WO2005069900A2 - Npc1l1 (npc3) and methods of identifying ligands thereof - Google Patents
Npc1l1 (npc3) and methods of identifying ligands thereof Download PDFInfo
- Publication number
- WO2005069900A2 WO2005069900A2 PCT/US2005/001469 US2005001469W WO2005069900A2 WO 2005069900 A2 WO2005069900 A2 WO 2005069900A2 US 2005001469 W US2005001469 W US 2005001469W WO 2005069900 A2 WO2005069900 A2 WO 2005069900A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- npcili
- cholesterol
- binding
- rat
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/60—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving cholesterol
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5076—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving cell organelles, e.g. Golgi complex, endoplasmic reticulum
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
Definitions
- the present invention includes NPCILI polypeptides and polynucleotides which encode the polypeptides, methods of use and methods of identifying modulators and ligands thereof.
- a factor leading to development of vascular disease is elevated serum cholesterol. It is estimated that 19% of Americans between the ages of 20 and 74 years of age have high serum cholesterol.
- arteriosclerosis a condition associated with the thickening and hardening of the arterial wall.
- Arteriosclerosis of the large vessels is referred to as atherosclerosis.
- Atherosclerosis is the predominant underlying factor in vascular disorders such as coronary artery disease, aortic aneurysm, arterial disease of the lower extremities and cerebrovascular disease.
- Cholesteryl esters are a major component of atherosclerotic lesions and the major storage form of cholesterol in arterial wall cells.
- cholesteryl esters is also a step in the intestinal absorption of dietary cholesterol.
- inhibition of cholesteryl ester formation and reduction of serum cholesterol can inhibit the progression of atherosclerotic lesion formation, decrease the accumulation of cholesteryl esters in the arterial wall, and block the intestinal absorption of dietary cholesterol.
- the regulation of whole-body cholesterol homeostasis in mammals and animals involves the regulation of intestinal cholesterol absorption, cellular cholesterol trafficking, dietary cholesterol and modulation of cholesterol biosynthesis, bile acid biosynthesis, steroid biosynthesis and the catabolism of the cholesterol- containing plasma lipoproteins. Regulation of intestinal cholesterol absorption has proven to be an effective means by which to regulate serum cholesterol levels. For example, a cholesterol absorption inhibitor, ezetimibe (
- a pharmaceutical composition containing ezetimibe is commercially available from Merck/Schering-Plough
- NPCILI human NPCILI
- NPCILI is an N-glycosylated protein comprising a YQRL (SEQ ID NO: 38) motif (i.e., a trans-golgL network to plasma membrane transport signal; see Bos, et al, (1993) EMBO J. 12: 2219-2228; Humphrey, et al, (1993) J. Cell. Biol. 120: 1123-1135; Ponnambalam, et al, (1994) J. Cell. Biol. 125: 253-268 and Rothman, et al, (1996) Science 272: 227-234) which exhibits limited tissue distribution and gastrointestinal abundance.
- YQRL SEQ ID NO: 38 motif
- the human NPCILI promoter includes a Sterol Regulated Element Binding Protein 1 (SREBP1) binding consensus sequence (Athanikar, et al, (1998) Proc. Natl. Acad. Sci. USA 95: 4935-4940; Ericsson, et al, (1996) Proc. Natl. Acad. Sci. USA 93: 945-950; Metherall, et al, (1989) J. Biol. Chem. 264: 15634-15641; Smith, et al, (1990) J. Biol. Chem. 265: 2306-2310; Bennett, et al, (1999) J. Biol. Chem.
- SREBP1 Sterol Regulated Element Binding Protein 1
- NPCILI has 42% amino acid sequence homology to human NPCl (Genbank Accession No. AF002O20), a receptor responsible for Niemann-Pick CI disease (Carstea, et al, (1997) Science 277: 228-231).
- Niemann- Pick CI disease is a rare genetic disorder in humans which results in accumulation of low density lipoprotein (LDL)-derived unesteri ied cholesterol in lysosomes (Pentchev, et al, (1994) Biochim. Biophys. Acta. 1225: 235-243 and Vanier, et al, (1991) Biochim. Biophys. Acta.
- LDL low density lipoprotein
- NPCl and NPCILI each possess 13 transmembrane spanning segments as well as a sterol-sensing domain (SSD).
- HMG-R HMG-CoA Reductase
- PTC Patched
- SCAP Sterol Regulatory Element Binding Protein Cleavage- Activation Protein
- NPCILI is the target through which ezetimibe acts, and consequently plays a critical role in the regulation of sterol and 5 -stanol intestinal transport and absorption, e.g. cholesterol absorption.
- this invention provides for the use of NPCILI in an assay for identifying ligands that block NPCILI -mediated sterol and 5 ⁇ -stanol intestinal transport.
- the present invention provides methods for identifying ligands of NPCILI which involve contacting NPCILI with a detectably labeled substituted 2-azetidinone, preferably substituted 2-azetidinone-glucuronide, and a candidate compound, and determining whether the candidate compound binds to NPCILI .
- the modulation of the binding of the substituted 2-azetidinone to NPCILI by the binding of the candidate compound to NPCILI indicates that the candidate compound is a ligand that binds to NPCILI and is an inhibitor of sterol and 5 ⁇ -stanol absorption.
- the present invention also provides a method for identifying a ligand of NPCILI comprising contacting NPCILI with a detectably labeled substituted 2- azetidinone, preferably substituted 2-azetidinone-glucvxronide, and measuring the binding of detectably labeled substituted 2-azetidinone to NPCILI in the presence and absence of a candidate compound, wherein decreased binding of the detectably labeled substituted 2-azetidinone to the NPCILI in the presence of the candidate compound indicates that said candidate compound is a ligand of NPCILI and is an inhibitor of sterol and 5 ⁇ -stanol absorption.
- the present invention also provides for a method for identifying a compound that inhibits intestinal sterol or 5 ⁇ -stanol absorption mediated by NPCILI involving contacting NPCILI with a detectably labeled ligand and the candidate compound and determining whether the candidate compound binds to NPCILI, wherein binding of said candidate compound to NPCILI modulates binding of said ligand to NPCILI, wherein said modulation indicates that the candidate compound is an intestinal sterol or 5 ⁇ -stanol abso ⁇ tion inhibitor.
- the present invention provides methods for identifying an ligand of NPCILI comprising (a) contacting a host cell (e.g., human embryonic kidney (HEK) 293 cells, Chinese hamster ovary (CHO) cell, a J774 cell, a macrophage cell or a Caco2 cell) expressing a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 12 or a functional fragment thereof on a cell surface, in the presence of a known amount of a detectably labeled (e.g., with 3 H, 14 C, 125 1, 35 S or fluorescence labeling) substituted azetidinone (e.g., ezetimibe), with a sample to be tested for the presence of an NPCILI ligand; and (b) measuring the amount of detectably labeled substituted azetidinone (e.g., ezetimibe) specifically bound to the polypeptide; wherein an NP
- the method comprises (a) placing, in an aqueous suspension, a plurality of support particles, impregnated with a fluorescer (e.g., yttrium silicate, yttrium oxide, diphenyloxazole and polyvinyltoluene), to which a host cell (e.g., Chinese hamster ovary (CHO) cell, a J774 cell, a macrophage cell or a Caco2 cell) expressing a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 12 or a functional fragment thereof on a cell surface are attached; (b) adding, to the suspension, a radiolabeled (e.g., with 3 H, 14 C or 125 I) substituted azetidinone (e.g., ezetimibe) and a sample to be tested for the presence of a ligand, wherein
- a radiolabeled e.g., with 3 H
- Also provided is a method for identifying a ligand of NPCILI comprising (a) contacting a host cell (e.g., Chinese hamster ovary (CHO) cell, a J774 cell, a macrophage cell or a Caco2 cell) expressing a polypeptide comprising an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 12 or a functional fragment thereof on a cell surface with detectably labeled (e.g., with 3 H, C or 5 I) sterol (e.g., cholesterol) or 5 -stanol and with a sample to be tested for the presence of an ligand; and (b) measuring the amount of detectably labeled sterol (e.g., cholesterol) or 5 ⁇ -stanol in the cell; wherein an NPCILI antagonist in the sample is identified by measuring substantially reduced detectably labeled sterol (e.g., cholesterol) or 5 ⁇ -stanol within the host cell, compared to what
- the present invention includes methods for inhibiting NPCl LI - mediated intestinal sterol (e.g., cholesterol) or 5 ⁇ -stanol uptake, in a subject, by administering a substance identified by the screening methods described herein to the subject.
- substances include compounds such as small molecule antagonists of NPCILI other than ezetimibe.
- methods for antagonizing NPCl LI -mediated sterol (e.g., cholesterol) or 5 ⁇ -stanol abso ⁇ tion by administering anti-NPClLl antibodies are also contemplated.
- NPClLl-mediated abso ⁇ tion of sterol ⁇ e.g., cholesterol) or 5 ⁇ -stanol can also be antagonized by any method which reduces expression of NPCILI in an organism.
- NPCILI expression can be reduced by introduction of anti-sense NPCILI mRNA into a cell of an organism or by genetic mutation of the NPCILI gene in an organism (e.g., by complete knockout, disruption, truncation or by introduction of one or more point mutations).
- a mutant transgenic mammal e.g., mouse, rat, dog, rabbit, pig, guinea pig, cat, horse
- a mouse comprising a homozygous or heterozygous mutation (e.g., disruption, truncation, one or more point mutations, knock out) of endogenous, chromosomal NPCILI wherein, preferably, the mouse does not produce any functional NPCILI protein.
- the mutant mouse lacking functional NPCILI, exhibits a reduced level of intestinal sterol (e.g., cholesterol) or 5 ⁇ -stanol abso ⁇ tion and/or a reduced level of serum sterol (e.g., cholesterol) or 5 -stanol and/or a reduced level of liver sterol (e.g., cholesterol) or 5 ⁇ -stanol as compared to that of a non-mutant mouse comprising functional NPCl LI .
- the region of NPCILI (SEQ ID NO: 45) deleted is from nucleotide 790 to nucleotide 998.
- NPCILI SEQ ID NO: 11
- npclll parent NPCILI mutant mouse of the invention which has inherited an npclll mutant allele is also part of the present invention.
- the scope of the present invention also includes a method for screening a sample for an intestinal sterol (e.g., cholesterol) or 5 ⁇ -stanol abso ⁇ tion antagonist comprising (a) feeding a sterol (e.g., cholesterol) or 5 ⁇ -stanol-containing substance (e.g., comprising radiolabeled cholesterol, such as 14 C-cholesterol or 3 H- cholesterol) to a first and second mouse comprising a functional NPCILI gene and to a third, mutant mouse lacking a functional NPCILI; (b) administering the sample to the first mouse comprising a functional NPCILI but not to the second mouse; (c) measuring the amount of sterol (e.g., cholesterol) or 5 ⁇ -stanol abso ⁇ tion in the intestine of said first, second and third mouse (e.g., by measuring serum cholesterol); and (d) comparing the levels of intestinal sterol (e.g., cholesterol) or 5 ⁇ -stanol abso ⁇ tion in each mouse; wherein
- the present invention also encompasses a kit comprising (a) a substituted azetidinone (e.g., ezetimibe) in a pharmaceutical dosage form (e.g., a pill or tablet comprising 10 mg substituted azetidinone (e.g., ezetimibe)); and (b) information, for example in the form of an insert, indicating that NPCILI is a target of ezetimibe.
- the kit may also include simvastatin in a pharmaceutical dosage form (e.g., a pill or tablet comprising 5 mg, 10 mg, 20 mg, 40 mg or 80 mg simvastatin).
- the simvastatin in pharmaceutical dosage form and the ezetimibe in pha ⁇ naceutical dosage form can be associated in a single pill or tablet or in separate pills or tablets.
- the present invention also provides any isolated mammalian cell ( «s.g ⁇ , isolated mouse cell, isolated rat cell or isolated human cell) which lacks a gene wliich encodes or can produce a functional NPCILI polypeptide.
- the isolated cell can be isolated from a mutant mouse comprisixig a homozygous mutation of endogenous, chromosomal NPCILI wherein the moxise does not produce any functional NPCl LI protein.
- the mutation can be in a gene which when un-mutated encodes an amino acid sequence of SEQ ID NO: 12 (e.g., comprising a nucleotide sequence of SEQ ID NO: 11).
- the cell can be isolated or derived from duodenum, gall bladder, liver, small intestine or stomach tissue.
- the cell can be an enterocyte.
- BRIEF DESCRIPTriON OF THE FIGURES Figure 1 A shows an equilibrium saturation binding plot exhibiting the binding of 3 H-EZE-glucuronide to rhesvis brush border membrane (BBM) vesicles.
- FIG. 1 Observed total binding (Total) is shown as open circles; nonspecific binding (NS) as triangles, and specific binding (S-bind) as solid circles.
- Figure IB shows a scatcliard analysis of 3 H-EZE-glucuronide binding to rhesus brush border membrane vesicles.
- Figure 2A shows an equilibrium saturation binding plot exhibiting the binding of 3 H-EZE-glucuronide (V) to rat brush border membrane vesicles. Observed total binding (open circles) and nonspecific binding (triangles), determined in the presence of 100 ⁇ M unlabeled ezetimib e glucuronide, are included; specific binding
- Figure 3 A shows association kinetic analysis of 3 H-EZE-glucuronide in rat brush border membrane vesicles. Conditions were 25 nM of 1 and 3 mg/ml protein at 25°C.
- FIG. 4A shows association kinetic analysis of 3 H-EZE-glucuronide in rhesus brush border membrane vesicles.
- Figure 4B shows dissociation kinetic analysis of 3 H-EZE-glucuronide in rhesus brush border membrane vesicles.
- Figure 5 shows the results of a binding assay where 3 H-EZE- glucuronide is dissociated by EZE-glucuronide and compound 2 from rhesus (A) and rat (B) brush border membrane vesicles.
- Figure 6 shows the results of a binding assay where S-2 is dissociated by EZE-glucuronide and 2 from mouse brush border membrane vesicles.
- Figure 7 shows the distribution of 3 H-EZE-glucuronide binding to rhesus (A) and rat (B) brush border membranes prepared from various portions of rhesus (A) and rat (B) intestinal tissue.
- Figure 8 shows the results of a binding assay where S-2 is dissociated by EZE-glucuronide and various analogs from CHO cells transfected with rat NPCILI.
- Figure 9 shows the results of a binding assay where S-2 is dissociated by EZE-glucuronide and various analogs from CHO cells transfected with human NPCILI.
- Figure 10 shows the binding of 35 S-2 to brush border membrane vesicles prepared from wild type (A) and NPCILI knockout (-/-) mice.
- Figure 11 shows the results of a binding assay where 35 S-2 is dissociated by compound 2 from mouse wild type and NPCILI knockout (-/-) brush border membrane vesicles.
- Figure 12A shows equilibrium determination of K D for ezetimibe glucuronide by competition of unlabeled compound against 1 in rat enterocyte brush border membranes. Membranes (1.5 mg/ml protein) were incubated with 1 (50 nM) and the indicated concentrations of ezetimibe glucuronide for 1 hour to ensure equilibrium. K D at equilibrium is 600 nM.
- Figure 12B shows the corresponding measurement for rhesus monkey, which were conducted between 0.5 and 1.25 mg/ml protein and 22-50 nM 1, with incubation time of more than 3 hours. K D at equilibrium is 38.6 nM.
- Figure 13 shows the expression of NPCILI in HEK-293 cells using Western blot analysis (Panel 1) and immunofluorescence (Panel 2).
- Figure 14A shows binding of 3 H-ezetimibe glucuronide to enterocyte brush border membranes from wild type mice and NPCILI deficient mice in the presence of detergent.
- Figure 14B shows competition studies of unlabeled ezetimibe glucuronide against labeled ezetimibe glucuronide.
- Figure 15 shows the effect of detergents, taurocholate and digitonin, on
- the present invention includes NPCILI polypeptides from rat, human and mouse, along with polynucleotides encoding the respective polypeptides.
- the rat NPCILI polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 2
- the human NPCILI comprises the amino acid sequence set forth in SEQ ID NO: 4
- the mouse NPCILI polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 12.
- the rat NPCILI polynucleotide of SEQ ID NO: 1 or 10 encodes the rat NPCILI polypeptide.
- the human NPCILI polynucleotide of SEQ ID NO: 3 encodes the human NPCILI polypeptide.
- the mouse NPCILI polynucleotide of SEQ ID NO: 11 or 13 encodes the mouse NPCILI polypeptide.
- the present invention includes any isolated polynucleotide or isolated polypeptide comprising a nucleotide or amino acid sequence referred to, below, in Table 1.
- a human NPCILI is also disclosed under Genbank Accession Number AF 192522.
- the nucleotide sequence of the rat NPCILI set forth in SEQ LD NO: 1 was obtained from an expressed sequence tag (EST) from a rat jejunum enterocyte cDNA library.
- SEQ ID NOs: 5-7 include partial nucleotide sequences of three independent cDNA clones.
- the downstream sequence of the SEQ ID NO: 5 EST (603662080F1) were determined; the sequencing data from these experiments are set forth in SEQ ID NO: 8.
- the upstream sequences were also determined; these data are set forth in SEQ ID NO: 9.
- SEQ ID NOs: 43 and 44 are the nucleotide and amino acid sequence, respectively, of human NPCILI which is disclosed under Genbank Accession No.: AF192522 (see Davies, et al, (2000) Genomics 65(2): 137-45).
- SEQ ID NO: 45 is the nucleotide sequence of a mouse NPCILI which is disclosed under Genbank Accession No. AK078947.
- NPCILI mediates intestinal sterol (e.g., cholesterol) or 5 ⁇ -stanol abso ⁇ tion.
- Inhibition of NPCILI in a patient is a useful method for reducing intestinal sterol (e.g., cholesterol) or 5 ⁇ -stanol abso ⁇ tion and serum sterol (e.g., cholesterol) or 5 ⁇ -stanol in the patient.
- Reducing the level of intestinal sterol (e.g., cholesterol) or 5 ⁇ -stanol abso ⁇ tion and serum sterol (e.g., cholesterol) or 5 ⁇ -stanol in a patient is a useful way in which to treat or prevent the occurrence of atherosclerosis, particularly diet-induced atherosclerosis.
- sterol includes, but is not limited to, cholesterol and phytosterols (including, but not limited to, sitosterol, campesterol, stigmasterol and avenosterol).
- 5 ⁇ -stanol includes, but is not limited to, cholestanol, 5 ⁇ -campestanol and 5 -sitostanol.
- SCAP controls activation of sterol regulatory element binding proteins (SREBP), a transcription factor which controls more than 35 genes related to lipid and cholesterol homeostasis (Brown, M.S. & Goldstein, J.L. A proteolytic pathway that controls the cholesterol content of membranes, cells, and blood. Proc. Natl. Acad. Sci. U.S.A. 96, 11041-11048 (1999)).
- SREBP sterol regulatory element binding proteins
- the SSD consisting of ⁇ 180 amino acids in a packet of 5 putative membrane-spanning helices, also serves a regulatory function in two key enzymes on the cholesterol biosynthesis pathway and is present in the receptor Patched.
- nucleic acid or “nucleic acid molecule” may refer to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules”), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in single stranded form, double-stranded form or otherwise.
- RNA molecules phosphate ester polymeric form of ribonucleosides
- deoxyribonucleosides deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine
- DNA molecules or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in single stranded form, double-strand
- a “polynucleotide sequence”, “nucleic acid sequence” or “nucleotide sequence” is a series of nucleotide bases (also called “nucleotides”) in a nucleic acid, such as DNA or RNA, and means any chain of two or more nucleotides.
- a “coding sequence” or a sequence “encoding” an expression product, such as a RNA, polypeptide, protein, or enzyme, is a nucleotide sequence that, when expressed, results in production of the product.
- gene means a DNA sequence that codes for or corresponds to a particular sequence of ribonucleotides or amino acids which comprise all or part of one or more RNA molecules, proteins or enzymes, and may or may not include regulatory DNA sequences, such as promoter sequences, which determine, for example, the conditions under which the gene is expressed. Genes may be transcribed from DNA to RNA which may or may not be translated into an amino acid sequence.
- the present invention includes nucleic acid fragments of any of SEQ
- a nucleic acid "fragment” includes at least about 30 (e.g., 31, 32, 33, 34), preferably at least about 35 (e.g, 25, 26, 27, 28, 29, 30, 31, 32, 33 or 34), more preferably at least about 45 (e.g., 35, 36, 37, 38, 39, 40, 41, 42, 43 or 44), and most preferably at least about 126 or more contiguous nucleotides (e.g., 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 1000 or 1200) from any of SEQ ID NOs: 1, 5-11 or 13.
- the present invention also includes nucleic acid fragments consisting of at least about 7 (e.g., 9, 12, 17, 19), preferably at least about 20 (e.g., 30, 40, 50, 60), more preferably about 70 (e.g., 80, 90, 95), yet more preferably at least about 100 (e.g., 105, 110, 114) and even more preferably at least about 115 (e.g., 117, 119, 120, 122, 124, 125, 126) contiguous nucleotides from any of SEQ ID NOs: 1, 5-11 or 13.
- nucleic acid fragments consisting of at least about 7 (e.g., 9, 12, 17, 19), preferably at least about 20 (e.g., 30, 40, 50, 60), more preferably about 70 (e.g., 80, 90, 95), yet more preferably at least about 100 (e.g., 105, 110, 114) and even more preferably at least about 115 (e.g., 117, 119, 120, 122,
- oligonucleotide refers to a nucleic acid, generally of no more than about 100 nucleotides (e.g., 30, 40, 50, 60, 70, 80, or 90), that may be hybridizable to a genomic DNA molecule, a cDNA molecule, or an mRNA molecule encoding a gene, mRNA, cDNA, or other nucleic acid of interest.
- Oligonucleotides can be labeled, e.g., by inco ⁇ oration of 32 P-nucleotides, 3 H- nucleotides, 14 C-nucleotides, 35 S-nucleotides or nucleotides to which a label, such as biotin, has been covalently conjugated.
- a labeled oligonucleotide can be used as a probe to detect the presence of a nucleic acid.
- oligonucleotides (one or both of which may be labeled) can be used as PCR primers, either for cloning full length or a fragment of the gene, or to detect the presence of nucleic acids.
- oligonucleotides are prepared synthetically, preferably on a nucleic acid synthesizer.
- a "protein sequence”, “peptide sequence” or “polypeptide sequence” or “amino acid sequence” may refer to a series of two or more amino acids in a protein, peptide or polypeptide.
- Protein”, “peptide” or “polypeptide” includes a contiguous string of two or more amino acids.
- Preferred peptides of the invention include those set forth in any of SEQ ID NOs: 2 or 12 as well as variants and fragments thereof.
- Such fragments preferably comprise at least about 10 (e.g., 11, 12, 13, 14, 15, 16, 17, 18 or 19), more preferably at least about 20 (e.g., 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40), and yet more preferably at least about 42 (e.g., 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, 100, 110, 120 or 130) or more contiguous amino acid residues from any of SEQ ID NOs: 2 or 12.
- 10 e.g., 11, 12, 13, 14, 15, 16, 17, 18 or 19
- 20 e.g., 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40
- 42 e.g., 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, 100, 110, 120 or 130
- contiguous amino acid residues from any of SEQ ID NOs: 2 or 12.
- the present invention also includes polypeptides, preferably antigenic polypeptides, consisting of at least about 7 (e.g., 9, 10, 13, 15, 17, 19), preferably at least about 20 (e.g., 22, 24, 26, 28), yet more preferably at least about 30 (e.g., 32, 34, 36, 38) and even more preferably at least about 40 (e.g., 41, 42) contiguous amino acids from any of SEQ ID NOs: 2 or 12.
- the polypeptides of the invention can be produced by proteolytic cleavage of an intact peptide, by chemical synthesis or by the application of recombinant DNA technology and are not limited to polypeptides delineated by proteolytic cleavage sites.
- the polypeptides are useful as antigens to elicit the production of antibodies and fragments thereof.
- the antibodies can be used, e.g., in immunoassays for immunoaffinity purification or for inhibition of NPCILI, etc.
- PCR polymerase chain reaction
- host cell includes any cell of any organism that is selected, modified, transfected, transformed, grown, or used or manipulated in any way, for the production of a substance by the cell, for example, the expression or replication, by the cell, of a gene, a DNA or RNA sequence or a protein.
- Preferred host cells include HEK-293 cells, Chinese hamster ovary (CHO) cells, murine macrophage J774 cells or any other macrophage cell line and human intestinal epithelial Caco2 cells.
- the nucleotide sequence of a nucleic acid may be determined by any method known in the art (e.g., chemical sequencing or enzymatic sequencing). "Chemical sequencing" of DNA includes methods such as that of Maxam and Gilbert (1977) (Proc.
- Enzymatic sequencing of DNA includes methods such as that of Sanger (Sanger, et al, (1977) Proc. Natl. Acad. Sci. USA 74: 5463).
- the nucleic acids herein may be flanked by natural regulatory (expression control) sequences, or may be associated with heterologous sequences, including promoters, internal ribosome entry sites (IRES) and other ribosome binding site sequences, enhancers, response elements, suppressors, signal sequences, polyadenylation sequences, introns, 5'- and 3'- non-coding regions, and the like.
- a “promoter” or “promoter sequence” is a DNA regulatory region capable of binding an RNA polymerase in a cell (e.g., directly or through other promoter-bound proteins or substances) and initiating transcription of a coding sequence.
- a promoter sequence is, in general, bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at any level. Within the promoter sequence may be found a transcription initiation site (conveniently defined, for example, by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
- the promoter may be operably associated with other expression control sequences, including enhancer and repressor sequences or with a nucleic acid of the invention.
- Promoters which may be used to control gene expression include, but are not limited to, cytomegalovirus (CMV) promoter (U.S. Patent Nos.
- a coding sequence is "under the control of 7 "functionally associated with” or “operably associated with” transcriptional and translational control sequences in a cell when the sequences direct RNA polymerase mediated transcription of the coding sequence into RNA, preferably mRNA, which then may be RNA spliced (if it contains introns) and, optionally, translated into a protein encoded by the coding sequence.
- RNA preferably mRNA
- the terms “express” and “expression” mean allowing or causing the information in a gene, RNA or DNA sequence to become manifest; for example, producing a protein by activating the cellular functions involved in transcription and translation of a corresponding gene.
- a DNA sequence is expressed in or by a cell to form an "expression product" such as an RNA (e.g., mRNA) or a protein.
- the expression product itself may also be said to be “expressed” by the cell.
- transformation means the introduction of a nucleic acid into a cell.
- the introduced gene or sequence may be called a "clone”.
- a host cell that receives the introduced DNA or RNA has been "transformed” and is a “transformant” or a “clone.”
- the DNA or RNA introduced to a host cell can come from any source, including cells of the same genus or species as the host cell, or from cells of a different genus or species.
- vector includes a vehicle (e.g., a plasmid) by which a DNA or RNA sequence can be introduced into a host cell, so as to transform the host and, optionally, promote expression and/or replication of the introduced sequence.
- vehicles that can be used in this invention include plasmids, viruses, bacteriophage, integratable DNA fragments, and other vehicles that may facilitate introduction of the nucleic acids into the genome of the host. Plasmids are the most commonly used form of vector but all other forms of vectors which serve a similar function and which are, or become, known in the art are suitable for use herein.
- expression system means a host cell and compatible vector which, under suitable conditions, can express a protein or nucleic acid which is carried by the vector and introduced to the host cell.
- Common expression systems include E. coli host cells and plasmid vectors, insect host cells and Baculovirus vectors, and mammalian host cells and vectors.
- nucleic acids encoding the NPCILI polypeptides of this invention can be carried out by conventional methods in either prokaryotic or eukaryotic cells.
- E. coli host cells are employed most frequently in prokaryotic systems, many other bacteria, such as various strains of Pseudomonas and Bacillus, are known in the art and can be used as well.
- Suitable host cells for expressing nucleic acids encoding the NPCILI polypeptides include prokaryotes and higher eukaryotes. Prokaryotes include both gram-negative and gram-positive organisms, e.g., E. coli and B. subtilis.
- Higher eukaryotes include established tissue culture cell lines from animal cells, both of non-mammalian origin, e.g., insect cells, and birds, and of mammalian origin, e.g., human, primates, and rodents.
- Prokaryotic host- vector systems include a wide variety of vectors for many different species.
- a representative vector for amplifying DNA is pBR322 or many of its derivatives (e.g. , pUCl 8 or 19).
- Vectors that can be used to express the NPCILI polypeptides include, but are not limited to, those containing the lac promoter (pUC-series); trp promoter (pBR322-trp); Ipp promoter (the pIN-series); lambda-pP or pR promoters (pOTS); or hybrid promoters such asptac (pDR540). See Brosius et al, "Expression Vectors Employing Lambda-, trp-, lac-, and ipp-derived Promoters", in Rodriguez and Denhardt (eds.) Vectors: A Survey of Molecular Cloning Vectors and Their Uses, 1988, Buttersworth, Boston, pp. 205-236.
- polypeptides can be expressed, at high levels, in an E.coli/Tl expression system as disclosed in U.S. Patent Nos. 4,952,496; 5,693,489 and 5,869,320 and in Davanloo, P., et al, (1984) Proc. Natl. Acad. Sci. USA 81 : 2035-2039; Studier, F.W., et al,
- eukaryotic tissue culture cells may also be used for the recombinant production of the NPCILI polypeptides of the invention. Although any higher eukaryotic tissue culture cell line might be used, including insect baculovirus expression systems, mammalian cells are preferred. Transformation or transfection and propagation of such cells have become a routine procedure.
- Examples of useful cell lines include HeLa cells, Chinese hamster ovary (CHO) cell lines, J774 cells, HEK-293 cells, Caco2 cells, baby rat kidney (BRK) cell lines, insect cell lines, bird cell lines, and monkey (COS) cell lines.
- Expression vectors for such cell lines usually include an origin of replication, a promoter, a translation initiation site, RNA splice sites (if genomic DNA is used), a polyadenylation site, and a transcription termination site. These vectors also, usually, contain a selection gene or amplification gene.
- Suitable expression vectors may be plasmids, viruses, or retroviruses carrying promoters derived, e.g., from such sources as adenovirus, SV40, parvoviruses, vaccinia virus, or cytomegalovirus.
- Examples of expression vectors include pCR®3.1, pCDNAl, pCD (Okayama, et al, (1985) Mol. Cell Biol. 5: 1136), pMClneo Poly-A (Thomas, et al, (1987) Cell 51: 503), pREP8, pSVSPORT and derivatives thereof, and baculovirus vectors such as pAC373 or pAC610.
- One embodiment of the invention includes membrane bound NPC 1 LI .
- NPCILI can be expressed in the cell membrane of a eukaryotic cell and the membrane bound protein can be isolated from the cell by conventional methods which are known in the art.
- the present invention also includes fusions which include the NPCILI polypeptides and NPCILI polynucleotides of the present invention and a second polypeptide or polynucleotide moiety, which may be referred to as a "tag".
- the fusions of the present invention may comprise any of the polynucleotides or polypeptides set forth in Table 1 or any subsequence or fragment thereof (discussed above).
- the fused polypeptides of the invention may be conveniently constructed, for example, by insertion of a polynucleotide of the invention or fragment thereof into an expression vector.
- the fusions of the invention may include tags which facilitate purification or detection.
- tags include glutathione-S-transferase (GST), hexahistidine (His6) tags, maltose binding protein (MBP) tags, haemagglutinin (HA) tags, cellulose binding protein (CBP) tags and myc tags.
- Detectable tags such as 32 P, 35 S, 3 H, 99m Tc, 123 I, U1 ln, 68 Ga, 18 F, 125 1, 131 1, 113m In, 76 Br, 67 Ga, 99m Tc, 123 I, l ⁇ In and 68 Ga may also be used to label the polypeptides and polynucleotides of the invention. Methods for constructing and using such fusions are very conventional and well known in the art. Modifications (e.g., post-translational modifications) that occur in a polypeptide often will be a function of how it is made.
- polypeptides made by expressing a cloned gene in a host for instance, the nature and extent of the modifications, in large part, will be determined by the host cell's post-translational modification capacity and the modification signals present in the polypeptide amino acid sequence.
- glycosylation often does not occur in bacterial hosts such as E. coli.
- a polypeptide can be expressed in a glycosylating host, generally a eukaryotic cell.
- Insect cells often carry out post-translational glycosylations which are similar to those of mammalian cells. For this reason, insect cell expression systems have been developed to express, efficiently, mammalian proteins having native patterns of glycosylation.
- An insect cell which may be used in this invention is any cell derived from an organism of the class Insecta.
- the insect is Spodoptera fruigiperda (Sf9 or Sf21) or Trichoplusia ni (High 5).
- Examples of insect expression systems that can be used with the present invention, for example to produce NPCl LI polypeptide include Bac-To-Bac (Invitrogen Co ⁇ oration, Carlsbad, CA) or Gateway (Invitrogen Co ⁇ oration, Carlsbad, CA).
- deglycosylation enzymes can be used to remove carbohydrates attached during production in eukaryotic expression systems.
- Other modifications may also include addition of aliphatic esters or amides to the polypeptide carboxyl terminus.
- the present invention also includes analogs of the NPCILI polypeptides which contain modifications, such as inco ⁇ oration of unnatural amino acid residues, or phosphorylated amino acid residues such as phosphotyrosine, phosphoserine or phosphothreonine residues. Other potential modifications include sulfonation, biotinylation, or the addition of other moieties.
- the NPCILI polypeptides of the invention may be appended with a polymer which increases the half-life of the peptide in the body of a subject.
- Preferred polymers include polyethylene glycol (PEG) (e.g., PEG with a molecular weight of 2 kDa, 5 kDa, 10 kDa, 12 kDa, 20 kDa, 30 kDa and 40 kDa), dextran and monomethoxypolyethylene glycol (mPEG).
- PEG polyethylene glycol
- mPEG monomethoxypolyethylene glycol
- the peptides of the invention may also be cyclized. Specifically, the amino- and carboxy-tenninal residues of an NPCILI polypeptide or two internal residues of an NPCILI polypeptide of the invention can be fused to create a cyclized peptide.
- Function-conservative variants of the polypeptides of the invention are also contemplated by the present invention.
- “Function-conservative variants” are those in which one or more amino acid residues in a protein or enzyme have been changed without altering the overall conformation and function of the polypeptide, including, but, by no means, limited to, replacement of an amino acid with one having similar properties. Amino acids with similar properties are well known in the art.
- polar/hydrophilic amino acids which may be interchangeable include asparagine, glutamine, serine, cysteine, threonine, lysine, arginine, histidine, aspartic acid and glutamic acid; nonpolar/hydrophobic amino acids which may be interchangeable include glycine, alanine, valine, leucine, isoleucine, proline, tyrosine, phenylalanine, tryptophan and methionine; acidic amino acids, which may be interchangeable include aspartic acid and glutamic acid and basic amino acids, which may be interchangeable include histidine, lysine and arginine.
- the present invention includes polynucleotides encoding rat, human or mouse NPCILI and fragments thereof as well as nucleic acids which hybridize to the polynucleotides.
- the nucleic acids hybridize under low stringency conditions, more preferably under moderate stringency conditions and most preferably under high stringency conditions.
- a nucleic acid molecule is
- hybridizable to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength (see Sambrook, et al, supra).
- the conditions of temperature and ionic strength determine the "stringency" of the hybridization.
- Typical low stringency hybridization conditions are 55°C, 5X SSC, 0.1% SDS, 0.25% milk, and no formamide at 42°C; or 30% formamide, 5X SSC, 0.5% SDS at 42°C.
- Typical, moderate stringency hybridization conditions are similar to the low stringency conditions except the hybridization is carried out in 40% formamide, with 5X or 6X SSC at 42°C.
- High stringency hybridization conditions are similar to low stringency conditions except the hybridization conditions are carried out in 50% formamide, 5X or 6X SSC and, optionally, at a higher temperature (e.g., higher than 42°C: 57°C, 59°C, 60°C, 62°C, 63°C, 65°C or 68°C).
- SSC is 0.15M NaCl and 0.015M Na-citrate.
- Hybridization requires that the two nucleic acids contain complementary sequences, although, depending on the stringency of the hybridization, mismatches between bases are possible.
- the appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the higher the stringency under which the nucleic acids may hybridize. For hybrids of greater than 100 nucleotides in length, equations for calculating the melting temperature have been derived (see Sambrook, et al, supra, 9.50-9.51). For hybridization with shorter nucleic acids, i.e., oligonucleotides, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see Sambrook, et al, supra).
- polynucleotides comprising nucleotide sequences and polypeptides comprising amino acid sequences which are at least about 70% identical, preferably at least about 80% identical, more preferably at least about 90% identical and most preferably at least about 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, 100%) to the reference rat NPCILI nucleotide (e.g., any of SEQ ID NOs: 1 or 5-10) and amino acid sequences (e.g., SEQ ID NO: 2), reference human NPCILI nucleotide (e.g., SEQ ID NO: 3) and amino acid sequences (e.g., SEQ ID NO: 4) or the reference mouse NPCILI nucleotide (e.g., any of SEQ ID NOs: 11 or 13) and amino acid sequences (e.g., SEQ ID NO: 12), when the comparison is performed by a BLAST algorithm wherein the parameters of the algorithm are selected to
- Polypeptides comprising amino acid sequences which are at least about 70% similar, preferably at least about 80% similar, more preferably at least about 90% similar and most preferably at least about 95% similar (e.g., 95%, 96%, 97%, 98%, 99%, 100%) to the reference rat NPCILI amino acid sequence of SEQ ID NO: 2, reference human NPCILI amino acid sequence of SEQ ID NO: 4 or the reference mouse NPCILI amino acid sequence of SEQ ID NO: 12, when the comparison is performed with a BLAST algorithm wherein the parameters of the algorithm are selected to give the largest match between the respective sequences over the entire length of the respective reference sequences, are also included in the present invention.
- Sequence identity refers to exact matches between the nucleotides or amino acids of two sequences which are being compared. Sequence similarity refers to both exact matches between the amino acids of two polypeptides which are being compared in addition to matches between nonidentical, biochemically related amino acids. Biochemically related amino acids which share similar properties and may be interchangeable are discussed above.
- the following references regarding the BLAST algorithm are herein inco ⁇ orated by reference: BLAST ALGORITHMS: Altschul, S.F., et al, (1990) J. Mol. Biol. 215: 403-410; Gish, W., et al, (1993) Nature Genet. 3: 266-272; Madden, T.L., et al, (1996) Meth.
- proteins, polypeptides and antigenic fragments of this invention can be purified by standard methods, including, but not limited to, salt or alcohol precipitation, affinity chromatography (e.g., used in conjunction with a purification tagged NPCILI polypeptide as discussed above), preparative disc-gel electrophoresis, isoelectric focusing, high pressure liquid chromatography (HPLC), reversed-phase HPLC, gel filtration, cation and anion exchange and partition chromatography, and countercurrent distribution.
- HPLC high pressure liquid chromatography
- HPLC high pressure liquid chromatography
- reversed-phase HPLC gel filtration
- anion exchange and partition chromatography and countercurrent distribution.
- Purification steps can be followed by performance of assays for receptor binding activity as described below.
- an NPCILI polypeptide is being isolated from a cellular or tissue source, it is preferable to include one or more inhibitors of proteolytic enzymes in the assay system, such as phenylmethanesulfonyl fluoride (PMSF), Pefabloc SC, pepstatin, leupeptin, chymostatin and EDTA.
- PMSF phenylmethanesulfonyl fluoride
- Pefabloc SC pepstatin
- leupeptin leupeptin
- chymostatin EDTA
- Antigenic (including immunogenic) fragments of the NPCILI polypeptides of the invention are within the scope of the present invention (e.g., 42 or more contiguous amino acids from SEQ ID NO: 2, 4 or 12).
- the antigenic peptides maybe useful, ter alia, for preparing isolated antibody molecules which recognize NPCILI.
- Isolated anti-NPClLl antibody molecules are useful NPCILI ligands.
- An antigen is any molecule that can bind specifically to an antibody. Some antigens cannot, by themselves, elicit antibody production. Those that can induce antibody production are immunogens.
- isolated anti-NPClLl antibodies recognize an antigenic peptide comprising an amino acid sequence selected from SEQ ID NOs: 39-42 (e.g., an antigen derived from rat NPCILI). More preferably, the antibody is A0715, A0716, A0717, A0718, A0867, A0868, A1801 or A1802.
- antibody molecule includes, but is not limited to, antibodies and fragments (preferably antigen-binding fragments) thereof.
- the tenn includes monoclonal antibodies, polyclonal antibodies, bispecific antibodies, Fab antibody fragments, F(ab) 2 antibody fragments, Fv antibody fragments (e.g., N H or V L ), single chain Fv antibody fragments and dsFv antibody fragments.
- the antibody molecules of the invention may be fully human antibodies, mouse antibodies, rat antibodies, rabbit antibodies, goat antibodies, chicken antibodies, humanized antibodies or chimeric antibodies.
- ⁇ PC1L1 polypeptides are used as antigens to elicit antibody production in an immunologically competent host, smaller antigenic fragments are, preferably, first rendered more immunogenic by cross-linking or concatenation, or by coupling to an immunogenic carrier molecule (i .
- Carrier molecules include, e.g., proteins and natural or synthetic polymeric compounds such as polypeptides, polysaccharides, lipopolysaccharides, etc.
- Protein carrier molecules are especially preferred, including, but not limited to, keyhole limpet hemocyanin and mammalian serum proteins such as human or bovine gammaglobulin, human, bovine or rabbit serum albumin, or methylated or other derivatives of such proteins.
- Other protein carriers will be apparent to those skilled in the art.
- the protein carrier will be foreign to the host animal in which antibodies against the fragments are to be elicited.
- Covalent coupling to the carrier molecule can be achieved using methods well known in the art, the exact choice of which will be dictated by the nature of the carrier molecule used.
- the fragments of the invention can be coupled, e.g., using water-soluble carbodiimides such as dicyclohexylcarbodiimide or glutaraldehyde. Coupling agents, such as these, can also be used to cross-link the fragments to themselves without the use of a separate carrier molecule. Such cross- linking into aggregates can also increase immunogenicity. Immunogenicity can also be increased by the use of known adjuvants, alone or in combination with coupling or aggregation.
- Adjuvants for the vaccination of animals include, but are not limited to, Adjuvant 65 (containing peanut oil, mannide monooleate and aluminum monostearate); Freund's complete or incomplete adjuvant; mineral gels such as aluminum hydroxide, aluminum phosphate and alum; surfactants such as hexadecylamine, octadecylamine, lysolecithin, dimethyldioctadecylammonium bromide, N,N-dioctadecyl-N',N'-bis(2-hydroxymethyl) propanediamine, methoxyhexadecylglycerol and pluronic polyols; polyanions such as pyran, dextran sulfate, poly IC, polyacrylic acid and carbopol; peptides such as muramyl dipeptide, dimethylglycine and tuftsin; and oil emulsions.
- Adjuvant 65 containing peanut oil, mannide
- polypeptides could also be administered following inco ⁇ oration into liposomes or other microcarriers.
- Information concerning adjuvants and various aspects of immunoassays are disclosed, e.g., in the series by P. Tijssen, Practice and Theory of Enzyme Immunoassays. 3rd Edition, 1987, Elsevier, New York.
- Other useful references covering methods for preparing polyclonal antisera include Microbiology, 1969, Hoeber Medical Division, Ha ⁇ er and Row; Landsteiner, Specificity of Serological Reactions. 1962, Dover Publications, New York, and Williams, et al, Methods in Immunology and Immunochemistrv. Vol. 1, 1967, Academic Press, New York.
- the anti-NPClLl antibody molecules of the invention preferably recognize human, mouse or rat NPCILI; however, the present invention includes antibody molecules which recognize NPCILI from any species, preferably mammals (e.g., cat, sheep or horse).
- the present invention also includes complexes comprising an NPCILI polypeptide of the invention and an anti-NPClLl antibody molecule. Such complexes can be made by simply contacting the antibody molecule with its cognate polypeptide.
- Various methods may be used to make the antibody molecules of the invention. Human antibodies can be made, for example, by methods which are similar to those disclosed in U.S. Patent Nos. 5,625,126; 5,877,397; 6,255,458; 6,023,010 and 5,874,299.
- Hybridoma cells which produce the monoclonal anti-NPClLl antibodies may be produced by methods which are commonly known in the art. These methods include, but are not limited to, the hybridoma technique originally developed by Kohler, et al, (1975) (Nature 256: 495-497), as well as the trioma technique (Hering, et al, (1988) Biomed. Biochim. Acta. 47: 211-216 and Hagiwara, et al, (1993) Hum. Antibod. Hybridomas 4: 15), the human B-cell hybridoma technique (Kozbor, et al, (1983) Immunology Today 4: 72 and Cote, et al, (1983) Proc. Natl. Acad. Sci.
- ELISA may be used to determine if hybridoma cells are expressing anti-NPClLl antibodies.
- the anti-NPClLl antibody molecules of the present invention may also be produced recombinantly (e.g., in an E.colilTl expression system as discussed above).
- nucleic acids encoding the antibody molecules of the invention e.g., V H or V L
- V H or V L may be inserted into a pet-based plasmid and expressed in the E.colilTl system.
- Monoclonal antibodies are highly specific, being directed against a single antigenic site. Monoclonal antibodies are advantageous in that they may be synthesized by a hybridoma culture, essentially uncontaminated by other immunoglobulins.
- the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
- the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method as described by Kohler, et al, (1975) Nature 256: 495.
- the term "polyclonal antibody” includes an antibody which was produced among or in the presence of one or more other, non-identical antibodies.
- polyclonal antibodies are produced from a B-lymphocyte in the presence of several other B-lymphocytes which produced non-identical antibodies.
- polyclonal antibodies are obtained directly from an immunized animal (e.g., a rabbit).
- a "bispecific antibody” comprises two different antigen binding regions which bind to distinct antigens. Bispecific antibodies, as well as methods of making and using the antibodies, are conventional and very well known in the art.
- Anti-idiotypic antibodies or anti-idiotypes are antibodies directed against the antigen-combining region or variable region (called the idiotype) of another antibody molecule.
- Jerne Jerne, N. K., (1974) Ann. Immunol. (Paris) 125c: 373
- immunization with an antibody molecule expressing a paratope (antigen-combining site) for a given antigen will produce a group of anti-antibodies, some of which share, with the antigen, a complementary structure to the paratope.
- Immunization with a subpopulation of the anti-idiotypic antibodies will, in turn, produce a subpopulation of antibodies or immune cell subsets that are reactive to the initial antigen.
- the term "fully human antibody” refers to an antibody which comprises human immunoglobulin sequences only.
- mae antibody refers to an antibody which comprises mouse immunoglobulin sequences only.
- Human/mouse chimeric antibody refers to an antibody which comprises a mouse variable region (V H and VL) fused to a human constant region.
- “Humanized” anti-NPClLl antibodies are also within the scope of the present invention.
- Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, which contain minimal sequence derived from non- human immunoglobulin.
- humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a complementary determining region of the recipient are replaced by residues from a complementary determining region of a nonhuman species (donor antibody), such as mouse, rat or rabbit, having a desired specificity, affinity and capacity.
- Fv framework residues of the human immunoglobulin are also replaced by corresponding non-human residues.
- Single-chain Fv or “sFv” antibody fragments include the VH and/or V domains of an antibody, wherein these domains are present in a single polypeptide chain.
- the sFv polypeptide further comprises a polypeptide linker between the V H and V L domains which enables the sFv to form the desired structure for antigen binding.
- Disulfide stabilized Fv fragments and “dsFv” include molecules having a variable heavy chain (V H ) and/or a variable light chain (V L ) which are linked by a disulfide bridge.
- Antibody fragments within the scope of the present invention also include F(ab) fragments which may be produced by enzymatic cleavage of an IgG by, for example, pepsin.
- Fab fragments may be produced by, for example, reduction of F(ab) with dithiothreitol or mercaptoethylamine.
- An FV fragment is a VL or V H region.
- immunoglobulins can be assigned to different classes. There are at least five major classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, and several of these maybe further divided into subclasses (isotypes), e.g., IgG-1, IgG-2, IgG-3 and IgG-4; IgA-1 and IgA-2.
- the anti-NPClL-1 antibody molecules of the invention may also be conjugated to a chemical moiety.
- the chemical moiety may be, inter alia, a polymer, a radionuclide or a cytotoxic factor.
- the chemical moiety is a polymer which increases the half-life of the antibody molecule in the body of a subject.
- Suitable polymers include, but are by no means limited to, polyethylene glycol (PEG) (e.g., PEG with a molecular weight of 2kDa, 5kDa, lOkDa, 12kDa, 20kDa, 30kDa or 40kDa), dextran and monomethoxypolyethylene glycol (mPEG).
- the antibody molecules of the invention may also be conjugated with labels such as 99 Tc, 90 Y, m In, 32 P, 14 C, 125 1, 3 H, 131 I, n C, 15 0, 13 N, 18 F, 35 S, 51 Cr, 57 To, 226 Ra, 60 Co, 59 Fe, 57 Se, 152 Eu, 67 CU, 217 Ci, 211 At, 212 Pb, 47 Sc, 109 Pd, 234 Th, 40 K, 157 Gd, 55 Mn, 52 Tr or 56 Fe.
- labels such as 99 Tc, 90 Y, m In, 32 P, 14 C, 125 1, 3 H, 131 I, n C, 15 0, 13 N, 18 F, 35 S, 51 Cr, 57 To, 226 Ra, 60 Co, 59 Fe, 57 Se, 152 Eu, 67 CU, 217 Ci, 211 At, 212 Pb, 47 Sc, 109 Pd, 234 Th, 40 K, 157 Gd, 55 Mn, 52 Tr or 56 Fe.
- the antibody molecules of the invention may also be conjugated with fluorescent or chemilluminescent labels, including fluorophores such as rare earth chelates, fluorescein and its derivatives, rhodamine and its derivatives, isothiocyanate, phycoerythrin, phycocyanin, allophycocyanin, o-phthaladehyde, fluorescamine, 152 Eu, dansyl, umbelliferone, luciferin, luminal label, isoluminal label, an aromatic acridinium ester label, an imidazole label, an acridimium salt label, an oxalate ester label, an aequorin label, 2,3-dihydrophthalazinediones, biotin/avidin, spin labels and stable free radicals.
- fluorophores such as rare earth chelates, fluorescein and its derivatives, rhodamine and its derivatives, isothiocyanate, phycoerythrin,
- the antibody molecules may also be conjugated to a cytotoxic factor such as diptheria toxin, Pseudomonas aeruginosa exotoxin A chain, ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins and compounds (e.g., fatty acids), dianthin proteins, Phytoiacca americana proteins PAP I, PAPII, and PAP-S, momordica charantia inhibitor, curcin, crotin, saponaria ojficinalis inhibitor, mitogellin, restrictocin, phenomycin, and enomycin.
- a cytotoxic factor such as diptheria toxin, Pseudomonas aeruginosa exotoxin A chain, ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins and compounds (e.g., fatty acids
- NPCILI neuropeptide-like cleavage agent
- SEQ ID NO: 2, 4 or 12 a sequence of amino acids that may be useful in treatment and management of a variety of medical conditions, including elevated serum sterol (e.g., cholesterol) or 5 ⁇ -stanol.
- NPCILI of this invention can be employed in screening systems to identify ligands.
- These ligands may be agonists or antagonists of NPCILI.
- these assays provide methods for identifying ligands of NPCILI by using (1) NPCILI, (2) an appropriate known NPCILI ligand, agonist or antagonist, for example, a sterol (such as cholesterol, phytosterols, including, but not limited to, sitosterol, campesterol, stigmasterol and avenosterol), a cholesterol oxidation product, a 5 ⁇ -stanol (including, but not limited to, cholestanol, 5 ⁇ -campestanol and 5 ⁇ - sitostanol), a substituted azetidinone (e.g., ezetimibe), BODLPY-ezetimibe (Altmann, et al, (2002) Biochim. Biophys.
- a sterol such as cholesterol, phytosterols, including, but not limited to, sitosterol, campesterol, stigmasterol and avenosterol
- a cholesterol oxidation product e.g., cholestanol, 5
- substituted azetidinone, ezetimibe, sterol (such as cholesterol) or 5 ⁇ -stanol) binds preferentially to NPCILI in comparison to other proteins in the assay system.
- detection of the specific binding of a ligand of NPCILI binds specifically to NPCILI is made apparent when a signal generated in the assay to indicate such binding exceeds, to any extent, a signal generated in a negative control wherein, for example, NPCILI or ligand is absent.
- “specific binding” includes binding of a ligand either directly to NPCILI or indirectly, for example via another moiety, in a complex of which NPCILI is a part.
- the moiety to which an NPCILI ligand binds can be another protein or a post-translational modification of NPCILI (e.g., a lipid chain or a carbohydrate chain).
- NPCILI e.g., a lipid chain or a carbohydrate chain.
- suitable substituted azetidinones for use in the screening assays include those disclosed in U.S. Patent Nos.
- the present invention provides for a method by which to evaluate whether a sample contains an NPCILI ligand by determining whether the sample contains a candidate compound which competes for binding between the known ligand (e.g., ezetimibe, ezetimibe-glucuronide, compound 2, etc.) and NPCILI.
- the ligand may be an agonist or antagonist.
- the binding of the known ligand (e.g., ezetimibe, ezetimibe-glucuronide, compound 2, etc.) to NPCILI is disrupted.
- known ligand refers to a compound which is known to bind to NPCILI and which can be detectably labeled for use in the screening assays and methods described herein.
- known ligands include the substituted 2-azetidinone glucuronides which can be detectably labeled for use in screening assays as described herein.
- Ezetimibe can be prepared by a variety of methods well know to those skilled in the art, for example such as are disclosed in U.S. Patents Nos. 5,631,365, 5,767,115, 5,846,966, 6,207,822, U.S. Patent Application Publication No.
- sample refers to a compound or composition which is evaluated in a test or assay, for example, for the ability to bind to NPCILI (e.g., SEQ ID NO: 2, 4 or 12) or a functional fragment thereof.
- the composition may comprise candidate compounds, such as small molecules, peptides, nucleotides, polynucleotides, subatomic particles (e.g., a particles, ⁇ particles) or antibodies.
- the present invention provides methods for identifying ligands of a compound that binds to NPCILI which involve contacting NPCILI with a detectably labeled substituted 2-azetidinone, preferably substituted 2-azetidinone-glucuronide, and a candidate compound, and determining whether the candidate compound binds to NPCILI, wherein binding of said candidate compound to NPCILI modulates binding of the detectably labeled substituted 2-azetidinone to NPCILI .
- the modulation of the binding of the substituted 2-azetidinone to NPCILI by the binding of the candidate compound to NPCILI indicates that the candidate compound is a ligand that binds to NPCILI.
- the present invention also provides a method for identifying a ligand of NPCILI comprising contacting NPCILI with a detectably labeled substituted 2- azetidinone, preferably substituted 2-azetidinone-glucuronide, and measuring the binding of NPCILI of the detectably labeled substituted 2-azetidinone in the presence and absence of a candidate compound, wherein decreased binding of the detectably labeled substituted 2-azetidinone to the NPCILI in the presence of the candidate compound indicates that said candidate compound is a ligand of NPCILI and is an inhibitor of sterol and 5 ⁇ -stanol abso ⁇ tion.
- the substituted 2-azetidinone is detectably labeled with 3 H, 35 S, 125 I, or a fluorescently labeled substituted 2-azetidinone.
- the substituted 2-azetidinone is labeled with 35 S or 125 I, and particularly 35 S.
- the substituted 2-azetidinone is substituted 2-azetidinone- glucuronide.
- Compounds that are substituted 2-azetidinone-glucuronides are those having the following structure (I):
- X 1 represents a group that links the glucuronide to the 4-phenyl ring, for example but not limited to -O- or -C ⁇ _ 3 alkyl-
- X 2 represents an optionally substituted -alkanediyl-
- any of the phenyl groups may be optionally substituted.
- Examples of the phenyl-X 2 -moiety in structure (I) include those represented at the 4-position on the 2-azetidinone structure shown below in structure (II).
- Additional examples of substituted 2-azetidinone-glucuronides include but are not limited to those described in U.S. Patent No. 5,75 ,470, WO02/066464 and US 2002/0137689.
- Additional examples of substituted 2-azetidinone-glucuronide compounds include those having the structure (II) and pharmaceutically acceptable salts and esters thereof as follows:
- Arl is selected from the group consisting of aryl and R4 -substituted aryl;
- X, Y and Z are independently selected from the group consisting of -CH2-, -CH(Cl- 6alkyl)- and -C(Cl-6alkyl)2-;
- R is selected from the group consisting of -OR6, -O(CO)R 6 , -0(CO)OR 9 , -O(CO)NR 6 R 7 , a sugar residue, a disugar residue, a trisugar residue and a tetrasugar residue;
- Rl is selected from the group consisting of -H, -C ⁇ _6alkyl and aryl, or R and Rl together are oxo;
- R2 is selected from the group consisting of -OR6, -O(CO)R 6 , -O(CO)OR 9 and -O(CO)NR 6 R 7 ;
- R3 is selected from the group consisting of -H, -C ⁇ _6alkyl and aryl or R and R3 together are oxo;
- q, r and t are each independently selected from 0 and 1;
- m, n and p are each independently selected from 0, 1, 2, 3 and 4;
- R4 is 1-5 substituents independently selected at each occurrence from the group consisting of: -OR5, -O(CO)R5, -O(CO)OR8, -O-C ⁇ _5alkyl-OR5, -O(CO)NR5R6, -NR5R6, - NR5(C0)R6, -NR5(C0)0R8, -NR5(CO)NR6R7, -NR5SO2R 8 , -COOR5, - CONR5R6, -COR5, -SO2NR5R6, -S(O)tR8, -O-Ci_ioalkyl-COOR5, -O-Ci-ioalkyl-CONR5R6 and fluoro; R5, R6 and R7 are independently selected at each occurrence from the group consisting of -H, Ci_6alkyl, aryl and aryl-substituted Ci- ⁇ alkyl;
- R8 is independently selected from the group consisting of C ⁇ _6alkyl, aryl and aryl- substituted Ci- ⁇ alkyl;
- R9 is selected from the group consisting of -C ⁇ C-CH2-NRl ⁇ Ri 1, -C ⁇ C-C(O)Rl3, and -(CH2)3-NRl ⁇ Rl4 ;
- RlO is independently selected at each occurrence from -H and — C1-.3 alkyl
- Rl 1 is selected from the group consisting of-H, - Ci_3alkyl, -C(O)-Ci-3alkyl, - C(O)-NRl RlO, -SO2-Ci_3alkyl, and -S ⁇ 2- ⁇ henyl;
- Rl is selected from
- glucuronide (referred to herein as “glucuronide”) (refened to herein as “methyl ester glucuronide”);
- Rl3 is selected from the group consisting of -OH and -NRIORI 1 ;
- Rl4 is selected from the group consisting of -C(O)-C 1-3 alkyl, -C(O)-NR10R10, -SO2-Ci_3alkyl and -S ⁇ 2- ⁇ henyl.
- Formula II are compounds wherein q, r and t are each independently selected from 0 and 1 ; and m, n and p are each independently selected from 0, 1, 2, 3 and 4; provided that at least one of q and r is 1, and the sum of m, n, p, q are r is 1 , 2, 3, 4, 5 or 6; and provided that when p is 0 and r is 1 , the sum of m, q and n is 1, 2, 3, 4, or 5.
- Formula IIa are compounds of Formula Ila,
- each of these embodiments are compounds wherein R9 is -C ⁇ C-CH2- NRIORI 1.
- R 9 contains an -SO 2 - group, i.e., wherein R9 is selected from the group consisting of _-C ⁇ C-CH2-NRi ⁇ Rl 1 ? -C ⁇ C-C(O) NRIORI 1, -(CH2)3-NRlO-SO2-Cl-3alkyl and
- Rl 1 is selected from -SO2-Ci -3alkyl, and -SO2- phenyl.
- alkyl is intended to include both branched- and straight- chain saturated aliphatic univalent hydrocarbon groups having the specified number of carbon atoms.
- alkyl groups include, but are not limited to, methyl (Me), ethyl (Et), n-propyl (Pr), n-butyl (Bu), n-pentyl, n-hexyl, and the isomers thereof such as isopropyl (i-Pr), isobutyl (i-Bu), secbutyl (s-Bu), tertbutyl (t-Bu), isopentyl, isohexyl and the like.
- alkyl group is an n-alkyl group (i.e., "propyl” is “n-propyl”).
- aryl is intended to include phenyl (Ph), naphthyl, indenyl, tetrahydronaphthyl or indanyl. Phenyl is preferred.
- Suitable protecting groups for the hydroxyl groups of Rl2 when Rl2 is a glucuronide or methyl ester glucuronide include but are not limited to those that are known to be useful as carbohydrate protecting groups, such as for example benzyl, acetyl, benzoyl, tert- butyldiphenylsilyl, trimethylsilyl, ⁇ ra-methoxybenzyl, benzylidine, and methoxy methyl. Conditions required to selectively add and remove such protecting groups are found in standard textbooks such as Greene, T, and Wuts, P. G.
- Radioactive isotopes of the compounds of Formula II are particularly useful in such assays, for example compounds of Formula II wherein sulfur is replaced with "hot" - 5s ⁇ , and particularly wherein the radioactive sulfur isotope is inco ⁇ orated within the R9 moiety.
- radioactive isotopes of the compounds of Formula II in an assay for identifying NPCILI ligands is included within the scope of this invention.
- pharmaceutically acceptable salts means non-toxic salts of the compounds of Formula II which are generally prepared by reacting the free acid with a suitable organic or inorganic base, particularly those formed from cations such as sodium, potassium, aluminum, calcium, lithium, magnesium, zinc and tetramethylammonium, as well as those salts formed from amines such as ammonia, ethylenediamine, N-methylglucamine, lysine, arginine, ornithine, choline, N,N'-dibenzylethylenediamine, chloroprocaine, diethanolamine, procaine, N-benzylphenethylamine, 1 -p-chlorobenzyl-2-pyrrolidine- 1 ' -yl-methylbenzimidazole, diethylamine, piperazine, mo ⁇ holine
- salts may be prepared from pharmaceutically acceptable non-toxic acids, including inorganic and organic acids.
- acids include acetic, benzenesulfonic, benzoic, camphorsulfonic, citric, ethanesulfonic, fumaric, gluconic, glutamic, hydrobromic, hydrochloric, isethionic, lactic, maleic, malic, mandelic, methanesulfonic, mucic, nitric, pamoic, pantothenic, phosphoric, succinic, sulfuric, tartaric, p-toluenesulfonic acid, and the like.
- esters include, but are not limited to, -Ci-4 alkyl and -Ci-4 alkyl substituted with phenyl, dimethylamino and acetylamii o.
- C ⁇ _4 alkyl herein includes straight or branched aliphatic chains containing from 1 to 4 carbon atoms, for example methyl, ethyl, n-propyl, n-butyl, iso-propyl, sec-butyl and tert-butyl.
- the compounds of structural Formula II can be prepared according to the procedures of the following Scheme using appropriate materials, and are further exemplified by specific examples which follow.
- a variety of chromato graphic techniques may be employed in the preparation of the compounds of Formula II. These techniques include, but are not limited to: High Performance Liquid Chromatography (including normal- reversed- and chiral-phase); Super Critical Fluid Chromatography; preparative Thin Layer Chromatography; flash chromatography with silica gel or reversed-phase silica gel; ion-exchange chromatography; and radial chromatography. All temperatures are degrees Celsius unless otherwise noted. Some abbreviations used herein include: Ac Acyl (CH 3 C(O)-) Bn benzyl calc.
- Alkyne II-2 may contain a radioactive atom such as 35S to provide the corresponding radiolabeled adduct upon reaction with II-l .
- Conversion of 11-3 to II-4 can be achieved using a variety of hydrolytic methods known to those skilled in the art of organic synthesis. For example, a particularly mild hydrolysis protocol involves the treatment of II-3 with a tertiary amine base such as triethylamine, or diisopropylethylamine or the like, in a mixed solvent system comprising methanol and water. The product of the reaction is a compound of structural formula II-4.
- a labeled-ligand binding assay e.g., direct binding assay or scintillation proximity assay (SPA)
- SPA scintillation proximity assay
- sterol e.g., cholesterol
- 5 ⁇ -stanol uptake e.g., 35 S, 125 I or 3 H.
- a labeled ligand, for use in the binding assay can be obtained by labeling a sterol (e.g., cholesterol) or a 5 ⁇ -stanol or a known NPCILI agonist or antagonist with a measurable group (e.g., 35 S, 125 I or 3 H).
- sterols e.g., cholesterol
- 5 ⁇ -stanols are available commercially or can be generated using standard techniques (e.g., Cholesterol- [1,2- 3 H(N)], Cholesterol-[1,2,6,7- 3 H(N)] or Cholesterol- [7- 3 H(N)]; American Radiolabeled Chemicals, Inc; St. Louis, MO).
- ezetimibe is ftuorescently labeled with a BODIPY group (Altmann, et al, (2002) Biochim. Biophys.
- NPCILI of the invention e.g., SEQ ID NO: 2, 4 or 12
- a complex including NPCILI is contacted with increasing amounts of labeled ligand or known antagonist or agonist (discussed above) and the amount of the bound, labeled ligand or known antagonist or agonist is measured after removing unbound, labeled ligand or known antagonist or agonist by washing.
- the amount of the labeled ligand or known agonist or antagonist is increased, a point is eventually reached at which all receptor binding sites are occupied or saturated.
- Non-specific receptor binding of the labeled ligand or known agonist or antagonist is abolished by a large excess of unlabeled ligand or known agonist or antagonist.
- an assay system is used in which non-specific binding of the labeled ligand or known antagonist or agonist to the receptor is minimal.
- Non-specific binding is typically less than 50%, preferably less than 15%, more preferably less than 10%, and most preferably 5% or less, of the total binding of the labeled ligand or known antagonist or agonist.
- the method for identifying an NPCILI ligand, agonist or antagonist includes: (a) contacting NPCILI (e.g., SEQ ID NO: 2 or 4 or 12), a fragment thereof or a complex including NPCILI, in the presence of a known amount of labeled sterol (e.g., cholesterol) or 5 ⁇ -stanol or known antagonist or agonist (e.g., labeled ezetimibe) with a sample to be tested for the presence of an NPCILI ligand, agonist or antagonist; and (b) measuring the amount of labeled sterol (e.g. , cholesterol) or 5 ⁇ - stanol or known antagonist or agonist directly or indirectly bound to NPCILI .
- NPCILI e.g., SEQ ID NO: 2 or 4 or 12
- labeled sterol e.g., cholesterol
- 5 ⁇ -stanol or known antagonist or agonist e.g., labeled ezetimibe
- An NPCILI ligand in the sample is identified by measuring substantially reduced direct or indirect binding of the labeled sterol (e.g., cholesterol) or 5 ⁇ -stanol or known antagonist or agonist to NPCILI, compared to what would be measured in the absence of such a ligand.
- sterol e.g., cholesterol
- 5 ⁇ -stanol or known antagonist or agonist e.g., sodium bicarbonate
- reduced direct or indirect binding between [ H] -cholesterol and NPCILI in the presence of a sample might suggest that the sample contains a substance which is competing against [ 3 H]- cholesterol for NPCILI binding.
- This assay can include a control experiment lacking any NPCILI - dependent ligand (e.g., sterol such as cholesterol or 5 ⁇ -stanol) binding.
- a whole cell or cell membrane lacking any functional NPCILI for example, a cell or membrane isolated or derived from a transgenic mutant npclll ' mouse of the invention, is assayed for ligand binding.
- an NPCILI antagonist When screening a sample for the presence of an NPCILI antagonist, it is useful to compare the level of binding observed in the presence of a sample being tested with that of a control experiment, as described herein, which completely lacks NPCl LI -dependent binding. Ideally, though by no means necessarily, the level of binding seen in the presence of a sample containing an antagonist will be similar to that of the confrol experiment.
- a sample can be tested directly for binding to NPCILI (e.g., SEQ ID NO: 2, 4 or 12).
- a basic assay of this type may include the following steps: (a) contacting NPCl LI (e.g. , SEQ ID NO: 2 or 4 or 12), a fragment thereof or a complex including NPCILI with a labeled candidate compound (e.g., [ 3 H]-ezetimibe); and (b) detecting direct or indirect binding between the labeled candidate compound and NPCILI. Again, these experiment can be performed along with a control experiment wherein NPCl LI -dependent binding is completely lacking.
- the assay can be performed using a whole cell or cell membrane lacking any functional NPCILI (e.g., cell or cell membrane derived from a transgenic, mutant npclll ' mouse as described herein).
- a candidate compound which is found to bind to NPCILI may function as ligand, agonist or antagonist of NPCILI (e.g., by inhibition of sterol (e.g., cholesterol) or 5 ⁇ -stanol uptake).
- the bound candidate compound is quantified after filtration using glass fiber filters.
- the bound candidate compound is detected after single-tube vacuum filtration of GF/C glass fiber filters, obtained from Whatman.
- the filters may be pretreated by soaking with 0.5%) polyethylenimine to reduce nonspecific binding. Filtration is accomplished by adding ice cold buffer to the assay tube, pouring the mixture through the filter, and then rinsing the tube and filter twice more with additional buffer.
- the buffer may be a Tris buffer or MES buffer (120 mM NaCl, 0.1 % sodium cholate, and 20 mM MES at pH 6.70).
- the filters can be counted using scintillation fluid, e.g., Packard DM liquid or Packard Ultima Gold MV.
- SPA Assay NPCILI ligands may also be measured using scintillation proximity assays (SPA).
- SPA assays are conventional and very well known in the art; see, for example, U.S. Patent No. 4,568,649.
- the target of interest is immobilized to a small microsphere approximately 5 microns in diameter.
- the microsphere typically, includes a solid scintillant core which has been coated with a polyhydroxy film, which in turn contains coupling molecules, which allow generic links for assay design.
- Radioisotopically labeled molecule When a radioisotopically labeled molecule binds to the microsphere, the radioisotope is brought into close proximity to the scintillant and effective energy transfer from electrons emitted by the isotope will take place resulting in the emission of light. While the radioisotope remains in free solution, it is too distant from the scintillant and the electron will dissipate the energy into the aqueous medium and therefore remain undetected. Scintillation may be detected with a scintillation counter. In general, 3 H, 125 I and 35 S labels are well suited to SPA.
- the lectin wheat germ agglutinin may be used as the SPA bead coupling molecule (Amersham Biosciences; Piscataway, NJ).
- the WGA coupled bead captures glycosylated, cellular membranes and glycoproteins and has been used for a wide variety of receptor sources and cultured cell membranes.
- the receptor is immobilized onto the WGA-SPA bead and a signal is generated on binding of an isotopically labeled ligand.
- Other coupling molecules which may be useful for receptor binding SPA assays include poly-L-lysi ⁇ e and WGA/polyethyleneimine (Amersham Biosciences; Piscataway, NJ).
- the scintillant contained in SPA beads may include, for example, yttrium silicate (YSi), yttrium oxide (YOx), diphenyloxazole or polyvinyltoluene (PVT) which acts as a solid solvent for diphenylanthracine (DP A).
- SPA assays may be used to analyze whether a sample contains an NPCILI ligand.
- a host cell which expresses NPCILI (e.g., SEQ ID NO: 2 or 4 or 12) on the cell surface or a membrane fraction thereof is incubated with and captured by SPA beads (e.g., WGA coated YOx beads or WGA coated YSi beads).
- the beads bearing the NPCILI are incubated with labeled, known ligand or agonist or antagonist (e.g., H-cholesterol, H-ezetimibe, I-ezetimibe or a S- ezetimibe analog).
- the assay mixture further includes either the sample to be tested or a blank (e.g., water). After an optional incubation, scintillation is measured using a scintillation counter.
- An NPCILI ligand, agonist or antagonist may be identified in the sample by measuring substantially reduced fluorescence, compared to what would be measured in the absence of such ligand, agonist or antagonist (blank).
- Measuring substantially reduced fluorescence may suggest that the sample contains a substance which competes for direct or indirect NPCILI binding with the known ligand, agonist or antagonist.
- a sample may be identified as an ligand of NPCILI by directly detecting binding in a SPA assay.
- a labeled version of a candidate compound to be tested may be put in contact with the host cell expressing NPCILI or a membrane fraction thereof which is bound to the SPA bead. Fluorescence may then be assayed to detect the presence of a complex between the labeled candidate compound and the host cell or membrane fraction expressing NPCILI or a complex including NPCILI .
- a candidate compound which binds directly or indirectly to NPCILI may possess NPCILI agonistic or antagonistic activity.
- SPA Assays can also be performed along with a control experiment lacking any NPC 1 LI -dependent binding.
- the control experiment can be performed, for example, with a cell or cell membrane lacking any functional NPCILI (e.g., cell or cell membrane derived from a transgenic, mutant npclll- mouse as described herein).
- the level of binding observed in the presence of sample being tested for the presence of an antagonist can be compared with that observed in the control experiment.
- Sterol/S -stanol Uptake Assay can be performed along with a control experiment lacking any NPC 1 LI -dependent binding.
- the control experiment can be performed, for example, with a cell or cell membrane lacking any functional NPCILI (e.g., cell or cell membrane derived from a transgenic, mutant npclll- mouse as described herein).
- Assays may also be performed to determine if a sample can agonize or antagonize NPCILI mediated sterol (e.g., cholesterol) or 5 ⁇ -stanol uptake.
- a host cell expressing NPCILI e.g., SEQ ID NO: 2 or 4 or 12
- detectably labeled sterol e.g., 3 H-cholesterol or 125 I-cholesterol
- the cells can be washed to remove unabsorbed sterol or 5 ⁇ -stanol.
- Sterol or 5 ⁇ -stanol uptake can be determined by detecting the presence of labeled sterol or 5 ⁇ -stanol in the host cells. For example, assayed cells or lysates or fractions thereof (e.g., fractions resolved by thin-layer chromatography) can be contacted with a liquid scintillant and scintillation can be measured using a scintillation counter.
- assayed cells or lysates or fractions thereof e.g., fractions resolved by thin-layer chromatography
- an NPCILI antagonist in the sample may be identified by measuring substantially reduced uptake of labeled sterol (e.g., 3 H-cholesterol) or 5 ⁇ -stanol, compared to what would be measured in the absence of such an antagonist and an agonist may be identified by measuring substantially increased uptake of labeled sterol (e.g., 3 H-cholesterol) or 5 ⁇ -stanol, compared to what would be measured in the absence of such an agonist.
- Uptake assays can also be performed along with a control experiment lacking any NPCl LI -dependent uptake.
- the control experiment can be performed, for example, with a cell lacking any functional NPCILI (e.g., cell derived from a transgenic, mutant npclll ' mouse as described herein).
- NPCILI e.g., cell derived from a transgenic, mutant npclll ' mouse as described herein.
- the level of uptake observed in the presence of sample being tested for the presence of an antagonist can be compared with that observed in the control experiment.
- Source of NPCILI In principle, a binding assay of the invention could be carried out using a soluble NPCILI polypeptide of the invention, e.g., following production and refolding by standard methods from an E.
- NPCILI is membrane-bound.
- a nucleic acid encoding an NPCILI polypeptide of the invention e.g., SEQ ID NO: 2, 4 or 12
- SEQ ID NO: 2, 4 or 12 can be transfected into an appropriate host cell, whereby the NPCILI will become inco ⁇ orated into the membrane of the cell.
- a membrane fraction can then be isolated from the cell and used as a source of NPCILI for assay.
- the whole cell expressing NPCILI in the cell surface can be used in an assay.
- specific binding of the labeled ligand or known antagonist or agonist to an untransfected/untransformed host cell or to a membrane fraction from an untransfected/untransformed host cell will be negligible.
- membranes maybe used directly as a source of NPCILI for the above-described screening systems, e.g. direct binding, scintillation proximity assay, sterol/5 ⁇ stanol uptake assay.
- NPCILI is highly expressed in certain tissues, especially in brush border cells of intestinal tissues.
- brush border membrane (BBM) vesicle preparations may be utilized as a source of NPCILI .
- the membranes may be derived from mammalian intestinal tissue from rhesus, rat, mouse or human tissue.
- Membranes may be derived from brush border cells of intestinal tissues. Such membranes are conventionally prepared by collecting intestinal tissue from freshly sacrificed animals. The mucosa of the tissue is scraped, collected into buffered solutions, and homogenized. Cellular debris is removed and the membrane fractions are collected by centrifugation.
- Conventional techniques known to one of skill in the art maybe used for the preparation of brush border membrane vesicles. See Hauser, H., Howell, K., Dawson, R.M.C., Bowyer, D. E. Biochim.
- the membrane preparation may be in vesicular or non- vesicular form.
- liposomes and liposomal preparations comprising NPCILI may also be a viable source of NPCILI for the screening assays of the present claimed method.
- NPCILI In vitro cultured cells expressing NPCILI may also be used.
- the host cells may be prepared by transforming or transfecting a nucleic acid encoding an NPCILI of the invention into an appropriate host cell, whereby the receptor becomes inco ⁇ orated into the membrane of the cell.
- a membrane fraction can then be isolated from the cell and used as a source of the receptor for assay.
- the whole cell expressing the receptor on the cell surface can be used in an assay.
- specific binding of the labeled ligand or known antagonist or agonist to an untransfected/untransformed host cell or membrane fraction from an untransfected/untransformed host cell will be negligible.
- Preferred host cells include Chinese Hamster Ovary (CHO) cells, murine macrophage J774 cells, HEK-293 cells or any other macrophage cell line and human intestinal epithelial Caco2 cells.
- the present invention provides for a method of identifying a ligand of NPCl LI using these membrane preparations, for example by contacting membranes comprising NPCILI, such as brush border membrane vesicle preparations, with detectably labeled substituted azetidinone compounds which are known NPCILI ligands, agonists or antagonists, and a candidate compound and determining whether the candidate compound can bind to NPCILI.
- NPCILI such as brush border membrane vesicle preparations
- the binding of the candidate compound to NPCILI may modulate binding of the detectably labeled NPCILI ligands, agonists or antagonists to NPCILI.
- a NPClLl ligand maybe identified by measuring the binding of NPCILI with detectably labeled NPCILI ligands, agonists or antagonists in the presence and absence of the candidate compound wherein decreased binding of the detectably labeled NPCILI ligands, agonists or antagonists to NPCILI is an indication that the candidate compound is ligand of NPCILI.
- NPCILI may also be obtained by solubilization of membrane fractions comprising NPCILI .
- the membranes may be obtained as discussed above, e.g., from mammalian tissue or in vitro cultured cells. Binding Affinities of NPCILI Ligands.
- the affinity and specificity of the known ligand (e.g., detectably labeled substituted 2-azetidinone-glucuronide) for NPCILI are important to the identification of ligands that bind NPCILI in a screening assay. It is understood that the known ligand will be labeled for use in the screening assay.
- the binding affinity of the known ligand for human NPCILI has a K D value equivalent or lower than the K D value of ezetimibe glucuronide 1 for human NPC 1 LI .
- the binding affinity of the known ligand for human NPCILI has a K D value of about 200nM or lower; particularly it has a K D value of about lOOnM or lower; more particularly it has a K D value of about 50nM or lower; even more particularly it has a K D value of about 20nM or lower; and most particularly it has a K D value of about lOnM or lower.
- K D value of the known ligand there is essentially no lower limit on the K D value of the known ligand and it may, for example, go down into the pM range.
- the binding affinity of the ligand for human NPCILI increases, which is desirable for the screening assay.
- the binding affinity of the known ligand for rat NPCILI has a K D value equivalent or lower than the K D value of ezetimibe glucuronide 1 for rat NPCILI.
- the binding affinity of the known ligand for rat NPCILI has a K D value of about 200nM or lower; particularly it has a K D value of about lOOnM or lower; more particularly it has a K D value of about 50nM or lower; even more particularly it has a K D value of about 20nM or lower; and most particularly it has a K D value of about lOnM or lower.
- the known ligand for human NPCILI is selected from (a) a sulfur-containing substituted 2-azetidinone- glucuronide that is labeled with 35 S, and particularly a compound of Formula II wherein R 9 contains an -SO - group and (b) a substituted 2-azetidinone-glucuronide labeled with 125 I.
- the known ligand for human NPCILI is selected from (a) a sulfur-containing substituted 2-azetidinone- glucuronide that is labeled with 35 S, and particularly a compound of Formula II wherein R 9 contains an -SO 2 - group, and (b) a substituted 2-azetidinone-glucuronide labeled with 125 I, and has a K D value equivalent or lower than the K D value of ezetimibe glucuronide 1.
- the known ligand for human NPCILI is selected from (a) a sulfur-containing substituted 2-azetidinone- glucuronide that is labeled with 35 S, and particularly a compound of Formula II wherein R 9 contains an -SO - group, and (b) a substituted 2-azetidinone-glucuronide labeled with 125 I, and has a KD value of about 200nM or lower; particularly it has a KD value of about lOOnM or lower; more particularly it has a K D value of about 50nM or lower; even more particularly it has a K D value of about 20nM or lower; and most particularly it has a K D value of about lOnM or lower.
- candidate compounds identified as NPCILI ligands are preferably those candidates that exhibit a binding affinity having a KD value of about 12,000nM or lower, preferably about lOOOnM or lower, more preferably about lOOnM or lower, and most preferably about lOnM or lower.
- candidate compounds identified as NPCILI ligands are preferably those candidates that exhibit a binding affinity having a K D value of about lOOOnM or lower, preferably about lOOnM or lower, and more preferably about lOnM or lower.
- candidate compounds identified as NPCILI ligands are preferably those candidates that exhibit a binding affinity having a K D value of about 50nM or lower, and preferably about 1 OnM or lower.
- candidate compounds identified as NPCILI ligands are preferably those candidates that exhibit a binding affinity having a K D value in the range from about
- candidate compounds identified as NPCILI ligands are preferably those candidates that exhibit a binding affinity having a KD value in the range from about lOnM to about lOpM, and preferably from about lOOpM to about lOpM.
- Mouse Assay The present invention comprises a mutant, transgenic mouse which lacks any functional NPCILI . This mouse may serve as a convenient control experiment in screening assays for identifying inhibitors of intestinal sterol (e.g., cholesterol) or 5 -stanol abso ⁇ tion, preferably inhibitors of NPCILI.
- a mouse assay of the present invention would comprise the following steps: (a) feeding a sterol (e.g., cholesterol) or 5 ⁇ -stanol-containing substance (e.g., comprising radiolabeled cholesterol, such as 14 C-cholesterol or 3 H ⁇ cholesterol) to a first and second mouse comprising a functional NPCILI gene and to a third, mutant mouse lacking a functional NPCILI ;
- the sterol (e.g., cholesterol) or 5 ⁇ -stanol containing substance preferably contains labeled cholesterol, such as a radiolabeled cholesterol, for example, 3 H or 1 C labeled cholesterol.
- the sterol (e.g., cholesterol) or 5 ⁇ -stanol containing substance may also include cold, unlabeled sterol (e.g., cholesterol) or 5 ⁇ - stanol such as in corn oil.
- the third npclll ' mutant mouse serves as a (+)-control experiment which exhibits low levels of intestinal sterol (e.g., cholesterol) or 5 ⁇ - stanol abso ⁇ tion and the second mouse serves as a (-)-control experiment which exhibits normal, uninhibited levels of intestinal sterol (e.g., cholesterol) or 5 ⁇ -stanol abso ⁇ tion.
- the second mouse is not administered the sample to be tested for an
- the first mouse is the experiment.
- the level intestinal abso ⁇ tion can be assayed by measuring the level of serum sterol (e.g., cholesterol) or 5 ⁇ -stanol.
- the sample contains an intestinal sterol (e.g., cholesterol) or 5 ⁇ -stanol abso ⁇ tion inhibitor (e.g., an NPCILI inhibitor)
- the level of sterol (e.g., cholesterol) or 5 ⁇ -stanol abso ⁇ tion in the first mouse will be similar to that of the third, npclll mutant mouse.
- An alternative, (+)-control experiment which may be used in these screening assays is a mouse comprising functional NPCILI which is administered a known antagonist of NPCILI, such as ezetimibe.
- NPCILI ligands discovered, for example, by the screening methods described above may be used therapeutically (e.g. , in a pharmaceutical composition) to stimulate or block the activity of NPCILI and, thereby, to treat any medical condition caused or mediated by NPCILI.
- the antibody molecules of the invention may also be used therapeutically (e.g., in a pharmaceutical composition) to bind NPCILI and, thereby, block the ability of NPCILI to bind a sterol (e.g., cholesterol) or 5 ⁇ -stanol.
- Blocking the binding of a sterol (e.g., cholesterol) or 5 ⁇ - stanol would prevent abso ⁇ tion of the molecule (e.g., by intestinal cells such as enterocytes). Blocking abso ⁇ tion of sterol (e.g., cholesterol) or 5 ⁇ -stanol would be a useful way to lower serum sterol (e.g., cholesterol) or 5 ⁇ -stanol levels in a subject and, thereby, reduce the incidence of, for example, hyperlipidemia, atherosclerosis, coronary heart disease, stroke or arteriosclerosis.
- composition refers to a composition including an active ingredient and a pharmaceutically acceptable carrier and/or adjuvant.
- a pharmaceutically acceptable carrier e.g., a pharmaceutically acceptable carrier for delivering the compositions of the invention to a subject.
- Useful, pharmaceutically acceptable carriers can be any compatible, non-toxic substances suitable for delivering the compositions of the invention to a subject. Sterile water, alcohol, fats, waxes, and inert solids may be included in a pharmaceutically acceptable carrier.
- compositions of the invention are in the form of a pill or capsule.
- Methods for formulating pills and capsules are very well known in the art.
- the active drug component may be combined with any oral, non-toxic pharmaceutically acceptable inert carrier, such as lactose, starch, sucrose, cellulose, magnesium stearate, dicalcium phosphate, calcium sulfate, talc, mannitol, ethyl alcohol (liquid forms) and the like.
- suitable binders include starch, gelatin, natural sugars, corn sweeteners, natural and synthetic gums such as acacia, sodium alginate, carboxymethylcellulose, polyethylene glycol and waxes.
- lubricants there may be mentioned for use in these dosage forms, boric acid, sodium benzoate, sodium acetate, sodium chloride, and the like.
- Disintegrants include starch, methylcellulose, guar gum and the like. Sweetening and flavoring agents and preservatives may also be included where appropriate.
- the pharmaceutical compositions of the invention may be administered in conjunction with a second pharmaceutical composition or substance.
- the second composition includes a cholesterol-lowering drag.
- both compositions may be formulated into a single composition for simultaneous delivery or formulated separately into two or more compositions (e.g., a kit).
- the formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. See, e.g. , Gilman et al. (eds.) (1990), The Pharmacological Bases of Therapeutics, 8th Ed., Pergamon Press; and Remington 's Pharmaceutical Sciences, supra, Easton, Penn.; Avis et al. (eds.) (1993) Pharmaceutical Dosage Forms: Parenteral Medications Dekker, New York; Lieberman et al. (eds.) (1990) Pharmaceutical Dosage Forms: Tablets Dekker, New York; and Lieberman et al. (eds.) (1990), Pharmaceutical
- Dosage Forms Disperse Systems Dekker, New York.
- the dosage regimen involved in a therapeutic application may be determined by a physician, considering various factors which may modify the action of the therapeutic substance, e.g., the condition, body weight, sex and diet of the patient, the severity of any infection, time of administration, and other clinical factors.
- an "effective amount" of a ligand of the invention may be an amount that will detectably reduce the level of intestinal sterol (e.g., cholesterol) or 5 ⁇ -stanol abso ⁇ tion or detectably reduce the level of serum sterol (e.g., cholesterol) or 5 ⁇ - stanol in a subject administered the composition. Typical protocols for the therapeutic administration of such substances are well known in the art.
- Pharmaceutical composition of the invention may be administered, for example, by any parenteral or non-parenteral route. Pills and capsules of the invention can be administered orally.
- Injectable compositions can be administered with medical devices known in the art; for example, by injection with a hypodermic needle.
- Injectable pharmaceutical compositions of the invention may also be administered with a needleless hypodermic injection device; such as the devices disclosed in U.S. Patent Nos. 5,399,163; 5,383,851; 5,312,335; 5,064,413; 4,941,880;
- the present invention also encompasses anti-sense oligonucleotides capable of specifically hybridizing to mRNA encoding NPCILI (e.g., any of SEQ ID NOs: 1, 3, 5-11 or 13) having an amino acid sequence defined by, for example, SEQ ID NO: 2 or 4 or 12 or a subsequence thereof so as to prevent translation of the mRNA. Additionally, this invention contemplates anti-sense oligonucleotides capable of specifically hybridizing to the genomic DNA molecule encoding NPCl LI , for example, having an amino acid sequence defined by SEQ ID NO: 2 or 4 or 12 or a subsequence thereof.
- NPCILI e.g., any of SEQ ID NOs: 1, 3, 5-11 or 13
- this invention contemplates anti-sense oligonucleotides capable of specifically hybridizing to the genomic DNA molecule encoding NPCl LI , for example, having an amino acid sequence defined by SEQ ID NO: 2 or 4 or 12 or a
- compositions comprising (a) an amount of an oligonucleotide effective to reduce NPClLl-mediated sterol (e.g., cholesterol) or 5 ⁇ -stanol abso ⁇ tion by passing through a cell membrane and binding specifically with mRNA encoding NPCILI in the cell so as to prevent its translation and (b) a pharmaceutically acceptable carrier capable of passing through a cell membrane.
- the oligonucleotide is coupled to a substance that inactivates mRNA.
- the substance that inactivates mRNA is a ribozyme.
- Reducing the level of NPCILI expression by introducing anti-sense NPCl LI RNA into the cells of a patient is a useful method reducing intestinal sterol (e.g., cholesterol) or 5D-stanol abso ⁇ tion and serum cholesterol in the patient.
- intestinal sterol e.g., cholesterol
- Kits Kits of the present invention include ezetimibe, preferably combined with a pharmaceutically acceptable carrier, in a pharmaceutical formulation, more preferably in a pharmaceutical dosage form such as a pill, a powder, an injectable liquid, a tablet, dispersible granules, a capsule, a cachet or a suppository.
- a pharmaceutical dosage form such as a pill, a powder, an injectable liquid, a tablet, dispersible granules, a capsule, a cachet or a suppository.
- the dosage form is a Zetia® tablet (Merck/Schering-Plough Co ⁇ .).
- Ezetimibe may be supplied in any convenient form.
- tablets including ezetimibe may be supplied in bottles of 30, 90 or 500.
- the kits of the present invention also include information, for example in the form of a package insert, indicating that the target of ezetimibe is NPCILI (NPC3).
- target of ezetimibe indicates that ezetimibe reduces intestinal sterol ⁇ e.g., cholesterol) or 5 ⁇ -stanol abso ⁇ tion, either directly or indirectly, by antagonizing NPCl LI .
- the form of the insert may take any form, such as paper or on electronic media such as a magnetically recorded medium (e.g., floppy disk) or a CD- ROM.
- the package insert may also include other information concerning the pharmaceutical compositions and dosage forms in the kit. Generally, such information aids patients and physicians in using the enclosed pharmaceutical compositions and dosage forms effectively and safely.
- ezetimibe e.g., Zetia®
- simvastatin e.g., Zocor®
- pharmacokinetics e.g., pharmacodynamics
- clinical studies e.g., pharmacodynamics
- efficacy parameters e.g., pharmacodynamics
- contraindications e.g., warnings, precautions, adverse reactions, overdosage
- proper dosage and administration e.g., how supplied, proper storage conditions, references and patent information.
- the kits of the invention may also include simvastatin (e.g., Zetia®) and/or simvastatin (e.g., Zocor®) may be supplied in the insert: pharmacokinetics, pharmacodynamics, clinical studies, efficacy parameters, indications and usage, contraindications, warnings, precautions, adverse reactions, overdosage, proper dosage and administration, how supplied, proper storage conditions, references and patent information.
- the kits of the invention may
- a pharmaceutically acceptable carrier in a pharmaceutical formulation, more preferably in a pharmaceutical dosage form such as a pill, a powder, an injectable liquid, a tablet, dispersible granules, a capsule, a cachet or a suppository.
- a pharmaceutical dosage form such as a pill, a powder, an injectable liquid, a tablet, dispersible granules, a capsule, a cachet or a suppository.
- the dosage form of simvastatin is a Zocor® tablet (Merck & Co.; Whitehouse Station, NJ). Tablets or pills comprising simvastatin may be supplied in any convenient form.
- pills or tablets comprising 5mg simvastatin can be supplied as follows: bottles of 30, 60, 90, 100 or 1000. Pills or tablets comprising 10 mg simvastatin maybe supplied as follows: bottles of 30, 60, 90, 100, 1000 or 10,000.
- Pills or tablets comprising 20 mg simvastatin may be supplied as follows: bottles of 30, 60, 90, 100, 1000 or 10,000. Pills or tablets comprising 40 mg simvastatin maybe supplied as follows: bottles of 30, 60, 90, 100 or 1000. Pills or tablets comprising 80 mg simvastatin maybe supplied as follows: bottles of 30, 60, 90, 100, 1000 or 10,000. Ezetimibe and simvastatin may be supplied, in the kit, as separate compositions or combined into a single composition. For example, ezetimibe and simvastatin may be supplied within a single, common pharmaceutical dosage form (e.g., pill or tablet) as in separate pharmaceutical dosage forms (e.g., two separate pills or tablets).
- ezetimibe and simvastatin may be supplied within a single, common pharmaceutical dosage form (e.g., pill or tablet) as in separate pharmaceutical dosage forms (e.g., two separate pills or tablets).
- npclll " Cells
- the present invention provides any isolated mammalian cell, (e.g., an isolated mouse cell, an isolated rat cell or an isolated human cell) which lacks an NPCILI gene which encodes or can produce a functional NPCILI protein.
- mutant npclll genes comprising a point mutation, truncation or deletion of the genetic coding region or of any regulatory element (e.g., a promoter).
- the cell can be isolated from a mutant mouse comprising a homozygous mutation of endogenous, chromosomal NPCILI wherein the mouse does not produce any functional NPCl LI protein (e.g. , the mouse described below in Example 22).
- the present invention comprises any cell, tissue, organ, fluid, nucleic acid, peptide or other biological substance derived or isolated from such a mutant mouse, particularly a mutant, transgenic mouse which does not produce any functional NPCl LI, wherein the region of endogenous, chromosomal NPCILI deleted, in the mouse, corresponds to nucleotides 790-998 of the nucleotide sequence set forth in SEQ ID NO: 45.
- the isolated cell can be isolated or derived, for example, from the duodenum, gall bladder, liver, small intestine or stomach of the mutant mouse. Further, the cell can be an enterocyte.
- npclll ' mutant cells are useful, for example, for use in control experiments in screening assays (see e.g., supra) since they lack any NPC1L1- dependent uptake or binding of sterol, 5 -stanol or ezetimibe.
- the level of inhibition caused by a particular sample, in a screening assay can be compared to that of an assay performed with the mutant cell.
- the same amount of binding will be observed by a non-mutant cell or cell membrane, in the presence of an antagonist, as is observed in connection with a mutant npclll cell or cell membrane alone.
- Rat NPCILI, mouse NPCILI or human NPCILI can all conveniently be amplified using polymerase chain reaction (PCR).
- PCR polymerase chain reaction
- DNA from a rat, mouse or human cDNA library can be amplified using appropriate primers and standard PCR conditions. Design of primers and optimal amplification conditions constitute standard techniques which are commonly known in the art.
- An amplified NPCILI gene may conveniently be expressed, again, using methods which are commonly known in the art.
- NPCILI may be inserted into a pET-based plasmid vector (Stratagene; La Joola, CA), downstream of the T7 RNA polymerase promoter. The plasmid may then be transformed into a T7 expression system (e.g., BL21DE3 E.coli cells), grown in a liquid culture and induced (e.g., by adding IPTG to the bacterial culture).
- T7 expression system e.g., BL21DE3 E.coli cells
- Example 2 Direct Binding Assay.
- Membrane preparation Caco2 cells transfected with an expression vector containing a polynucleotide encoding NPCILI (e.g., SEQ ID NO: 2, 4 or 12) are harvested by incubating in 5 mM EDT A/phosphate-buffered saline followed by repeated pipeting. The cells are centrifuged 5 min at 1000 x g. The EDTA/PBS is decanted and an equal volume of ice-cold 50mM Tris-HCl, pH 7.5 is added and cells are broken up with a Polytron (PT10 tip, setting 5, 30 sec).
- NPCILI polynucleotide encoding NPCILI
- Nuclei and unbroken cells are sedimented at 1O00 x g for 10 min and then the supernatant is centrifuged at 50,000 x g for 10 min. The supernatant is decanted, the pellet is resuspended by Polytron, a sample is taken for protein assay (bicinchoninic acid, Pierce), and the tissue is again centrifuged at 50,000 x g. Pellets are stored frozen at -20°C.
- Binding assay For saturation binding, four concentrations of [ 3 H]- ezetimibe (15 Ci/mmol) are incubated without and with 10 "5 M ezetimibe in triplicate with 50 ⁇ g of membrane protein in a total volume of 200 ⁇ l of 50 mM Tris-HCl, pH 7.5, for 30 min at 30°C. Samples are filtered on GF/B filters and washed three times with 2 ml of cold Tris buffer. Filters are dried in a microwave oven, impregnated with Meltilex wax scintillant, and counted at 45%> efficiency.
- Example 3A SPA Assay.
- a reaction mixture of 10 ⁇ g human, mouse or rat NPC1L1-CHO overexpressing membranes (Biosignal) and 200 ⁇ g well YSi-WGA-SPA beads (Amersham) in 100 ⁇ l is prepared in NPCILI assay buffer (25 mM HEPES, pH 7.8, 2 mM CaCl 2 , ImM MgCl 2 , 125 mM NaCl, 0.1% BSA).
- a 0.4 nM stock of ligand- [ 125 I]-ezetimibe- is prepared in the NPCILI assay buffer.
- Example 3A Alternate SPA Assay. The final concentrations should be: 1 nM 35 S-2 (Km ⁇ 2-5 nM,
- Example 4 Cholesterol Uptake Assay. CHO cells expressing either SR-B1 or three different clones of rat NPCILI or one clone of mouse NPCl LI were starved overnight in cholesterol free media then dosed with [3H]-cholesterol in a mixed synthetic micelle emulsion for 4 min, 8 min, 12 min or 24 min in the absence or presence of 10 DM ezetimibe. The cells were harvested and the lipids were organically extracted. The extracted lipids were spotted on thin-layer chromatography (TLC) plates and resolved within an organic vapor phase. The free cholesterol bands for each assay were isolated and counted in a scintillation counter.
- TLC thin-layer chromatography
- the SR-B1 expressing cells exhibited an increase in [ 3 H] -cholesterol uptake as early as 4 min which was also inhibited by ezetimibe.
- the three rat clones and the one mouse clone appeared to give background levels of [ 3 H]-cholesterol uptake which was similar to that of the untransformed CHO cell.
- Example 5 Expression of Rat NPCILI in Wistar Rat Tissue.
- the tissues evaluated were esophagus, stomach, duodenum, jejunum, ileum, proximal colon, distal colon, liver, pancreas, heart, aorta, spleen, lung, kidney, brain, muscle, testes, ovary, uterus, adrenal gland and thyroid gland.
- Total RNA samples were isolated from at least 3 male and 3 female animals and pooled. The samples were then subjected to real time quantitative PCR using Taqman analysis using standard dual-labeled fluorogenic oligonucleotide probes.
- Typical probe design inco ⁇ orated a 5' reporter dye e.g., 6FAM (6-carboxyfluorescein) or VIC
- a 3 ' quenching dye e.g., TAMRA (6-carboxytetramethyl-rhodamine)
- rat NPCILI Forward: TCTTCACCCTTGCTCTTTGC (SEQ ID NO: 14) Reverse: AATGATGGAGAGTAGGTTGAGGAT (SEQ ID NO: 15)
- Multiplex reactions contained gene specific primers at 200 nM each and FAM labeled probe at 100 nM and gene specific primers at 100 nM each and VIC labeled probe at 50 nM. Reactions were ran with a standard 2-step cycling program, 95°C for 15 sec and 60°C for 1 min, for 40 cycles. The highest levels of expression were observed in the duodenum, jejunum and ileum tissue. These data indicate that NPCILI plays a role in cholesterol abso ⁇ tion in the intestine.
- Example 6 Expression of Mouse NPCILI in Mouse Tissue.
- the tissues evaluated were adrenal gland, BM, brain, heart, islets of langerhans, LI, small intestine, kidney, liver, lung, MLN, PLN, muscle, ovary, pituitary gland, placenta, Peyers Patch, skin, spleen, stomach, testes, thymus, thyroid gland, uterus and trachea.
- Total RNA samples were isolate from at least 3 male and 3 female animals and pooled.
- mice NPCILI Forward: ATCCTCATCCTGGGCTTTGC (SEQ ID NO: 20) Reverse: GCAAGGTGATCAGGAGGTTGA (SEQ ID NO: 21) Probe: [6FAMJCCCAGCTTATCCAGATTTTCTTCTTCCGC [TAMRA] (SEQ ID NO: 22) The highest levels of expression were observed in the Peyer's Patch, small intestine, gall bladder and stomach tissue. These data are consistent with a cholesterol abso ⁇ tion role for NPCILI which takes place in the digestive system.
- Example 7 Expression of Human NPCILI in Human Tissue.
- the expression level of human NPCILI mRNA was evaluated in 2045 samples representing 46 normal tissues.
- Microarray-based gene expression analysis was performed on the Affymetrix HG-U95 GeneChip using a cRNA probe corresponding to base pairs 4192-51 17 (SEQ ID NO: 43) in strict accordance to Affymetrix's established protocols.
- Gene Chips were scanned under low photo multiplier tube (PMT), and data were normalized using either Affymetrix MAS 4.0 or MAS 5.0 algorithms.
- PMT low photo multiplier tube
- spike ins for most samples were used to construct a standard curve and obtain RNA concentration values according Gene Logic algorithms and procedures. A summary of these results are indicated, below, in Table 2.
- Shaded data corresponds to tissues wherein the highest levels of NPCILI mRNA was detected.
- the "Present” column indicates the proportion of specified tissue samples evaluated wherein NPCILI mRNA was detected.
- the “Absent” column indicates the proportion of specified tissue samples evaluated wherein NPCILI RNA was not detected.
- the “lower 25%”, “median” and “upper 75%” columns indicate statistical distribution of the relative NPCILI signal intensities observed for each set of tissue evaluated.
- Example 8 Distribution of Rat NPCILI, Rat IBAT or Rat SR-B1 mRNA in Rat Small Intestine.
- Intestines were isolated from five independent animals and divided into 10 sections of approximately equal length. Total RNA was isolated and analyzed, by real time quantitative PCR using Taqman analysis, for localized expression levels of rat NPCILI, rat IBAT (ileal bile acid transporter) or rat SR-B1 mRNA.
- rat NPCILI Forward: TCTTCACCCTTGCTCTTTGC (SEQ ID NO: 23) Reverse: AATGATGGAGAGTAGGTTGAGGAT (SEQ ID NO: 24) Probe: [6FAMJTGCCCACCTTTGTTGTCTGCTACC [TAMRA] (SEQ ID NO: 25) rat Vil-in: Forward: AGCACCTGTCCACTGAAGATTTC (SEQ ID NO: 26) Reverse: TGGACGCTGAGCTTCAGTTCT (SEQ ID NO: 27) Probe: [NIC]CTTCTCTGCGCTGCCTCGATGGAA[TAMRA] (SEQ ID NO:
- rat SR-Bl Forward: AGTAAAAAGGGCTCGCAGGAT (SEQ ID NO: 29) Reverse: GGCAGCTGGTGACATCAGAGA (SEQ ID NO: 30) Probe: [6FAM]AGGAGGCCATGCAGGCCTACTCTGA[TAMRA]
- rat IBAT Forward: GAGTCCACGGTCAGTCCATGT (SEQ ID NO: 32) Reverse: TTATGAACAACAATGCCAAGCAA (SEQ ID NO: 33) Probe: [6FAM]AGTCCTTAGGTAGTGGCTTAGTCCCTGGAAGC
- TC[TAMRA] SEQ ID NO: 34
- the mRNA expression levels of each animal intestinal section were analyzed separately, then the observed expression level was normalized to the observed level of villin mRNA in that intestinal section. The observed, normalized mRNA expression levels for each section where then averaged.
- the expression level of NPCILI and SR-B1 were highest in the jejunum (sections 2-5) as compared to that of the more distal ileum sections. Since the jejunum is believed to be the site of cholesterol absorption, these data suggest such a role for rat NPCILI . IBAT distribution favoring the ileum is well document and served as a control for the experiment.
- Example 9 In situ Analysis of Rat NPCILI mRNA in Rat Jejunum Tissue.
- the localization of rat NPCILI mRNA was characterized by in situ hybridization analysis of rat jejunum serial sections.
- the probes used in this analysis were: T7-sense probe: GTAATACGACTCACTATAGGGCCCTGACGGT CCTTCCTGAGGGAATCTTCAC (SEQ ID NO: 35)
- T7-antisense probe GTAATACGACTCACTATAGGGCCTGGGAA GTTGGTCATGGCCACTCCAGC (SEQ ID NO: 36)
- the RNA probes were synthesized using T7 RNA polymerase amplification of a PCR amplified DNA fragment corresponding rat NPCILI nucleotides 3318 to 3672 (SEQ ID NO 1).
- Sense and anti-sense digoxigenin-UTP labeled cRNA probes were generated from the T7 promoter using the DIG RNA Labeling Kit following the manufacturer's instructions. Serial cryosections rat jejunum were hybridized with the sense and antiisense probes. Digoxigenin labeling was detected with the DIG Nucleic Acid Detection Kit based on previous methods. A positive signal is characterized by the deposition of a red reaction product at the site of hybridization. The anti-sense probe showed strong staining of epithelium along the crypt-villus axis under low magnification (40X). The observed rat NPCILI mRNA expression levels may have been somewhat greater in the crypts than in the villus tips.
- Example 10 FACS Analysis of Fluorescently Labeled Ezetimibe Binding to Transiently Transfected CHO Cells. In these experiments, the ability of BODIPY-labeled ezetimibe
- BODIPY is a fluorescent group which was used to detect the BODIPY-ezetimibe.
- Chinese hamster ovary (CHO) cells were transiently transfected with rat NPCILI DNA (rNPClLl/CHO), mouse NPCILI DNA
- EGFP is enhanced green fluorescent protein which was used as a positive control.
- the transfected CHO cells or untransfected CHO cells were then stained with 100 nM BODIPY-labeled ezetimibe and analyzed by FACS. Control experiments were also performed wherein the cells were not labeled with the BODIPY-ezetimibe and wherein untransfected CHO cells were labeled with the BODIPY-ezetimibe. No staining was observed in the untransfected CHO, rNPClLl/CHO or mNPClLl/CHO cells.
- BODIPY-ezetimibe Fluorescence was detected in the positive-control EGFP/CHO cells. Staining was also detected in the mouse SR-B1/CHO cells. These data show that, under the conditions tested, BODIPY-ezetimibe is capable of binding to SR-B1 and that such binding is not ablated by the presence of the fluorescent BODIPY group. When more optimal conditions are determined, BODIPY-ezetimibe will be shown to label the rNPClLl/CHO and mNPClLl/CHO cells.
- Example 11 FACS Analysis of Transiently Transfected CHO Cells Labeled with Anti-FLAG Antibody M2. In these experiments, the expression of FLAG-tagged NPCILI on
- CHO cells was evaluated. CHO cells were transiently transfected with mouse NPCILI DNA, rat NPCILI DNA, FLAG- rat NPCILI DNA or FLAG- mouse
- NPCILI DNA The 8 amino acid FLAG tag used was DYKDDDDK (SEQ ID NO: 37) which was inserted on the amino-terminal extracellular loop just past the secretion signal sequence.
- the cells were incubated with commercially available anti-FLAG monoclonal mouse antibody M2 followed by a BODIPY-tagged anti-mouse secondary antibody. The treated cells were then analyzed by FACS. The M2 antibody stained the CHO cells transfected with FLAG-rat NPCILI DNA and with FLAG-mouse NPCILI . No staining was observed in the CHO cells transfected with mouse NPCILI DNA and with rat NPCILI DNA.
- Example 12 FACS Analysis of FLAG-rat NPC1L1-EGFP Chimera in Transiently Transfected CHO Cells. In these experiments, the surface and cytoplasmic localization of rat
- NPCILI in CHO cells was evaluated.
- CHO cells were transiently transfected with FLAG- rat NPCILI DNA or with FLAG-rat NPCILI -EGFP DNA.
- the FLAG tag is at amino-terminus of rat NPCILI
- EGFP fusion is at the carboxy- terminus of rat NPCILI.
- the cells were then stained with the M2 anti-FLAG mouse (primary) antibody followed by secondary staining with a BODIPY-labeled anti- mouse antibody.
- M2 anti-FLAG mouse (primary) antibody secondary staining with a BODIPY-labeled anti- mouse antibody.
- M2 anti-FLAG mouse (primary) antibody secondary staining with a BODIPY-labeled anti- mouse antibody.
- M2 anti-FLAG mouse (primary) antibody secondary staining with a BODIPY-labeled anti- mouse antibody.
- M2 primary antibody
- FLAG-rat NPCILI transfected cells were stained with BODIPY anti-mouse secondary antibody but not with the primary antibody.
- the data demonstrated that the secondary, anti-mouse antibody possessed- no significant specificity for FLAG-rat NPCILI and that the FLAG-rat NPCILI, itself, possesses no significant fluorescence.
- unlabeled FLAG-rat NPC1L1-EGFP cells were FACS analyzed. In these experiments, autofluorescence of the enhanced green fluorescent protein (EGFP) was detected.
- FLAG-rat NPCILI cells were stained with anti-FLAG mouse antibody M2 and with the BODIPY-labeled anti-mouse secondary antibody and FACS analyzed.
- Example 13 FACS Analysis and Fluorescent Microscopy of FLAG-rat NPC1L1-EGFP Chimera in a Cloned CHO Cell Line.
- the cellular localization of rat NPCILI was evaluated by FACS analysis and by immunohistochemistry.
- CHO cells were transfected with FLAG-rat NPC1L1-EGFP DNA and stained with anti-FLAG mouse antibody M2 and then with a BODIPY-labeled anti-mouse secondary antibody.
- the FLAG tag is at the amino-termim ⁇ s of rat NPCILI and the enhanced green fluorescent protein (EGFP) tag is located at the carboxy-terminus of the rat NPCILI.
- EGFP enhanced green fluorescent protein
- the stained cells were then analyzed by FACS and by fluorescence microscopy.
- Cells transfected with FLAG-rat NPC1L1-EGFP DNA were stained with the anti-FLAG mouse antibody M2 and then with the BODIPY-labeled anti- mouse secondary antibody.
- FACS analysis of the cells detected both markers indicating surface expression of the chimeric protein.
- FLAG-rat NPC1L1-EGFP transfected cells were analyzed by fluorescent microscopy at 63X magnification. Fluorescent microscopic analysis of the cells indicated non-nuclear staining with significant perinuclear organelle staining. Resolution of the image could not confirm the presence of vesicular associated protein. These data indicated that the fusion protein was expressed on the cell membrane of CHO cells.
- Example 14 Generation of Polyclonal Anti-rat NPCILI Rabbit Antibodies.
- Synthetic peptides (SEQ ID NO: 39-42) containing an amino- or carboxy-terminal cysteine residue were coupled to keyhole limpet hemocyanin (KLH) carrier protein through a disulfide linkage and used as antigen to raise polyclonal antiserum in New Zealand white rabbits (range 3-9 months in age).
- KLH-peptide was emulsified by mixing with an equal volume of Freund's Adjuvant, and injected into three subcutaneous dorsal sites.
- Example 15 FACS Analysis of Rat NPCILI Expression in CHO Cells Transiently Transfected with Rat NPCILI DNA Using Rabbit Anti-rat NPCILI Antisera. In these experiments, the expression of rat NPCILI on the surface of
- CHO cells was evaluated. CHO cells were transfected with rat NPCILI DNA, then incubated with either rabbit preimmune serum or with 10 week anti-rat NPCILI serum described, above, in Example 14 (i.e., A0715, A0716, A0867 or A0868). Cells labeled with primary antisera were then stained with a BODIPY-modified anti-rabbit secondary antibody followed by FACS analysis. No antibody surface labeling was observed for any of the pre-immune sera samples. Specific cell surface labeling of rat NPCILI transfected cells was observed for both A0715 and A0868. Antisera A0716 and A0867 did not recognize rat NPCILI surface expression in this assay format. This indicates that the native, unfused rat NPCILI protein is expressed in the CHO cells and localized to the CHO cell membranes. Cell surface expression of NPCILI is consistent with a role in intestinal cholesterol absorption.
- Example 16 FACS Analysis of CHO Cells Transiently Transfected with FLAG-Mouse NPCILI DNA or FLAG-rat NPCILI DNA or Untransfected CHO Cells Using Rabbit Anti-rat NPCILI Antisera. In these experiments, the expression of FLAG-mouse NPCILI and
- FLAG-rat NPCILI in CHO cells was evaluated. CHO cells were transiently transfected with FLAG-mouse NPCILI DNA or with FLAG-rat NPCILI DNA.
- FLAG-mouse NPCILI and FLAG-rat NPCILI transfected cells were labeled with either A0801, A0802, A0715 or A0868 sera (see Example 14) or with anti-FLAG antibody, M2.
- the labeled cells were then stained with BODIPY-labeled anti-rabbit secondary antibody and FACS analyzed.
- the untransfected CHO cells were analyzed in the same manner as the transfected cell lines. Positive staining of the untransfected CHO cells was not observed for any of the antisera tested. Serum A0801-dependent labeling of FLAG-rat NPCILI transfected cells was observed but such labeling of FLAG-mouse NPCILI transfected cells was not observed.
- Serum A0802-dependent labeling of FLAG-mouse NPCILI or FLAG-rat NPCILI transfected cells was not observed. Strong serum A0715- dependent labeling of FLAG-rat NPCILI transfected cells was observed and weak serum A0715-dependent labeling of FLAG-mouse NPCILI transfected cells was observed. Weak serum A0868-dependent labeling of rat NPCILI and mouse NPCILI transfected cells was observed. Strong Anti-FLAG M2 antibody-dependent labeling of FLAG-rat NPCILI and FLAG-mouse NPCILI transfected cells was observed. The strong M2 staining is likely to be due to the fact that M2 is an affinity- purified, monoclonal antibody of known concentration.
- the respective antisera are polyclonal, unpurified and contain an uncertain concentration of anti-rat NPCILI antibody.
- Example 17 Immunohistochemical Analysis of Rat Jejunum Tissue with Rabbit Anti-rat NPCILI Antisera A0715.
- Rat jejunum was removed, immediately embedded in O.C.T. compound and frozen in liquid nitrogen. Sections (6 ⁇ m) were cut with a cryostat microtome and mounted on glass slides. Sections were air dried at room temperature and then fixed in Bouin's fixative. Streptavidin-biotin-peroxidase immunostaining was carried out using Histostain-SP kit.
- a positive reaction using this protocol is characterized by the deposition of a red reaction product at the site of the antigen-antibody reaction. Nuclei appeared blue from the hematoxylin counterstain. Controls were performed simultaneously on the neighboring sections from the same tissue block. Control procedures consisted of the following: (1) substitute the primary antibody with the pre-immune serum, (2) substitute the primary antibody with the non-immune rabbit serum, (3) substitute the primary antibody with PBS, (4) substitute the second antibody with PBS.
- the example shows tissue stained with anti-rat NPCILI sera A0715 or with the preimmune sera analyzed at low magnification (40X) and at high magnification (200X).
- Example 18 Labeled Cholesterol Uptake Assay. In this example, the ability of CHO cells stably transfected with rat NPCILI to take up labeled cholesterol was evaluated.
- Example 19 Effect of Ezetimibe on Cholesterol Uptake.
- the effect of ezetimibe on the ability of CHO cells stably transfected with mouse or rat NPCILI or mouse SR-B1 to take up 3 H-labeled cholesterol was evaluated in pulse-chase experiments.
- One cDNA clone of mouse NPCILI (CI) and three clones of rat NPCILI (CI, C17 and C21) were evaluated.
- the ability of CHO cells stably transfected with mouse SR-BI, mouse NPCILI and rat NPCILI to take up labeled cholesterol, in the absence of ezetimibe, was also evaluated in the pulse-chase experiments.
- Extracts were spotted onto TLC plates and run for 30 minutes in 2 ml hexane: isopropanol (3: 2) mobile phase for 30 minutes, followed by a second run in 1 ml hexane: isopropanol (3: 2) mobile phase for 15 minutes.
- C Protein determination of cell extracts. Plates containing a sample of the cell extracts were placed on orbital shaker at 120 rpm for indicated times and then extracts are pooled into 12 X 75 tubes. Plates were dried and NaOH (2ml/well) added. The protein content of the samples were then determined. Two additional 50 ⁇ l aliquots from all wells were assayed for total protein by the Pierce micro BCA method. The quantity of labeled cholesterol observed in the cells was normalized to the quantity of protein in the cells.
- Cholesterol Ester in CHO cells in the Presence or Absence of Ezetimibe Cholesteryl Ester ,dpm ⁇ sem Cholesteryl Ester, dpnt/mgprotein ⁇ sem Vehicle EZ(lOuM) Vehicle 1 EZllOuMi
- Col- Ch-luttr-l 24 Min Pulse 3 ⁇ g/mL 12271 ⁇ 430 49603 ⁇ 2428 14250 ⁇ 1628 10656 ⁇ 1233 108936 ⁇ 3413 541562 *13785 140764 *14433 94945 *12916 10 ⁇ g/mL 16282 *2438 79967 ⁇ 8151 25465 ⁇ 3037 13225 ⁇ 4536 151283 ⁇ 23345 880224 ⁇ 82254 250985 *27481 123433 *34092 30 ⁇ g/mL 758 ⁇ 1607 71925 ⁇ 3863 19001 ⁇ 1530 13218 ⁇ 1149 135109 ⁇ 12106 796236 *18952 180436 ⁇ 12112 111522 *6941 100 ⁇ ./mL 16458 ⁇ 1.14 58185 ⁇ 4548 15973 *1665 11560 ⁇ 1132 149559 ⁇ 17977 630143 *3718 147717 ⁇ 8261 101328 ⁇ 71
- Example 20 Labeled Cholesterol Uptake Assay.
- the ability of CHO cells transiently transfected with rat NPCILI or mouse SR-BI to take up labeled cholesterol was evaluated. Also evaluated was the ability of rat NPCILI to potentiate the ability of CHO cells transfected with mouse SR-BI to take up labeled cholesterol.
- cholesterol uptake at a single concentration, was evaluated in pulse-chase experiments. The data generated in these experiments are set forth, below, in Table 7.
- B CHO cells transiently transfected with mouse SR-B 1.
- C. CHO transiently transfected with rat NPCILI cDNAs (n 8 clones). Transiently transfected cells were seeded at 300,000 cells / well (mL) in 12-well plates.
- Protein determination of cell extracts Plates containing a sample of the cell extracts were placed on orbital shaker at 120 rpm for indicated times and then extracts are pooled into 12X75 tubes. Plates were dried and NaOH (2ml/well) added. The protein content of the samples were then determined. Two additional 50 ⁇ l aliquots from all wells were assayed for total protein by the Pierce micro BCA method. The quantity of labeled cholesterol observed in the cells was normalized to the quantity of protein in the cells.
- Example 21 Expression of rat, mouse and human NPCILI.
- NPCILI was introduced into cells and expressed.
- Species specific NPCILI expression constructs were cloned into the plasmid pCDNA3 using clone specific PCR primers to generate the ORF flanked by appropriate restriction sites compatible with the polylinker of the vector.
- small intestine total tissue RNA was used as a template for reverse transcriptase-polymerase chain reaction (RT-PCR) using oligo dT as the template primer.
- RT-PCR reverse transcriptase-polymerase chain reaction
- the rat NPCILI was cloned as an EcoRI fragment
- human NPCILI was cloned as a Xbal/Notl fragment
- mouse NPCILI was cloned as an EcoRI fragment.
- Forward and reverse strand sequencing of each clone was performed to confirm sequence integrity.
- Standard transient transfection procedures were used with CHO cells. In a 6-well plate CHO cells were plated 1 day before transfection at a plating density of 2 X 10 5 cells/well. The following day, cells were incubated with 2 ⁇ g plasmid DNA and 6 ⁇ L Lipofectamine for 5 hours followed a fresh media change.
- transfected CHO cells were selected in the presence of geneticin (G418, 0.8 mg/ml) as recommended by the manufacturer (Life Technologies). Following one month of selection in culture, the cell population was stained with anti-NPClLl antisera and sorted by FACS. Individual positive staining cells were cloned after isolation by limiting dilution and then maintained in selective media containing geneticin (0.5 mg/ ml). Other cell types less susceptible to transfection procedures have been generated using adenoviral vector systems.
- NPCILI This system used to express NPCILI is derived from Ad 5, a type C adenovirus.
- This recombinant replication-defective adenoviral vector is made defective through modifications of the El, E2 and E4 regions.
- the vector also has additional modifications to the E3 region generally affecting the E3b region genes RIDa and RIDb.
- NPCILI expression was driven using the CMV promoter as an expression cassette substituted in the E3 region of the adenovirus.
- Rat and mouse NPCILI were amplified using clone specific primers flanked by restriction sites compatible with the adenovirus vector
- Adenovirus infective particles were produced from 293-D22 cells in titers of 5 X 10 10 P/mL.
- Viral lysates were used to infect cells resistant to standard transfection methodologies.
- Caco2 cells which are highly resistant to heterologous protein expression
- adenovirus mediated expression of NPCILI has been shown by western blot analysis to persist at least 21 days post-infection.
- NPCILI knockout mice were constructed via targeted mutagenesis. This methodology utilized a targeting construct designed to delete a specific region of the mouse NPCILI gene. During the targeting process the E. coli lacZ reporter gene was inserted under the control of the endogenous NPCILI promoter. The region in NPCILI (SEQ ID NO: 45) being deleted is from nucleotide 790 to nucleotide 998.
- the targeting vector contains the LacZ-Neo cassette flanked by 1.9 kb 5' arm ending with nucleotide 789 and a 3.2 kb 3' arm starting with nucleotide 999.
- Genomic DNA from the recombinant embryonic stem cell line was assayed for homologous recombination using PCR. Amplified DNA fragments were visualized by agarose gel electrophoresis.
- the test PCRs employed a gene specific primer, which lies outside of and adjacent to the targeting vector arm, paired with one of three primers specific to the LacZ-Neo cassette sequence.
- the NPCILI specific oligonucleotide ATGTTAGGTGAGTCTGAACCTACCC SEQ ID NO: 46
- 3 'PCR reconfirmation the NPCILI specific oligonucleotide
- GGATTGCATTTCCTTCAAGAAAGCC (SEQ ID NO: 47) were used. Genotyping of the F2 mice was performed by multiplex PCR using the NPCILI specific forward primer TATGGCTCTGCCCTCTGCAATGCTC (SEQ ID NO: 48) the LacZ-Neo cassette specific forward primer TCAGCAGCCTCTGTTCCACATACACTTC (SEQ ID NO: 49) in combination with the NPCILI gene specific reverse primer GTTCCACAGGGTCTGTGGTGAGTTC (SEQ ID NO: 50) allowed for determination of both the targeted and endogenous alleles. Analysis of the PCR products by agarose gel electrophoresis distinguished the wild-type, heterozygote and homozygote null mouse from each other.
- Example 23 Acute Cholesterol Absorption in NPCILI-Deficient Mice.
- Mice deficient in NPCILI were generated by breeding heterozygote mice (+/) to obtain wild-type (+/+) and NPCILI deficient mice (-/-).
- Example 24 Cholesterol Absorption in NPCILI (NPC3) Knockout Mice (Fecal Ratio Method: Cholesterol/Sitostanol).
- NPCILI NPCILI
- Knockout Mice Fecal Ratio Method: Cholesterol/Sitostanol.
- cholesterol absorption and the activity of ezetimibe was determined in the NPCILI knockout mice (-/-), heterozygous mice (+/-), and age matched wild- type mice (+/+).
- Cholesterol absorption in the mice was determined by the dual fecal isotope ratio method as described by Altmann et al. (Biochim. Biophys. Acta. 1580(1): 77-93 (2002)).
- the fraction of cholesterol absorbed was similar in wild type (+/+) and heterozygous mice (+/-) fed a chow diet (heterozygous mice absorbed 46 ⁇ 5% and age matched wild type mice absorbed 51 ⁇ 3% of the dose of 14 C-cholesterol).
- the NPCILI knockout mice (-/-) absorbed 15.6 ⁇ 0.4% of the 14 C-cholesterol, which was similar to the wild type mice treated with a maximally effective dose of ezetimibe (16.1 ⁇ 0.3%), and reduced by 69% compared to wild type mice (p ⁇ 0.001).
- NPCILI knockout treated with ezetimibe at 10 mg/kg/day cholesterol absorption was similar to that seen in the untreated knockout mice (16.2 ⁇ 0.6% compared to 15.6% ⁇ 0.4%, respectively).
- the majority of cholesterol absorption is dependent on the presence of NPCILI and the residual cholesterol absorption in mice lacking NPCILI is insensitive to ezetimibe treatment.
- Example 25 Mouse Screening Assay (Acute Cholesterol Absorption). The following screening assay is used to identify the presence of an NPCILI antagonist in a sample. Mice deficient in NPCILI (-/-) are generated by breeding heterozygote mice (+/) to obtain wild-type (+/+) and NPCILI deficient mice (-/-). In a first set of experiments, non-fasted mice (6.5-9 weeks old, mixed
- mice (+/+) are treated identically to the mice in the first set of experiments, above, except that the mice are additionally fed a sample to be tested for the presence of an NPCILI antagonist. Two hours later, blood is collected from each mouse by heart puncture.
- the liver is removed, weighed, and three samples are placed into 20 ml counting vials.
- Tissues are digested in 1 ml of IN NaOH at 60°C overnight.
- the tissue digests are acidified by addition of 250 ⁇ l of 4N HC1 prior to liquid scintillation counting (LSC).
- Plasma is isolated by centrifugation at 10,000 rpm for 5 minutes in a microfuge and duplicate lOO ⁇ l aliquots of plasma are taken for LSC. Cholesterol abso ⁇ tion, evaluated by this acute technique is expressed as the total amount of radioactive cholesterol in the plasma and liver.
- the sample tested is determined to contain an NPCILI antagonist when the level of cholesterol abso ⁇ tion (as measured by the above described methods) in the wild-type NPCILI mouse (+/+) which was fed the sample and in the NPCILI deficient mouse (-/-) are less than the amount of cholesterol abso ⁇ tion in the wild-type NPCILI mouse (+/+) which was not fed the sample.
- Example 26 Mouse Screening Assay
- mice Cholesterol/Sitostanol
- mice are gavaged with 14 C-cholesterol (l ⁇ Ci, O.lmg unlabeled cholesterol) and 3 H-sitostanol (2 ⁇ Ci) in 0.1ml corn oil.
- One group of mice, which comprise wild-type NPCILI mice (+/+) are further fed a sample to be tested for the presence of an NPCILI antagonist.
- Feces are collected for 2 days and fecal ** C- cholesterol and 3 H-sitostanol levels are determined by combustion in a Packard Oxidizer.
- the sample tested is determined to contain an NPCILI antagonist when the level of cholesterol and/or sitostanol abso ⁇ tion (as measured by the above described methods) in the wild-type NPCILI mouse (+/+) which was fed the sample and in the NPCILI deficient mouse (-/-) are less than the amount of cholesterol and/or sitostanol absorption in the wild-type NPCILI mouse (+/+) which was not fed the sample.
- Example 27 Binding Analysis Using Brush Border Membrane Vesicles
- the following screening assay may be used to identify the presence of an NPCILI ligand in a sample. Materials. The following two compounds were synthesized for the binding assay described herein , 3 H-ezetimibe glucuronide 1 (34.5 Ci/mmol) and its
- Ezetimibe glucuronide (compound 1) (also referred to as EZE-glucuronide) can be made according to the procedures in U.S. Patent No. 5,756,470.
- the general scheme below illustrates a method for the synthesis of compound 2 and radiolabel led 35 S-2.
- Step A Preparation of [ S]N-prop-2-yn-l-ylmethanesulfonamide (i).
- the appropriate volume of [35s]methane sulfonyl chloride (see Dean, D.C.; et al., J. Med. Chem. 1996, 39, 1767) totaling 3.5 Ci was removed from a stock solution in methylene chloride and placed in a 5mL conical flask. It was then distilled at atmospheric pressure until the volume was approximately 50 ⁇ L. To this solution was immediately added 50 ⁇ L of propargylamine.
- reaction mixture was diluted with 10 mL of ethyl acetate, washed with saturated sodium bicarbonate solution (3 x 2 mL), and dried over sodium sulfate. After filtration the resulting solution had a count of 3.3 mCi and a radiochemical purity of 99.9 % by HPLC
- Step B Preparation of [35s] 4-[(2S,3R)-3-[(3S)-3-(4-fluorophenyl)-3- hydroxypropyl]- 1 -(4- ⁇ 3-[(methylsulfonyl)amino]prop- 1 -yn- 1 -yl ⁇ phenyl)-4- oxoazetidin-2-yl]phenyl methyl ⁇ -D-glucopyranosiduronate ([35s]) (iii).
- Step C Preparation of [35s] 4-[(2S,3R)-3-[(3S)-3-(4-fluorophenyl)-3- hydroxypropyl] - 1 -(4- ⁇ 3 - [(methylsulfonyl)amino jprop- 1 -yn- 1 -yl ⁇ phenyl)-4- oxoazetidin-2-yl]phenyl ⁇ -D-glucopyranosiduronic acid 35 S-2.
- the crude reaction mixture containing compound iii was treated with 25 ⁇ L of methanol, 90 ⁇ L of water, and 30 ⁇ L of triethylamine and stirred at room temperature for one hour at which time it was concentrated to near dryness under a slow stream of nitrogen.
- the residue was dissolved in 1:1 acetonitrile:H 2 O and subjected to semi-preparative chromatography (Zorbax XDB C8 250 x 9.4 mm column, 70:30 acetonitrile:H 2 O (0.1 % TFA) 4 mL/min, 1 x 0.2 mL injections).
- Step A Preparation of iii.
- the appropriate volume of [ 35 S]methane sulfonyl chloride (see Dean, D.C.; et al., J. Med. Chem. 1996, 39, 1767) totaling 1.3 mCi was removed from a stock solution in methyl ene chloride and placed in a 5mL conical flask. It was then distilled at atmospheric pressure until the volume was approximately 50 ⁇ L. To this solution was immediately added a solution of 1 mg of v in 5 ⁇ L of pyridine (freshly distilled over calcium hydride).
- Membranes were prepared from Rhesus macaque (Macaca mulatta), rat (male Sprague-Dawley), and mouse (male C57BL/6J) intestines, using Mg ++ precipitation method described in the following references and with modifications described below (Hauser, H., Howell, K., Dawson, R.M.C, Bowyer, D. E. Biochim. Biophys. Acta 602. 567-577 (1980); Kramer, W., Girbig, F., Gutjahr, U., Kowalewski, S., Jouvenal, K., Muller, G., Tripier, D., Wess, G. J. Biol. Chem.
- the mucosal scrapings were resuspended in 20 volumes of cold buffer consisting of 300 mM D-mannitol, 5 mM EGTA, 12 mM Tris, pH 7.4 with HC1, and containing 0.1 mM PMSF and a 1% dilution of a protease inhibitor cocktail (set 1, Calbiochem). They were homogenized using a Polytron at medium speed on ice until inspection with a microscope indicated complete cell lysis. Then, solid MgCl 2 was added slowly with stirring to a final concentration of 1O mM, and the solution was kept stirring on ice for 15 min.
- cold buffer consisting of 300 mM D-mannitol, 5 mM EGTA, 12 mM Tris, pH 7.4 with HC1, and containing 0.1 mM PMSF and a 1% dilution of a protease inhibitor cocktail (set 1, Calbiochem). They were homogenized using a Polytron at medium speed on ice until inspection with
- Membrane protein was measured by the Bradford assay (Bradford, M.M. Anal. Biochem. 72, 248-254 (1976)) txsing bovine serum albumin as standard.
- the enrichment in brush border membranes was assessed using gamma- glutamyltransferase as a marker enzyme (Kramer, W., Girbig, F., Gutjahr, U., Kowalewski, S., Jouvenal, K., Muller, G, Tripier, D., Wess, G. J. Biol. Chem. 268. 18035-18046 (1993)), which indicated a 6-fold enrichment over the initial homogenate. Binding assay.
- Assays were conducted in 12 x 75 mm glass test tabes and total volume 20-100 ul. In general, frozen membranes were diluted in buffer A or buffer A containing 0.03% taurocholate and 0.05% digitonin to a final concentration of 0.02 to 5 mg/ml.
- Radiolabeled ligands were typically 25-50 nM for 3 H-ezetimih>e (EZE)glucuronide 1, and 3-5 nM for its 35 S analog 2, in the assay, and they were delivered as DMSO or CH CN solutions. Competing ligands were likewise added as DMSO solutions to give a total 2-10 % organic solvent content. Nonspecific binding was defined by competition with 100 uM ezetimibe glucuronide.
- buffer A At least 2 components of buffer A, the bicarbonate and phosphate salts, were later found to be inconsequential and were routinely omitted.
- the reactions with compound 1 were incubated at least 3 hours for rhesus membranes and at least one hour for rat membranes at ro om temperature, and with compound 2 as long as 2 hours at 37°C with rhesus and rat brush membranes. Additionally, reactions with compound 2 were incubated as long as 2 hours at 37°C with membranes from HEK-293 cells expressing mouse, rat or hurrxan NPCILI . Bound ligand was quantified " by single-tube vacuum filtration using GF/C glass fiber filters.
- Glass fiber filters were obtained from Whatman. The filters were pretreated by soaking with 0.5% polyethylenimine to reduce nonspecific binding. Filtration was accomplished by adding 2.5 ml of ice cold buffer (120 mM NaCl, 0.1% sodium cholate, and 20 mM ME S at pH 6.70) to the assay tube, pouring the mixture through the filter, and then rinsiog the tube and filter twice more with
- both 3 H-ezetimibe and its corresponding glucuronide derivative (1) were prepared and tested for binding to intestinal brush border membrane preparations, using a single-tube vacuum filtration technique.
- 3 H-ezetimibe high nonspecific binding was observed, precluding its use as a radioligand for the binding assay.
- specific binding was observed with this radioligand and it was used to assess binding in rhesus, rat, and mouse intestinal brush border membranes.
- Rhesus, rat, and mouse intestinal scrapings were homogenized and the brush border membranes isolated. Specific binding was observed exclusively in the membrane fraction.
- the data are shown in Figure 3, where the solid lines are theoretical for these rate constants.
- Example 28 Binding Analysis of a Potent NPCILI ligand
- a S-labeled propargyl-sulfonamide analogue of ezetimibe glucuronide ( 35 S-2) was identified as a potential NPCILI antagonist.
- Compound 2 was prepared as described in Example 27 and found to have markedly improved affinity for some species of brush border membranes vesicles. For rhesus brush border membranes vesicles, 56 ⁇ g protein/assay were incubated with 25 nM H-EZE- glucuronide in the presence of increasing concentrations of EZE-glucuronide and 2.
- Kj values are nM.
- Example 29 Distribution of H-ezetimibe glucuronide (1) binding to intestinal tissues. Previous studies have established that cholesterol abso ⁇ tion occurs primarily in the jejunum, and is substantially lower in the ileum and duodenum. To determine if the binding activity is similarly distributed, the binding assay using 3 H- ezetimibe glucuronide ( H-I) as a radioligand was used to determine the distribution of binding sites in sections from rhesus and rat intestines. For the rhesus studies, 10 cm corresponding to the ileum of a rhesus small intestine was separated and the remaining intestine was divided into three segments, (proximal, middle and distal) of equal length (70 cm each).
- H-I 3 H- ezetimibe glucuronide
- Brash border membrane vesicles were prepared as described in Example 27. Aliquots of vesicles (100-200 ⁇ g) protein/assay were incubated with 50nM 3 H-EZE-glucuronide in the absence and presence of 1 OO ⁇ M EZE-glucuronide. As shown in Figure 7, specific binding for 3 H-ezetimibe glucuronide peaks in the jejunum in both species, consistent with the previously observed pattern of cholesterol abso ⁇ tion.
- Example 30 Correlation of in vitro and in vivo binding activity of NPCILI
- the enantiomer of ezetimibe glucuronide and several close structural analogues of ezetimibe glucuronide that were tested in the rat membrane binding assay were tested in an acute rat cholesterol abso ⁇ tion study as described in Examples 23-26.
- the selected analogs had a range of in vitro potencies, and were anticipated to have similar physical properties to ezetimibe glucuronide (Tables 9 and 12).
- the same rank order of potency is observed in the in vitro and in vivo assays, further evidence that the observed binding is due to the target of ezetimibe.
- Example 31 Binding affinities of ezetimibe glucuronide and its analogs to recombinant NPCILI NPCILI was identified as a candidate target of ezetimibe from a search of genetic databases for cholesterol binding motifs. Subsequently, NPCILI deficient mice were found to have 80% reduction of cholesterol abso ⁇ tion, and did not respond to ezetimibe treatment, strongly suggesting that this protein is required for ezetimibe efficacy. To determine if NPCILI is the direct target of ezetimibe, binding affinities were compared for ezetimibe glucuronide and several analogs to NPC 1 LI transfected cells and rat brush border membrane vesicles.
- Rat NPCILI transfected CHO cells (-500,000 cells/assay) were incubated with 5 nM 35 S-2 ( ⁇ 1 million dpm/assay) for 2 hours at 37 °C in the absence or presence of increasing concentrations of EZE-glucuronide (compound 1), compounds 2, 3, 5, 6, or 8.
- Compound 8 is an analog of compound 2 wherein the hydroxyl group in the 3-hydroxylpropyl moiety of 2 is replaced with an oxo group.
- NPCILI transfected CHO cells (-600,000 cells/assay) were incubated with 5 nM 35 S-2 (-1 million dpm/assay) in buffer A for 2 hours at 37 °C in the absence or presence of increasing concentrations of EZE-glucuronide (compound 1), compounds 2, 3, 5, 6, or 8.
- EZE-glucuronide compound 1
- compounds 2, 3, 5, 6, or 8 EZE-glucuronide
- the affinities for the recombinant and native proteins are virtually identical, providing compelling evidence that NPCILI is the direct target of ezetimibe in mammalian tissues, and that other proteins are not required for binding. Affinities of ezetimibe glucuronide and analogues thereof were also determined for human recombinant NPCILI .
- Example 32 Binding of 35 S-2 to membranes from wild type and NPCILI deficient mice. Final confirmation that NPCILI is the target of ezetimibe was r provided by binding studies with S-2 in intestinal brush border membranes from NPCILI deficient and control mice. Brash border membranes vesicles were prepared from intestinal tissues of wild type and NPCILI knockout (-/-) mice. 15, 30 and 60 ⁇ g protein/ assay of brush border membranes vesicles were incubated with 4nM 35 S-2 in buffer A for 3 hours at 37°C in the presence and absence of 1 OO ⁇ M EZE-glucuronide.
- Example 33 Binding Analysis Using Brush Border Membrane Vesicles from Rat Mouse and Rhesus Monkey Binding studies were performed to compare the relative binding affinity of ezetimibe glucuronide to various brash border membrane vesicles. 3 H-ezetimibe glucuronide 1 was prepared as described in Example 27. The brush border membranes were prepared as described in Example 27. Binding Assay. Assays were conducted in 12 x 75 mm glass test tubes and total volume 20-100 ⁇ l.
- Final concentrations of [ 3 H] ezetimibe glucuronide 1 were typically 25-50 nM , and were delivered as DMSO or CH CN solutions. Competing ligands were likewise added as DMSO solutions to give a total 1-5 % organic solvent content.
- Nonspecific binding was defined by competition with 100-500 ⁇ M ezetimibe glucuronide. At least three components of buffer A, the bicarbonate and phosphate salts, and glucose, were later found to be inconsequential and were routinely omitted. Reactions were incubated until equilibrium was achieved (one hour for rat or three hours for rhesus membranes). Bound ligand was recovered by single-tube vacuum filtration on
- Whatman GF/C glass fiber filters The filters were pretreated by soaking with 0.5% polyethylenimine to reduce nonspecific binding. Filtration was accomplished by adding 2.5 ml of ice cold buffer (120 mM NaCl, 0.1 % sodium cholate, and 20 mM MES at pH 6.7) to the assay tube, pouring the mixture through the filter, and then rinsing the tube and filter twice more with another 2 x 2.5 ml buffer. The filters were counted in 7 ml vials using Ultima Gold MN liquid scintillation fluid from Packard. Where triplicate assays were performed, the standard error was typically ⁇ 4%.
- the rates for binding and dissociation of [ 3 H]ezetimibe glucuronide were determined and found to be slow relative to those typically observed for protein- ligand interactions.
- Table 11 also shows a correlation between in vitro and in vivo binding of [ 3 H]ezetimibe glucuronide in various enterocyte brush border membrane preparations from rat, mouse and rhesus monkey.
- the in vivo ED 50 values are derived from cholesterol abso ⁇ tion and cholesterol feeding studies.
- the rank order of ezetimibe potency (ED 50 ) in vivo as follows: rhesus (0.0005mpk) > rat (0.03mpk) > mouse (0.5mpk) is the same as the order of in vitro binding affinity (IC 50 ) as follows: rhesus monkey (41nM) ⁇ rat (542nM) ⁇ mouse (12,000nM).
- Beta-lactam cholesterol abso ⁇ tion inhibitors Curr. Med. Chem. 11, 1873-1887 (2004), consistent with the hypothesis that the assay is relevant to the target of ezetimibe in vivo (Table 11).
- the glucuronide of the enantiomer of ezetimibe was prepared and found to be completely inactive in vitro (Kj > 100 x K D for ezetimibe glucuronide in all species), consistent with its lack of activity in vivo in a rat acute cholesterol abso ⁇ tion model (see Table 12 in which the enantiomer is analyzed).
- Example 34 NPCILI as the target of ezetimibe in NPOLl-expressing HEK293 cells.
- This example demonstrates that ezetimibe binds specifically to NPCl LI -expressing HEK293 cells.
- Transient expression of NPCILI Plasmid pCR3.1 expressing rat NPCILI (Genbank AY437867) or human NPCILI (Genbank AY437865) were prepared using standard molecular biology protocols.
- HEK-293 cells ATCC were seeded at 10 x 10 6 cells per T-225 flask (Coming) in DMEM containing 10% fetal calf serum, 4.5 g/L D-glucose and L-glutamine, 18 hours prior to transfection.
- HEPES/Tris buffer pH 7.40 containing 8% sucrose, and sonicating the suspensions with a probe sonicator on ice until most of the cells were lysed.
- the sonicates were centrifuged at 1600 x g for 10 min to remove cell debris, and then the supernatants were centrifuged at 125,000 x g for 1 hour to recover the membranes.
- These membranes were resuspended in 20 mM HEPES/Tris buffer at pH 7.40 containing 160 mM NaCl and 5% glycerol, and stored at 10-20 mg/ml protein at -80°C.
- NPCILI human embryonic kidney
- Figure 13 Cell lysates from HEK-293 cells expressing NPCILI (Lanes 1 and 3 of Panel 1 Figure 13) and wild-type cells (Lanes 2 and 4 of Panel 1 Figure 13) were analyzed by gel electrophoresis and Western blot with an anti-NPClLl antibody A1801. An excess of NPCILI -specific peptide was included to assess specificity of the antibody for NPCILI (Lane 3 and 4 of Panel 1 Figure 13).
- Panel 2 of Figure 13 shows confocal microscope images of a fluorescent ezetimibe glucuronide analog (SCH354909) bound to the surface of NPC1L1-293 cells (Panel 2A), nonspecific binding of SCH354909 to NPC1L1-293 cells in the presence of 100 ⁇ M unlabeled ezetimibe glucuronide (Panel 2B), binding of SCH354909 to wild type HEK 293 cells (Panel 2C), and nonspecific binding of SCH354909 to wild type HEK 293 cells in the presence of 100 ⁇ M unlabeled ezetimibe glucuronide (Panel 2D).
- SCH354909 fluorescent ezetimibe glucuronide analog
- plated cells were incubated in culture media with 500 nM SCH354909 for 4 hours at 37°C. Cells were subsequently washed with PBS and fluorescence was detected using confocal microscopy. Binding of SCH345909 was clearly evident at the cell surface membrane of the NPCl LI -expressing cells and was completely abolished in the presence of excess unlabeled ezetimibe glucuronide (Figure 13, Panel 2C). No binding was observed in wild type HEK 293 cells ( Figure 13, Panels 2B and 2D).
- Example 35 NPCILI as the in vivo target of ezetimibe.
- NPCILI is the direct binding target of ezetimibe in vivo
- binding affinities of 1 and several key analogs were determined for recombinant rat and human NPCl LI expressed in HEK-293 cell membranes and compared to those for native rat and rhesus intestinal enterocyte brush border membranes.
- a series of ezetimibe analogs was selected with subtle structural diversity, but with no binding affinities to native brash border membranes that covered a range of 1000-fold.
- Table 12 shows a comparison of binding affinities (K ⁇ values) for recombinant NPC1L1-293 cell membranes and native brush border membranes Selected analogs of ezetimibe glucuronide are compared against recombinant rat and human NPCILI membranes prepared from transiently transfected HEK-293 cells compared to native rat and rhesus brash border membranes. The binding assays were conducted in a final volume of 20 ⁇ l in the presence of 0.03 % sodium taurocholate and 0.05% digitonin until equilibrium was achieved.
- Figure 14B shows a plot demonstrating competition of unlabeled ezetimibe glucuronide against 1.
- Conditions were those described in Figure 14A.
- the present studies involve a quantitative comparison of binding between recombinant proteins and brush border membranes.
- SR-BI scavenger receptor type Bl
- Example 36 Effect of detergents on [ 3 H]ezetimibe glucuronide binding.
- a practical aspect of work with the recombinant protein was that the number of binding sites in transfected NPClLl-293 cell membranes initially appeared quite low.
- the influence of a combination of 0.03 % taurocholate and 0.05% digitonin on specific binding to these and native enterocyte brash border membrane preparations is dramatic as illustrated in Figure 15.
- Equal amounts (25 ⁇ g protein) of rat brush border membranes, membranes from HEK-293 cells transiently expressing recombinant rat and human NPCILI, were incubated with 25 nM 1 in a final volume of 20 ⁇ l until equilibrium was achieved.
- the incubation conditions were buffer A with and without sodium taurocholate and digitonin to a final concentration of 0.03% and 0.05%, respectively.
- C denotes controls in the absence of detergent, and "+det” the response in the presence of both detergents.
- the results are shown in 3 bar groupings; Total binding (left bar in each 3 bar group), nonspecific binding in the presence of 100 ⁇ M unlabeled ezetimibe glucuronide (middle bar in each 3 bar group), and specific binding (right bar in each 3 bar group) are shown.
- Example 37 Binding affinities of ezetimibe glucuronide and various analogues NPCILI in rat and rhesus monkey membranes. As determined from binding assay results using 3 H-ezetimibe glucuronide with rat brush, border membrane, representative tested compounds of
- Formula II were determined to have ICso's of about 13,000nM or lower, and particularly certain tested compounds had ICso's of about 1900nM or lower, more particularly certain tested compounds had IC5 ⁇ 's of about lOOOnM or lower, and most particularly certain tested compounds had ICso's of less than lOOnM.
- representative tested compounds of Formula II were determined to have ICso's of about 4200nM or lower, and particularly certain tested compounds had ICso's of about 165nM or lower, more particularly certain tested compounds had ICso's of less than lOOnM, and most particularly certain tested compounds had ICso's of less than 50nM.
- the designations below are used in the Examples that follow for certain repetitively used intermediates:
- Triethylamine (7 equivalents) is added to a solution of (3R,4S)-3-[(3S)- 3-(4-fluorophenyl)-3-hydroxypropyl]-4-(4-hydroxyphenyl)-l-(4-iodophenyl)azetidin- 2-one (i-6) (1.00 equivalent), N-prop-2-yn-l-ylmethanesulfonamide (i-5) (1.50 equivalents), tetrakistriphenylphosphine alladium(O) (0.15 equivalents) and copper(I) iodide (0.30 equivalents) in DMF (0.1 M concentration with respect to final product) under a nitrogen atmosphere and the resulting solution aged at room temperature. After completion of reaction, the volatiles are evaporated in vacuo and the crude residue can be purified by flash chromatography on silica gel to afford the title compound.
- Step A Preparation of 4-r(2S.3R -3-[r3S -3-r4-fluorophenyl)-3- hydroxyprop yl] - 1 -(4- ⁇ 3 - [(methylsulfonyl amin ⁇ ]prop- 1 -yn- 1 - yl ⁇ phenyD-4-oxoazetidin-2-yl] ⁇ henyl methyl ⁇ -D- glucopyranosiduronate (Compound 7a)
- Triethylamine (0.07 mL, 0.502 mmol) was added to a stirred solution of4-[(2S,3R)-3-[(3S)-3-(4-fluorophenyl)-3-hydroxypropyl]-l-(4-iodo ⁇ henyl)-4- oxoazetidin-2-yl]phenyl methyl ⁇ -D-glucopyranosiduronate (i-7) (0.050 g, 0.071 mmol), N-prop-2-yn-l-ylmethanesulfonamide (i-5) (0.014 g, 0.105 mmol), tetrakistriphenylphosphine palladium(O) (0.012 g, 0.010 mmol) and copper iodide (0.005 g, 0.026 mmol) in DMF (0.5 mL) under a nitrogen atmosphere and the resulting solution aged at room temperature for 18 h.
- Step B Preparation of 4-[(2S.3R)-3-[(3, ( ?)-3-(4-fluorophenylV3- hydroxypropyl]-! -(4- ⁇ 3-[(methylsulfonyl amino]pro ⁇ -l -yn-1 - yl ⁇ phenyl -4-oxoazetidin-2-yl]phenyl ⁇ -D-glucopyranosiduronic acid (Compound 7b. also referred to herein as compound 2)
- EXAMPLE 45 (COMPOUNDS 6B TO 6G AND 7C TO 7N)
- the following compounds of Formula Ila have been prepared (as indicated by MS data provided) or can be prepared using the general synthetic procedures described in Example 43 (shown in Table 13) or Example 44 (shown in Table 14).
- Step A Preparation of 4-((2S.3RV3-f(3S)-3-(4-fluorophenylV3- hydroxypropyl] -4-oxo- 1 - ⁇ 4-[(trimethylsilyDethynyl]phenyl ⁇ azetidin- 2-yl)phenyl methyl ⁇ -D-glucopyranosiduronate (8a)
- Triethylamine (69.0 ⁇ L, 0.495 mmol) was added to a stirred solution of i-7 (50.0 mg, 0.071 mmol), trimethylsilyacetylene (12.0 ⁇ L, 0.085 mmol), tetrakistriphenylphosphine palladium(O) (13.0 mg, 0.011 mmol) and copper iodide 10 (5.10 mg, 0.028 mmol) in DMF (0.5 mL) under a nitrogen atmosphere and the resulting solution aged at room temperature for 18 h.
- Step B Preparation of 4-((2S.3RVl-(4-ethvnyl ⁇ henylV3-[(3SV3-(4- fluorophenyl)-3-hvdroxy ⁇ ropyl]-4-oxoazetidin-2— yl ⁇ henyl ⁇ -D- glucopyranosiduronic acid (8b)
- Step A Preparation of 4 * -r(2S3R -3- (3Sl-3-(4-fluorophenyn-3- hydroxypropyl]-! -(4- ⁇ 3-[(methylsulfonyl)amino]propyl ⁇ phenylV4- oxoazetidin-2-yl]phenyl methyl ⁇ -D-glucopyranosiduronate (9a)
- Step B Preparation of 4-f(2S.3RV3-[ ' (3S)-3-(4-fluorophenylV3- hydroxypropyl]-l-(4- ⁇ 3-[(methylsulfonyl amino]propyl ⁇ phenylV4- oxoazetidin-2-yl]phenyl ⁇ -D-glucopyranosiduronic acid (9b
- Step A Preparation of 4-((2S.3RV3-
- Triethylamine (170 ⁇ L, 1.25 mmol) was added to a solution of A& (156 mg, 0.178 mmol), tert-butyldimethyl(2-propynyloxy)silane (43.0 ⁇ L, 0.214 mmol), dichlorobistriphenylphosphine palladium(II) (12.0 mg, 0.018 mmol) and copper iodide (7.00 mg, 0.036 mmol) in DMF (1.3 mL) under a nitrogen atmosphere and the resulting solution aged at room temperature for approximately 20 h. The reaction mixture was poured into saturated aqueous sodium bicarbonate and extracted twice with diethyl ether.
- Step B Preparation of 4-((2S3RV3-[Y3S)-3-(acetyloxy)-3- (4-fluorophenyl)propyl] - 1 - [4-(3 -hydroxyprop- 1 -yn- 1 - yPphenyl] -4-oxoazetidin-2-yl Iphenyl methyl 23.4-tri-O-acetyl- ⁇ -D-glucopyranosiduronate (10b)
- Tetrabutylammonium fluoride hydrate (39.0 mg, 0.148 mmol) was added to 10a (136 mg, 0.148 mmol) in tefrahydrofuran (1.5mL), and the resulting solution aged at room temperature for 1 h.
- the reaction mixture was poured into saturated aqueous ammonium chloride and extracted twice with ether.
- the combined organic extracts were washed with saturated sodium bicarbonate, brine, dried (MgSO 4 ), filtered and concentrated in vacuo. Purification of the crade residue by flash chromatography on silica gel (50% ethyl acetate/hexanes) afforded the title compound 10b.
- Step C Preparation of 4-((2S.3RV3-r(3S)-3-(acetyloxyV 3-(4-fluorophenyl)propyl]-4-oxo- 1 -[4-(3-oxoprop- 1 -yn- 1 - vDphenyl] azetidin-2-yl ⁇ phenyl methyl 2.3.4-tri-O-acetyl- ⁇ -D-glucopyranosiduronate (10c)
- Step D Preparation of 4- ((2S.3RV3-[(3Sl-3-(acetyloxyV3-(4- fluorophenyl)propyl]-l-[4-(carboxyethyny ⁇ phenyl]-4-oxoazetidin-2- yllphenyl methyl 23.4-tri-O-acetyl- ⁇ -D-glucopyranosiduronate (lOd)
- Step E Preparation of 4-((2S.3RVl- 4-(carboxyethvnyl phenyll-3-( " (3S)- 3-(4-fluorophenyl)-3-hydroxypropyl]-4-oxoazetidin-2-yl ⁇ phenyl ⁇ -D-glucopyranosiduronic acid (lOe)
- Step A Preparation of 4-((2S.3RV3-[(3S)-3-(acetyloxyV3-(4- fluorophenyl)propyl]-l - ⁇ 4-(3-(ethylaminoV3-oxoprop- 1 -yn- 1 -yl]phenyl ⁇ -4-oxoazetidin-2-yDphenyl methyl 23,4-tri-O-acetyl- ⁇ -D-glucopyranosiduronate (11a)
- Step B Preparation of 4- ⁇ (2S.3R)- 1 - (4-[3 -(ethylamino -3 -oxoprop- 1 -yn- l-yl]phenyl ⁇ -3-[(3S)-3-(4-fluorophenyl -3-hvdroxypropyl]-4- oxoazetidin-2-yl ⁇ phenyl ⁇ -D-glucopyranosiduronic acid (l ib)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Urology & Nephrology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Toxicology (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Hematology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Food Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Peptides Or Proteins (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP05711542A EP1723414A4 (en) | 2004-01-16 | 2005-01-14 | Npc1l1 (npc3) and methods of identifying ligands thereof |
| MXPA06008124A MXPA06008124A (es) | 2004-01-16 | 2005-01-14 | Npc1l1 (npc3) y metodos para identificar ligandos del mismo. |
| CA2553769A CA2553769C (en) | 2004-01-16 | 2005-01-14 | Npc1l1 (npc3) and methods of identifying ligands thereof |
| US10/586,310 US7901893B2 (en) | 2004-01-16 | 2005-01-14 | NPC1L1 (NPC3) and methods of identifying ligands thereof |
| JP2006549676A JP4590417B2 (ja) | 2004-01-16 | 2005-01-14 | Npc1l1(npc3)およびこのリガンドの同定方法 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US53734104P | 2004-01-16 | 2004-01-16 | |
| US60/537,341 | 2004-01-16 |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| WO2005069900A2 true WO2005069900A2 (en) | 2005-08-04 |
| WO2005069900A3 WO2005069900A3 (en) | 2006-06-08 |
| WO2005069900B1 WO2005069900B1 (en) | 2006-08-03 |
Family
ID=34807095
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2005/001469 Ceased WO2005069900A2 (en) | 2004-01-16 | 2005-01-14 | Npc1l1 (npc3) and methods of identifying ligands thereof |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US7901893B2 (https=) |
| EP (1) | EP1723414A4 (https=) |
| JP (1) | JP4590417B2 (https=) |
| CA (1) | CA2553769C (https=) |
| MX (1) | MXPA06008124A (https=) |
| WO (1) | WO2005069900A2 (https=) |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7135556B2 (en) | 2002-07-19 | 2006-11-14 | Schering Corporation | NPC1L1 (NPC3) and methods of use thereof |
| WO2007059871A1 (de) * | 2005-11-23 | 2007-05-31 | Sanofi-Aventis Deutschland Gmbh | Hydroxy-substituierte diphenylazetidinone zur behandlung von hyperlipidämie |
| JP2007523595A (ja) * | 2003-07-17 | 2007-08-23 | シェーリング コーポレイション | Npc1l1(npc3)およびその使用方法 |
| US7470678B2 (en) | 2002-07-05 | 2008-12-30 | Astrazeneca Ab | Diphenylazetidinone derivatives for treating disorders of the lipid metabolism |
| WO2009138035A1 (zh) * | 2008-05-13 | 2009-11-19 | 中国科学院上海生命科学研究院 | 基于分析npc1l1蛋白亚细胞定位变化筛选降胆固醇新药的方法 |
| US7622449B2 (en) | 2003-12-23 | 2009-11-24 | Merck & Co., Inc. | Anti-hypercholesterolemic compounds |
| EP1893222A4 (en) * | 2005-06-15 | 2010-07-07 | Merck Sharp & Dohme | ANTI-HYPERCHOLESTERINAMIC COMPOUNDS |
| EP2173893A4 (en) * | 2007-06-28 | 2010-07-21 | Merck Sharp & Dohme | USE OF MDCK CELLS IN THE ASSESSMENT OF CHOLESTEROL MODULATORS |
| US7842684B2 (en) | 2006-04-27 | 2010-11-30 | Astrazeneca Ab | Diphenylazetidinone derivatives possessing cholesterol absorption inhibitor activity |
| US7863265B2 (en) | 2005-06-20 | 2011-01-04 | Astrazeneca Ab | 2-azetidinone derivatives and their use as cholesterol absorption inhibitors for the treatment of hyperlipidaemia |
| US7871998B2 (en) | 2003-12-23 | 2011-01-18 | Astrazeneca Ab | Diphenylazetidinone derivatives possessing cholesterol absorption inhibitory activity |
| US7893048B2 (en) | 2005-06-22 | 2011-02-22 | Astrazeneca Ab | 2-azetidinone derivatives as cholesterol absorption inhibitors for the treatment of hyperlipidaemic conditions |
| US7901893B2 (en) | 2004-01-16 | 2011-03-08 | Merck Sharp & Dohme Corp. | NPC1L1 (NPC3) and methods of identifying ligands thereof |
| US7906502B2 (en) | 2005-06-22 | 2011-03-15 | Astrazeneca Ab | 2-azetidinone derivatives as cholesterol absorption inhibitors for the treatment of hyperlipidaemic conditions |
| US7910698B2 (en) | 2006-02-24 | 2011-03-22 | Schering Corporation | NPC1L1 orthologues |
| US20120322987A1 (en) * | 2010-06-10 | 2012-12-20 | Bioceltran Co., Ltd. | Composition for repression of hyperlipidemia and obesity through suppression of intestinal cholesterol absorption |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016179212A1 (en) * | 2015-05-05 | 2016-11-10 | Albert Einstein College Of Medicine, Inc. | Antibody therapeutics against filovirus infections and uses thereof |
Family Cites Families (38)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5561227A (en) * | 1991-07-23 | 1996-10-01 | Schering Corporation | Process for the stereospecific synthesis of azetidinones |
| US5688787A (en) * | 1991-07-23 | 1997-11-18 | Schering Corporation | Substituted β-lactam compounds useful as hypochlesterolemic agents and processes for the preparation thereof |
| US5688785A (en) * | 1991-07-23 | 1997-11-18 | Schering Corporation | Substituted azetidinone compounds useful as hypocholesterolemic agents |
| ES2107548T3 (es) * | 1991-07-23 | 1997-12-01 | Schering Corp | Compuestos de beta-lactama sustituidos utiles como agentes hipocolesterolemicos y procedimientos para su preparacion. |
| LT3300B (en) * | 1992-12-23 | 1995-06-26 | Schering Corp | Combination of a cholesterol biosynhtesis inhibitor and a beta- lactam cholesterol absorbtion inhibitor |
| LT3595B (en) * | 1993-01-21 | 1995-12-27 | Schering Corp | Spirocycloalkyl-substituted azetidinones useful as hypocholesterolemic agents |
| FI960095L (fi) * | 1993-07-09 | 1996-01-09 | Schering Corp | Menetelmä atsetidinonien syntetitoimiseksi |
| US5631365A (en) * | 1993-09-21 | 1997-05-20 | Schering Corporation | Hydroxy-substituted azetidinone compounds useful as hypocholesterolemic agents |
| US5627176A (en) * | 1994-03-25 | 1997-05-06 | Schering Corporation | Substituted azetidinone compounds useful as hypocholesterolemic agents |
| US5624920A (en) * | 1994-11-18 | 1997-04-29 | Schering Corporation | Sulfur-substituted azetidinone compounds useful as hypocholesterolemic agents |
| US5633246A (en) * | 1994-11-18 | 1997-05-27 | Schering Corporation | Sulfur-substituted azetidinone compounds useful as hypocholesterolemic agents |
| US5656624A (en) * | 1994-12-21 | 1997-08-12 | Schering Corporation | 4-[(heterocycloalkyl or heteroaromatic)-substituted phenyl]-2-azetidinones useful as hypolipidemic agents |
| US5618707A (en) * | 1996-01-04 | 1997-04-08 | Schering Corporation | Stereoselective microbial reduction of 5-fluorophenyl-5-oxo-pentanoic acid and a phenyloxazolidinone condensation product thereof |
| AU7472896A (en) * | 1995-11-02 | 1997-05-22 | Schering Corporation | Process for preparing 1-(4-fluorophenyl)-3(r)-(3(s)-hydroxy-3-({phenyl or 4-fluorophenyl})-propyl)-4(s)-(4-hydroxyphenyl)-2-azetidinon |
| US5886171A (en) * | 1996-05-31 | 1999-03-23 | Schering Corporation | 3-hydroxy gamma-lactone based enantioselective synthesis of azetidinones |
| US5739321A (en) * | 1996-05-31 | 1998-04-14 | Schering Corporation | 3-hydroxy γ-lactone based enantionselective synthesis of azetidinones |
| US5756470A (en) * | 1996-10-29 | 1998-05-26 | Schering Corporation | Sugar-substituted 2-azetidinones useful as hypocholesterolemic agents |
| AU8286998A (en) * | 1997-07-03 | 1999-01-25 | United States Of America, Represented By The Secretary, Department Of Health And Human Services, The | Genes for niemann-pick type c disease |
| US6133001A (en) * | 1998-02-23 | 2000-10-17 | Schering Corporation | Stereoselective microbial reduction for the preparation of 1-(4-fluorophenyl)-3(R)-[3(S)-Hydroxy-3-(4-fluorophenyl)propyl)]-4(S)-(4 -hydroxyphenyl)-2-azetidinone |
| US5919672A (en) * | 1998-10-02 | 1999-07-06 | Schering Corporation | Resolution of trans-2-(alkoxycarbonylethyl)-lactams useful in the synthesis of 1-(4-fluoro-phenyl)-3(R)- (S)-hydroxy-3-(4-fluorophenyl)-propyl!-4(S)-(4-hydroxyphenyl)-2-azetidinone |
| HK1039487B (en) | 1998-12-07 | 2005-08-12 | Merck Sharp & Dohme Corp. | Process for the synthesis of azetidinones |
| US6207822B1 (en) * | 1998-12-07 | 2001-03-27 | Schering Corporation | Process for the synthesis of azetidinones |
| ATE549412T1 (de) | 1999-04-05 | 2012-03-15 | Schering Corp | Stereoselektive mikrobielle reduktion für die herstellung von 1-(4-fluorophenyl)-3(r)- 3(s)- hydroxy-3-(4-fluorophenyl)propyl) -4(s)-(4-hhydroxyphenyl)-2-azetidinon |
| WO2000063703A1 (en) * | 1999-04-16 | 2000-10-26 | Schering Corporation | Use of azetidinone compounds |
| CA2399776A1 (en) | 2000-02-03 | 2001-08-09 | Hyseq, Inc. | Novel nucleic acids and polypeptides |
| EP1273657A4 (en) | 2000-03-24 | 2005-04-06 | Takeda Pharmaceutical | NEW PROTEIN, METHOD FOR ITS PRODUCTION AND ITS USE |
| US6436703B1 (en) | 2000-03-31 | 2002-08-20 | Hyseq, Inc. | Nucleic acids and polypeptides |
| IL156445A0 (en) * | 2001-01-26 | 2004-01-04 | Schering Corp | Combinations of peroxisome proliferator-activated receptor (ppar) activator(s) and sterol absorption inhibitor(s) and treatments for vascular indications |
| EE05453B1 (et) * | 2001-03-28 | 2011-08-15 | Schering Corporation | Protsess asetidinoonvahehendite valmistamiseks |
| WO2003100094A2 (en) | 2002-05-23 | 2003-12-04 | Devgen Nv | Method for determining the influence of a compound on cholesterol transport |
| CA2492017A1 (en) * | 2002-07-19 | 2004-01-29 | Schering Corporation | Npc1l1 (npc3) and methods of use thereof |
| US20040132058A1 (en) * | 2002-07-19 | 2004-07-08 | Schering Corporation | NPC1L1 (NPC3) and methods of use thereof |
| US20040137467A1 (en) * | 2002-07-19 | 2004-07-15 | Schering Corporation | NPC1L1 (NPC3) and methods of use thereof |
| US7135556B2 (en) * | 2002-07-19 | 2006-11-14 | Schering Corporation | NPC1L1 (NPC3) and methods of use thereof |
| RU2345089C2 (ru) | 2002-08-06 | 2009-01-27 | Санофи-Авентис Дойчланд Гмбх | ОЧИЩЕННЫЙ 145 кДа-БЕЛОК, СПОСОБНЫЙ СВЯЗЫВАТЬ ХОЛЕСТЕРИН И/ИЛИ ИНГИБИТОРЫ ПОГЛОЩЕНИЯ ХОЛЕСТЕРИНА, СПОСОБЫ ЕГО ПОЛУЧЕНИЯ И ОЧИСТКИ И ПРИМЕНЕНИЕ 145 кДа-БЕЛКА |
| EP1562605A4 (en) | 2002-10-08 | 2006-07-12 | Massachusetts Inst Technology | COMPOUNDS FOR MODULATING CHOLESTER INTRANSPORT |
| WO2005069900A2 (en) | 2004-01-16 | 2005-08-04 | Merck & Co., Inc. | Npc1l1 (npc3) and methods of identifying ligands thereof |
| CA2579790A1 (en) | 2004-07-30 | 2006-02-09 | Mount Sinai School Of Medicine Of New York University | Npc1l1 and npc1l1 inhibitors and methods of use thereof |
-
2005
- 2005-01-14 WO PCT/US2005/001469 patent/WO2005069900A2/en not_active Ceased
- 2005-01-14 EP EP05711542A patent/EP1723414A4/en not_active Withdrawn
- 2005-01-14 MX MXPA06008124A patent/MXPA06008124A/es unknown
- 2005-01-14 JP JP2006549676A patent/JP4590417B2/ja not_active Expired - Fee Related
- 2005-01-14 US US10/586,310 patent/US7901893B2/en not_active Expired - Fee Related
- 2005-01-14 CA CA2553769A patent/CA2553769C/en not_active Expired - Fee Related
Non-Patent Citations (1)
| Title |
|---|
| See references of EP1723414A4 * |
Cited By (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7470678B2 (en) | 2002-07-05 | 2008-12-30 | Astrazeneca Ab | Diphenylazetidinone derivatives for treating disorders of the lipid metabolism |
| US7135556B2 (en) | 2002-07-19 | 2006-11-14 | Schering Corporation | NPC1L1 (NPC3) and methods of use thereof |
| JP2007523595A (ja) * | 2003-07-17 | 2007-08-23 | シェーリング コーポレイション | Npc1l1(npc3)およびその使用方法 |
| US7622449B2 (en) | 2003-12-23 | 2009-11-24 | Merck & Co., Inc. | Anti-hypercholesterolemic compounds |
| US7871998B2 (en) | 2003-12-23 | 2011-01-18 | Astrazeneca Ab | Diphenylazetidinone derivatives possessing cholesterol absorption inhibitory activity |
| US7901893B2 (en) | 2004-01-16 | 2011-03-08 | Merck Sharp & Dohme Corp. | NPC1L1 (NPC3) and methods of identifying ligands thereof |
| EP1893222A4 (en) * | 2005-06-15 | 2010-07-07 | Merck Sharp & Dohme | ANTI-HYPERCHOLESTERINAMIC COMPOUNDS |
| US7863265B2 (en) | 2005-06-20 | 2011-01-04 | Astrazeneca Ab | 2-azetidinone derivatives and their use as cholesterol absorption inhibitors for the treatment of hyperlipidaemia |
| US7893048B2 (en) | 2005-06-22 | 2011-02-22 | Astrazeneca Ab | 2-azetidinone derivatives as cholesterol absorption inhibitors for the treatment of hyperlipidaemic conditions |
| US7906502B2 (en) | 2005-06-22 | 2011-03-15 | Astrazeneca Ab | 2-azetidinone derivatives as cholesterol absorption inhibitors for the treatment of hyperlipidaemic conditions |
| WO2007059871A1 (de) * | 2005-11-23 | 2007-05-31 | Sanofi-Aventis Deutschland Gmbh | Hydroxy-substituierte diphenylazetidinone zur behandlung von hyperlipidämie |
| DE102005055726A1 (de) * | 2005-11-23 | 2007-08-30 | Sanofi-Aventis Deutschland Gmbh | Hydroxy-substituierte Diphenylazetidinone, Verfahren zu deren Herstellung, diese Verbindungen enthaltende Arzneimittel und deren Verwendung |
| US7910698B2 (en) | 2006-02-24 | 2011-03-22 | Schering Corporation | NPC1L1 orthologues |
| US8212016B2 (en) | 2006-02-24 | 2012-07-03 | Schering Corporation | NPC1L1 orthologues |
| US7842684B2 (en) | 2006-04-27 | 2010-11-30 | Astrazeneca Ab | Diphenylazetidinone derivatives possessing cholesterol absorption inhibitor activity |
| EP2173893A4 (en) * | 2007-06-28 | 2010-07-21 | Merck Sharp & Dohme | USE OF MDCK CELLS IN THE ASSESSMENT OF CHOLESTEROL MODULATORS |
| WO2009138035A1 (zh) * | 2008-05-13 | 2009-11-19 | 中国科学院上海生命科学研究院 | 基于分析npc1l1蛋白亚细胞定位变化筛选降胆固醇新药的方法 |
| US20120322987A1 (en) * | 2010-06-10 | 2012-12-20 | Bioceltran Co., Ltd. | Composition for repression of hyperlipidemia and obesity through suppression of intestinal cholesterol absorption |
| US8609098B2 (en) * | 2010-06-10 | 2013-12-17 | Adbiotech Co., Ltd. | Composition for repression of hyperlipidemia and obesity through suppression of intestinal cholesterol absorption |
| EP2581094A4 (en) * | 2010-06-10 | 2015-04-08 | Adbiotech Co Ltd | COMPOSITION FOR INHIBITING HYPERLIPIDEMIA AND ADIPOSITAS BY INHIBITING THE INHIBITION OF CHOLESTEROL BY THE DARM |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2553769A1 (en) | 2005-08-04 |
| CA2553769C (en) | 2011-01-04 |
| EP1723414A2 (en) | 2006-11-22 |
| JP2007526998A (ja) | 2007-09-20 |
| US7901893B2 (en) | 2011-03-08 |
| WO2005069900A3 (en) | 2006-06-08 |
| WO2005069900B1 (en) | 2006-08-03 |
| US20100009461A1 (en) | 2010-01-14 |
| JP4590417B2 (ja) | 2010-12-01 |
| EP1723414A4 (en) | 2008-03-26 |
| MXPA06008124A (es) | 2007-01-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7901893B2 (en) | NPC1L1 (NPC3) and methods of identifying ligands thereof | |
| JP2010142238A (ja) | Npc1l1(npc3)およびその使用方法 | |
| CA2842429A1 (en) | Compositions and methods for the diagnosis and treatment of inflammatory bowel disorders | |
| US20120079616A1 (en) | Npc1l1 (npc3) and methods of use thereof | |
| JP2010252798A (ja) | Npc1l1(npc3)およびその使用方法 | |
| JP2010046077A (ja) | 脊椎動物patched−2タンパク質 | |
| US8212016B2 (en) | NPC1L1 orthologues | |
| US20040137467A1 (en) | NPC1L1 (NPC3) and methods of use thereof | |
| JP2003534765A (ja) | 単離されたvshk−1レセプターポリペプチドおよびそれを使用する方法 | |
| WO2006098520A1 (ja) | スクリーニング方法 | |
| CA2691267A1 (en) | Use of mdck cells in the evaluation of cholesterol modulators | |
| AU718197B2 (en) | DNA encoding human alpha 1 adrenergic receptors and methods therefor | |
| JP2003310281A (ja) | 新規タンパク質およびそのdna | |
| WO2003072780A1 (fr) | Nouvelles protéines, leurs adn et leur utilisation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006549676 Country of ref document: JP Ref document number: PA/a/2006/008124 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2553769 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWW | Wipo information: withdrawn in national office |
Country of ref document: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005711542 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005711542 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10586310 Country of ref document: US |