acids long, preferably at least 20 amino acids long, usually at least 50 amino acids long or longer, and span the portion of the polypeptide required for intermolecular binding of the compositions (claimed in the present invention) with its various ligands and/or substrates.
  • polymorphic locus is a locus present in a population that shows variation between members of the population (i.e., the most common allele has a frequency of less than 0.95).
  • a "monomorphic locus” is a genetic locus at little or no variations seen between members of the population (generally taken to be a locus at which the most common allele exceeds a frequency of 0.95 in the gene pool of the population).
  • the term “genetic variation information” or “genetic variant information” refers to the presence or absence of one or more variant nucleic acid sequences (e.g., polymorphism or mutations) in a given allele of a particular gene (e.g., a REEP and/or RTP gene of the present invention).
  • the term “detection assay” refers to an assay for detecting the presence or absence of variant nucleic acid sequences (e.g., polymorphisms or mutations) in a given allele of a particular gene (e.g., a REEP and/or RTP gene).
  • Naturally-occurring refers to the fact that an object can be found in nature.
  • a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally-occurring.
  • "Amplification” is a special case of nucleic acid replication involving template specificity. It is to be contrasted with non-specific template replication (i.e., replication that is template-dependent but not dependent on a specific template).
  • Template specificity is here distinguished from fidelity of replication (i.e., synthesis of the proper polynucleotide sequence) and nucleotide (ribo- or deoxyribo-) specificity. Template specificity is frequently described in terms of “target” specificity. Target sequences are “targets” in the sense that they are sought to be sorted out from other nucleic acid. Amplification techniques have been designed primarily for this sorting out.
  • the term "primer” refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, (i.e., in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature and pH).
  • the primer is preferably single stranded for maximum efficiency in amplification, but may alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products.
  • the primer is an oligodeoxyribonucleotide.
  • the primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent. The exact lengths of the primers will depend on many factors, including temperature, source of primer and the use of the method.
  • the term "probe” refers to an oligonucleotide (i.e., a sequence of nucleotides), whether occurring naturally as in a purified restriction digest or produced synthetically, recombinantly or by PCR amplification, that is capable of hybridizing to another oligonucleotide of interest.
  • a probe may be single-stranded or double-stranded.
  • Probes are useful in the detection, identification and isolation of particular gene sequences. It is contemplated that any probe used in the present invention will be labeled with any "reporter molecule,” so that is detectable in any detection system, including, but not limited to enzyme (e.g., ELISA, as well as enzyme-based histochemical assays), fluorescent, radioactive, and luminescent systems. It is not intended that the present invention be limited to any particular detection system or label.
  • the term "target” refers to a nucleic acid sequence or structure to be detected or characterized. Thus, the “target” is sought to be sorted out from other nucleic acid sequences. A “segment” is defined as a region of nucleic acid within the target sequence.
  • amplification reagents refers to those reagents (deoxyribonucleotide triphosphates, buffer, etc.), needed for amplification except for primers, nucleic acid template, and the amplification enzyme. Typically, amplification reagents along with other reaction components are placed and contained in a reaction vessel (test tube, microwell, etc.).
  • amplification reagents along with other reaction components are placed and contained in a reaction vessel (test tube, microwell, etc.).
  • the terms “restriction endonucleases” and “restriction enzymes” refer to bacterial enzymes, each of which cut double-stranded DNA at or near a specific nucleotide sequence.
  • the term "recombinant DNA molecule” as used herein refers to a DNA molecule that is comprised of segments of DNA j oined together by means of molecular biological techniques.
  • the term “antisense” is used in reference to RNA sequences that are complementary to a specific RNA sequence (e.g., mRNA). Included within this definition are antisense RNA (“asRNA”) molecules involved in gene regulation by bacteria. Antisense RNA may be produced by any method, including synthesis by splicing the gene(s) of interest in a reverse orientation to a viral promoter that permits the synthesis of a coding strand.
  • duplexes Once introduced into an embryo, this transcribed strand combines with natural mRNA produced by the embryo to form duplexes. These duplexes then block either the further transcription of the mRNA or its translation, hi this manner, mutant phenotypes may be generated.
  • antisense strand is used in reference to a nucleic acid strand that is complementary to the "sense” strand.
  • the designation (-) i.e., "negative” is sometimes used in reference to the antisense strand, with the designation (+) sometimes used in reference to the sense (i.e., "positive") strand.
  • isolated when used in relation to a nucleic acid, as in “an isolated oligonucleotide” or “isolated polynucleotide” refers to a nucleic acid sequence that is identified and separated from at least one contaminant nucleic acid with which it is ordinarily associated in its natural source. Isolated nucleic acid is present in a form or setting that is different from that in which it is found in nature. In contrast, non-isolated nucleic acids are nucleic acids such as DNA and RNA found in the state they exist in nature. For example, a given DNA sequence (e.g.
  • RNA sequences such as a specific mRNA sequence encoding a specific protein, are found in the cell as a mixture with numerous other rnRNAs that encode a multitude of proteins.
  • isolated nucleic acid encoding REEP and/or RTP includes, by way of example, such nucleic acid in cells ordinarily expressing REEP and/or RTP where the nucleic acid is in a chromosomal location different from that of natural cells, or is otherwise flanked by a different nucleic acid sequence than that found in nature.
  • the isolated nucleic acid, oligonucleotide, or polynucleotide may be present in single-stranded or double-stranded form.
  • the oligonucleotide or polynucleotide will contain at a minimum the sense or coding strand (i.e., the oligonucleotide or polynucleotide may single-stranded), but may contain both the sense and anti-sense strands (i.e., the oligonucleotide or polynucleotide may be double-stranded).
  • a "portion of a chromosome” refers to a discrete section of the chromosome. Chromosomes are divided into sites or sections by cytogeneticists as follows: the short (relative to the centromere) arm of a chromosome is termed the "p" arm; the long arm is termed the "q” arm. Each arm is then divided into 2 regions termed region 1 and region 2 (region 1 is closest to the centromere). Each region is further divided into bands. The bands may be further divided into sub-bands.
  • the 1 Ip 15.5 portion of human chromosome 11 is the portion located on chromosome 11 (11) on the short arm (p) in the first region (1) in the 5th band (5) in sub-band 5 (.5).
  • a portion of a chromosome may be "altered;" for instance the entire portion may be absent due to a deletion or may be rearranged (e.g., inversions, translocations, expanded or contracted due to changes in repeat regions).
  • hybridize i.e., specifically bind
  • a probe homologous to a particular portion of a chromosome could result in a negative result (i.e., the probe could not bind to the sample containing genetic material suspected of containing the missing portion of the chromosome).
  • hybridization of a probe homologous to a particular portion of a chromosome may be used to detect alterations in a portion of a chromosome.
  • sequences associated with a chromosome means preparations of chromosomes (e.g., spreads of metaphase chromosomes), nucleic acid extracted from a sample containing chromosomal DNA (e.g., preparations of genomic DNA); the RNA that is produced by transcription of genes located on a chromosome (e.g., hnRNA and mRNA), and cDNA copies of the RNA transcribed from the DNA located on a chromosome.
  • Sequences associated with a chromosome may be detected by numerous techniques including probing of Southern and Northern blots and in situ hybridization to RNA, DNA, or metaphase chromosomes with probes containing sequences homologous to the nucleic acids in the above listed preparations.
  • coding region when used in reference to structural gene refers to the nucleotide sequences that encode the amino acids found in the nascent polypeptide as a result of translation of a mRNA molecule.
  • the coding region is bounded, in eukaryotes, on the 5' side by the nucleotide triplet "ATG" that encodes the initiator methionine and on the 3' side by one of the three triplets, which specify stop codons (i.e., TAA, TAG, TGA).
  • ATG nucleotide triplet
  • stop codons i.e., TAA, TAG, TGA.
  • purified or “to purify” refers to the removal of contaminants from a sample.
  • REEP and/or RTP antibodies are purified by removal of contaminating non-immunoglobulin proteins; they are also purified by the removal of immunoglobulin that does not bind a REEP and/or RTP polypeptide.
  • recombinant REEP and/or RTP polypeptides are expressed in bacterial host cells and the polypeptides are purified by the removal of host cell proteins; the percent of recombinant REEP and/or RTP polypeptides is thereby increased in the sample.
  • the term "recombinant DNA molecule" as used herein refers to a DNA molecule that is comprised of segments of DNA joined together by means of molecular biological techniques.
  • recombinant protein or “recombinant polypeptide” as used herein refers to a protein molecule that is expressed from a recombinant DNA molecule.
  • native protein as used herein, is used to indicate a protein that does not contain amino acid residues encoded by vector sequences; that is the native protein contains only those amino acids found in the protein as it occurs in nature.
  • a native protein may be produced by recombinant means or may be isolated from a naturally occurring source.
  • portion when in reference to a protein (as in "a portion of a given protein") refers to fragments of that protein. The fragments may range in size from four consecutive amino acid residues to the entire amino acid sequence minus one amino acid.
  • Southern blot refers to the analysis of DNA on agarose or acrylamide gels to fractionate the DNA according to size followed by transfer of the DNA from the gel to a solid support, such as nitrocellulose or a nylon membrane.
  • the immobilized DNA is then probed with a labeled probe to detect DNA species complementary to the probe used.
  • the DNA may be cleaved with restriction enzymes prior to electrophoresis. Following electrophoresis, the DNA may be partially depurinated and denatured prior to or during transfer to the solid support.
  • Southern blots are a standard tool of molecular biologists (J.
  • Northern blot refers to the analysis of RNA by electrophoresis of RNA on agarose gels to fractionate the RNA according to size followed by transfer of the RNA from the gel to a solid support, such as nitrocellulose or a nylon membrane. The immobilized RNA is then probed with a labeled probe to detect RNA species complementary to the probe used.
  • Northern blots are a standard tool of molecular biologists (J. Sambrook, et al, supra, pp 7.39-7.52 [1989]).
  • the term “Western blot” refers to the analysis of protein(s) (or polypeptides) immobilized onto a support such as nitrocellulose or a membrane.
  • the proteins are run on acrylamide gels to separate the proteins, followed by transfer of the protein from the gel to a solid support, such as nitrocellulose or a nylon membrane.
  • the immobilized proteins are then exposed to antibodies with reactivity against an antigen of interest.
  • the binding of the antibodies may be detected by various methods, including the use of radiolabeled antibodies.
  • antigenic determinant refers to that portion of an antigen that makes contact with a particular antibody ⁇ i.e., an epitope).
  • antigenic determinants When a protein or fragment of a protein is used to immunize a host animal, numerous regions of the protein may induce the production of antibodies that bind specifically to a given region or three-dimensional structure on the protein; these regions or structures are referred to as antigenic determinants.
  • An antigenic determinant may compete with the intact antigen (i.e., the "immunogen” used to elicit the immune response) for binding to an antibody.
  • the term "transgene” as used herein refers to a foreign, heterologous, or autologous gene that is placed into an organism by introducing the gene into newly fertilized eggs or early embryos.
  • foreign gene refers to any nucleic acid (e.g., gene sequence) that is introduced into the genome of an animal by experimental manipulations and may include gene sequences found in that animal so long as the introduced gene does not reside in the same location as does the naturally-occurring gene.
  • autologous gene is intended to encompass variants (e.g., polymorphisms or mutants) of the naturally occurring gene.
  • transgene thus encompasses the replacement of the naturally occurring gene with a variant form of the gene.
  • vector is used in reference to nucleic acid molecules that transfer DNA segment(s) from one cell to another.
  • vector refers to a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence in a particular host organism. Nucleic acid sequences necessary for expression in prokaryotes usually include a promoter, an operator (optional), and a ribosome binding site, often along with other sequences. Eukaryotic cells are known to utilize promoters, enhancers, and termination and polyadenylation signals.
  • host cell refers to any eukaryotic or prokaryotic cell (e.g., bacterial cells such as E.
  • coli coli, yeast cells, mammalian cells, avian cells, amphibian cells, plant cells, fish cells, and insect cells), whether located in vitro or in vivo.
  • host cells may be located in a transgenic animal.
  • overexpression and “overexpressing” and grammatical equivalents are used in reference to levels of mRNA to indicate a level of expression approximately 3-fold higher than that typically observed in a given tissue in a control or non-transgenic animal. Levels of mRNA are measured using any of a number of techniques known to those skilled in the art including, but not limited to Northern blot analysis (See, Example 10, for a protocol for performing Northern blot analysis).
  • transfection refers to the introduction of foreign DNA into eukaryotic cells. Transfection may be accomplished by a variety of means known to the art including calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipofection, protoplast fusion, retroviral infection, and biolistics.
  • stable transfection or “stably transfected” refers to the introduction and integration of foreign DNA into the genome of the transfected cell.
  • stable transfectant refers to a cell that has stably integrated foreign DNA into the genomic DNA.
  • transient transfection or “transiently transfected” refers to the introduction of foreign DNA into a cell where the foreign DNA fails to integrate into the genome of the transfected cell.
  • the foreign DNA persists in the nucleus of the transfected cell for several days. During this time the foreign DNA is subject to the regulatory controls that govern the expression of endogenous genes in the chromosomes.
  • transient transfectant refers to cells that have taken up foreign DNA but have failed to integrate this DNA.
  • calcium phosphate co-precipitation refers to a technique for the introduction of nucleic acids into a cell.
  • composition comprising a given polynucleotide sequence refers broadly to any composition containing the given polynucleotide sequence.
  • the composition may comprise an aqueous solution.
  • compositions comprising polynucleotide sequences encoding REEPIs, RTPIs or RTP2s (e.g., SEQ ID NOs: 1, 2 and 3) or fragments thereof may be employed as hybridization probes.
  • REEP and/or RTP encoding polynucleotide sequences are typically employed in an aqueous solution containing salts (e.g., NaCl), detergents (e.g., SDS), and other components (e.g., Denhardt's solution, dry milk, salmon sperm DNA, etc.).
  • test compound refers to any chemical entity, pharmaceutical, drug, and the like that can be used to treat or prevent a disease, illness, sickness, or disorder of bodily function, or otherwise alter the physiological or cellular status of a sample.
  • Test compounds comprise both known and potential therapeutic compounds.
  • a test compound can be determined to be therapeutic by screening using the screening methods of the present invention.
  • a "known therapeutic compound” refers to a therapeutic compound that has been shown (e.g., through animal trials or prior experience with administration to humans) to be effective in such treatment or prevention.
  • sample as used herein is used in its broadest sense.
  • a sample suspected of containing a human chromosome or sequences associated with a human chromosome may comprise a cell, chromosomes isolated from a cell (e.g., a spread of metaphase chromosomes), genomic DNA (in solution or bound to a solid support such as for Southern blot analysis), RNA (in solution or bound to a solid support such as for Northern blot analysis), cDNA (in solution or bound to a solid support) and the like.
  • a sample suspected of containing a protein may comprise a cell, a portion of a tissue, an extract containing one or more proteins and the like.
  • reporter gene refers to a gene encoding a protein that may be assayed. Examples of reporter genes include, but are not limited to, luciferase (See, e.g., deWet et al, MoI. Cell. Biol. 7:725 [1987] and U.S.
  • nucleic acids and proteins of the present invention permit the selective and controllable presentation of ORs on test cells to, among other things, identify new ORs, characterize ORs, identify OR ligands, correlate olfactory responses to the molecular interactions underlying such response, identify and characterize groups of ORs and ligands responsible for olfactory responses and health conditions, and identify, select, and characterize regulators of OR response to study and control olfactory responses.
  • the present invention also, thus provides means for manipulating olfactory responses and the molecular basis for such response in vitro and in vivo.
  • Numerous commercial applications are thus made possible, including the production, characterization, and use of in vitro or in vivo cell arrays expressing desired localized ORs for screening (e.g., high-throughput screening) compounds or use as synthetic olfactory systems.
  • Any industry including food industries, health industries, cosmetic industries, militaries, sanitary agencies, animal sniffers (e.g., for drugs, explosives, accident victims, etc.), among many others will find use of the compositions and methods of the present invention.
  • Inhibitors e.g., antibodies, small molecules, aptamers, etc.
  • the present invention provides a systematic way to identify which receptors and ligands are responsible for particular olfactory sensations (e.g., perceived scents).
  • olfactory sensations e.g., perceived scents.
  • by blocking particular interactions e.g., via a nasal spray having the inhibitors
  • enhancing particular interactions e.g., via a nasal spray that provides certain ligands or a coating on the surface of an object that emits certain ligands
  • undesired scents can be blocked, covered, or altered (e.g., a sniffer dog can be treated so as to only smell a target of interested and no other distracting smells, a sanitary worked can be made immune to the scent of waste, etc.) and desired scents can be enhanced.
  • the present invention also provides novel gene and protein sequences and methods of their use. A detailed description of certain preferred embodiments and uses of the present invention is described below. The present invention is not limited to these particular illustrative embodiments.
  • the present invention relates to peptides capable of promoting odorant receptor cell- surface localization and odorant receptor functional expression.
  • the present invention further provides assays for the detection of therapeutic agents, and for the detection of odorant receptor accessory protein polymorphisms and mutations associated with disease states. Exemplary embodiments of the present invention are described below. Exemplary compositions and methods of the present invention are described in more detail in the following sections: I. Olfactory Sensation; II. REEP and RTP Polynucleotides; III. REEP and RTP Polypeptides; IV. Detection of REEP and RTP Alleles; V. Generation of REEP and RTP Antibodies; VI.
  • RNA Interference RNAi
  • XL RNAi RNAi for REEP and RTP
  • XII Identification of Odorant Receptor Ligands.
  • the practice of the present invention employs, unless otherwise indicated, conventional techniques of organic chemistry, pharmacology, molecular biology (including recombinant techniques), cell biology, biochemistry, and immunology, which are within the skill of the art.
  • the olfactory system represents one of the oldest sensory modalities in the phylogenetic history of mammals. Olfaction is less developed in humans than in other mammals such as rodents. As a chemical sensor, the olfactory system detects food and influences social and sexual behavior. The specialized olfactory epithelial cells characterize the only group of neurons capable of regeneration. Activation occurs when odiferous molecules come in contact with specialized processes known as the olfactory vesicles. Within the nasal cavity, the turbinates or nasal conchae serve to direct the inspired air toward the olfactory epithelium in the upper posterior region.
  • This area (only a few centimeters wide) contains more than 100 million olfactory receptor cells. These specialized epithelial cells give rise to the olfactory vesicles containing kinocilia, which serve as sites of stimulus transduction.
  • olfactory receptor cells There are three specialized neural systems are present within the nasal cavities in humans: 1) the main olfactory system (cranial nerve I), 2) trigeminal somatosensory system (cranial nerve V), 3) the nervus terminalis (cranial nerve 0).
  • CN I mediates odor sensation. It is responsible for determining flavors.
  • CN V mediates somatosensory sensations, including burning, cooling, irritation, and tickling.
  • CN 0 is a ganglionated neural plexus.
  • the olfactory neuroepithelium is a pseudostratified columnar epithelium.
  • the specialized olfactory epithelial cells are the only group of neurons capable of regeneration.
  • the olfactory epithelium is situated in the superior aspect of each nostril, including cribriform plate, superior turbinate, superior septum, and sections of the middle turbinate. It harbors sensory receptors of the main olfactory system and some CN V free nerve endings.
  • the olfactory epithelium loses its general homogeneity postnatally, and as early as the first few weeks of life metaplastic islands of respiratory-like epithelium appear. The metaplasia increases in extent throughout life. It is presumed that this process is the result of insults from the environment, such as viruses, bacteria, and toxins.
  • olfactory fila The unmyelinated axons coalesce into 40 bundles, termed olfactory fila, which are ensheathed by Schwann-like cells. The fila transverses the cribriform plate to enter the anterior cranial fossa and constitute CN I.
  • Microvillar cells are near the surface of the neuroepithelium, but the exact functions of these cells are unknown. Supporting cells are also at the surface of the epithelium. They join tightly with neurons and microvillar cells.
  • the basal cells are located near the basement membrane, and are the progenitor cells from which the other cell types arise.
  • the Bowman's glands are a major source of mucus within the region of the olfactory epithelium.
  • the odorant receptors are located on the cilia of the receptor cells. Each receptor cell expresses a single odorant receptor gene. There are approximately 1,000 classes of receptors at present.
  • the olfactory receptors are linked to the stimulatory guanine nucleotide binding protein Golf.
  • each receptor cell When stimulated, it can activate adenylate cyclase to produce the second messenger cAMP, and subsequent events lead to depolarization of the cell membrane and signal propagation.
  • each receptor cell only expresses one type of receptor, each cell is electrophysiologically responsive to a wide but circumscribed range of stimuli. This implies that a single receptor accepts a range of molecular entities.
  • the olfactory bulb is located on top of the cribriform plate at the base of the frontal lobe in the anterior cranial fossa. It receives thousands of primary axons from olfactory receptor neurons.
  • olfactory cortex includes the frontal and temporal lobes, thalamus, and hypothalamus.
  • mammalian ORs were identified over 10 years ago, little is known about the selectivity of the different ORs for chemical stimuli, mainly because it has been difficult to express ORs on the cell surface of heterologous cells and assay their ligand-binding specificity (see, e.g., Mombaerts, P. (2004) Nat Rev Neurosci 5, 263-278; herein incorporated by reference in its entirety).
  • rhodopsin e.g., Rho-tag
  • a foreign signal peptide to the N-terminus facilitates surface expression of some ORs in heterologous cells (see, e.g., Hatt, H., et al., (1999) Cell MoI Biol 45, 285-291; Krautwurst, D., et al., (1998) Cell 95, 917-926; each herein incorporated in their entirety).
  • modifications do not reliably promote cell-surface expression.
  • ODR-4 which is required for proper localization of chemosensory receptors in C.elegans, has a small effect on facilitating cell-surface expression of one rat OR, but not another OR (see, e.g., Gimelbrant, A. A., et al., (2001) J Biol Chem 276, 7285-7290; herein incorporated by reference).
  • Gimelbrant A. A., et al., (2001) J Biol Chem 276, 7285-7290; herein incorporated by reference.
  • accessory proteins are required for correct targeting to the cell surface membrane (see, e.g., Brady, A. E., and Limbird, L. E. (2002) Cell Signal 14, 297- 309; herein incorporated by reference in its entirety).
  • These proteins include NinaA for Drosophila Rhodopsin (see, e.g., Baker, E. K., et al., (1994) Embo J 13, 4886-4895; Shieh, B.
  • the present invention provides novel proteins ⁇ e.g., REEPl, RTPl, RTP2, RTPl-A, RTPl-B, RTPl-C, RTPl-D, RTPl-E, RTPl-Al, RTPl-Dl, RTP-D2, RTP-D3, RTPl-Al-A (Chimera 1), RTP1-A1-D2 (Chimera 2), RTPl-Al-Dl (Chimera 3), RTP4-A1-A (Chimera 4), RTP4-A1 -D2 (Chimera 5), and RTP4-A1 -D 1 (Chimera 6)) promoting OR cell surface localization and OR functional expression, and numerous compositions and methods related to these findings.
  • novel proteins ⁇ e.g., REEPl, RTPl, RTP2, RTPl-A, RTPl-B, RTPl-C, RTPl-D, RTPl-E, RTPl-Al, RTP
  • the present invention provides novel proteins promoting odorant receptor cell surface localization and odorant receptor functional expression.
  • the present invention provides REEP genes and polypeptides ⁇ e.g., REEPl, REEP2, REEP3, REEP4, REEP5, and REEP6) and RTP genes and polypeptides ⁇ e.g., RTPl, RTP2, RTP3, RTP4, RTPl-A, RTPl-B, RTPl-C, RTPl-D, RTPl-E, RTPl-Al, RTPl-Dl, RTP-D2, RTP-D3, RTPl-Al-A (Chimera 1), RTP1-A1-D2 (Chimera 2), RTPl- Al-Dl (Chimera 3), RTP4-A1-A (Chimera 4), RTP4-A1-D2 (Chimera 5), and RTP4-A1- Dl (Chimera 6)
  • REEPl, RTPl, RTP2, and variants of RTPl e.g., RTPl-A, RTPl-B, RTPl-C, RTPl-D, and RTPl-E, RTPl-Al, RTPl-Dl, RTP-D2, RTP-D3, RTPl-Al-A (Chimera 1), RTP1-A1-D2 (Chimera 2), RTPl-Al-Dl (Chimera 3), RTP4-A1-A (Chimera 4), RTP4-A1-D2 (Chimera 5), and RTP4-A1-D1 (Chimera 6) promote odorant receptor cell surface localization and odorant receptor functional expression.
  • RTPl-A, RTPl-B, RTPl-C, RTPl-D, and RTPl-E RTPl-Al, RTPl-Dl, RTP-D2, RTP-D3, RTPl-Al-A (Chimera 1)
  • the present invention provides nucleic acids encoding REEP genes, homologs, variants ⁇ e.g., polymorphisms and mutants), including but not limited to, those described in SEQ ID NOs:l-12.
  • the present invention provides nucleic acids encoding RTP genes, homologs, variants ⁇ e.g., polymorphisms and mutants), including but not limited to, those described in SEQ ID NOs: 13-20.
  • Table 1 describes exemplary REEP and RTP genes of the present invention.
  • the present invention provides polynucleotide sequences that are capable of hybridizing to SEQ ID NOs: 1-20 under conditions of low to high stringency as long as the polynucleotide sequence capable of hybridizing encodes a protein that retains a biological activity of the naturally occurring REEP and/or RTP protein.
  • the protein that retains a biological activity of a naturally occurring REEP and/or RTP is 70% homologous to the wild-type REEP and/or RTP, preferably 80% homologous to the wild-type REEP and/or RTP, more preferably 90% homologous to the wild-type REEP and/or RTP, and most preferably 95% homologous to wild-type the REEP and/or RTP.
  • hybridization conditions are based on the melting temperature (T m ) of the nucleic acid binding complex and confer a defined "stringency” as explained above (see e.g., Wahl, et al., Meth. Enzymol., 152:399-407 (1987), incorporated herein by reference).
  • T m melting temperature
  • additional alleles of REEP and/or RTP genes are provided.
  • alleles result from a polymorphism or mutation (i.e., a change in the nucleic acid sequence) and generally produce altered mRNAs or polypeptides whose structure or function may or may not be altered. Any given gene may have none, one or many allelic forms.
  • nucleotide sequences of the present invention may be engineered in order to alter a REEP and/or RTP coding sequence for a variety of reasons, including but not limited to, alterations which modify the cloning, processing and/or expression of the gene product.
  • RTPl include but are not limited to RTPl-A, RTPl-B, RTPl-C 5 RTPl-D, and RTPl-E, RTPl-Al, RTPl-Dl, RTP-D2, RTP-D3, RTPl-Al-A (Chimera 1), RTP1-A1-D2 (Chimera 2), RTPl-Al-Dl (Chimera 3), RTP4-A1-A (Chimera 4), RTP4-A1-D2 (Chimera 5), and RTP4-A1-D1 (Chimera 6).
  • the polynucleotide sequence of REEP and/or RTP may be extended utilizing the nucleotide sequence in various methods known in the art to detect upstream sequences such as promoters and regulatory elements.
  • PCR restriction-site polymerase chain reaction
  • This is a direct method that uses universal primers to retrieve unknown sequence adjacent to a known locus (Gobinda et al, PCR Methods Applic, 2:318-22 (1993); herein incorporated by reference in its entirety).
  • genomic DNA is amplified in the presence of a primer to a linker sequence and a primer specific to the known region.
  • amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one.
  • Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
  • inverse PCR can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al , Nucleic Acids Res., 16:8186 [1988]).
  • the primers may be designed using Oligo 4.0 (National Biosciences Inc, Plymouth Minn.), or another appropriate program, to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68-72°C.
  • the method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.
  • walking PCR is utilized. Walking PCR is a method for targeted gene walking that permits retrieval of unknown sequence (Parker et al, Nucleic Acids Res., 19:3055-60 [1991]).
  • the PROMOTERFINDER kit (Clontech) uses PCR, nested primers and special libraries to "walk in" genomic DNA. This process avoids the need to screen libraries and is useful in finding intron/exon junctions.
  • Preferred libraries for screening for full length cDNAs include mammalian libraries that have been size-selected to include larger cDNAs.
  • random primed libraries are preferred, in that they will contain more sequences that contain the 5' and upstream gene regions.
  • a randomly primed library may be particularly useful in case where an oligo d(T) library does not yield full-length cDNA.
  • Genomic mammalian libraries are useful for obtaining introns and extending 5' sequence.
  • variants of the disclosed REEP and/or RTP sequences are provided, hi preferred embodiments, variants result from polymorphisms or mutations (i.e., a change in the nucleic acid sequence) and generally produce altered mRNAs or polypeptides whose structure or function may or may not be altered. Any given gene may have none, one, or many variant forms. Common mutational changes that give rise to variants are generally ascribed to deletions, additions or substitutions of nucleic acids. Each of these types of changes may occur alone, or in combination with the others, and at the rate of one or more times in a given sequence.
  • modified peptides are considered functional equivalents of peptides having an activity of a REEP and/or RTP peptide as defined herein.
  • a modified peptide can be produced in which the nucleotide sequence encoding the polypeptide has been altered, such as by substitution, deletion, or addition, hi particularly preferred embodiments, these modifications do not significantly reduce the biological activity of the modified REEP and/or RTP genes, hi other words, construct "X" can be evaluated in order to determine whether it is a member of the genus of modified or variant REEP and/or RTP of the present invention as defined functionally, rather than structurally, hi preferred embodiments, the activity of variant REEP and/or RTP polypeptides is evaluated by methods described herein (e.g., the generation of transgenic animals or the use of signaling assays).
  • variant forms of REEP and/or RTP genes are also contemplated as being equivalent to those peptides and DNA molecules that are set forth in more detail herein.
  • isolated replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar replacement of an amino acid with a structurally related amino acid i.e., conservative mutations
  • conservative mutations will not have a major effect on the biological activity of the resulting molecule.
  • some embodiments of the present invention provide variants of REEP and/or RTP containing conservative replacements. Conservative replacements are those that take place within a family of amino acids that are related in their side chains.
  • Genetically encoded amino acids can be divided into four families: (1) acidic (aspartate, glutamate); (2) basic (lysine, arginine, histidine); (3) nonpolar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan); and (4) uncharged polar (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine).
  • Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids, hi similar fashion, the amino acid repertoire can be grouped as (1) acidic (aspartate, glutamate); (2) basic (lysine, arginine, histidine), (3) aliphatic (glycine, alanine, valine, leucine, isoleucine, serine, threonine), with serine and threonine optionally be grouped separately as aliphatic-hydroxyl; (4) aromatic (phenylalanine, tyrosine, tryptophan); (5) amide (asparagine, glutamine); and (6) sulfur -containing (cysteine and methionine) (e.g., Stryer ed., Biochemistry, pg.
  • Whether a change in the amino acid sequence of a peptide results in a functional polypeptide can be readily determined by assessing the ability of the variant peptide to function in a fashion similar to the wild-type protein. Peptides having more than one replacement can readily be tested in the same manner. More rarely, a variant includes "nonconservative" changes (e.g., replacement of a glycine with a tryptophan). Analogous minor variations can also include amino acid deletions or insertions, or both.
  • nucleotide sequences of the present invention may be engineered in order to alter a REEP and/or RTP coding sequence including, but not limited to, alterations that modify the cloning, processing, localization, secretion, and/or expression of the gene product.
  • mutations may be introduced using techniques that are well known in the art (e.g.
  • RTPl include but are not limited to RTPl-A, RTPl-B, RTPl-C, RTPl- D, and RTPl-E, RTPl-Al, RTPl-Dl, RTP-D2, RTP-D3, RTPl-Al-A (Chimera 1), RTPl- A1-D2 (Chimera 2), RTPl-Al-Dl (Chimera 3), RTP4-A1-A (Chimera 4), RTP4-A1-D2 (Chimera 5), and RTP4-A1-D1 (Chimera 6).
  • the present invention provides REEP and/or RTP polynucleotide sequences that encode REEP and/or RTP polypeptide sequences (e.g., the polypeptides of SEQ ID NOs: 21-40, 41-50 respectively).
  • the present invention provides a polypeptide encoded by a nucleic acid selected from the group consisting of SEQ ID NOs: 1, 7, 13, 14, 17 and 18 and variants thereof that are at least 80% identical to SEQ ID NOs: 1, 7, 13, 14, 17 and 18.
  • the protein is at least 90% identical to SEQ ID NOs: 1, 7, 13, 14, 17 and 18.
  • the protein is at least 95% identical to SEQ ID NOs: 1, 7, 13, 14, 17 and 18.
  • RTPl-A, RTPl-B, RTPl-C, RTPl-D, and RTPl-E fragments, fusion proteins or functional equivalents of REEP and/or RTP proteins
  • the present invention provides mutants of REEP and/or RTP polypeptides, hi still other embodiments of the present invention, nucleic acid sequences corresponding to REEP and/or RTP variants, homologs, and mutants may be used to generate recombinant DNA molecules that direct the expression of the REEP and/or RTP variants, homologs, and mutants in appropriate host cells.
  • the polypeptide may be a naturally purified product, in other embodiments it may be a product of chemical synthetic procedures, and in still other embodiments it may be produced by recombinant techniques using a prokaryotic or eukaryotic host (e.g., by bacterial, yeast, higher plant, insect and mammalian cells in culture).
  • a prokaryotic or eukaryotic host e.g., by bacterial, yeast, higher plant, insect and mammalian cells in culture.
  • the polypeptide of the present invention may be glycosylated or may be non-glycosylated.
  • the polypeptides of the invention may also include an initial methionine amino acid residue.
  • DNA sequences other than the polynucleotide sequences of SEQ ID NOs: 21- 50 that encode substantially the same or a functionally equivalent amino acid sequence may be used to clone and express REEP and/or RTP proteins, hi general, such polynucleotide sequences hybridize to one of SEQ ID NOs: 21-50 under conditions of high to medium stringency as described above.
  • REEP and/or RTP-encoding nucleotide sequences possessing non-naturally occurring codons may be advantageous to produce REEP and/or RTP-encoding nucleotide sequences possessing non-naturally occurring codons.
  • codons preferred by a particular prokaryotic or eukaryotic host are selected, for example, to increase the rate of REEP and/or RTP expression or to produce recombinant RNA transcripts having desirable properties, such as a longer half-life, than transcripts produced from naturally occurring sequence.
  • REEPl, RTPl and RTP2 polypeptides promote odorant receptor cell surface localization and odorant receptor functional expression.
  • the polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques.
  • the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide.
  • vectors include, but are not limited to, chromosomal, nonchromosomal and synthetic DNA sequences (e.g., derivatives of SV40, bacterial plasmids, phage DNA; baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, and viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies). It is contemplated that any vector may be used as long as it is replicable and viable in the host. hi particular, some embodiments of the present invention provide recombinant constructs comprising one or more of the sequences as broadly described above (e.g., SEQ E) NOs: 1-20).
  • the constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
  • the heterologous structural sequence e.g., SEQ TD NOs: 1-20 is assembled in appropriate phase with translation initiation and termination sequences.
  • the appropriate DNA sequence is inserted into the vector using any of a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Large numbers of suitable vectors are known to those of skill in the art, and are commercially available.
  • Such vectors include, but are not limited to, the following vectors: 1) Bacterial ⁇ pQE70, pQE60, pQE-9 (Qiagen), pBS, pDIO, phagescript, psiX174, pbluescript SK, pBSKS, pNH8A, pNHl ⁇ a, ⁇ NH18A, ⁇ NH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia); 2) Eukaryotic - pWLNEO, pSV2CAT, pOG44, PXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia); and 3) Baculovirus - pPbac and pMbac (Stratagene).
  • mammalian expression vectors comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non-transcribed sequences.
  • DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required non-transcribed genetic elements.
  • the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis.
  • Promoters useful in the present invention include, but are not limited to, the LTR or SV40 promoter, the E. coli lac or trp, the phage lambda PL and PR, T3 and T7 promoters, and the cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, and mouse metallothionem-I promoters and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • CMV cytomegalovirus
  • HSV herpes simplex virus
  • thymidine kinase thymidine kinase
  • recombinant expression vectors include origins of replication and selectable markers permitting transformation of the host cell (e.g., dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or tetracycline or ampicillin resistance in E. coli).
  • transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are ezs-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription.
  • Enhancers useful in the present invention include, but are not limited to, the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expression.
  • the present invention provides host cells containing the above-described constructs.
  • the host cell is a higher eukaryotic cell (e.g., a mammalian or insect cell).
  • the host cell is a lower eukaryotic cell (e.g., a yeast cell).
  • the host cell can be a prokaryotic cell (e.g., a bacterial cell).
  • host cells include, but are not limited to, Escherichia coli, Salmonella typhimurium, Bacillus subtilis, and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, as well as Saccharomycees cerivisiae, Schizosaccharomycees pombe, Drosophila S2 cells, Spodoptera Sf9 cells, Chinese hamster ovary (CHO) cells, COS-7 lines of monkey kidney fibroblasts, (Gluzman, Cell 23:175 [1981]), C127, 3T3, 293, 293T, HeLa and BHK cell lines.
  • Escherichia coli Salmonella typhimurium
  • Bacillus subtilis and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus
  • Saccharomycees cerivisiae Schizosaccharomycees pombe
  • the constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
  • introduction of the construct into the host cell can be accomplished by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation (See e.g., Davis et al., Basic Methods in Molecular Biology, [1986]).
  • the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers. Proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
  • the selected promoter is induced by appropriate means ⁇ e.g., temperature shift or chemical induction) and cells are cultured for an additional period
  • cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification
  • microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents.
  • the present invention provides a cell line ⁇ e.g., heterologous 293T cell line) comprising expression of an odorant receptor ⁇ e.g., human odorant receptor, murine odorant receptor, synthetic odorant receptor) localized to the cell surface, REEPl, RTPl, RTP2, and G ⁇ o i f - hi some embodiements, the odorant receptor is tagged with a reporting agent ⁇ e.g., glutathione-S-transferase (GST) 5 c-myc, 6-histidine (6X- His), green fluorescent protein (GFP), maltose binding protein (MBP), influenza A virus haemagglutinin (HA), b-galactosidase, and GAL4).
  • GST glutathione-S-transferase
  • GST glutathione-S-transferase
  • GST glutathione-S-transferase
  • GST glutathione-S-transfera
  • the cell line described in this embodiment is not limited to particular odorant receptors
  • the odorant receptors expressed in the cell line include, but are not limited to, S6/79, S 18, S46, S50, MOR23-1, MOR31-4, MOR31-6, MOR32-5 and MOR32-ll.
  • cell lines expressing odorant receptors are used in the classification of an odorant receptor's functional expression ⁇ e.g., ligand specificity), hi even further embodiments, cell lines expressing odorant receptors are used in the classification of an animal's olfactory sensation.
  • the present invention also provides methods for recovering and purifying REEP and/or RTP polypeptides from recombinant cell cultures including, but not limited to, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography.
  • protein-refolding steps can be used as necessary, in completing configuration of the mature protein.
  • HPLC high performance liquid chromatography
  • the present invention further provides polynucleotides having a coding sequence of a REEP and/or RTP gene (e.g., SEQ ID NOs: 1-20) fused in frame to a marker sequence that allows for purification of the polypeptide of the present invention.
  • a marker sequence is a hexahistidine tag which may be supplied by a vector, preferably a pQE-9 vector, which provides for purification of the polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host (e.g., COS-7 cells) is used.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al., Cell, 37:767 [1984]).
  • the present invention provides fragments of REEP and/or RTP polypeptides (i.e., truncation mutants).
  • a start codon ATG
  • MAP methionine aminopeptidase
  • the present invention also provides fusion proteins incorporating all or part of the REEP and/or RTP polypeptides of the present invention. Accordingly, in some embodiments of the present invention, the coding sequences for the polypeptide can be incorporated as a part of a fusion gene including a nucleotide sequence encoding a different polypeptide. It is contemplated that this type of expression system will find use under conditions where it is desirable to produce an immunogenic fragment of a REEP and/or RTP protein.
  • the VP6 capsid protein of rotavirus is used as an immunologic carrier protein for portions of a REEP and/or RTP polypeptide, either in the monomeric form or in the form of a viral particle.
  • the nucleic acid sequences corresponding to the portion of a REEP and/or RTP polypeptide against which antibodies are to be raised can be incorporated into a fusion gene construct which includes coding sequences for a late vaccinia virus structural protein to produce a set of recombinant viruses expressing fusion proteins comprising a portion of REEP and/or RTP as part of the virion.
  • chimeric constructs coding for fusion proteins containing a portion of a REEP and/or RTP polypeptide and the poliovirus capsid protein are created to enhance immunogenicity of the set of polypeptide antigens (See e.g., EP Publication No. 025949; and Evans et al, Nature 339:385 [1989]; Huang et al, J. Virol., 62:3855 [1988]; and Schlienger et al, J.
  • the multiple antigen peptide system for peptide-based immunization can be utilized, m this system, a desired portion of REEP and/or RTP is obtained directly from organo-chemical synthesis of the peptide onto an oligomeric branching lysine core (see e.g., Posnett et al, J. Biol. Chem., 263:1719 [1988]; and Nardelli et al, J. Immunol., 148:914 [1992]).
  • antigenic determinants of the REEP and/or RTP proteins can also be expressed and presented by bacterial cells.
  • REEP and/or RTP polypeptides can be generated as glutathione-S -transferase (i.e., GST fusion proteins). It is contemplated that such GST fusion proteins will enable easy purification of REEP and/or RTP polypeptides, such as by the use of glutathione-derivatized matrices (See e.g., Ausabel et al (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY [1991]).
  • a fusion gene coding for a purification leader sequence such as a poly-(His)/enterokinase cleavage site sequence at the N-terminus of the desired portion of a REEP and/or RTP polypeptide
  • a purification leader sequence can allow purification of the expressed REEP and/or RTP fusion protein by affinity chromatography using a Ni ⁇ + metal resin
  • the purification leader sequence can then be subsequently removed by treatment with enterokinase ⁇ See e.g., Hochuli et al, J. Chromatogr., 411:177 [1987]; and Janknecht et al, Proc. Natl. Acad. Sci.
  • fusion genes are well known. Essentially, the joining of various DNA fragments coding for different polypeptide sequences is performed in accordance with conventional techniques, employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation.
  • the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
  • PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed to generate a chimeric gene sequence ⁇ See e.g., Current Protocols in Molecular Biology, supra).
  • variant forms of REEP and/or RTP polypeptides ⁇ i.e., muteins). It is possible to modify the structure of a peptide having an activity of a REEP and/or RTP polypeptide of the present invention for such purposes as enhancing therapeutic or prophylactic efficacy, disabling the protein, or stability ⁇ e.g., ex vivo shelf life, and/or resistance to proteolytic degradation in vivo). Such modified peptides are considered functional equivalents of peptides having an activity of the subject REEP and/or RTP proteins as defined herein.
  • RTPl include but are not limited to RTPl-A, RTPl-B, RTPl-C, RTPl-D, and RTPl-E, RTPl-Al, RTPl-Dl, RTP-D2, RTP-D3, RTPl-Al-A (Chimera 1), RTP1-A1-D2 (Chimera 2), RTPl-Al-Dl (Chimera 3), RTP4-A1-A (Chimera 4), RTP4-A1- D2 (Chimera 5), and RTP4-A1-D1 (Chimera 6).
  • variant forms (e.g., mutants or polymorphic sequences) of the subject REEP and/or RTP proteins are also contemplated as being equivalent to those peptides and DNA molecules that are set forth in more detail.
  • the present invention encompasses mutant and variant proteins that contain conservative or non-conservative amino acid substitutions.
  • This invention further contemplates a method of generating sets of combinatorial mutants of the present REEP and/or RTP proteins, as well as truncation mutants, and is especially useful for identifying potential variant sequences (i.e., mutants or polymorphic sequences) that are involved in neurological disorders (e.g., olfactory disorders) or resistance to neurological disorders.
  • REEP and/or RTP variants are engineered by the present method to provide altered (e.g., increased or decreased) biological activity.
  • combinatorially-derived variants are generated which have a selective potency relative to a naturally occurring REEP and/or RTP.
  • proteins when expressed from recombinant DNA constructs, can be used in gene therapy protocols.
  • Still other embodiments of the present invention provide REEP and/or RTP variants that have intracellular half-lives dramatically different than the corresponding wild-type protein.
  • the altered protein can be rendered either more stable or less stable to proteolytic degradation or other cellular process that result in destruction of, or otherwise inactivate REEP and/or RTP polypeptides.
  • Such variants, and the genes which encode them can be utilized to alter the location of REEP and/or RTP expression by modulating the half-life of the protein. For instance, a short half-life can give rise to more transient REEP and/or RTP biological effects and, when part of an inducible expression system, can allow tighter control of REEP and/or RTP levels within the cell.
  • proteins, and particularly their recombinant nucleic acid constructs can be used in gene therapy protocols.
  • REEP and/or RTP variants are generated by the combinatorial approach to act as antagonists, in that they are able to interfere with the ability of the corresponding wild-type protein to regulate cell function.
  • the amino acid sequences for a population of REEP and/or RTP homologs, variants or other related proteins are aligned, preferably to promote the highest homology possible.
  • Such a population of variants can include, for example, REEP and/or RTP homologs from one or more species, or REEP and/or RTP variants from the same species but which differ due to mutation or polymorphisms.
  • the combinatorial REEP and/or RTP library is produced by way of a degenerate library of genes encoding a library of polypeptides which each include at least a portion of potential REEP and/or RTP protein sequences.
  • a mixture of synthetic oligonucleotides can be enzymatically ligated into gene sequences such that the degenerate set of potential REEP and/or RTP sequences are expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for phage display) containing the set of REEP and/or RTP sequences therein.
  • the library of potential REEP and/or RTP homologs and variants can be generated from a degenerate oligonucleotide sequence.
  • chemical synthesis of a degenerate gene sequence is carried out in an automatic DNA synthesizer, and the synthetic genes are ligated into an appropriate gene for expression.
  • degenerate set of genes is to provide, in one mixture, all of the sequences encoding the desired set of potential REEP and/or RTP sequences.
  • the synthesis of degenerate oligonucleotides is well known in the art (See e.g., Narang, Tetrahedron Lett., 39:39 [1983]; Itakura et al, Recombinant DNA, in Walton (ed.), Proceedings of the 3rd Cleveland Symposium on Macromolecules, Elsevier, Amsterdam, pp 273-289 [1981]; Itakura et al, Annu. Rev.
  • REEP and/or RTP nucleic acids of the present invention e.g., SEQ ID NOs: 1-20, and fragments and variants thereof
  • REEP and/or RTP nucleic acids of the present invention can be utilized as starting nucleic acids for directed evolution. These techniques can be utilized to develop REEP and/or RTP variants having desirable properties such as increased or decreased biological activity.
  • artificial evolution is performed by random mutagenesis (e.g., by utilizing error-prone PCR to introduce random mutations into a given coding sequence).
  • This method requires that the frequency of mutation be finely tuned.
  • beneficial mutations are rare, while deleterious mutations are common. This is because the combination of a deleterious mutation and a beneficial mutation often results in an inactive enzyme.
  • the ideal number of base substitutions for targeted gene is usually between 1.5 and 5 (Moore and Arnold, Nat.
  • the polynucleotides of the present invention are used in gene shuffling or sexual PCR procedures (e.g., Smith, Nature, 370:324 [1994]; U.S. Pat. Nos. 5,837,458; 5,830,721; 5,811,238; 5,733,731; all of which are herein incorporated by reference).
  • Gene shuffling involves random fragmentation of several mutant DNAs followed by their reassembly by PCR into full length molecules. Examples of various gene shuffling procedures include, but are not limited to, assembly following DNase treatment, the staggered extension process (STEP), and random priming in vitro recombination.
  • DNA segments isolated from a pool of positive mutants are cleaved into random fragments with DNaseI and subjected to multiple rounds of PCR with no added primer.
  • the lengths of random fragments approach that of the uncleaved segment as the PCR cycles proceed, resulting in mutations in present in different clones becoming mixed and accumulating in some of the resulting sequences.
  • Multiple cycles of selection and shuffling have led to the functional enhancement of several enzymes (Stemmer, Nature, 370:398 [1994]; Stemmer, Proc. Natl. Acad. Sci. USA, 91:10747 [1994]; Crameri et al, Nat.
  • Variants produced by directed evolution can be screened for REEP and/or RTP activity by the methods described herein.
  • a wide range of techniques are known in the art for screening gene products of combinatorial libraries made by point mutations, and for screening cDNA libraries for gene products having a certain property. Such techniques will be generally adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis or recombination of REEP and/or RTP homologs or variants.
  • the most widely used techniques for screening large gene libraries typically comprises cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates relatively easy isolation of the vector encoding the gene whose product was detected.
  • REEP and/or RTP Polypeptides In an alternate embodiment of the invention, the coding sequence of REEP and/or RTP is synthesized, whole or in part, using chemical methods well known in the art (See e.g., Caruthers et ah, Nucl. Acids Res. Symp. Ser., 7:215 [1980]; Crea and Horn, Nucl. Acids Res., 9:2331 [1980]; Matteucci and Caruthers, Tetrahedron Lett., 21:719 [1980]; and Chow and Kempe, Nucl. Acids Res., 9:2807 [1981]).
  • the protein itself is produced using chemical methods to synthesize either an entire REEP and/or RTP amino acid sequence or a portion thereof.
  • peptides can be synthesized by solid phase techniques, cleaved from the resin, and purified by preparative high performance liquid chromatography (See e.g. , Creighton, Proteins Structures And Molecular Principles, W H Freeman and Co, New York N. Y. [1983]).
  • the composition of the synthetic peptides is confirmed by amino acid analysis or sequencing (See e.g., Creighton, supra).
  • Direct peptide synthesis can be performed using various solid-phase techniques (Roberge et al., Science 269:202 [1995]) and automated synthesis may be achieved, for example, using ABI 431 A Peptide Synthesizer (Perkin Elmer) in accordance with the instructions provided by the manufacturer. Additionally, the amino acid sequence of a REEP and/or RTP polypeptide, or any part thereof, may be altered during direct synthesis and/or combined using chemical methods with other sequences to produce a variant polypeptide.
  • the present invention provides methods of detecting the presence of wild type or variant (e.g., mutant or polymorphic) REEP and/or RTP nucleic acids or polypeptides.
  • the detection of mutant REEP and/or RTP polypeptides finds use in the diagnosis of disease (e.g., olfactory disorder).
  • the present invention provides alleles of REEP and/or RTP that increase a patient's susceptibility to olfactory disorders (e.g., upper respiratory infections, tumors of the anterior cranial fossa, Kallmann syndrome, Foster Kennedy syndrome, Parkinson's disease, Alzheimer's disease, and Huntington chorea). Any mutation that results in an altered phenotype (e.g., diminished olfactory sensing abilility) is within the scope of the present invention.
  • olfactory disorders e.g., upper respiratory infections, tumors of the anterior cranial fossa, Kallmann syndrome, Foster Kennedy syndrome, Parkinson's disease, Alzheimer's disease, and Huntington chorea.
  • the present invention provides methods for determining whether a patient has an increased susceptibility to olfactory disorders (e.g., upper respiratory infections, tumors of the anterior cranial fossa, and Kallmann syndrome, Foster Kennedy syndrome, Parkinson's disease, Alzheimer's disease, Huntington chorea) by determining, directly or indirectly, whether the individual has a variant REEP and/or RTP allele.
  • the present invention provides methods for providing a prognosis of increased risk for olfactory disorder to an individual based on the presence or absence of one or more variant REEP and/or RTP alleles.
  • a number of methods are available for analysis of variant (e.g., mutant or polymorphic) nucleic acid or polypeptide sequences.
  • Assays for detection variants e.g., polymorphisms or mutations
  • nucleic acid analysis fall into several categories including, but not limited to, direct sequencing assays, fragment polymorphism assays, hybridization assays, and computer based data analysis. Protocols and commercially available kits or services for performing multiple variations of these assays are available. In some embodiments, assays are performed in combination or in hybrid (e.g., different reagents or technologies from several assays are combined to yield one assay).
  • the following exemplary assays are useful in the present invention: directs sequencing assays, PCR assays, mutational analysis by dHPLC (e.g., available from Transgenomic, Omaha, NE or Varian, Palo Alto, CA), fragment length polymorphism assays (e.g., RFLP or CFLP (See e.g. U.S. Patents U.S. Patent Nos. 5,843,654; 5,843,669; 5,719,208; and 5,888,780; each of which is herein incorporated by reference)), hybridization assays (e.g., direct detection of hybridization, detection of hybridization using DNA chip assays (See e.g., U.S. Patent Nos.
  • polymorphisms detected directly or indirectly e.g., detecting sequences (other polymorphisms) that are in linkage disequilibrium with the polymorphism to be indentified; for example, other sequences in the SPG-6 locus maybe used; this method is described in U.S. Patent No.: 5,612,179 (herein incorporated by reference)) and mass spectrometry assays.
  • assays for the detection of variant REEP and/or RTP proteins find use in the present invention (e.g., cell free translation methods, See e.g., U.S. Patent 6,303,337, herein incorporated by reference) and antibody binding assays. The generation of antibodies that specifically recognize mutant versus wild type proteins are discussed below.
  • kits for Analyzing Risk of Olfactory disorders also provides kits for determining whether an individual contains a wild-type or variant (e.g., mutant or polymorphic) allele or polypeptide of REEP and/or RTP.
  • the kits are useful determining whether the subject is at risk of developing an olfactory disorder (e.g., upper respiratory infections, tumors of the anterior cranial fossa, and Kallmann syndrome, Foster Kennedy syndrome, Parkinson's disease, Alzheimer's disease, Huntington chorea).
  • the diagnostic kits are produced in a variety of ways.
  • the kits contain at least one reagent for specifically detecting a mutant REEP and/or RTP allele or protein.
  • the reagent is a nucleic acid that hybridizes to nucleic acids containing the mutation and that does not bind to nucleic acids that do not contain the mutation.
  • the reagents are primers for amplifying the region of DNA containing the mutation.
  • the reagents are antibodies that preferentially bind either the wild-type or mutant REEP and/or RTP proteins.
  • the kit contains instructions for determining whether the subject is at risk for an olfactory disorder (e.g, upper respiratory infections, tumors of the anterior cranial fossa, and Kallmann syndrome, Foster Kennedy syndrome, Parkinson's disease, Alzheimer's disease, Huntington chorea).
  • an olfactory disorder e.g, upper respiratory infections, tumors of the anterior cranial fossa, and Kallmann syndrome, Foster Kennedy syndrome, Parkinson's disease, Alzheimer's disease, Huntington chorea.
  • the instructions specify that risk for developing an olfactory disorder is determined by detecting the presence or absence of a mutant REEP and/or RTP allele in the subject, wherein subjects having an mutant allele are at greater risk for developing an olfactory disorder.
  • the presence or absence of a disease-associated mutation in a REEP and/or RTP gene can be used to make therapeutic or other medical decisions.
  • couples with a family history of odorant receptor related diseases may choose to conceive a child via in vitro fertilization and pre-implantation genetic screening, hi this case, fertilized embryos are screened for mutant (e.g., disease associated) alleles of a REEP and/or RTP gene and only embryos with wild type alleles are implanted in the uterus.
  • in utero screening is performed on a developing fetus (e.g., amniocentesis or chorionic villi screening), hi still other embodiments, genetic screening of newborn babies or very young children is performed.
  • kits include ancillary reagents such as buffering agents, nucleic acid stabilizing reagents, protein stabilizing reagents, and signal producing systems (e.g., florescence generating systems as Fret systems).
  • the test kit may be packaged in any suitable manner, typically with the elements in a single container or various containers as necessary along with a sheet of instructions for carrying out the test, hi some embodiments, the kits also preferably include a positive control sample.
  • the present invention provides methods of determining an individual's risk of developing an olfactory disorder (e.g., upper respiratory infections, tumors of the anterior cranial fossa, and Kallmann syndrome, Foster Kennedy syndrome, Parkinson's disease, Alzheimer's disease, Huntington chorea) based on the presence of one or more variant alleles of a REEP and/or RTP gene.
  • an olfactory disorder e.g., upper respiratory infections, tumors of the anterior cranial fossa, and Kallmann syndrome, Foster Kennedy syndrome, Parkinson's disease, Alzheimer's disease, Huntington chorea
  • the analysis of variant data is processed by a computer using information stored on a computer (e.g. , in a database).
  • the present invention provides a bioinformatics research system comprising a plurality of computers running a multi- platform object oriented programming language (See e.g., U.S. Patent 6,125,383; herein incorporated by reference).
  • one of the computers stores genetics data (e.g., the risk of contacting an REEP and/or RTP related olfactory disorder associated with a given polymorphism, as well as the sequences).
  • one of the computers stores application programs (e.g., for analyzing the results of detection assays). Results are then delivered to the user (e.g., via one of the computers or via the internet).
  • a computer-based analysis program is used to translate the raw data generated by the detection assay (e.g., the presence, absence, or amount of a given REEP and/or RTP allele or polypeptide) into data of predictive value for a clinician.
  • the clinician can access the predictive data using any suitable means.
  • the present invention provides the further benefit that the clinician, who is not likely to be trained in genetics or molecular biology, need not understand the raw data.
  • the data is presented directly to the clinician in its most useful form. The clinician is then able to immediately utilize the information in order to optimize the care of the subject.
  • the present invention contemplates any method capable of receiving, processing, and transmitting the information to and from laboratories conducting the assays, information providers, medical personal, and subjects.
  • a sample e.g., a biopsy or a serum or urine sample
  • a profiling service e.g., clinical lab at a medical facility, genomic profiling business, etc.
  • any part of the world e.g., in a country different than the country where the subject resides or where the information is ultimately used
  • the subject may visit a medical center to have the sample obtained and sent to the profiling center, or subjects may collect the sample themselves (e.g., a urine sample) and directly send it to a profiling center.
  • the sample comprises previously determined biological information
  • the information may be directly sent to the profiling service by the subject (e.g., an information card containing the information may be scanned by a computer and the data transmitted to a computer of the profiling center using an electronic communication systems).
  • the profiling service Once received by the profiling service, the sample is processed and a profile is produced (i.e., presence of wild type or mutant REEP and/or RTP genes or polypeptides), specific for the diagnostic or prognostic information desired for the subject.
  • the profile data is then prepared in a format suitable for interpretation by a treating clinician.
  • the prepared format may represent a diagnosis or risk assessment (e.g., likelihood of developing an REEP and/or RTP related olfactory disorder) for the subject, along with recommendations for particular treatment options.
  • the data may be displayed to the clinician by any suitable method.
  • the profiling service generates a report that can be printed for the clinician (e.g., at the point of care) or displayed to the clinician on a computer monitor.
  • the information is first analyzed at the point of care or at a regional facility.
  • the raw data is then sent to a central processing facility for further analysis and/or to convert the raw data to information useful for a clinician or patient.
  • the central processing facility provides the advantage of privacy (all data is stored in a central facility with uniform security protocols), speed, and uniformity of data analysis.
  • the central processing facility can then control the fate of the data following treatment of the subject.
  • the central facility can provide data to the clinician, the subject, or researchers.
  • the subject is able to directly access the data using the electronic communication system.
  • the subject may chose further intervention or counseling based on the results.
  • the data is used for research use.
  • the data may be used to further optimize the association of a given REEP and/or RTP allele with olfactory disorders.
  • the present invention provides isolated antibodies or antibody fragments (e.g., FAB fragments). Antibodies can be generated to allow for the detection of REEP and/or RTP proteins (e.g., wild type or mutant) of the present invention.
  • the antibodies may be prepared using various immunogens.
  • the immunogen is a human REEP and/or RTP peptide to generate antibodies that recognize human REEP and/or RTP.
  • Such antibodies include, but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments, Fab expression libraries, or recombinant (e.g., chimeric, humanized, etc.) antibodies, as long as it can recognize the protein.
  • Antibodies can be produced by using a protein of the present invention as the antigen according to a conventional antibody or antiserum preparation process.
  • Various procedures known in the art may be used for the production of polyclonal antibodies directed against a REEP and/or RTP polypeptide.
  • various host animals can be immunized by injection with the peptide corresponding to the REEP and/or RTP epitope including but not limited to rabbits, mice, rats, sheep, goats, etc.
  • the peptide is conjugated to an immunogenic carrier (e.g., diphtheria toxoid, bovine serum albumin (BSA), or keyhole limpet hemocyanin (KLH)).
  • an immunogenic carrier e.g., diphtheria toxoid, bovine serum albumin (BSA), or keyhole limpet hemocyanin (KLH).
  • adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels (e.g., aluminum hydroxide), surface active substances (e.g., lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (Bacille Calmette-Guerin) and Corynebacterium parvuni).
  • BCG Bacille Calmette-Guerin
  • any technique that provides for the production of antibody molecules by continuous cell lines in culture will find use with the present invention ⁇ See e.g., Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). These include but are not limited to the hybridoma technique originally developed by K ⁇ hler and Milstein (K ⁇ hler and Milstein, Nature 256:495-497 [1975]), as well as the trioma technique, the human B-cell hybridoma technique ⁇ See e.g., Kozbor et al., Immunol.
  • monoclonal antibodies are produced in germ-free animals utilizing technology such as that described in PCT/US90/02545).
  • human antibodies will be generated by human hybridomas (Cote et al, Proc. Natl. Acad. Sci.
  • An additional embodiment of the invention utilizes the techniques described for the construction of Fab expression libraries (Huse et al, Science 246:1275-1281 [1989]) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity for a REEP and/or RTP polypeptide.
  • the present invention contemplated recombinant antibodies or fragments thereof to the proteins of the present invention.
  • Recombinant antibodies include, but are not limited to, humanized and chimeric antibodies. Methods for generating recombinant antibodies are known in the art ⁇ See e.g., U.S. Patents 6,180,370 and 6,277,969 and "Monoclonal Antibodies" H. Zola, BIOS Scientific Publishers Limited 2000.
  • any technique suitable for producing antibody fragments will find use in generating antibody fragments that contain the idiotype (antigen binding region) of the antibody molecule.
  • fragments include but are not limited to: F(ab')2 fragment that can be produced by pepsin digestion of the antibody molecule; Fab' fragments that can be generated by reducing the disulfide bridges of the F(ab')2 fragment, and Fab fragments that can be generated by treating the antibody molecule with papain and a reducing agent.
  • screening for the desired antibody will be accomplished by techniques known in the art (e.g., radioimmunoassay, ELISA (enzyme-linked immunosorbant assay), "sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitation reactions, immudiffusion assays, in situ immunoassays (e.g., using colloidal gold, enzyme or radioisotope labels), Western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays, etc.), complement fixation assays, immunofluorescence assays, protein A assays, and Immunoelectrophoresis assays, etc.
  • radioimmunoassay e.g., ELISA (enzyme-linked immunosorbant assay), "sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitation reactions, immudiffusion assays
  • antibody binding is detected by detecting a label on the primary antibody.
  • the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody.
  • the secondary antibody is labeled.
  • Many means are known in the art for detecting binding in an immunoassay and are within the scope of the present invention.
  • the immunogenic peptide should be provided free of the carrier molecule used in any immunization protocol.
  • the peptide was conjugated to KLH, it may be conjugated to BSA, or used directly, in a screening assay.
  • the foregoing antibodies can be used in methods known in the art relating to the localization and structure of REEP and/or RTP (e.g., for Western blotting), measuring levels thereof in appropriate biological samples, etc.
  • the antibodies can be used to detect a REEP and/or RTP in a biological sample from an individual.
  • the biological sample can be a biological fluid, such as, but not limited to, blood, serum, plasma, interstitial fluid, urine, cerebrospinal fluid, and the like, containing cells.
  • the biological samples can then be tested directly for the presence of a human REEP and/or RTP using an appropriate strategy (e.g., ELISA or radioimmunoassay) and format (e.g., microwells, dipstick (e.g., as described in International Patent Publication WO 93/03367), etc.
  • an appropriate strategy e.g., ELISA or radioimmunoassay
  • format e.g., microwells, dipstick (e.g., as described in International Patent Publication WO 93/03367), etc.
  • proteins in the sample can be size separated (e.g., by polyacrylamide gel electrophoresis (PAGE), in the presence or not of sodium dodecyl sulfate (SDS), and the presence of REEP and/or RTP detected by immunoblotting (Western blotting).
  • PAGE polyacrylamide gel electrophoresis
  • SDS sodium dodecyl sulfate
  • Immunoblotting techniques are generally more effective with antibodies generated against a peptide corresponding to an epitope of a protein, and hence, are particularly suited to the present invention.
  • Another method uses antibodies as agents to alter signal transduction. Specific antibodies that bind to the binding domains of REEP and/or RTP or other proteins involved in intracellular signaling can be used to inhibit the interaction between the various proteins and their interaction with other ligands. Antibodies that bind to the complex can also be used therapeutically to inhibit interactions of the protein complex in the signal transduction pathways leading to the various physiological and cellular effects of REEP and/or RTP. Such antibodies can also be used diagnostically to measure abnormal expression of REEPl and/or RTP, or the aberrant formation of protein complexes, which may be indicative of a disease state.
  • the present invention also provides methods and compositions suitable for gene therapy to alter REEP and/or RTP expression, production, or function for research, generation of transgenic animals, and/or therapeutic applications.
  • the present invention provides human REEP and/or RTP genes and provides methods of obtaining REEP and/or RTP genes from other species. Thus, the methods described below are generally applicable across many species.
  • the gene therapy is performed by providing a subject with a wild-type allele of a REEP and/or RTP gene (i.e., an allele that does not contain a REEP and/or RTP disease allele (e.g., free of disease causing polymorphisms or mutations)).
  • transient or stable therapeutic nucleic acids are used (e.g., antisense oligonucleotides, siRNAs) to reduce or prevent expression of mutant proteins.
  • genes are deleted to reduce or block desired olfactory senses.
  • Viral vectors commonly used for in vivo or ex vivo targeting and therapy procedures are DNA-based vectors and retroviral vectors. Methods for constructing and using viral vectors are known in the art (See e.g., Miller and Rosman, BioTech., 7:980-990 [1992]).
  • the viral vectors are replication defective, that is, they are unable to replicate autonomously in the target cell.
  • the genome of the replication defective viral vectors that are used within the scope of the present invention lack at least one region that is necessary for the replication of the virus in the infected cell. These regions can either be eliminated (in whole or in part), or be rendered non-functional by any technique known to a person skilled in the art. These techniques include the total removal, substitution (by other sequences, in particular by the inserted nucleic acid), partial deletion or addition of one or more bases to an essential (for replication) region. Such techniques may be performed in vitro ⁇ i.e., on the isolated DNA) or in situ, using the techniques of genetic manipulation or by treatment with mutagenic agents. Preferably, the replication defective virus retains the sequences of its genome that are necessary for encapsidating the viral particles.
  • DNA viral vectors include an attenuated or defective DNA viruses, including, but not limited to, herpes simplex virus (HSV), papillomavirus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the like.
  • HSV herpes simplex virus
  • EBV Epstein Barr virus
  • AAV adeno-associated virus
  • Defective viruses that entirely or almost entirely lack viral genes, are preferred, as defective virus is not infective after introduction into a cell.
  • Use of defective viral vectors allows for administration to cells in a specific, localized area, without concern that the vector can infect other cells. Thus, a specific tissue can be specifically targeted.
  • particular vectors include, but are not limited to, a defective herpes virus 1 (HSVl) vector (Kaplitt et al, MoI. Cell.
  • defective herpes virus vector lacking a glycoprotein L gene ⁇ See e.g., Patent Publication RD 371005 A
  • an attenuated adenovirus vector such as the vector described by Stratford-Perricaudet et al (J. Clin. Invest., 90:626-630 [1992]; See also, La SaUe et al, Science 259:988-990 [1993]
  • a defective adeno-associated virus vector Simmulski et al, J.
  • an appropriate immunosuppressive treatment is employed in conjunction with the viral vector ⁇ e.g., adenovirus vector), to avoid imrnuno- deactivation of the viral vector and transfected cells.
  • the viral vector e.g., adenovirus vector
  • immunosuppressive cytokines such as interleukin-12 (IL- 12), interferon-gamma (IFN- ⁇ ), or anti-CD4 antibody
  • IL-12 interleukin-12
  • IFN- ⁇ interferon-gamma
  • anti-CD4 antibody can be administered to block humoral or cellular immune responses to the viral vectors.
  • a viral vector that is engineered to express a minimal number of antigens.
  • the vector is an adenovirus vector.
  • Adenoviruses are eukaryotic DNA viruses that can be modified to efficiently deliver a nucleic acid of the invention to a variety of cell types.
  • serotypes of adenovirus exist.
  • adenoviruses of animal origin preference is given, within the scope of the present invention, to type 2 or type 5 human adenoviruses (Ad 2 or Ad 5), or adenoviruses of animal origin ⁇ See e.g., WO 94/26914).
  • Those adenoviruses of animal origin that can be used within the scope of the present invention include adenoviruses of canine, bovine, murine ⁇ e.g., Mavl, Beard et al, Virol., 75-81 [1990]), ovine, porcine, avian, and simian ⁇ e.g., SAV) origin.
  • the adenovirus of animal origin is a canine adenovirus, more preferably a CAV2 adenovirus ⁇ e.g. Manhattan or A26/61 strain (ATCC VR-800)).
  • the replication defective adenoviral vectors of the invention comprise the ITRs, an encapsidation sequence and the nucleic acid of interest.
  • at least the El region of the adenoviral vector is non-functional. The deletion in the El region preferably extends from nucleotides ⁇ S to 3329 in the sequence of the Ad5 adenovirus ⁇ PvuE-Bglil fragment) or 382 to 3446 ⁇ Hinfl ⁇ -Sau3A fragment).
  • the adenoviral vector has a deletion in the El region (Ad 1.0). Examples of El-deleted adenoviruses are disclosed in EP 185,573, the contents of which are incorporated herein by reference. In another preferred embodiment, the adenoviral vector has a deletion in the El and E4 regions (Ad 3.0).
  • the adenoviral vector has a deletion in the El region into which the E4 region and the nucleic acid sequence are inserted.
  • the replication defective recombinant adenoviruses according to the invention can be prepared by any technique known to the person skilled in the art ⁇ See e.g., Levrero et al, Gene 101:195 [1991]; EP 185 573; and Graham, EMBO J., 3:2917 [1984]).
  • adenoviruss can be prepared by homologous recombination between an adenovirus and a plasmid that carries, inter alia, the DNA sequence of interest.
  • the homologous recombination is accomplished following co-transfection of the adenovirus and plasmid into an appropriate cell line.
  • the cell line that is employed should preferably (i) be transformable by the elements to be used, and (ii) contain the sequences that are able to complement the part of the genome of the replication defective adenovirus, preferably in integrated form in order to avoid the risks of recombination.
  • Examples of cell lines that may be used are the human embryonic kidney cell line 293 (Graham et al, J. Gen.
  • AAV adeno-associated viruses
  • the AAV genome has been cloned, sequenced and characterized. It encompasses approximately 4700 bases and contains an inverted terminal repeat (ITR) region of approximately 145 bases at each end, which serves as an origin of replication for the virus. The remainder of the genome is divided into two essential regions that carry the encapsidation functions: the left-hand part of the genome, that contains the rep gene involved in viral replication and expression of the viral genes; and the right-hand part of the genome, that contains the cap gene encoding the capsid proteins of the virus.
  • ITR inverted terminal repeat
  • the replication defective recombinant AAVs according to the invention can be prepared by co-transfecting a plasmid containing the nucleic acid sequence of interest flanked by two AAV inverted terminal repeat (ITR) regions, and a plasmid carrying the AAV encapsidation genes (rep and cap genes), into a cell line that is infected with a human helper virus (for example an adenovirus).
  • ITR inverted terminal repeat
  • rep and cap genes AAV encapsidation genes
  • the AAV recombinants that are produced are then purified by standard techniques.
  • the gene can be introduced in a retroviral vector (e.g., as described in U.S. Pat. Nos.
  • the retrovirus genome includes two LTRs, an encapsidation sequence and three coding regions (gag, pol and env).
  • the gag, pol and env genes are generally deleted, in whole or in part, and replaced with a heterologous nucleic acid sequence of interest.
  • These vectors can be constructed from different types of retrovirus, such as, HIV, MOMULV ("murine Moloney leukemia virus” MSV ("murine Moloney sarcoma virus"), HaSV (“Harvey sarcoma virus”); SNV (“spleen necrosis virus”); RSV ("Rous sarcoma virus”) and Friend virus.
  • Defective retroviral vectors are also disclosed in WO 95/02697.
  • a plasmid is constructed that contains the LTRs, the encapsidation sequence and the coding sequence.
  • This construct is used to transfect a packaging cell line, which cell line is able to supply in trans the retroviral functions that are deficient in the plasmid.
  • the packaging cell lines are thus able to express the gag, pol and env genes.
  • Such packaging cell lines have been described in the prior art, in particular the cell line PA317 (US Pat. No.
  • the recombinant retroviral vectors can contain modifications within the LTRs for suppressing transcriptional activity as well as extensive encapsidation sequences that may include a part of the gag gene (Bender et al, J. Virol., 61 :1639 [1987]). Recombinant retroviral vectors are purified by standard techniques known to those having ordinary skill in the art. Alternatively, the vector can be introduced in vivo by lipofection.
  • cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes (Feigner and Ringold, Science 337:387-388 [1989]).
  • Particularly useful lipid compounds and compositions for transfer of nucleic acids are described in WO95/18863 and WO96/17823, and in U.S. Pat. No. 5,459,127, herein incorporated by reference.
  • a nucleic acid in vivo such as a cationic oligopeptide ⁇ e.g., WO95/21931), peptides derived from DNA binding proteins ⁇ e.g., WO96/25508), or a cationic polymer ⁇ e.g., WO95/21931). It is also possible to introduce the vector in vivo as a naked DNA plasmid. Methods for formulating and administering naked DNA to mammalian muscle tissue are disclosed in U.S. Pat. Nos. 5,580,859 and 5,589,466, both of which are herein incorporated by reference.
  • DNA vectors for gene therapy can be introduced into the desired host cells by methods known in the art, including but not limited to transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter (See e.g., Wu et al., J. Biol. Chem., 267:963 [1992]; Wu and Wu, J. Biol. Chem., 263:14621 [1988]; and Williams et al, Proc. Natl. Acad. Sci. USA 88:2726 [1991]). Receptor-mediated DNA delivery approaches can also be used (Curiel et al, Hum. Gene Ther., 3:147 [1992]; and Wu and Wu, J. Biol. Chem., 262:4429 [1987]).
  • transgenic Animals Expressing Exogenous REEP and RTP Genes and Homologs, Mutants, and Variants Thereof
  • the present invention contemplates the generation of transgenic animals comprising an exogenous REEP and/or RTP gene or homologs, mutants, or variants thereof.
  • the transgenic animal displays an altered phenotype as compared to wild-type animals.
  • the altered phenotype is the overexpression of mRNA for a REEP and/or RTP gene as compared to wild-type levels of REEP and/or RTP expression.
  • the altered phenotype is the decreased expression of mRNA for an endogenous REEP and/or RTP gene as compared to wild-type levels of endogenous REEP and/or RTP expression.
  • the transgenic animals comprise mutant alleles of REEP and/or RTP. Methods for analyzing the presence or absence of such phenotypes include Northern blotting, mRNA protection assays, and RT- PCR.
  • the transgenic mice have a knock out mutation of a REEP and/or RTP gene.
  • the transgenic animals display an altered susceptibility to olfactory disorders (e.g., upper respiratory infections, tumors of the anterior cranial fossa, and Kallmann syndrome, Foster Kennedy syndrome, Parkinson's disease, Alzheimer's disease, Huntington chorea).
  • olfactory disorders e.g., upper respiratory infections, tumors of the anterior cranial fossa, and Kallmann syndrome, Foster Kennedy syndrome, Parkinson's disease, Alzheimer's disease, Huntington chorea.
  • Such animals find use in research applications (e.g., identifying signaling pathways that a REEP and/or RTP protein is involved in), as well as drug screening applications (e.g., to screen for drugs that prevent or treat olfactory disorders).
  • test compounds e.g., a drug that is suspected of being useful to treat an olfactory disorder
  • the transgenic animals can be generated via a variety of methods, hi some embodiments, embryonal cells at various developmental stages are used to introduce transgenes for the production of transgenic animals. Different methods are used depending on the stage of development of the embryonal cell.
  • the zygote is the best target for micro ⁇ injection, hi the mouse, the male pronucleus reaches the size of approximately 20 micrometers in diameter, which allows reproducible injection of 1-2 picoliters (pi) of DNA solution.
  • the use of zygotes as a target for gene transfer has a major advantage in that in most cases the injected DNA will be incorporated into the host genome before the first cleavage (Brinster et al, Proc. Natl. Acad. Sci. USA 82:4438-4442 [1985]). As a consequence, all cells of the transgenic non-human animal will carry the incorporated transgene.
  • retroviral infection is used to introduce transgenes into a non- human animal.
  • the retroviral vector is utilized to transfect oocytes by injecting the retroviral vector into the perivitelline space of the oocyte (U.S. Pat. No. 6,080,912, incorporated herein by reference).
  • the developing non- human embryo can be cultured in vitro to the blastocyst stage.
  • the blastomeres can be targets for retroviral infection (Janenich, Proc. Natl. Acad. Sci. USA 73:1260 [1976]). Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (Hogan et al, in Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. [1986]).
  • the viral vector system used to introduce the transgene is typically a replication-defective retrovirus carrying the transgene (Jahner et al, Proc. Natl. Acad Sci. USA 82:6927 [1985]).
  • Transfection is easily and efficiently obtained by culturing the blastomeres on a monolayer of virus-producing cells (Van der Putten, supra; Stewart, et al, EMBO J., 6:383 [1987]). Alternatively, infection can be performed at a later stage. Virus or virus-producing cells can be injected into the blastocoele (Jahner et al, Nature 298:623 [1982]). Most of the founders will be mosaic for the transgene since incorporation occurs only in a subset of cells that form the transgenic animal. Further, the founder may contain various retroviral insertions of the transgene at different positions in the genome that generally will segregate in the offspring.
  • transgenes into the germline, albeit with low efficiency, by intrauterine retroviral infection of the midgestation embryo (Jahner et al, supra [1982]).
  • Additional means of using retroviruses or retroviral vectors to create transgenic animals known to the art involves the micro-injection of retroviral particles or mitomycin C-treated cells producing retrovirus into the perivitelline space of fertilized eggs or early embryos (PCT International Application WO 90/08832 [1990], and Haskell and Bowen, MoL Reprod. Dev., 40:386 [1995]).
  • the transgene is introduced into embryonic stem cells and the transfected stem cells are utilized to form an embryo.
  • ES cells are obtained by culturing pre-implantation embryos in vitro under appropriate conditions (Evans et al, Nature 292:154 [1981]; Bradley et al, Nature 309:255 [1984]; Gossler et al, Proc. Acad. Sci. USA 83:9065 [1986]; and Robertson et al, Nature 322:445 [1986]).
  • Transgenes can be efficiently introduced into the ES cells by DNA transfection by a variety of methods known to the art including calcium phosphate co-precipitation, protoplast or spheroplast fusion, lipofection and DEAE-dextran-mediated transfection.
  • Transgenes may also be introduced into ES cells by retro virus-mediated transduction or by micro-injection. Such transfected ES cells can thereafter colonize an embryo following their introduction into the blastocoel of a blastocyst-stage embryo and contribute to the germ line of the resulting chimeric animal (for review, See, Jaenisch, Science 240:1468 [1988]). Prior to the introduction of transfected ES cells into the blastocoel, the transfected ES cells may be subjected to various selection protocols to enrich for ES cells which have integrated the transgene assuming that the transgene provides a means for such selection. Alternatively, the polymerase chain reaction may be used to screen for ES cells that have integrated the transgene.
  • homologous recombination is utilized to knock-out gene function or create deletion mutants ⁇ e.g., mutants in which a particular domain of REEP and/or RTP is deleted). Methods for homologous recombination are described in U.S. Pat. No. 5,614,396, incorporated herein by reference.
  • the isolated nucleic acid and polypeptides of REEP and/or RTP genes of the present invention e.g., SEQ ID NOS: 1-50
  • related proteins and nucleic acids are used in drug screening applications for compounds that alter (e.g., enhance or inhibit) REEP and/or RTP activity and signaling.
  • the present invention further provides methods of identifying ligands and signaling pathways of the REEP and/or RTP proteins of the present invention.
  • the present invention is not limited to a particular mechanism. Indeed, an understanding of the mechanism is not necessary to practice the present invention.
  • REEP and/or RTP family proteins function in promoting odorant receptor cell surface localization and functional expression.
  • the present invention provides methods of screening compounds for the ability to alter REEP and/or RTP activity mediated by natural ligands (e.g., identified using the methods described above). Such compounds find use in the treatment of disease mediated by REEP and/or RTP (e.g., olfactory disorders), the alteration of olfactory sensory responses, and the like.
  • the present invention provides methods of screening compounds for an ability to interact with mutant REEP and/or RTP nucleic acid and/or mutant REEP and/or RTP polypeptides, while simultaneously not interacting with wild type REEP and/or RTP nucleic acid (e.g., SEQ ID NOS: 1-20) and/or wild type REEP and/or RTP polypeptides (e.g., SEQ ID NOS:21-50).
  • wild type REEP and/or RTP nucleic acid e.g., SEQ ID NOS: 1-20
  • wild type REEP and/or RTP polypeptides e.g., SEQ ID NOS:21-50.
  • Such compounds find use in the treatment of olfactory disorders facilitated by the presence of mutant forms of REEP and/or RTP nucleic acids and/or proteins.
  • the activity of cell surface localized ORs in cells expressing exogenous REEP or RTP polypeptides is assessed in response to compounds (e.g., candidate or ligands or inhibitors).
  • compounds e.g., candidate or ligands or inhibitors.
  • One technique uses REEP, RTP, or OR antibodies, generated as discussed above. Such antibodies are capable of specifically binding to REEP, RTP, or OR peptides and compete with a test compound for binding to REEP, RTP, or OR peptides. Similar screens can be carried out with small molecule libraries, aptamers, etc.
  • the present invention contemplates the use of cell lines transfected with REEP and/or RTP genes and variants thereof for screening compounds for activity, and in particular to high throughput screening of compounds from combinatorial libraries (e.g.
  • the cell lines of the present invention can be used in a variety of screening methods.
  • the cells can be used in second messenger assays that monitor signal transduction following activation of cell- surface receptors.
  • the cells can be used in reporter gene assays that monitor cellular responses at the transcription/translation level.
  • the host cells are preferably transfected as described above with vectors encoding REEP and/or RTP or variants or mutants thereof. The host cells are then treated with a compound or plurality of compounds (e.g. , from a combinatorial library) and assayed for the presence or absence of a response.
  • the compounds in the combinatorial library can serve as agonists, antagonists, activators, or inhibitors of the protein or proteins encoded by the vectors or of ORs localized at the cell membrane. It is also contemplated that at least some of the compounds in the combinatorial library can serve as agonists, antagonists, activators, or inhibitors of protein acting upstream or downstream of the protein encoded by the vector in a signal transduction pathway.
  • the second messenger assays measure fluorescent signals from reporter molecules that respond to intracellular changes (e.g., Ca ⁇ + concentration, membrane potential, pH, IP3, cAMP, arachidonic acid release) due to stimulation of membrane receptors and ion channels (e.g., ligand gated ion channels; see Denyer et al, Drug Discov. Today 3:323 [1998]; and Gonzales et al, Drug. Discov. Today 4:431-39 [1999]).
  • reporter molecules e.g., Ca ⁇ + concentration, membrane potential, pH, IP3, cAMP, arachidonic acid release
  • ion channels e.g., ligand gated ion channels
  • reporter molecules include, but are not limited to, FRET (florescence resonance energy transfer) systems (e.g., Cuo-lipids and oxonols, ED AN/D ABCYL), calcium sensitive indicators (e.g., Fluo-3, FURA 2, INDO 1, and FLUO3/AM, BAPTA AM), chloride-sensitive indicators (e.g., SPQ, SPA), potassium-sensitive indicators (e.g., PBFI), sodium-sensitive indicators (e.g., SBFI), and pH sensitive indicators (e.g., BCECF).
  • FRET fluescence resonance energy transfer
  • Responses of the host cells to treatment with the compounds can be detected by methods known in the art, including, but not limited to, fluorescence microscopy, confocal microscopy (e.g., FCS systems), flow cytometry, microfluidic devices, FLIPR systems (See, e.g., Schroeder and Neagle, J. Biomol. Screening 1:75 [1996]), and plate-reading systems.
  • the response e.g., increase in fluorescent intensity
  • the response caused by compound of unknown activity is compared to the response generated by a known agonist and expressed as a percentage of the maximal response of the known agonist.
  • the maximum response caused by a known agonist is defined as a 100% response.
  • the maximal response recorded after addition of an agonist to a sample containing a known or test antagonist is detectably lower than the 100% response.
  • the cells are also useful in reporter gene assays. Reporter gene assays involve the use of host cells transfected with vectors encoding a nucleic acid comprising transcriptional control elements of a target gene (i.e., a gene that controls the biological expression and function of a disease target) spliced to a coding sequence for a reporter gene. Therefore, activation of the target gene results in activation of the reporter gene product.
  • a target gene i.e., a gene that controls the biological expression and function of a disease target
  • test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including biological libraries; peptoid libraries (libraries of molecules having the functionalities of peptides, but with a novel, non-peptide backbone, which are resistant to enzymatic degradation but which nevertheless remain bioactive; see, e.g., Zuckennann et ah, J. Med. Chem. 37: 2678-85 [1994]); spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the 'one-bead one-compound' library method; and synthetic library methods using affinity chromatography selection.
  • test compound to modulate REEP and/or RTP binding to a compound, e.g., an odorant receptor, can also be evaluated. This can be accomplished, for example, by coupling the compound, e.g., the substrate, with a radioisotope or enzymatic label such that binding of the compound, e.g., the substrate, to REEP and/or RTP can be determined by detecting the labeled compound, e.g., substrate, in a complex.
  • REEP and/or RTP is coupled with a radioisotope or enzymatic label to monitor the ability of a test compound to modulate REEP and/or RTP binding to a REEP and/or RTP substrate in a complex.
  • compounds e.g., substrates
  • compounds can be labeled with 125 1, 35 S 14 C or 3 H, either directly or indirectly, and the radioisotope detected by direct counting of radioemmission or by scintillation counting.
  • compounds can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product.
  • a compound e.g., an odorant receptor
  • a microphysiorneter can be used to detect the interaction of a compound with REEP and/or RTP without the labeling of either the compound or the REEP and/or RTP (McConnell et al. Science 257:1906-1912 [1992]).
  • a "microphysiometer” e.g., Cytosensor
  • LAPS light-addressable potentiometric sensor
  • Changes in this acidification rate can be used as an indicator of the interaction between a compound and a REEP and/or RTP polypeptide.
  • a cell-free assay is provided in which REEP and/or RTP protein or biologically active portion thereof is contacted with a test compound and the ability of the test compound to bind to the REEP and/or RTP protein or biologically active portion thereof is evaluated.
  • Preferred biologically active portions of REEP and/or RTP proteins to be used in assays of the present invention include fragments that participate in interactions with substrates or other proteins, e.g., fragments with high surface probability scores.
  • Cell-free assays involve preparing a reaction mixture of the target gene protein and the test compound under conditions and for a time sufficient to allow the two components to interact and bind, thus forming a complex that can be removed and/or detected.
  • the interaction between two molecules can also be detected, e.g., using fluorescence energy transfer (FRET) (see, for example, Lakowicz et ah, U.S. Patent No. 5,631,169; Stavrianopoulos et ah, U.S. Patent No. 4,968,103; each of which is herein incorporated by reference).
  • FRET fluorescence energy transfer
  • a fluorophore label is selected such that a first donor molecule's emitted fluorescent energy will be absorbed by a fluorescent label on a second, 'acceptor' molecule, which in turn is able to fluoresce due to the absorbed energy.
  • the 'donor' protein molecule may simply utilize the natural fluorescent energy of tryptophan residues.
  • Labels are chosen that emit different wavelengths of light, such that the 'acceptor' molecule label may be differentiated from that of the 'donor'. Since the efficiency of energy transfer between the labels is related to the distance separating the molecules, the spatial relationship between the molecules can be assessed.
  • the fluorescent emission of the 'acceptor' molecule label in 1 5 the assay should be maximal.
  • An FRET binding event can be conveniently measured through standard fluorometric detection means well known in the art (e.g., using a fluorimeter).
  • Modulators of REEP and/or RTP expression can also be identified. For example, a cell or cell free mixture is contacted with a candidate compound and the expression of REEP and/or RTP rnRNA or protein evaluated relative to the level of expression of the REEP and/or RTP rnRNA or protein in the absence of the candidate compound.
  • the candidate compound When expression of the REEP and/or RTP rnRNA or protein is greater in the presence of the candidate compound than in its absence, the candidate compound is identified as a stimulator of a REEP and/or RTP mRNA or protein expression. Alternatively, when expression of REEP and/or RTP mRNA or protein is less ⁇ i.e., statistically significantly less) in the presence of the candidate compound than in its absence, the candidate compound is identified as an inhibitor of REEP and/or RTP mRNA or protein expression.
  • the level of REEP and/or RTP mRNA or protein expression can be determined by methods described herein for detecting REEP and/or RTP mRNA or protein.
  • a modulating agent can be identified using a cell-based or a cell free assay, and the ability of the agent to modulate the activity of a REEP and/or RTP protein can be confirmed in vivo, e.g., in an animal such as an animal model for a disease ⁇ e.g., an animal with an REEP and/or RTP related olfactory disorder).
  • This invention further pertains to novel agents identified by the above-described screening assays. Accordingly, it is within the scope of this invention to further use an agent identified as described herein ⁇ e.g., a REEP and/or RTP modulating agent or mimetic, a REEP and/or RTP specific antibody, a REEP and/or RTP - binding partner, or an OR agonist or inhibitor) in an appropriate animal model (such as those described herein) to determine the efficacy, toxicity, side effects, or mechanism of action, of treatment with such an agent. Furthermore, as described above, novel agents identified by the above-described screening assays can be, e.g., used for treatments of olfactory disorders ⁇ e.g., including, but not limited to, olfactory disorders).
  • an agent identified as described herein e.g., a REEP and/or RTP modulating agent or mimetic, a REEP and/or RTP specific antibody, a REEP and/or RTP - binding partner,
  • compositions Containing REEP and RTP Nucleic Acid, Peptides, and Analogs The present invention further provides pharmaceutical compositions which may comprise all or portions of REEP and/or RTP polynucleotide sequences, REEP and/or RTP polypeptides, inhibitors or antagonists of REEP and/or RTP bioactivity, including antibodies, alone or in combination with at least one other agent, such as a stabilizing compound, and may be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
  • the methods of the present invention find use in treating diseases or altering physiological states characterized by mutant REEP and/or RTP alleles ⁇ e.g., upper respiratory infections, tumors of the anterior cranial fossa, and Kallmann syndrome, Foster Kennedy syndrome, Parkinson's disease, Alzheimer's disease, Huntington chorea).
  • Peptides can be administered to the patient intravenously in a pharmaceutically acceptable carrier such as physiological saline.
  • Standard methods for intracellular delivery of peptides can be used (e.g., delivery via liposome). Such methods are well known to those of ordinary skill in the art.
  • the formulations of this invention are useful for parenteral administration, such as intravenous, subcutaneous, intramuscular, and intraperitoneal.
  • REEP and/or RTP nucleotide and REEP and/or RTP amino acid sequences can be administered to a patient alone, or in combination with other nucleotide sequences, drugs or hormones or in pharmaceutical compositions where it is mixed with excipient(s) or other pharmaceutically acceptable carriers.
  • the pharmaceutically acceptable carrier is pharmaceutically inert.
  • REEP and/or RTP polynucleotide sequences or REEP and/or RTP amino acid sequences may be administered alone to individuals subject to or suffering from a disease.
  • these pharmaceutical compositions may be formulated and administered systemically or locally.
  • Techniques for formulation and administration may be found in the latest edition of "Remington's Pharmaceutical Sciences” (Mack Publishing Co, Easton Pa.). Suitable routes may, for example, include oral or transmucosal administration; as well as parenteral delivery, including intramuscular, subcutaneous, intramedullary, intrathecal, intraventricular, intravenous, intraperitoneal, or intranasal administration.
  • the pharmaceutical compositions of the invention maybe formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline.
  • physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline.
  • penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • the pharmaceutical compositions of the present invention can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral or nasal ingestion by a patient to be treated.
  • compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an effective amount to achieve the intended purpose.
  • an effective amount of REEP and/or RTP may be that amount that suppresses olfactory disorder related symptoms. Determination of effective amounts is well within the capability of those skilled in the art, especially in light of the disclosure provided herein.
  • these pharmaceutical compositions may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries that facilitate processing of the active compounds into preparations that can be used pharmaceutically.
  • the preparations formulated for oral administration may be in the form of tablets, dragees, capsules, or solutions.
  • compositions of the present invention may be manufactured in a manner that is itself known ⁇ e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes).
  • Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
  • Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • the suspension may also contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • Pharmaceutical preparations for oral use can be obtained by combining the active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are carbohydrate or protein fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, etc; cellulose such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; and gums including arabic and tragacanth; and proteins such as gelatin and collagen.
  • disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid or a salt thereof such as sodium alginate.
  • Dragee cores are provided with suitable coatings such as concentrated sugar solutions, which may also contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, (i.e., dosage).
  • Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating such as glycerol or sorbitol.
  • the push-fit capsules can contain the active ingredients mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers.
  • the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers.
  • suitable liquids such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers.
  • Compositions comprising a compound of the invention formulated in a pharmaceutical acceptable carrier may be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.
  • conditions indicated on the label may include treatment of condition related to olfactory disorders.
  • the pharmaceutical composition may be provided as a salt and can be formed with many acids, including but not limited to hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents that are the corresponding free base forms, hi other cases, the preferred preparation may be a lyophilized powder in 1 mM-50 mM histidine, 0.1%-2% sucrose, 2%-7% mannitol at a pH range of 4.5 to 5.5 that is combined with buffer prior to use.
  • the therapeutically effective dose can be estimated initially from cell culture assays.
  • dosage can be formulated in animal models (particularly murine models) to achieve a desirable circulating concentration range that adjusts REEP and/or RTP levels.
  • a therapeutically effective dose refers to that amount of REEP and/or RTP that ameliorates symptoms of the disease state. Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index, and it can be expressed as the ratio LD50/ED50. Compounds that exhibit large therapeutic indices are preferred.
  • the data obtained from these cell culture assays and additional animal studies can be used in formulating a range of dosage for human use.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
  • the dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration. The exact dosage is chosen by the individual physician in view of the patient to be treated. Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect. Additional factors which may be taken into account include the severity of the disease state; age, weight, and gender of the patient; diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy.
  • Long acting pharmaceutical compositions might be administered every 3 to 4 days, every week, or once every two weeks depending on half-life and clearance rate of the particular formulation. Normal dosage amounts may vary from 0.01 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration. Guidance as to particular dosages and methods of delivery is provided in the literature (See, U.S. Pat. Nos. 4,657,760; 5,206,344; or 5,225,212, all of which are herein incorporated by reference). Those skilled in the art will employ different formulations for REEP and/or RTP than for the inhibitors of REEP and/or RTP. Administration to the bone marrow may necessitate delivery in a manner different from intravenous injections.
  • RNAi represents an evolutionary conserved cellular defense for controlling the expression of foreign genes in most eukaryotes, including humans. RNAi is triggered by double-stranded RNA (dsRNA) and causes sequence-specific mRNA degradation of single- stranded target RNAs homologous in response to dsRNA.
  • the mediators of mRNA degradation are small interfering RNA duplexes (siRNAs), which are normally produced from long dsRNA by enzymatic cleavage in the cell.
  • siRNAs are generally approximately twenty-one nucleotides in length (e.g.
  • RNA-induced silencing complex RNA-induced silencing complex
  • siRNAs Beyond their value for validation of gene function, siRNAs also hold great potential as gene-specific therapeutic agents (Tuschl and Borkhardt, Molecular Intervent. 2002; 2(3):158-67, herein incorporated by reference).
  • the transfection of siRNAs into animal cells results in the potent, long-lasting post- transcriptional silencing of specific genes (Caplen et al, Proc Natl Acad Sci U.S.A. 2001; 98: 9742-7; Elbashir et al., Nature. 2001; 411:494-8; Elbashir et al., Genes Dev. 2001;15: 188-200; and Elbashir et al., EMBO J.
  • siRNAs are extraordinarily effective at lowering the amounts of targeted RNA, and by extension proteins, frequently to undetectable levels.
  • the silencing effect can last several months, and is extraordinarily specific, because one nucleotide mismatch between the target RNA and the central region of the siRNA is frequently sufficient to prevent silencing Brummelkamp et al, Science 2002; 296:550-3; and Holen et al, Nucleic Acids Res. 2002; 30:1757-66, both of which are herein incorporated by reference.
  • RNAi for REEP and RTP As discussed above, the present invention provides RNAi for inhibiting the expression of the REEP and/or RTP polypeptide in cells, ORs, or pathway components involved in the expression or activity of such components.
  • RNAi for REEP and/or RTP software design tools are available in the art (e.g. on the Internet).
  • Oligoengine's web page has one such design tool that finds RNAi candidates based on Elbashir's (Elbashir et al, Methods 2002; 26: 199-213, herein incorporated by reference) criteria.
  • Other design tools may also be used, such as the Cenix Bioscience design tool offered by Ambion.
  • Si2 silencing duplex offered by Oligoengine.
  • RNA folding software programs available that allow one to determine if the mRNA has a tendency to fold on its own and form a "hair-pin" (which in the case of dsRNAi is not as desirable since one goal is to have the RNAi attach to the mRNA and not itself).
  • One preferred configuration is an open configuration with three or less bonds. Generally, a positive delta G is desirable to show that it would not tend to fold on itself spontaneously.
  • siRNA candidate molecules that are generated can be, for example, screened in an animal model of an olfactory disorder for the quantitative evaluation of REEP and/or RTP expression in vivo using similar techniques as described above.
  • REEP and/or RTP specific siRNAs of the present invention may be synthesized ⁇ chemically. Chemical synthesis can be achieved by any method known or discovered in the art. Alternatively, REEP and/or RTP specific siRNAs of the present invention may be synthesized by methods which comprise synthesis by transcription. In some embodiments, transcription is in vitro, as from a DNA template and bacteriophage RNA polymerase promoter, in other embodiments, synthesis is in vivo, as from a gene and a promoter. Separate-stranded duplex siRNA, where the two strands are synthesized separately and annealed, can also be synthesized chemically by any method known or discovered in the art.
  • ds siRNA are synthesized by methods that comprise synthesis by transcription, hi some embodiments, the two strands of the double-stranded region of a siRNA are expressed separately by two different expression cassettes, either in vitro (e.g., in a transcription system) or in vivo in a host cell, and then brought together to form a duplex.
  • the present invention provides a composition comprising an expression cassette comprising a promoter and a gene that encodes a siRNA specific for REEP and/or RTP.
  • the transcribed siRNA forms a single strand of a separate-stranded duplex (or double-stranded, or ds) siRNA of about 18 to 25 base pairs long; thus, formation of ds siRNA requires transcription of each of the two different strands of a ds siRNA.
  • the term "gene" in the expression cassette refers to a nucleic acid sequence that comprises coding sequences necessary for the production of a siRNA.
  • a gene includes but is not limited to coding sequences for a strand of a ds siRNA.
  • a DNA expression cassette comprises a chemically synthesized or recombinant DNA molecule containing at least one gene, or desired coding sequence for a single strand of a ds siRNA, and appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence, either in vitro or in vivo.
  • Expression in vitro may include expression in transcription systems and in transcription/ translation systems.
  • Expression in vivo may include expression in a particular host cell and/or organism.
  • Nucleic acid sequences necessary for expression in a prokaryotic cell or in a prokaryotic in vitro expression system are well known and usually include a promoter, an operator, and a ribosome binding site, often along with other sequences.
  • Nucleic acid sequences necessary for expression via bacterial RNA polymerases include a template DNA strand which has a polymerase promoter region followed by the complement of the RNA sequence desired (or the coding sequence or gene for the siRNA).
  • a complementary strand is annealed to the promoter portion of the template strand.
  • the gene may encode a transcript that contains at least one cleavage site, such that when cleaved results in at least two cleavage products.
  • Such products can include the two opposite strands of a ds siRNA.
  • the promoter may be constitutive or inducible; the promoter may also be tissue or organ specific (e.g. specific to the eye), or specific to a developmental phase.
  • the promoter is positioned 5 1 to the transcribed region.
  • Other promoters are also contemplated; such promoters include other polymerase III promoters and microRNA promoters.
  • a eukaryotic expression cassette further comprises a transcription termination signal suitable for use with the promoter; for example, when the promoter is recognized by RNA polymerase III, the termination signal is an RNA polymerase III termination signal.
  • the cassette may also include sites for stable integration into a host cell genome.
  • compositions comprise a vector comprising a gene encoding an siRNA specific for REEP and/or RTP or preferably at least one expression cassette comprising a promoter and a gene which encodes a sequence necessary for the production of a siRNA specific for REEP and/or RTP (an siRNA gene).
  • the vectors may further comprise marker genes, reporter genes, selection genes, or genes of interest, such as experimental genes.
  • Vectors of the present invention include cloning vectors and expression vectors. Expression vectors may be used in in vitro transcription/translation systems, as well as in in vivo in a host cell.
  • Expression vectors used in vivo in a host cell may be transfected into a host cell, either transiently, or stably.
  • a vector may also include sites for stable integration into a host cell genome.
  • it is useful to clone a siRNA gene downstream of a bacteriophage RNA polymerase promoter into a multicopy plasmid.
  • a variety of transcription vectors containing bacteriophage RNA polymerase promoters are available.
  • DNA synthesis can be used to add a bacteriophage RNA polymerase promoter upstream of a siRNA coding sequence.
  • vectors include, but are not limited to, chromosomal, nonchromosomal and synthetic DNA sequences (e.g., derivatives of viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies). It is contemplated that any vector may be used as long as it is expressed in the appropriate system (either in vitro or in vivo) and viable in the host when used in vivo; these two criteria are sufficient for transient transfection.
  • mammalian expression vectors comprise an origin of replication, suitable promoters and enhancers, and also any necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non-transcribed sequences.
  • DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required non-transcribed genetic elements.
  • a gene sequence in an expression vector which is not part of an expression cassette comprising a siRNA gene (specific for REEPl 5 RTPl, RTP2, RTPl-A, RTPl-B, RTPl-C, RTPl-D, and RTPl-E, RTPl-Al 5 RTPl-Dl 5 RTP-D2, RTP-D3, RTPl-Al-A (Chimera 1), RTP1-A1-D2 (Chimera 2), RTPl- Al-Dl (Chimera 3), RTP4-A1-A (Chimera 4), RTP4-A1-D2 (Chimera 5), and RTP4-A1- Dl (Chimera 6)) is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis.
  • a siRNA gene specifically for REEPl 5 RTPl, RTP2, RTPl-A, RTPl-B, RTPl-C, RTPl-D, and R
  • the gene sequence is a marker gene or a selection gene.
  • Promoters useful in the present invention include, but are not limited to, the cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, and mouse metallothionem promoters and other promoters known to control expression of gene in mammalian cells or their viruses.
  • recombinant expression vectors include origins of replication and selectable markers permitting transformation of the host cell (e.g., dihydrofolate reductase or neomycin resistance for eukaryotic cell culture).
  • transcription of DNA encoding a gene is increased by inserting an enhancer sequence into the vector.
  • Enhancers are cis- acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription.
  • Enhancers useful in the present invention include, but are not limited to, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • the design of a vector is configured to deliver the RNAi for more permanent inhibition.
  • the pSilencer siRNA expression vector offered by Ambion the pSuper RNAi system offered by Oligoengine, and the GneSilencer System offered by IMGENEX.
  • BD Biosciences offer the RNAi-Ready pSIREN Vectors, that allow both a Plasmid-based vectors and an Adenoviral or a Retroviral delivery formats. Ambion is expected to release an adenoviral vector for siRNA shortly.
  • SEQ ID NOS: 1-20 for example, may be used with in a Vector (both Plasmid and Viral) delivery systems. It is noted that Ambion offers a design tool for a vector on their web page, and BD Biosciences offers a manual for the design of a vector, both of which are useful for designing vectors for siRNA.
  • the present invention provides compositions comprising cells transfected by an expression cassette of the present invention as described above, or by a vector of the present invention, where the vector comprises an expression cassette (or simply the siRNA gene) of the present invention, as described above.
  • the host cell is a mammalian cell.
  • a transfected cell may be a cultured cell or a tissue, organ, or organismal cell.
  • Specific examples of cultured host cells include, but are not limited to, Chinese hamster ovary (CHO) cells, COS-7 lines of monkey kidney fibroblasts, 293T, C127, 3T3, HeLa, and BHK cell lines.
  • Specific examples of host cells in vivo include tumor tissue and eye tissue.
  • the cells may be transfected transiently or stably (e.g. DNA expressing the siRNA is stably integrated and expressed by the host cell's genome).
  • the cells may also be transfected with an expression cassette of the present invention, or they are transfected with an expression vector of the present invention.
  • transfected cells are cultured mammalian cells, preferably human cells, m other embodiments, they are tissue, organ, or organismal cells.
  • cells to be transfected in vitro are typically cultured prior to transfection according to methods which are well known in the art, as for example by the preferred methods as defined by the American Tissue Culture Collection, hi certain embodiments of the present invention, cells are transfected with siRNAs that are synthesized exogenously (or in vitro, as by chemical methods or in vitro transcription methods), or they are transfected with expression cassettes or vectors, which express siRNAs within the transfected cell. In some embodiments, cells are transfected with siRNAs by any method known or discovered in the art which allows a cell to take up exogenous RNA and remain viable.
  • Non-limiting examples include electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, osmotic shock, temperature shock, and electroporation, and pressure treatment.
  • the siRNAs are introduced in vivo by lipofection, as has been reported (as, for example, by Elbashir et al. (2001) Nature 411: 494-498, herein incorporated by reference).
  • expression cassettes or vectors comprising at least one expression cassette are introduced into the desired host cells by methods known in the art, including but not limited to transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter (See e.g., Wu et al. (1992) J. Biol. Chem., 267:963; Wu and Wu (1988) J. Biol. Chem., 263:14621; and Williams et al. (1991) Proc. Natl. Acad. Sci. USA 88:272). Receptor-mediated DNA delivery approaches are also used (Curiel et al. (1992) Hum.
  • various methods are used to enhance transfection of the cells. These methods include but are not limited to osmotic shock, temperature shock, and electroporation, and pressure treatment.
  • the vector can be introduced in vivo by lipofection. For the past decade, there has been increasing use of liposomes for encapsulation and transfection of nucleic acids in vitro. Synthetic cationic lipids designed to limit the difficulties and dangers encountered with liposome mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker.
  • cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes.
  • Particularly useful lipid compounds and compositions for transfer of nucleic acids are described in WO95/18863 and WO96/17823, and in U.S. Pat. No. 5,459,127, herein incorporated by reference.
  • Other molecules are also useful for facilitating transfection of a nucleic acid in vivo, such as a cationic oligopeptide (e.g., WO95/21931), peptides derived from DNA binding proteins (e.g., WO96/25508), or a cationic polymer (e.g., WO95/21931).
  • a sequence encoding a siRNA in vivo as a naked DNA, either as an expression cassette or as a vector.
  • Methods for formulating and administering naked DNA to mammalian muscle tissue are disclosed in U.S. Pat. Nos. 5,580,859 and 5,589,466, both of which are herein incorporated by reference.
  • Stable transfection typically requires the presence of a selectable marker in the vector used for transfection.
  • Transfected cells are then subjected to a selection procedure. Generally, selection involves growing the cells in a toxic substance, such as G418 or Hygromycin B, such that only those cells expressing a transfected marker gene conferring resistance to the toxic substance upon the transfected cell survive and grow.
  • the transfecting agent is OLIGOFECT AMINE.
  • OLIGOFECTAMINE is a lipid based transfection reagent. Additional example of lipid based transfection reagents that were designed for the transfection of dsRNAis are the Transit-TKO reagent which is provided by Mirus (Madison, WI) and the jetSI which was introduced by Polyplus-trasfection SAS.
  • the Silencer siRNA Transfection Kit provided by Ambion's includes siPORT Amine and siPORT Lipid transfection agents.
  • a plasmid vector delivery system is transfected into the cell with OLIGOFECTAMINE provided by Invitrogen or with siPORT XP-I transfection agent provided by Ambion.
  • certain chemical modifications of the dsRNAis such as changing the lipophilicity of the molecule maybe employed (e.g., attachment of lipophilic residues at the 3' termini of the dsRNA). Delivery of dsRNAs into organisms may also be achieved with methods previously developed for the application of antisense oligonucleotides such as injection of liposomes-encapsulated molecules.
  • kits comprising at least one expression cassette comprising a siRNA gene specific for REEP and/or RTP.
  • a transcript from the expression cassette forms a double stranded siRNA of about 18 to 25 base pairs long.
  • the expression cassette is contained within a vector, as described above, where the vector can be used in in vitro transcription or transcription/translation systems, or used in vivo to transfect cells, either transiently or stably.
  • the kit comprises at least two expression cassettes, each of which comprises a siRNA gene, such that at least one gene encodes one strand of a siRNA that combines with a strand encoded by a second cassette to form a ds siRNA; the ds siRNA so produced is any of the embodiments described above.
  • These cassettes may comprise a promoter and a sequence encoding one strand of a ds siRNA.
  • the two expression cassettes are present in a single vector; in other embodiments, the two expression cassettes are present in two different vectors.
  • a vector with at least one expression cassette, or two different vectors, each comprising a single expression cassette can be used in in vitro transcription or transcription/translation systems, or used in vivo to transfect cells, either transiently or stably.
  • the kit comprises at least one expression cassettes which comprises a gene which encodes two separate strands of a ds siRNA and a processing site between the sequences encoding each strand such that, when the gene is transcribed, the transcript is processed, such as by cleavage, to result in two separate strands which can combine to form a ds siRNA, as described above.
  • kits comprising; a) a composition comprising small interfering RNA duplexes (siRNAs) configured to inhibit expression of the REEP and/or RTP protein, and b) printed material with instructions for employing the composition for treating a target cell expressing REEP and/or RTP protein via expression of REEP and/or RTP mRNA under conditions such that the REEP and/or RTP mRNA is cleaved or otherwise disabled, hi certain embodiments, the printed material comprises instructions for employing the composition for treating eye disease.
  • siRNAs small interfering RNA duplexes
  • the present invention also provides methods of synthesizing siRNAs specific for REEP and/or RTP (e.g. human REEP and/or RTP) or specific for mutant or wild type forms of REEP and/or RTP.
  • the siRNAs may be synthesized in vitro or in vivo. In vitro synthesis includes chemical synthesis and synthesis by in vitro transcription, hi vitro transcription is achieved in a transcription system, as from a bacteriophage RNA polymerase, or in a transcription/translation system, as from a eukaryotic RNA polymerase. In vivo synthesis occurs in a transfected host cell.
  • the siRNAs synthesized in vitro are used to transfect cells. Therefore, the present invention also provides methods of transfecting host cells with siRNAs synthesized in vitro; in particular embodiments, the siRNAs are synthesized by in vitro transcription. The present invention further provides methods of silencing the REEP and/or RTP gene in vivo by transfecting cells with siRNAs synthesized in vitro. In other methods, the siRNAs is expressed in vitro in a transcription/ translation system from an expression cassette or expression vector, along with an expression vector encoding and expressing a reporter gene.
  • the present invention also provides methods of expressing siRNAs in vivo by transfecting cells with expression cassettes or vectors which direct synthesis of siRNAs in vivo.
  • the present invention also provides methods of silencing genes in vivo by transfecting cells with expression cassettes or vectors that direct synthesis of siRNAs in vivo.
  • the present invention provides methods for identifying ligands specific for odorant receptors.
  • the present invention is not limited to a particular method for indentifying ligands specific for odorant receptors.
  • the present invention provides a cell line (e.g., heterologous 293T cell line) expressing an odorant receptor of interest (e.g., any human odorant receptor) localized to the cell surface, REEPl, RTPl or variant thereof, RTP2, and G ⁇ o if.
  • an odorant receptor of interest e.g., any human odorant receptor
  • the cell line further comprises a cAMP responsive element linked with a reporting agent (e.g., luciferase) for detecting odorant receptor activation.
  • a reporting agent e.g., luciferase
  • An odiferous molecule e.g., eugenol
  • luciferase expression or a change in luciferase expression is detectable (see, e.g., Example 7).
  • Example 1 Identification of Odorant Receptor Accessory Proteins After hypothesizing that mammalian ORs require accessory protein(s) for functional cell surface expression, a search was instituted for detecting such molecule(s).
  • Long-SAGE (serial analysis of gene expression) libraries (see, e.g., Saha, S., et al., (2002) Nat Biotechnol 20, 508-512; herein incorporated by reference in its entirety) were constructed from single olfactory neurons as well as neurons from the vomeronasal organ and genes were collected that are expressed by these neurons.
  • each cDNA together with a mouse OR (MOR203-1) tagged with a 20 N-terminal amino acids of rhodopsin (Rho-tag), was transfected into 293T cells. Measurements were made assessing whether these clones had any effect on the cell-surface expression of ORs by staining living cells using antibodies against the Rho-tag (see, e.g., Laird, D. W., and Molday, R. S. (1988) Invest Ophthalmol Vis Sci 29, 419-428; herein incorporated by reference in its entirety). When MOR203-1 was transfected alone, antibody staining detected only faint cell-surface expression in less than 1% of the cells.
  • a schematic diagram outlining the screening procedure utilized with the present invention is provided at Figure 1.
  • Example 2 REEP and/or RTP Enhance Cell Surface Expression of ORs
  • Two unrelated clones (of 61 tested) enhanced both the number and staining intensity of cell surface expression of MOR203-1 (see Figure 2A).
  • the proteins encoded by these clones were named REEPl, for Receptor Expression Enhancing Protein 1 and RTPl, for Receptor Transporting Protein 1. Subsequently, RTP2 was found, a close relative of RTP 1. RTP2 also enhanced cell surface expression of MOR203-1. Next, REEPl, RTPl, and RTP2 were tested to detect a similar effect in promoting cell-surface expression of other ORs.
  • ORs mouse OREG, mouse olfr62, mouse OR-S46 and rat 17
  • REEPl RTPl
  • RTP2 RTP2
  • Co-transfection of BFP or GFP demonstrated that transfection efficiency was consistent (-70%).
  • ORs transfected with REEP and/or RTP generated more immunofluorescent cells and stronger signals in positive cells compared with ORs without REEP and/or RTP (see Figure 2A).
  • the signal intensity and the number of immunopositive cells varied when using different ORs at each condition. For example, in the case of rat 17, the surface expression was significantly lower than that of other ORs tested. Nonetheless, occasionarimmunopositive cells were observed only when the accessory proteins were co-expressed.
  • RTPl or RTP2 were consistently more robust than that of REEPl.
  • the enhancement of cell-surface expression was specific for ORs and not for other GPCRs: neither REEP and/or RTP enhanced expression of the ⁇ 2 adrenergic receptor, mT2R5 (a mouse bitter taste receptor) (see, e.g., Chandrashekar, J., et al. (2000) Cell 100, 703-711; herein incorporated by reference in its entirety), or a V2R pheromone receptor (VR4) (see, e.g., Matsunami, H., and Buck, L. B. (1997) Cell 90, 775-784; herein incorporated by reference in its entirety) (see Figure 2A and Figure 3).
  • FACS Fluorescence-activated cell sorting
  • REEP and/or RTP Genes Encode Transmembrane Proteins
  • the REEPl gene encodes a protein of 201 amino acids, containing two putative transmembrane domains (see Figure 5A). Immunostaining of C-terminal tagged REEPl protein indicate that the C-terminal end is extracellular.
  • BLAST searches identified homologous genes in diverse eukaryotic species.
  • REEPl showed limited similarities with yeast YOPl, barley HVA22, and human DP1/TB2 (see Figure 5B).
  • YOPl is implicated in vesicular transport ⁇ see, e.g., Brands, A., and Ho, T. H.
  • HVA22 is induced by abscisic acid and regulated by various environmental stresses such as extreme temperatures or dehydration ⁇ see, e.g., Chen, C. N., et al. (2002) Plant MoI Biol 49, 633-644; Shen, Q., et al. (1993) J Biol Chem 268, 23652-23660; each herein incorporated by reference in their entireties).
  • DP1/TB2 is encoded by a gene deleted in colon cancers ⁇ see, e.g., Kinzler, K. W., et al.
  • REEP5 mouse homolog of DPI
  • IgE plus antigen ⁇ see, e.g., Prieschl, E., et al. (1996) Gene 169, 215-218; herein incorporated by reference in its entirety
  • REEPl has at least 5 additional homologous genes (designated REEP2-6) (see Figure 5B).
  • RTPl and RTP2 genes encode proteins with 263 and 223 amino acids, respectively and share a 73% sequence identity in amino acid level (see Figure 5C).
  • Example 4 REEP and/or RTP are Specifically Expressed in Olfactory Neurons
  • Northern blot analysis with RNAs extracted from various mouse tissues revealed that REEPl and especially RTPl and RTP2 are most prominently expressed in olfactory and vomeronasal organs.
  • REEPl RNA was also detected at significant levels in the brain (see Figure 6A). Long exposure revealed faint signals for RTPl and RTP2 in the brain. Expression in testis was not observed, where a subset of ORs are expressed ⁇ see, e.g., Parmentier, M., et al. (1992) Nature 355, 453-455; Spehr, M., et al. (2003) Science 299, 2054-2058; each herein incorporated by reference in their entireties).
  • REEP and/or RTP were expressed specifically in olfactory neurons, which is evident from comparison with OMP expression, a marker for mature olfactory sensory neurons (see Figure 6B).
  • RTPl and RTP2 RNA which are 87% identical at nucleotide level across the coding sequence
  • non-homologous 3'UTR regions as probes were used in addition to probes corresponding to the open reading frames. The signals were identical.
  • No expression of other REEP or RTP genes was detected in olfactory neurons with the exception of RTP4 which was expressed at lower levels (see Figure 6B).
  • REEPl was expressed by a subset of brain cells (see Figure 6C).
  • REEPl and RTPl can Interact with ORs Given the ability of REEP and/or RTP to promote cell-surface expression of ORs, it was hypothesized that they may also interact with OR proteins. This was assessed using co- immunoprecipitation assays. HA-tagged MOR203-1 and Flag-tagged REEPl, RTPl or ICAP-I, a negative control ⁇ see, e.g., Zawistowski, J. S., et al. (2002) Hum MoI Genet 11, 389-396; herein incorporated by reference in its entirety) were transfected in 293T cells.
  • OR proteins were detected as high molecular weight bands after precipitation of REEPl or RTPl (see Figure 7B, lanes 1 and 2). The majority of a control GPCR, ⁇ 2 adrenergic receptor, did not form high-molecular weight oligomers using these elution conditions. Similarly, when the HA-MOR203-1 proteins were precipitated, REEPl or RTPl proteins were co-precipitated whereas ICAP-I was not detectable (see Figure 7C, lanes 1, 2 and 3). The present invention is not limited to a particular mechanism.
  • Example 6 REEP and/or RTP Enhance OR Function Poor odorant evoked signaling activity in heterologous cell culture systems expressing ORs has been attributed to the poor cell surface expression of ORs.
  • the identification of REEP and/or RTP allowed a direct assessment of this issue.
  • a luciferase reporter gene assay was employed in which a cAMP responsive element (CRE) mediated luciferase gene expression (see Figure 8A). Because OR activation leads to an increase in cAMP, activation of the mouse odorant receptor OREG by its ligand eugenol was measured in the presence and absence of REEP and/or RTP ⁇ see, e.g., Kajiya, K., et al.
  • Example 7 Constructing a Functional Assay to Identify Odorant-Receptor Interactions
  • 293 T cell lines were established which stably express REEPl, RTPl, RTP2 and G ⁇ o i f , the G protein alpha subunit that couples to OR (see, e.g., Belluscio, L., et al. (1998) Neuron 20, 69-81; Jones, D. T., and Reed, R. R. (1989). Science 244, 790-795; each herein incorporated by reference in their entireties).
  • RT-PCR analysis indicated that Hana3A cells express exogenous REEPl, RTPl, RTP2 and G ⁇ o i f (see Figure 9). Enhanced cell-surface expression was observed when OREG or other ORs were transfected in Hana3A cells and immunostained (see Figure 10).
  • the CRE- luciferase reporter gene along with either OREG (HA-tagged), OR-S46 or OR-S50 were co-transfected and stimulated the cells with their ligands, eugenol, nonanoic acid, and nonanedioic acid, respectively (see, e.g., Malnic, B., et al. (1999) Cell 96, 713-723; Touhara, K., et al. (1999) Proc Natl Acad Sci U S A 96, 4040-4045; each herein incorporated by reference in their entireties).
  • ORs primarily class I (fish-like) ORs ⁇ see, e.g., Malnic, B., et al. (1999) Cell 96, 713-723; Zhang, X., and Firestein, S. (2002) Nat Neurosci 5, 124-133; each herein incorporated by reference in their entireties).
  • ORs S6/79, S 18, S46 and S50
  • Olfr62 responded to coumarine and piperonal (see Figure 11C). Several related aromatic compounds were next tested and 2-coumaranone was identified as a preferred ligand for olfr62 (see Figure HC). When parental 293T cells for these ORs were used in this luciferase assay, little or no response to the odorants was observed.
  • the present invention is not limited to a particular mechanism. Indeed, an understanding of the mechanism is not necessary to practice the present invention. Nonetheless, these results further demonstrate the importance of REEP and/or RTP in functional OR expression.
  • Example 8 Example 8.
  • REEP and/or RTP Function during Receptor Folding, Transport, and/or Odorant Recognition Expression of GPCRs is a complex process that includes protein folding, post- translational modifications and transport through cellular compartments including the ER and Golgi apparatus. Additionally, evidence indicates that the proper targeting of GPCRs to the plasma membrane may involve homo or heterodimerization (see, e.g., Angers, S., et al. (2002) Annu Rev Pharmacol Toxicol 42, 409-435; herein incorporated by reference in its entirety).
  • the present invention is not limited to a particular mechanism. Indeed, an understanding of the mechanism is not necessary to practice the present invention.
  • REEP and/or RTP can function at any of these steps of OR expression, three possibilities are presented in Figure 13 regarding their possible interaction.
  • NinaA a cyclophilin homolog of Drosophila, was identified as a chaperone protein for rhodopsin and thought to facilitate the correct folding (see, e.g., Baker, E. K., et al. (1994) Embo J 13, 4886-4895; Shieh, B. H., et al. (1989) Nature 338, 67-70; each herein incorporated by reference in their entireties).
  • the plant homologs of REEPl, HVA22s are stress-induced genes and may allow plants to tolerate adverse conditions (see, e.g., Chen, C. N., et al. (2002) Plant MoI Biol 49, 633-644; Shen, Q., et al. (1993) J Biol Chem 268, 23652-23660; each herein incorporated by reference in their entireties).
  • the present invention is not limited to a particular mechanism. Indeed, an understanding of the mechanism is not necessary to practice the present invention.
  • HVA22s While the precise roles of HVA22s are not known, since a number of stress induced proteins, such as heat shock proteins, function as chaperones, it is conceivable that HVA22s and, by analogy, perhaps REEPl act as chaperones to promote folding.
  • REEPl, RTPl, and RTP2 facilitate the transport of specific vesicles/cargos that include ORs. Consistent with this idea, a REEPl homolog in yeast, YOPlP, has been implicated in Rab-mediated vesicle transport (see, e.g., Brands, A., and Ho, T. H. (2002) Plant Physiol 130, 1121-1131; Calero, M.
  • ORs may contain ER retention signal(s) that are masked by the association with RTPs (or REEPl), a mechanism similar to the regulation of cell-surface expression of GABA(B)Rl receptor by the association of GABA(B)R2 (see, e.g., Jones, K. A., et al. (1998) Nature 396, 674-679; Kaupmann, K., et al. (1998) Nature 396, 683-687; White, J. H., et al. (1998) Nature 396, 679-682; each herein incorporated by reference in their entireties).
  • the REEPs and RTPs may have different or complementary roles, a hypothesis that is consistent with the absence of any amino acid sequence similarity or specific sequence motifs.
  • the present invention is not limited to a particular mechanism. Indeed, an understanding of the mechanism is not necessary to practice the present invention. Nonetheless, the three roles outlined above are reasonable for REEPl, RTPl and RTP2; however, other possible functions are not excluded. Even though changes in ligand specificity of OREG or OR-S46 was not observed when expressed with REEPl, RTPl or RTP2, it is possible that they do play a role in modulating recognition profiles of some ORs. For example, different RAMP members change the ligand specificity of calcitonin receptor like receptor (CRLR), a member of GPCRs.
  • CRLR calcitonin receptor like receptor
  • CRLR expressed with RAMPl function as a CGRP receptor
  • CRLR expressed with RAMP2 functions as adrenomedullin receptor
  • the present invention is not limited to a particular mechanism. Indeed, an understanding of the mechanism is not necessary to practice the present invention. Nonetheless, many GPCRs, including VlR pheromone receptors (see, e.g., Dulac, C, and Axel, R.
  • T2R taste receptors see, e.g., Adler et al. (2000) Cell 100, 693-702; Matsunami, H., Montmayeur, J. P., and Buck, L. B. (2000) Nature 404, 601-604; each herein incorporated by reference in their entireties
  • the ⁇ 2C adrenergic receptor see, e.g., Hurt, C. M., et al.
  • REEP and RTP members may regulate trafficking of such GPCRs.
  • In situ hybridization analysis has shown that REEP3, REEP5, RTPl and RTP2 are all expressed by the VNO neurons.
  • REEP members are differentially expressed in subset of brain cells (M.M. and H.M., unpublished observations). The strategy to create a list of genes expressed in specific cell types using SAGE and/or Digital Differential Display and screen genes that promote cell-surface expression of the receptors could be applied in such cases.
  • Example 9 REEP and/or RTP Enable Investigations of Odorant Receptor-Odorant Interactions An expression system has been established that permits rapid identification of ligands for ORs. This system was tested with twelve ORs. Four of the tested ORs (S6/S79, S 18, S46, and S50) were expressed in single olfactory neurons responding to aliphatic odorants (see, e.g., Malnic, B., et al. (1999) Cell 96, 713-723; herein incorporated by reference in its entirety). The response profiles of OR-S50, but not that of OR-S 18 agreed with the previous report (see, e.g., Malnic, B., et al.
  • the present invention is not limited to a particular mechanism. Indeed, an understanding of the mechanism is not necessary to practice the present invention. Nonetheless, these results support the olfactory neuron S 6 response profile. Differences may be due to the variation of responses when recording from single olfactory neurons. When multiple single olfactory neurons that expressed the same OR were recorded against the same set of odorants using calcium imaging, their response profiles were similar but different (see, e.g., Bozza, T., et al. (2002) J Neurosci 22, 3033-3043; herein incorporated by reference in its entirety). Seven new ORs were identified that responded to different odorants in the test panels. The present invention is not limited to a particular mechanism. Indeed, an understanding of the mechanism is not necessary to practice the present invention.
  • Example 10 Single-Cell Long SAGE Analysis Single-cell RT-PCR was conducted as described ⁇ see, e.g., Brady, G., and Iscove, N. N. (1993) Methods Enzymol 225, 611-623; Dulac, C, and Axel, R. (1995) Cell 83, 195- 206; Matsunami, H., and Buck, L. B. (1997) Cell 90, 775-784; each herein incorporated by reference in their entireties) with modifications. Briefly, adult mouse olfactory tissues were dissociated with dispase (Invitrogen) and collagenase (Invitrogen).
  • Single cells were picked under inverted microscope using micromanipulator and transferred into 4.75ul of lysis mix (IxPCR buffer (Roche), 1.5mM MgC12, 5OuM dNTPs, 200ng/mg anchor primer (biotin- TATAGAATTCGCGGCCGCTCGCGA (T) 24), 0.3U/ul Prime RNase Inhibitor (Eppendorf), and 0.4U/ul rRNasin (Promega).
  • IxPCR buffer Roche
  • 1.5mM MgC12 5OuM dNTPs
  • 200ng/mg anchor primer biotin- TATAGAATTCGCGGCCGCTCGCGA (T) 24
  • 0.3U/ul Prime RNase Inhibitor Eppendorf
  • 0.4U/ul rRNasin Promega
  • PCR tubes containing lysed cells were heated to 65 degrees C for lmin, cooled at 4 degrees C and 0.25ul of RT mix (170U/ul Superscript II (Invitrogen), 35UM Prime RNase Inhibitor and 45U/ul rRNasin.) was added and incubated at 37 degrees C for 10 min then 65 degrees C for 10 min. 5ul of TdT mix (Ix PCR buffer (Roche), 1.5mM MgC12, 3mM dATP, 1.25U/ul TdT (Roche), 0.05U RNase H (Roche)) was added to each tube and incubated at 37 degrees C for 20 min then at 65 degrees C for lOmin.
  • RT mix 170U/ul Superscript II (Invitrogen), 35UM Prime RNase Inhibitor and 45U/ul rRNasin.
  • Example 11 Vector Construction cDNAs were amplified from olfactory epithelium cDNA using HotstarTaq DNA polymerase (Qiagen) or KOD DNA polymerase (Toyobo/Novagen) and subcloned into pCI expression vectors (Promega). OR open reading frames were amplified from genomic DNA of C57BL6 (MOR203-1 and S46), 129 (S 18) or DBA2 (olfr62, S6/S79, S50, MOR23-1, MOR31-4, MOR31-6, MOR32-5 and MOR32-11) and subcloned into pCI containing Rho- tag.
  • HotstarTaq DNA polymerase Qiagen
  • KOD DNA polymerase Toyobo/Novagen
  • OR open reading frames were amplified from genomic DNA of C57BL6 (MOR203-1 and S46), 129 (S 18) or DBA2 (olfr62, S6/S79, S50
  • Example 12 Cell Culture and Immunocytochemistry 293 T cells were maintained in minimal essential medium containing 10 % fetal bovine serum (MlO). Lipofectamine 2000 (Invitrogen) was used for transfection. hi live- cell staining, 16 hours after transfection, cells were incubated in MlO containing anti rhodopsin antibody, 4D2 ⁇ see, e.g., Laird, D. W., and Molday, R. S. (1988) Invest Ophthalmol Vis Sci 29, 419-428; herein incorporated by reference in its entirety) and 15mM NaN3 at 4 degrees C for lhour. After washing, cells were incubated with Cy3- conjugated anti mouse IgG (Jackson Immunologicals), washed and mounted.
  • MlO fetal bovine serum
  • Example 13 Analysis of REEPs and RTPs
  • SignalP see, e.g., Nielsen, H., et al. (1997) Protein Eng 10, 1-6; herein incorporated by reference in its entirety
  • TMHMM TMHMM
  • RNAs from various tissues were extracted using Trizol reagent (Invitrogen) or Aurum Total RNA (Biorad). RNAs were electrophoresed on formaldehyde-agarose gel and transferred onto HybondN membrane (Amersham). Dig-labeled probes were hybridized to the membrane in Dig easyhyb solution (Roche) at 65 degrees C. After washing, anti-Dig AP (Roche) were applied and the membranes were washed. The signals were detected with CDP-Star (Roche). The same membrane for all three probes was used. In situ hybridization was performed as described (see, e.g., Matsunami, H., and Buck, L. B.
  • Example 15 Immunoprecipitation 293T cells in 100mm dishes were transfected with ORs, REEPl, and/or RTPl cDNAs. 16 hours after transfection, cells were lysed in lysis buffer (5OmM Tris (7.4), 15OmM NaCl, 1% NP-40, 0.5mM PMSF, 2mM Benzamidene, 0.5ug/ml Leupeptin, 1.4ug/ml pepstatin A, 2.4ug/ml chymostatin, 15ug/ml aprotinin, ImM sodium ortho vanadate).
  • lysis buffer 5OmM Tris (7.4), 15OmM NaCl, 1% NP-40, 0.5mM PMSF, 2mM Benzamidene, 0.5ug/ml Leupeptin, 1.4ug/ml pepstatin A, 2.4ug/ml chymostatin, 15ug/ml aprotinin, ImM sodium ortho van
  • the lysis were incubated with anti-Flag M2 affinity gel (Sigma) or anti-HA affinity matrix (Roche) for 2 hours at 4 degrees C and washed with lysis buffer. Subsequently, the bound proteins were eluted by incubation with SDS sample buffer at room temperature for 2 hours. SDS-PAGE and western blotting were performed according to Mini-Protean 3 Cell (Bio-Rad) instruction manual. ECL (Amersham) was used for detecting proteins on membranes.
  • Example 16 Lucif erase Assay Dual-Glo system (Promega) for luciferase assay was used. CRE-Luciferase (Stratagene) was used to measure the receptor activities. Renilla luciferase driven by constitutively active SV40 promoter (pRL-SV40: Promega) was used as an internal control. Cells were plated on poly-D-lysine coated 96 well plates (BIOCOAT, Beckton Dickinson). After 8 hours (for experiments shown in Figure 8B and 8C) or 12 hours (for experiments shown in Figure 8D and Figure 11) after transfection, the medium was replaced with CD293 chemically defined medium (hrvitrogen) and the plates were incubated for one hour at 37 degrees C.
  • CRE-Luciferase (Stratagene) was used to measure the receptor activities. Renilla luciferase driven by constitutively active SV40 promoter (pRL-SV40: Promega) was used as an internal control. Cells were plated
  • cAMP assays cells were plated onto 24-well plate. OREG or OREG / Golf cDNA was transfected into Hana3a or HEK293-Tcells, respectively. 14 hours after transfection, the cells were incubated in CD293 for 2hrs, and exposed to eugenol or isoproterenol in MEM containing 1OmM Hepes and 50OuM IBMX for 5 min. cAMP-Screen Direct System (Applied Biosystems) was used to measure the cAMP levels. Prism software (Graphpad) was used for data analysis.
  • Example 17 Chemicals All odorants were purchased from Sigma except octanoic acid from Calbiochem. The chemicals used in finding cognate ligands for MOR203-1 and olfr62 are provided in Example 19.
  • Example 18 Genbank accession numbers The genbank accession numbers of mouse and human REEP1-6 and RTP1-4: AY562225-AY562244.
  • Example 19 Supplemental Materials Chemicals that are used for initial ligand screening for MOR203-1 and olfr62 are the following: 1 (+)-Carvone, 2 L-Canvone, 3 (-)-Fenchone, 4 Citral, 5 (lR)-(-)-Fenchone, 6 (+)-Fenchone, 7 Rosemary oil, 8 (-)-Rose oxide, 9 (+)-Rose oxide, 10 (-)-Camphor, 11 (S)- (-)-Limonene, 12 (R)-(+)-l-Phenylethanol, 13 (S)-(+)-2-Phenylbutyric acid, 14 (R)-(-)-2- Phenylbutyric acid, 15 2-Hexanone, 16 1-Pentanol, 17 1-Heptanol, 18 ( ⁇ )-2-Butanol, 19 1- propanol, 20 1-Hexanol, 21 (-)-Menthol, 22 (R)-
  • Chemicals related to coumarin and piperonal are the following: 140 Benzaldehyde, 141 Piperonyl alcohol, 142 4-Hydroxycoumarm, 143 4-Chromanone, 144 2-Coumaranone.
  • Example 20 Activation Patterns of Human Odorant Receptors Hana3A cells (293T cells expressing mouse REEPl, RTPl, RTP2, and G ⁇ o if) were used. CRE-Luciferase (Stratagene) was used to measure odorant receptor activities. The following human odorant receptors were tested for expression patterns in response to various odiferous agents: 36, 35, 11, 57, 58, 9, 3, 42, 81, 82, 66, 13, 87, 33, 44, 43, 77, 75, 64, 59, 12, 62, 60, 120, 90, 95, 160, and 106.
  • CRE-Luciferase (Stratagene) was used to measure odorant receptor activities. The following human odorant receptors were tested for expression patterns in response to various odiferous agents: 36, 35, 11, 57, 58, 9, 3, 42, 81, 82, 66, 13, 87, 33, 44, 43, 77, 75, 64, 59,
  • odiferous agents were used to test human odorant receptor expression patterns: Pyridine, 2,2' - (Dithiodimethylene)difuran, 1-Decanol, 1-Hexanol, (-)-Fenchone, (+)-Fenchone, Geraniol, 2-Pentanone, Benzyl salicylate, (+)-Menthol, (-)-Menthol, Benzene, Undecanal, Methyl butylate, Heptyl isobutyrate, p-Tolyl isobutyrate, amylbutyrate, Ethyl butyrate, Hexyl acetate, Pentyl Acetate, Piperonyl acetate, (-)-b-Citronellol, citronellol, Eugenol methyl ether, Methyl Eugenol, a-Amylcinnamaldehyde, a-Amylcinnamaldehyde dimethyl acetal
  • Renilla luciferase driven by constitutively active SV40 promoter (pRL-SV40: Promega) was used as an internal control. Dual-Glo system (Promega) was used for the luciferase assay.
  • Cells were plated on poly-D-lysine coated 96 well plates (BIOCOAT, Beckton Dickinson). 12-16 hours after transfection, the medium was replaced with CD293 chemically defined medium (Invitrogen) and the plates were incubated for one hour at 37 degrees C. The medium was replaced with 50 ⁇ l of odorant solutions dissolved in CD293 and incubated for 4 hours at 37 degrees C. The manufacture's protocol was followed for measuring luciferase and Renilla luciferase activities.
  • Figure 34 shows the activation patterns of the human odorant receptors in response to odiferous agent exposure.
  • Example 21 Cell-Surface Expression of VlREIl in Hana3A and 293T Cells cDNAs encoding a putative pheromone receptor (VlREl 1) were transfected into Hana3A cells (HEK293T cells expressing REEPl, RTPl, RTP2 and G ⁇ o i f ) or 293T cells.
  • VlREl 1 is a putative pheromone receptor in the mouse and is completely different from odorant receptors in amino acid sequences.
  • Hana3A cells supported cell-surface expression of VlREl 1.
  • the present invention is not limited to a particular mechanism. Indeed, an understanding of the mechanism is not necessary to practice the present invention. Nonetheless, these results indicate that REEP 1 , RTP 1 , and RTP2 can support functional expression of receptors other than odorant receptors.
  • Example 22 The Ability Of RTPl-A, RTPl-B, RTPl-C, RTPl-D And RTPl-E To Enhance OLFR62 Cell-Surface Expression And Activity
  • This example describes the generation of the RTP 1 variants RTP 1 -A, RTP 1 - B, RTPl-C, RTPl-D and RTPl-E and their ability to enhance OLFR62 cell-surface expression and activity.
  • Variants of RTPl were generated by deleting portions of RTPl .
  • Figure 35 schematically shows the amino acid segments of RTPl-A, RTPl-B, RTPl-C, RTPl-D, and RTPl-E in comparison to RTPl.
  • pCI was a control vector.
  • Figure 36 shows the murine amino acid sequence for RTPl-A (SEQ ID NO: 41)
  • Figure 37 shows the murine amino acid sequence for RTPl-B (SEQ ID NO: 42)
  • Figure 38 shows the murine amino acid sequence for RTPl-C (SEQ ID NO: 43)
  • Figure 39 shows the murine amino acid sequence for RTPl-D (SEQ ID NO: 44)
  • Figure 40 shows the murine amino acid sequence for RTPl-E (SEQ ID NO: 45).
  • Figure 41 shows cell-surface expression of OLFR62 in Hana3A and 293T cells.
  • cDNAs encoding RTPl, RTPl-A, RTPl-B, RTPl-C, RTPl-D, RTPl-E, and control pCI were transfected into Hana3A cells or 293T cells. Increased cell-surface staining was seen in Hana3A cells and 239T cells expressing RTPl-D.
  • Figure 42 schematically shows a luciferase assay used to monitor the activity of OLFR62 activity.
  • cAMP responsive element (CRE) and luciferase was used to monitor activation of OLFR62. Activation of OLFR62 increases cAMP, which enhances the expression of luciferase reporter gene through the CRE.
  • Figure 43 shows OLFR62 activity as indicated by luciferase expression in Hana3A cells and 293T cells expressing RTPl 5 RTPl-A, RTPl-B, RTPl-C, RTPl-D, RTPl-E, and control pCI. Increased enhancement of OLFR62 activity was seen in 293T cells and Hana3A cells expressing RTPl-D.
  • Example 23 The Ability Of RTPl-Al, RTPl-Dl, RTP1-D2, And RTP1-D3 To Enhance OLFR62 Cell-Surface Expression And Activity
  • This example describes the generation of the RTPl variants RTPl-Al, RTPl-Dl, RTP1-D2, and RTP1-D3 and their ability to enhance OLFR62 cell-surface expression and activity.
  • Variants of RTPl were generated by deleting portions of RTPl-A and RTPl-D. hi particular, primer pairs were laid down at specific locations corresponding to desired deletion segments and were amplified by PCR with KOD polymerase.
  • Figure 44 schematically shows the amino acid segments of RTPl-Al, RTPl-Dl, RTP1-D2, and RTP1-D3 in comparison to RTPl-A and RTPl-D, respectively.
  • Figure 45 shows the murine amino acid sequence for RTPl-Al (SEQ ID NO: 46) and the human amino acid sequence for RTPl-Al (SEQ ID NO: 47).
  • Figure 46 shows the murine amino acid sequence for RTPl-Dl (SEQ ID NO: 48).
  • Figure 47 shows the murine amino acid sequence for RTP-D2 (SEQ ID NO: 49).
  • Figure 48 shows the murine amino acid sequence for RTP-D3 (SEQ ID NO: 50).
  • Figure 49 shows cell-surface expression of OLFR62 in 293T cells.
  • cDNAs encoding RTP 1 , RTP 1 -Al , RTP 1 -D 1 , RTP 1 -D2, and RTP 1 -D3 , and control pCI were transfected into 293T cells. Increased cell-surface staining was seen in 239T cells expressing RTPl-Al 5 RTPl-Dl and RTP1-D3.
  • Figure 50 shows OLFR62, OREG, S6, and 23-1 activity as indicated by luciferase expression in 293T cells expressing RTPl, RTPl-Al, RTPl-Dl, RTP1-D2, and RTP1-D3, and control pCI.
  • FIG. 51 shows OLFR62, OREG, S6, and 23-1 activity as indicated by luciferase expression in Hana3A cells expressing RTPl, RTPl-Al, RTPl-Dl, RTP1-D2, and RTPl- D3, and control pCI.
  • Figure 52 shows cell-surface expression of OLFR62, OREG, MOR203-1, S6, and 23-1 in 293T cells co-transfected with either RTPl, RTPl-Al or control pCI. cDNAs encoding RTPl, RTPl-Al, and control pCI were transfected into cells. Increased cell- surface staining was seen in cells expressing RTPl-Al.
  • Example 24 RTPl and RTP4 Chimeras
  • This example describes RTPl and RTP4 chimeras generated with chimeric PCR.
  • complex chimera primers were designed at the connection points of the RTPl and RTP4 sequences.
  • two pairs of primers were first amplified (e.g., forward primer and complex primer, complex primer and reverse primer).
  • the two PCR products were used as templates in a subsequent megaprimer PCR, with the original forward and reverse primers, to obtain a desired chimera.
  • Figure 53 schematically shows the amino acid segments of RTPl-Al-A (Chimera 1), RTP1-A1-D2 (Chimera 2), RTPl- Al-Dl (Chimera 3), RTP4-A1-A (Chimera 4), RTP14-A1-D2 (Chimera 5), and RTP4-A1- Dl (Chimera 6).
  • Figure 54 shows cell-surface expression of an OR in cells expressing RTPl, RTP4, Chimera 1, Chimera 2, Chimera 3, Chimera 4, Chimera 5, Chimera 6, and control pCI.
  • FIG. 55 shows OLFR62, OREG, S6, and 23-1 activity as indicated by luciferase expression in 293T cells expressing RTPl, RTP4, RTPl-Al, RTPl-Dl, RTP1-D2, Chimera 1, Chimera 2, Chimera 3, Chimera 4, Chimera 5, Chimera 6, and control pCI.
  • Figure 56 shows detection of RTPl, RTPl-A, RTPl-B, RTPl-C, RTPl-Al, RTPl- D, Chimera 4, Chimera 5, RTP1-D3, RTPl-Dl, Chimera 6, and RTP4 using anti-RTPl.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Food Science & Technology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Genetics & Genomics (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Endocrinology (AREA)
  • Otolaryngology (AREA)
PCT/US2005/021921 2004-06-18 2005-06-20 Modulators of odorant receptors Ceased WO2006002161A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
AU2005258061A AU2005258061C1 (en) 2004-06-18 2005-06-20 Modulators of odorant receptors
EP05792749A EP1771582A4 (en) 2004-06-18 2005-06-20 Modulators of odorant receptors
CN2005800275380A CN101087879B (zh) 2004-06-18 2005-06-20 气味受体的调控剂
HK08106475.3A HK1116217B (en) 2004-06-18 2005-06-20 Modulators of odorant receptors
CA2571080A CA2571080C (en) 2004-06-18 2005-06-20 Modulators of odorant receptors
JP2007516837A JP5022217B2 (ja) 2004-06-18 2005-06-20 匂い物質受容体のモジュレーター

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US58108704P 2004-06-18 2004-06-18
US60/581,087 2004-06-18
US58201104P 2004-06-22 2004-06-22
US60/582,011 2004-06-22
US11/156,516 US7425445B2 (en) 2004-06-18 2005-06-20 Modulators that promote cell surface expression of odorant receptors

Publications (2)

Publication Number Publication Date
WO2006002161A2 true WO2006002161A2 (en) 2006-01-05
WO2006002161A3 WO2006002161A3 (en) 2007-06-21

Family

ID=36034502

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/021921 Ceased WO2006002161A2 (en) 2004-06-18 2005-06-20 Modulators of odorant receptors

Country Status (9)

Country Link
US (6) US7425445B2 (enExample)
EP (2) EP1771582A4 (enExample)
JP (2) JP5022217B2 (enExample)
CN (1) CN101087879B (enExample)
AU (2) AU2005258061C1 (enExample)
CA (1) CA2571080C (enExample)
DK (1) DK2031063T3 (enExample)
PL (1) PL2031063T3 (enExample)
WO (1) WO2006002161A2 (enExample)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8822165B2 (en) 2010-10-25 2014-09-02 Panasonic Corporation Method for producing cAMP using chimeric olfactory receptor
EP2832347A1 (en) 2013-08-02 2015-02-04 Takasago International Corporation Method for identifying patchouli odorant materials
WO2018138369A1 (en) 2017-01-30 2018-08-02 Chemcom S.A. Compounds reducing malodour perception and the use thereof
US10041935B2 (en) 2013-08-05 2018-08-07 New York University Identification of olfactory receptors sensitive to different odorants
US10908147B2 (en) 2013-12-16 2021-02-02 Monell Chemical Senses Center Methods of identifying modulators of olfactory receptors
GB202108867D0 (en) 2021-06-21 2021-08-04 Givaudan Sa Screening system
WO2024126820A1 (en) 2022-12-15 2024-06-20 Givaudan Sa Modified olfactory receptors
US12063914B2 (en) 2015-08-03 2024-08-20 Paul Feinstein DNA sequence that increases odorant receptor representation in the olfactory system
EP4664463A1 (en) 2024-06-14 2025-12-17 Givaudan SA Computer-implemented method for olfactory property prediction
WO2025257381A1 (en) 2024-06-14 2025-12-18 Givaudan Sa Modified olfactory receptors

Families Citing this family (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7811762B2 (en) * 2006-03-30 2010-10-12 Duke University Identification of a novel gene underlying familial spastic paraplegia
US8298781B2 (en) * 2007-05-08 2012-10-30 Duke University Compositions and methods for characterizing and regulating olfactory sensation
JP5690467B2 (ja) * 2008-04-11 2015-03-25 花王株式会社 嗅覚感度抑制剤のスクリーニング法
US9068226B2 (en) 2009-12-04 2015-06-30 Duke University Compositions and methods for enhancing odorant receptor activity
JP5520173B2 (ja) * 2010-09-16 2014-06-11 花王株式会社 ミューゲ香料素材の探索方法
WO2012139526A1 (zh) * 2011-04-14 2012-10-18 上海交通大学医学院 一种配位金属的气味化合物的探测方法
JP5921226B2 (ja) * 2012-02-02 2016-05-24 花王株式会社 ミューゲ香料素材の探索方法
US20130210775A1 (en) 2012-02-09 2013-08-15 Kao Corporation Agent for inhibiting odor of pyrazine derivatives
US9783585B2 (en) 2012-09-10 2017-10-10 Johns Hopkins University Compositions and methods for increasing the expression and signalling of proteins on cell surfaces
BR112015032700B1 (pt) * 2013-06-29 2022-12-20 Firmenich Sa Métodos de identificação, isolamento e uso de receptores de aroma e odorizante
US10435456B2 (en) 2014-01-29 2019-10-08 The Johns Hopkins University Compositions and methods for increasing the expression and signalling of proteins on cell surfaces
EP3308168B1 (en) 2015-06-10 2020-04-01 Firmenich SA Cell lines for screening odorant and aroma receptors
CN109071626A (zh) * 2016-02-24 2018-12-21 阿罗姆斯公司 用于检测气味、香味和味道的生物传感器
CA3034419C (en) * 2016-09-30 2023-01-03 Mars, Incorporated Screening methods using olfactory receptors and novel compounds identified using the same
US11029308B2 (en) 2016-10-27 2021-06-08 Duke University Methods for vapor detection and discrimination with mammalian odorant receptors expressed in heterologous cells
US11255830B2 (en) 2016-12-30 2022-02-22 Research Foundation Of The City University Of New York Biosensor exhibiting sensitivity to trinitrotoluene
JP7062636B2 (ja) * 2017-03-07 2022-05-06 高砂香料工業株式会社 マリンノートを呈する香料素材のスクリーニング方法
US10209239B1 (en) 2017-08-16 2019-02-19 Aromyx Corporation Method of making an aromagraph comprising ectopic olfactory receptors
US12163950B2 (en) 2018-06-26 2024-12-10 Duke University Synthetic odorant receptors
US12017506B2 (en) 2020-08-20 2024-06-25 Denso International America, Inc. Passenger cabin air control systems and methods
US12251991B2 (en) 2020-08-20 2025-03-18 Denso International America, Inc. Humidity control for olfaction sensors
US11813926B2 (en) 2020-08-20 2023-11-14 Denso International America, Inc. Binding agent and olfaction sensor
US11636870B2 (en) 2020-08-20 2023-04-25 Denso International America, Inc. Smoking cessation systems and methods
US12269315B2 (en) 2020-08-20 2025-04-08 Denso International America, Inc. Systems and methods for measuring and managing odor brought into rental vehicles
US11881093B2 (en) 2020-08-20 2024-01-23 Denso International America, Inc. Systems and methods for identifying smoking in vehicles
US12377711B2 (en) 2020-08-20 2025-08-05 Denso International America, Inc. Vehicle feature control systems and methods based on smoking
US11760169B2 (en) 2020-08-20 2023-09-19 Denso International America, Inc. Particulate control systems and methods for olfaction sensors
US11932080B2 (en) 2020-08-20 2024-03-19 Denso International America, Inc. Diagnostic and recirculation control systems and methods
US11760170B2 (en) 2020-08-20 2023-09-19 Denso International America, Inc. Olfaction sensor preservation systems and methods
US11828210B2 (en) 2020-08-20 2023-11-28 Denso International America, Inc. Diagnostic systems and methods of vehicles using olfaction
JP2024132485A (ja) * 2023-03-17 2024-10-01 住友化学株式会社 ヒトリガ科の昆虫由来細胞
CN116200456B (zh) * 2023-04-27 2023-07-28 汉王科技股份有限公司 利用嗅觉受体检测食品变质的方法
CN118501118B (zh) * 2024-07-16 2024-10-29 汉王科技股份有限公司 一种基于细胞的生物荧光能量共振转移检测系统及应用

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1989007150A1 (en) 1988-02-05 1989-08-10 The Trustees Of Columbia University In The City Of Retroviral packaging cell lines and processes of using same
US4861719A (en) 1986-04-25 1989-08-29 Fred Hutchinson Cancer Research Center DNA constructs for retrovirus packaging cell lines
WO1990002806A1 (en) 1988-09-01 1990-03-22 Whitehead Institute For Biomedical Research Recombinant retroviruses with amphotropic and ecotropic host ranges
WO1990008832A1 (en) 1989-01-27 1990-08-09 National Research Development Corporation Retroviral vector and its use in the production of transgenic animals
WO1995002697A1 (fr) 1993-07-13 1995-01-26 Rhone-Poulenc Rorer S.A. Vecteurs adenoviraux defectifs et utilisation en therapie genique
WO1995021931A1 (fr) 1994-02-08 1995-08-17 Rhone-Poulenc Rorer S.A. Composition contenant des acides nucleiques, preparation et utilisations
WO1996025508A1 (fr) 1995-02-17 1996-08-22 Rhone-Poulenc Rorer S.A. Compositions contenant des acides nucleiques, preparation et utilisation

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5993778A (en) * 1997-05-07 1999-11-30 Firestein; Stuart J. Functional expression of, and assay for, functional cellular receptors in vivo
US20020048812A1 (en) * 2000-01-14 2002-04-25 Ronnett Gabriele V. Isolation and in vitro differentiation of conditionally immortalized murine olfactory receptor neurons
US6436703B1 (en) * 2000-03-31 2002-08-20 Hyseq, Inc. Nucleic acids and polypeptides
WO2003025130A2 (en) * 2001-09-14 2003-03-27 Incyte Genomics, Inc. Receptors and membrane-associated proteins
WO2003098221A1 (en) * 2002-05-02 2003-11-27 Evotec Neurosciences Gmbh Diagnostic and therapeutic use of ensadin-0255 gene and protein for neurodegenerative diseases
PL375202A1 (en) * 2002-05-07 2005-11-28 Immunex Corporation Cytokine polypeptides
CA2500521A1 (en) * 2002-10-02 2004-09-23 Nuvelo, Inc. Novel nucleic acids and polypeptides

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4861719A (en) 1986-04-25 1989-08-29 Fred Hutchinson Cancer Research Center DNA constructs for retrovirus packaging cell lines
WO1989007150A1 (en) 1988-02-05 1989-08-10 The Trustees Of Columbia University In The City Of Retroviral packaging cell lines and processes of using same
WO1990002806A1 (en) 1988-09-01 1990-03-22 Whitehead Institute For Biomedical Research Recombinant retroviruses with amphotropic and ecotropic host ranges
WO1990008832A1 (en) 1989-01-27 1990-08-09 National Research Development Corporation Retroviral vector and its use in the production of transgenic animals
WO1995002697A1 (fr) 1993-07-13 1995-01-26 Rhone-Poulenc Rorer S.A. Vecteurs adenoviraux defectifs et utilisation en therapie genique
WO1995021931A1 (fr) 1994-02-08 1995-08-17 Rhone-Poulenc Rorer S.A. Composition contenant des acides nucleiques, preparation et utilisations
WO1996025508A1 (fr) 1995-02-17 1996-08-22 Rhone-Poulenc Rorer S.A. Compositions contenant des acides nucleiques, preparation et utilisation

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences", MACK PUBLISHING CO
DENYER ET AL., DRUG DISCOV. TODAY, vol. 3, 1998, pages 323
GONZALES ET AL., DRUG. DISCOV. TODAY, vol. 4, 1999, pages 431 - 39
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR
SCHROEDER; NEAGLE, J. BIOMOL. SCREENING, vol. 1, 1996, pages 75
See also references of EP1771582A4

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8822165B2 (en) 2010-10-25 2014-09-02 Panasonic Corporation Method for producing cAMP using chimeric olfactory receptor
EP2832347A1 (en) 2013-08-02 2015-02-04 Takasago International Corporation Method for identifying patchouli odorant materials
US10041935B2 (en) 2013-08-05 2018-08-07 New York University Identification of olfactory receptors sensitive to different odorants
US10908147B2 (en) 2013-12-16 2021-02-02 Monell Chemical Senses Center Methods of identifying modulators of olfactory receptors
US12063914B2 (en) 2015-08-03 2024-08-20 Paul Feinstein DNA sequence that increases odorant receptor representation in the olfactory system
EP4059917A2 (en) 2017-01-30 2022-09-21 ChemCom S.A. Compounds reducing malodour perception and the use thereof
WO2018138369A1 (en) 2017-01-30 2018-08-02 Chemcom S.A. Compounds reducing malodour perception and the use thereof
GB202108867D0 (en) 2021-06-21 2021-08-04 Givaudan Sa Screening system
WO2022268745A1 (en) 2021-06-21 2022-12-29 Givaudan Sa Screening system
WO2024126820A1 (en) 2022-12-15 2024-06-20 Givaudan Sa Modified olfactory receptors
EP4664463A1 (en) 2024-06-14 2025-12-17 Givaudan SA Computer-implemented method for olfactory property prediction
WO2025257381A1 (en) 2024-06-14 2025-12-18 Givaudan Sa Modified olfactory receptors
WO2025257382A1 (en) 2024-06-14 2025-12-18 Givaudan Sa Computer-implemented method for olfactory property prediction

Also Published As

Publication number Publication date
US7838288B2 (en) 2010-11-23
US7691592B2 (en) 2010-04-06
EP1771582A2 (en) 2007-04-11
JP5340430B2 (ja) 2013-11-13
WO2006002161A3 (en) 2007-06-21
US20100222561A1 (en) 2010-09-02
EP2031063A3 (en) 2009-03-11
AU2009227827A1 (en) 2009-11-05
AU2005258061C1 (en) 2010-09-09
JP2012105660A (ja) 2012-06-07
AU2005258061A1 (en) 2006-01-05
US7879565B2 (en) 2011-02-01
CA2571080C (en) 2013-05-28
US20080124742A1 (en) 2008-05-29
CN101087879A (zh) 2007-12-12
EP1771582A4 (en) 2008-04-16
CA2571080A1 (en) 2006-01-05
PL2031063T3 (pl) 2014-04-30
EP2031063B1 (en) 2013-11-06
EP2031063A2 (en) 2009-03-04
JP5022217B2 (ja) 2012-09-12
US20090092997A1 (en) 2009-04-09
AU2005258061B2 (en) 2009-07-16
US20090123997A1 (en) 2009-05-14
JP2008503220A (ja) 2008-02-07
AU2009227827A2 (en) 2010-03-11
US20060057640A1 (en) 2006-03-16
AU2005258061B9 (en) 2009-12-17
DK2031063T3 (da) 2014-01-27
CN101087879B (zh) 2013-08-14
US7425445B2 (en) 2008-09-16
US20090124003A1 (en) 2009-05-14

Similar Documents

Publication Publication Date Title
EP2031063B1 (en) Modulators of odorant receptors
US10883143B2 (en) Compositions and methods for enhancing odorant receptor activity
JP2008503220A5 (enExample)
US9416421B2 (en) Methods for diagnosing episodic movement disorders and related conditions
US20130102007A1 (en) Compositions and methods for characterizing and regulating olfactory sensation
JP4848276B2 (ja) 神経学的状態の検出および治療のための組成物および方法
HK1116217A1 (en) Modulators of odorant receptors
HK1116217B (en) Modulators of odorant receptors

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2007516837

Country of ref document: JP

Ref document number: 2571080

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Ref document number: DE

WWE Wipo information: entry into national phase

Ref document number: 2005792749

Country of ref document: EP

Ref document number: 2005258061

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2005258061

Country of ref document: AU

Date of ref document: 20050620

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2005258061

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 200580027538.0

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2005792749

Country of ref document: EP