WO2005007822A2 - Method for assaying protein-protein interaction - Google Patents

Method for assaying protein-protein interaction Download PDF

Info

Publication number
WO2005007822A2
WO2005007822A2 PCT/US2004/021887 US2004021887W WO2005007822A2 WO 2005007822 A2 WO2005007822 A2 WO 2005007822A2 US 2004021887 W US2004021887 W US 2004021887W WO 2005007822 A2 WO2005007822 A2 WO 2005007822A2
Authority
WO
WIPO (PCT)
Prior art keywords
protein
test
nucleotide sequence
protease
encodes
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2004/021887
Other languages
English (en)
French (fr)
Other versions
WO2005007822A3 (en
Inventor
Kevin J. Lee
Richard Axel
Walter Strapps
Gilad Barnea
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Columbia University in the City of New York
Sentigen Biosciences Inc
Original Assignee
Columbia University in the City of New York
Sentigen Biosciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Columbia University in the City of New York, Sentigen Biosciences Inc filed Critical Columbia University in the City of New York
Priority to JP2006518902A priority Critical patent/JP4734498B2/ja
Priority to CN2004800248641A priority patent/CN1894581B/zh
Priority to AT04756784T priority patent/ATE534900T1/de
Priority to CA002531698A priority patent/CA2531698A1/en
Priority to AU2004257228A priority patent/AU2004257228B8/en
Priority to EP04756784A priority patent/EP1644734B1/en
Publication of WO2005007822A2 publication Critical patent/WO2005007822A2/en
Publication of WO2005007822A3 publication Critical patent/WO2005007822A3/en
Priority to IL173023A priority patent/IL173023A0/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6845Methods of identifying protein-protein interactions in protein mixtures
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1055Protein x Protein interaction, e.g. two hybrid selection
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/94Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving narcotics or drugs or pharmaceuticals, neurotransmitters or associated receptors
    • G01N33/9406Neurotransmitters
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/72Assays involving receptors, cell surface antigens or cell surface determinants for hormones
    • G01N2333/726G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/10Screening for compounds of potential therapeutic value involving cells

Definitions

  • This invention relates to methods for determining interaction between molecules of interest. More particularly, it relates to determining if a particular substance referred to as the test compound modulates the interaction of two or more specific proteins of interest, via determining activation of a reporter gene in a cell, where the activation, or lack thereof, results from the modulation or its absence. The determination occurs using transformed or transfected cells, which are also a feature of the invention, as are the agents used to transform or transfect them.
  • GPCRs are the largest class of cell surface receptors known for humans.
  • GPCRs refers to any member of the GPCR superfamily of receptors characterized by a seven-transmembrane domain (7TM) structure.
  • these receptors include, but are not limited to, the class A or "rhodopsin-like” receptors; the class B or “secretin-like” receptors; the class C or “metabotropic glutamate-like” receptors; the Frizzled and Smoothened-related receptors; the adhesion receptor family or EGF-7TM / LNB-7TM receptors; adiponectin receptors and related receptors; and chemosensory receptors including odorant, taste, vomeronasal and pheromone receptors.
  • the GPCR superfamily in humans includes but is not limited to those receptor molecules described by Vassilatis, et al., Proc. Natl. Acad. Sci.
  • GPCRs transduce signals by modulating the activity of intracellular, heterotrimeric guanine nucleotide binding proteins, or "G proteins".
  • G proteins The complex of ligand and receptor stimulates guanine nucleotide exchange and dissociation of the G protein heterotrimer into ⁇ and ⁇ subunits.
  • Both the GTP-bound subunit and the ⁇ di er can act to regulate various cellular effector proteins, including adenylyl cyclase and phospholipase C (PLC).
  • PLC phospholipase C
  • G-protein regulated effector pathway such as the accumulation of cAMP that is produced by adenylyl cyclase, or the release of intracellular calcium, which is stimulated by PLC activity.
  • G-protein regulated effector pathway such as the accumulation of cAMP that is produced by adenylyl cyclase, or the release of intracellular calcium, which is stimulated by PLC activity.
  • Conventional G-protein based, signal transduction assays have been difficult to develop for some targets, as a result of two major issues.
  • different GPCRs are coupled to different G protein regulated signal transduction pathways, and G-protein based assays are dependent on knowing the G-protein specificity of the target receptor, or require engineering of the cellular system, to force coupling of the target receptor to a particular effect or pathway.
  • the binding of a ligand to a GPCR can be said to "modulate” the interaction between the GPCR and arrestin protein, since the binding of ligand to GPCR causes the arrestin to bind to the GPCR, thereby modulating its activity.
  • modulates or any form thereof is used, it refers simply to some change in the way the two proteins of the invention interact, when the test compound is present, as compared to how these two proteins interact, in its absence. For example, the presence ofthe test compound may strengthen or enhance the interaction of the two proteins, weaken it, inhibit it, or lessen it in some way, manner or form which can then be detected. [0010] This background information has led to alternate methods for assaying activation and inhibition of GPCRs.
  • U.S. Patent No. 6,528,271 to Bohn, et al. deals with assays for screening for pain controlling medications, where the inhibitor of ⁇ -arrestin binding is measured.
  • Published U.S. patent applications, such as 2004/0002119, 2003/0157553, 2003/0143626, and 2002/0132327 all describe different forms of assays involving GPCRs.
  • Published application 2002/0106379 describes a construct which is used in an example which follows; however, it does not teach or suggest the invention described herein.
  • proteins include but are not limited to, membrane bound proteins, such as receptors, GPCRs in particular. How this is accomplished will be seen in the examples which follow.
  • a method for determining if a test compound modulates a specific protein/protein interaction of interest comprising contacting said compound to a cell which has been transformed or transfected with (a) a nucleic acid molecule which comprises, (i) a nucleotide sequence which encodes said first test protein, (ii) a nucleotide sequence encoding a cleavage site for a protease or a portion of a protease, and (iii) a nucleotide sequence which encodes a protein which activates a reporter gene in said cell, and (b) a nucleic acid molecule which comprises, (i) a nucleotide sequence which encodes a second test protein whose interaction with said first test protein in the presence of said test compound is to be measured, and (ii) a nucleotide sequence which encodes a protease or a portion of
  • the first test protein may be a membrane bound protein, such as a transmembrane receptor, and in particular a GPCR.
  • transmembrane receptors include ⁇ 2-adrenergic receptor (ADRB2), arginine vasopressin receptor 2 (AVPR2), serotonin receptor la (HTR1A), m2 muscarinic acetylcholine receptor (CHRM2), chemokine (C-C motif) receptor 5 (CCR5), dopamine D2 receptor (DRD2), kappa opioid receptor (OPR ), or ⁇ la-adregenic receptor (ADRA1A) although it is to be understood that in all cases the invention is not limited to these specific embodiments.
  • ADRB2 ⁇ 2-adrenergic receptor
  • AVPR2 arginine vasopressin receptor 2
  • HTR1A serotonin receptor la
  • CHRM2 m2 muscarinic acetylcholine receptor
  • CCR5 chemokine receptor
  • molecules such as the insulin growth factor- 1 receptor (IGF-1R), which is a tyrosine kinase, and proteins which are not normally membrane bound, like estrogen receptor 1(ESR1) and estrogen receptors 2 (ESR2).
  • the protease or portion of a protease may be a tobacco etch virus nuclear inclusion A protease.
  • the protein which activates said reporter gene may be a transcription factor, such as tTA or GAL4.
  • the second protein may be an inhibitory protein, such as an arrestin.
  • the cell may be a eukaryote or a prokaryote.
  • the reporter gene may be an exogenous gene, such as ⁇ -galactosidase or luciferase.
  • the nucleotide sequence encoding said first test protein may be modified to increase interaction with said second test protein. Such modifications include but are not limited to replacing all or part of the nucleotide sequence of the C-terminal region of said first test protein with a nucleotide sequence which encodes an amino acid sequence which has higher affinity for said second test protein than the original sequence.
  • the C-terminal region may be replaced by a nucleotide sequence encoding the C-terminal region of AVPR2, AGTRLI, GRPR, F2RL1, CXCR2/IL-8b, CCR4, or GRPR.
  • the method may comprise contacting more than one test compound to a plurality of samples of cells, each of said samples being contacted by one or more of said test compounds, wherein each of said cell samples have been transformed or transfected with the aforementioned nucleic acid molecules, and determining activity of reporter genes in said plurality of said samples to determine if any of said test compounds modulate a specific, protein/protein interaction.
  • the method may comprise contacting each of said samples with one test compound, each of which differs from all others, or comprise contacting each of said samples with a mixture of said test compounds.
  • a method for determining if a test compound modulates one or more of a plurality of protein interactions of interest comprising contacting said test compound to a plurality of samples of cells, each of wliich has been transformed or transfected with (a) a first nucleic acid molecule comprising, (i) a nucleotide sequence which encodes a first test protein, a nucleotide sequence encoding a cleavage site for a protease, and (ii) a nucleotide sequence which encodes a protein which activates a reporter gene in said cell, (b) a second nucleic acid molecule which comprises, (i) a nucleotide sequence which encodes a second test protein whose interaction with said first test protein in the presence of said test compound of interest is to be measured, (ii) a nucleotide sequence which encodes a protease or a protease which is specific for said cleavage
  • All of said samples may be combined in a common receptacle, and each sample comprises a different pair of first and second test proteins. Alternatively, each sample may be tested in a different receptacle.
  • the reporter gene in a given sample may differ from the reporter gene in other samples.
  • the mixture of test compounds may comprise or be present in a biological sample, such as cerebrospinal fluid, urine, blood, serum, pus, ascites, synovial fluid, a tissue extract, or an exudate.
  • a recombinant cell transformed or transfected with (a) a nucleic acid molecule which comprises, (i) a nucleotide sequence which encodes said first test protein, (ii) a nucleotide sequence encoding a cleavage site for a protease or a portion of a protease, and (iii) a nucleotide sequence which encodes a protein which activates a reporter gene in said cell, and (b) a nucleic acid molecule which comprises, (i) a nucleotide sequence which encodes a second test protein whose interaction with said first test protein in the presence of said test compound is to be measured, and (ii) a nucleotide sequence which encodes a protease or a portion of a protease which is specific for said cleavage site.
  • the first test protein may be a membrane bound protein, such as a transmembrane receptor, and in particular a GPCR. Particular transmembrane receptors include ADRB2, AVPR2, HTR1A, CHRM2, CCR5, DRD2, OPRK, or ADRA1A.
  • the protease or portion of a protease may be a tobacco etch virus nuclear inclusion A protease.
  • the protein which activates said reporter gene may be a transcription factor, such as tTA or GAL4.
  • the second protein may be an inhibitory protein.
  • the cell may be a eukaryote or a prokaryote.
  • the reporter gene may be an exogenous gene, such as ⁇ -galactosidase or luciferase.
  • the nucleotide sequence encoding said first test protein may be modified to increase interaction with said second test protein, such as by replacing all or part of the nucleotide sequence of the C-terminal region of said first test protein with a nucleotide sequence which encodes an amino acid sequence which has higher affinity for said second test protein than the original sequence.
  • an isolated nucleic acid molecule which comprises, (i) a nucleotide sequence which encodes a test protein (ii) a nucleotide sequence encoding a cleavage site for a protease or a portion of a protease, and (iii) a nucleotide sequence which encodes a protein which activates a reporter gene in said cell.
  • the test protein may be a membrane bound protein, such as is a transmembrane receptor.
  • a particular type of transmembrane protein is a GPCR.
  • Particular transmembrane receptors include ADRB2, ANPR2, HTR1A, CHRM2, CCR5, DRD2, OPRK, or ADRA1 A.
  • the protease or portion of a protease may be a tobacco etch virus nuclear inclusion A protease.
  • the protein which activates said reporter gene may be a transcription factor, such as tTA or GAL4. As above, the invention is not to be viewed as limited to these specific embodiments.
  • an expression vector comprising an isolated nucleic acid molecule which comprises, (i) a nucleotide sequence which encodes a test protein (ii) a nucleotide sequence encoding a cleavage site for a protease or a portion of a protease, and (iii) a nucleotide sequence which encodes a protein which activates a reporter gene in said cell, and further being operably linked to a promoter.
  • an isolated nucleic acid molecule which comprises, (i) a nucleotide sequence which encodes a test protein whose interaction with another test protein in the presence of a test compound is to be measured, and (ii) a nucleotide sequence which encodes a protease or a portion of a protease which is specific for said cleavage site.
  • the test protein may be an inhibitory protein, such as an arrestin.
  • an expression vector comprising an isolated nucleic acid molecule which comprises, (i) a nucleotide sequence which encodes a test protein whose interaction with another test protein in the presence of a test compound is to be measured, and (ii) a nucleotide sequence which encodes a protease or a portion of a protease which is specific for said cleavage site, said nucleic acid further being operably linked to a promoter.
  • An additional embodiment comprises a fusion protein produced by expression of: [0028] an isolated nucleic acid molecule which comprises, (i) a nucleotide sequence which encodes a test protein (ii) a nucleotide sequence encoding a cleavage site for a protease or a portion of a protease, and (iii) a nucleotide sequence which encodes a protein which activates a reporter gene in said cell, and further being operably linked to a promoter; or [0029] an isolated nucleic acid molecule which comprises, (i) a nucleotide sequence which encodes a test protein whose interaction with another test protein in the presence of a test compound is to be measured, and (ii) a nucleotide sequence which encodes a protease or a portion of a protease which is specific for said cleavage site [0030] In yet another embodiment, there is provided a test kit useful for determining if
  • the first test protein may be a membrane bound protein, such as a transmembrane receptor.
  • a particular type of transmembrane receptor is a GPCR.
  • a particular transmembrane protein is a GPCR.
  • Particular transmembrane receptors include ADRB2, AVPR2, HTRIA, CHRM2, CCR5, DRD2, OPRK, or ADRAIA.
  • the protease or portion of a protease may be tobacco etch virus nuclear inclusion A protease.
  • the protein which activates said reporter gene may be a transcription factor, such as tTA or GAL4.
  • the second protein may be an inhibitory protein, such as an arrestin.
  • the kit may further comprise a separate portion of an isolated nucleic acid molecule which encodes a reporter gene.
  • the reporter gene may encode ⁇ -galactosidase or luciferase.
  • the nucleotide sequence encoding said first test protein may be modified to increase interaction with said second test protein, such as by replacing all or part of the nucleotide sequence of the C-terminal region of said first test protein with a nucleotide sequence which encodes an amino acid sequence which has higher affinity for said second test protein than the original sequence.
  • the nucleotide sequence of said C-terminal region may be replaced by a nucleotide sequence encoding the C-terminal region of AVPR2, AGTRLI, GRPR, F2RL1, CXCR2/IL-8B, CCR4, or GRPR.
  • FIG. 1 shows the conceptual underpinnings of the invention, pictorially, using ligand-receptor binding as an example.
  • Figures 2a and 2b show that the response of targets in assays in accordance with the invention is dose dependent, both for agonists and antagonists.
  • Figure 3 shows that a dose response curve results with a different target and a different agonist as well.
  • Figure 4 depicts results obtained in accordance with the invention, using the D2 dopamine receptor.
  • Figures 5 a and 5b illustrate results of an assay which shows that two molecules can be studied simultaneously.
  • Figure 6 sets forth the result of another "multiplex" assay, i.e., one where two molecules are studied simultaneously.
  • Figure 7 presents data obtained from assays measuring EGFR activity.
  • Figure 8 presents data obtained from assays in accordance with the invention, designed to measure the activity of human type I interferon receptor.
  • Figure 9 elaborates on the results in figure 7, showing a dose response curve for IFN-c- in the cells used to generate figure 7.
  • Figure 10 shows the results of additional experiments where a different transcription factor, and a different cell line, were used.
  • the present invention relates to methods for determining if a substance of interest modulates interaction of a first test protein, such as a membrane bound protein, like a receptor, e.g., a transmembrane receptor, with a second test protein, like a member of the arrestin family.
  • a first test protein such as a membrane bound protein, like a receptor, e.g., a transmembrane receptor
  • a second test protein like a member of the arrestin family.
  • the methodology involves cotransforming or cotransfecting a cell, which may be prokaryotic or eukaryotic, with two constructs.
  • the first construct includes, a sequence encoding (i) the first test protein, such as a transmembrane receptor, (ii) a cleavage site for a protease, and (iii) a sequence encoding a protein which activates a reporter gene.
  • the second construct includes, (i) a sequence which encodes a second test protein whose interaction with the first test protein is measured and/or determined, and (ii) a nucleotide sequence which encodes a protease or a portion of a protease sufficient to act on the cleavage site that is part of the first construct. In especially preferred embodiments, these constructs become stably integrated into the cells.
  • DNA encoding a transcription factor to DNA encoding a first test protein, such as a transmembrane receptor molecule, being studied. This fusion is accompanied by the inclusion of a recognition and cleavage site for a protease not expressed endogenously by the host cell being used in the experiments.
  • DNA encoding this first fusion protein is introduced into and is expressed by a cell which also contains a reporter gene sequence, under the control of a promoter element which is dependent upon the transcription factor fused to the first test protein, e.g., the receptor.
  • the transcription factor remains tethered to the first test protein and is unable to enter the nucleus to stimulate expression ofthe reporter gene.
  • Recombinant techniques can also be used to produce a second fusion protein.
  • DNA encoding a member of the arrestin family is fused to a DNA molecule encoding the exogenous protease, resulting in a second fusion protein containing the second test protein, i.e., the arrestin family member.
  • An assay is then carried out wherein the second fusion protein is expressed, together with the first fusion protein, and a test compound is contacted to the cells, preferably for a specific length of time.
  • test compound modulates interaction of the two test proteins, e.g., by stimulating, promoting or enhancing the association of the first and second test proteins, this leads to release of the transcription factor, which in turn moves to the nucleus, and provokes expression of the reporter gene.
  • the activity of the reporter gene is measured.
  • the two test proteins may interact in the absence of the test compound, and the test compound may cause the two test proteins to dissociate, lessen or inhibit their interaction. In such a case, the level of free, functionally active transcription factor in the cell decreases in the presence of the test compound, leading to a decrease in proteolysis, and a measurable decrease in the activity ofthe reporter gene.
  • the arrestin protein which is the second test protein, binds to the receptor in the presence of an agonist; however, it is to be understood that since receptors are but one type of protein, the assay is not dependent upon the use of receptor molecules, nor is agonist binding the only interaction capable of being involved. Any protein will suffice, although the interest in transmembrane proteins is clear. Further, agonist binding to a receptor is not the only type of binding which can be assayed. One can determine antagonists, per se and also determine the relative strengths of different antagonists and/or agonists in accordance with the invention. [0052] Other details of the invention, include specific methods and technology for making and using the subject matter thereof, are described below.
  • vector is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated.
  • a nucleic acid sequence can be "exogenous,” which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found.
  • Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs).
  • expression vector refers to any type of genetic construct comprising a nucleic acid coding for a RNA capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes.
  • Expression vectors can contain a variety of "control sequences," which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host cell. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleotide sequences that serve other functions as well and are described infra. [0055]
  • a plasmid vector is contemplated for use -t ⁇ in cloning and gene transfer.
  • plasmid vectors containing replicon and control sequences which are derived from species compatible with the host cell are used in connection with these hosts.
  • the vector ordinarily carries a replication site, as well as marking sequences which are capable of providing phenotypic selection in transformed cells.
  • E. coli is often transformed using derivatives of pBR322, a plasmid derived from an E. coli species.
  • pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells.
  • the pBR plasmid, or other microbial plasmid or phage must also contain, or be modified to contain, for example, promoters which can be used by the microbial organism for expression of its own proteins.
  • phage vectors containing replicon and control sequences that are compatible with the host microorganism can be used as transforming vectors in connection with these hosts.
  • the phage lambda G ⁇ MTM-11 may be utilized in making a recombinant phage vector which can be used to transform host cells, such as, for example, E. coli LE392.
  • Bacterial host cells for example, E. coli, comprising the expression vector, are grown in any of a number of suitable media, for example, LB.
  • the expression of the recombinant protein in certain vectors may be induced, as would be understood by those of skill in the art, by contacting a host cell with an agent specific for certain promoters, e.g., by adding IPTG to the media or by switching incubation to a higher temperature.
  • prokaryotic vectors can also be used to transform eukaryotic host cells. However, it may be desirable to select vectors that have been modified for the specific purpose of expressing proteins in eukaryotic host cells. Expression systems have been designed for regulated and/or high level expression in such cells. For example, the insect cell baculovirus system can produce a high level of protein expression of a heterologous nucleic acid segment, such as described in U.S.
  • Other examples of expression systems include STRATAGENE ® 's COMPLETE CONTROLTM Inducible Mammalian Expression System, which involves a synthetic ecdysone- inducible receptor, or its pET Expression System, an E.coli expression system.
  • INVITROGEN ® which carries the T-REXTM (tetracycline-regulated expression) System, an inducible mammalian expression system that uses the full-length CMV promoter.
  • INVITROGEN ® also provides a yeast expression system called the Pichia methanolica Expression System, which is designed for high-level production of recombinant proteins in the methylotrophic yeast Pichia methanolica.
  • a vector such as an expression construct, to produce a nucleic acid sequence or its cognate polypeptide, protein, or peptide.
  • the construct may contain additional 5' and/or 3' elements, such as promoters, poly A sequences, and so forth.
  • the elements may be derived from the host cell, i.e., homologous to the host, or they may be derived from distinct source, i.e., heterologous.
  • a "promoter” is a control sequence that is a region of a nucleic acid sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind, such as RNA polymerase and other transcription factors, to initiate the specific transcription a nucleic acid sequence.
  • a promoter generally comprises a sequence that functions to position the start site for RNA synthesis.
  • the best known example of this is the TATA box, but in some promoters lacking a TATA box, such as, for example, the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.
  • Additional promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have been shown to contain functional elements downstream of the start site as well.
  • To bring a coding sequence "under the control of a promoter one positions the 5' end of the transcription initiation site of the transcriptional reading frame "downstream" of (i.e., 3' of) the chosen promoter.
  • the "upstream" promoter stimulates transcription of the DNA and promotes expression ofthe encoded RNA.
  • the spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another.
  • a promoter may or may not be used in conjunction with an "enhancer,” which refers to a cis- acting regulatory sequence involved in the transcriptional activation of a nucleic acid sequence.
  • a promoter may be one naturally associated with a nucleic acid molecule, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and/or exon.
  • an enhancer may be one naturally associated with a nucleic acid molecule, located either downstream or upstream of that sequence.
  • an enhancer may be one naturally associated with a nucleic acid molecule, located either downstream or upstream of that sequence.
  • certain advantages will be gained by positioning the coding nucleic acid segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid molecule in its natural environment.
  • a recombinant or heterologous enhancer refers also to an enhancer not normally associated with a nucleic acid molecule in its natural environment.
  • promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other virus, or prokaryotic or eukaryotic cell, and promoters or enhancers not "naturally occurring," i.e., containing different elements of different transcriptional regulatory regions, and/or mutations that alter expression.
  • promoters that are most commonly used in recombinant DNA construction include the ⁇ -lactamase (penicillinase), lactose and tryptophan (trp) promoter systems.
  • sequences may be produced using recombinant cloning and/or nucleic acid amplification technolog ⁇ ', including PCRTM, in connection with the compositions disclosed herein (see U.S. Patents Nos. 4,683,202 and 5,928,906, each incorporated herein by reference).
  • control sequences that direct transcription and/or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.
  • a promoter and/or enhancer that effectively directs the expression of the DNA segment in the organelle, cell type, tissue, organ, or organism chosen for expression.
  • promoters for protein expression
  • the promoters employed may be constitutive, tissue-specific, inducible, and/or useful under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and/or peptides.
  • the promoter may be heterologous or endogenous.
  • any promoter/enhancer combination (as per, for example, the Eukaryotic Promoter Data Base EPDB, www.epd.isb-sib.ch/) could also be used to drive expression.
  • Eukaryotic cells can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided, either as part of the delivery complex or as an additional genetic expression construct.
  • a specific initiation signal also may be required for efficient translation of coding sequences. These signals include the ATG initiation codon or adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may need to be provided.
  • One of ordinary skill in the art would readily be capable of determining this and providing the necessary signals. It is well known that the initiation codon must be "in-frame" with the reading frame of the desired coding sequence to ensure translation of the entire insert.
  • exogenous translational control signals and initiation codons can be either natural or synthetic.
  • the efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements.
  • IRES internal ribosome entry sites
  • IRES elements are used to create multigene, or polycistronic, messages. IRES elements are able to bypass the ribosome scanning model of 5' methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg, Nature. 334:320- 325 (1988)).
  • IRES elements from two members of the picomavirus family have been described (Pelletier and Sonenberg, supra), as well an IRES from a mammalian message (Macejak and Sarnow, Nature, 353:90-94 (1991))1991).
  • IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating polycistronic messages. By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message (see U.S. Patent Nos.
  • Vectors can include a multiple cloning site (MCS), which is a nucleic acid region that contains multiple restriction enzyme sites, any of which can be used in conjunction with standard recombinant technology to digest the vector (see, for example, Carbonelli, et al, FEMS Microbiol. Lett.. 172(l):75-82 (1999), Levenson, et al, Hum. Gene Ther. 9(8):1233-1236 (1998), and Cocea, Biotechniques.
  • MCS multiple cloning site
  • Restriction enzyme digestion refers to catalytic cleavage of a nucleic acid molecule with an enzyme that functions only at specific locations in a nucleic acid molecule. Many of these restriction enzymes are commercially available. Use of such enzymes is widely understood by those of skill in the art. Frequently, a vector is linearized or fragmented using a restriction enzyme that cuts within the MCS to enable exogenous sequences to be ligated to the vector. "Ligation” refers to the process of forming phosphodiester bonds between two nucleic acid fragments, which may or may not be contiguous with each other.
  • the vectors or constructs of the present invention will generally comprise at least one termination signal.
  • a "termination signal” or “terminator” comprises a DNA sequence involved in specific termination of an RNA transcript by an RNA polymerase.
  • a termination signal that ends the production of an RNA transcript is contemplated.
  • a terminator may be necessary in vivo to achieve desirable message levels.
  • the teiminator region may also comprise specific DNA sequences that permit site-specific cleavage of the new transcript so as to expose a polyadenylation site. This signals a specialized endogenous polymerase to add a stretch of about 200 adenosine residues (polyA) to the 3' end of the transcript. RNA molecules modified with this polyA tail appear to more stable and are translated more efficiently.
  • terminator comprises a signal for the cleavage of the RNA, and it is more preferred that the terminator signal promotes polyadenylation of the message.
  • the terminator and/or polyadenylation site elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.
  • Terminators contemplated for use in the invention include any known terminator of transcription described herein or known to one of ordinary skill in the art, including but not being limited to, for example, the termination sequences of genes, such as the bovine growth hormone terminator, viral termination sequences, such as the SV40 terminator.
  • the termination signal may be a lack of transcribable or translatable sequence, such as an untranslatable/untranscribable sequence due to a sequence truncation.
  • a polyadenylation signal to effect proper polyadenylation of the transcript.
  • the nature of the polyadenylation signal is not believed to be crucial to the successful practice ofthe invention, and any such sequence may be employed.
  • Preferred embodiments include the SV40 polyadenylation signal or the bovine growth hormone polyadenylation signal, both of which are convenient, readily available, and known to function well in various target cells. Polyadenylation may increase the stability of the transcript or may facilitate cytoplasmic transport.
  • nucleic acid delivery for use with the current invention are believed to include virtually any method by which a nucleic acid molecule (e.g., DNA) can be introduced into a cell as described herein or as would be known to one of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of DNA such as by ex vivo transfection (Wilson, et al., Science.
  • test protein is preferably a membrane bound protein, such as a transmembrane receptor, e.g., a member ofthe GPCR family.
  • a membrane bound protein such as a transmembrane receptor, e.g., a member ofthe GPCR family.
  • the modifications can include, e.g., replacing a C-terminal encoding sequence ofthe test protein, such as a GPCR, with the C terminal coding region for AVPR2, AGTRLI, GRPR, F2PLI, CCR4, CXCR2/IL-8, CCR4, or GRPR, all of which are defined supra.
  • the protein which activates the reporter gene may be a protein which acts within the nucleus, like a transcription factor (e.g., tTA, GAL4, etc.), or it may be a molecule that sets a cascade of reactions in motion, leading to an intranuclear reaction by another protein. The skilled artisan will be well versed in such cascades.
  • the second construct includes a region which encodes a protein that interacts with the first protein, leading to some measurable phenomenon.
  • the protein may be an activator, an inhibitor, or, more, generically, a "modulator" of the first protein.
  • Members of the arrestin family are preferred, especially when the first protein is a GPCR, but other protein encoding sequences may be used, especially when the first protein is not a GPCR.
  • the second part of these two part constructs encodes the protease, or portion of a protease, which acts to remove the activating molecule from the fusion protein encoded by the first construct.
  • these preferred embodiments do not limit the invention, as discussed in the following additional embodiments.
  • host cell refers to a prokaryotic or eukaryotic cell that is capable of replicating a vector and/or expressing a heterologous gene encoded by a vector.
  • host cells When host cells are “transfected” or “transformed” with nucleic acid molecules, they are referred to as “engineered” or “recombinant” cells or host cells, e.g., a cell into which an exogenous nucleic acid sequence, such as, for example, a vector, has been introduced. Therefore, recombinant cells are distinguishable from naturally-occurring cells which do not contain a recombinantly introduced nucleic acid. [0083] Numerous cell lines and cultures are available for use as a host cell, and they can be obtained through the American Type Culture Collection (ATCC), which is an organization that serves as an archive for living cultures and genetic materials (www.atcc.org).
  • ATCC American Type Culture Collection
  • An appropriate host can be determined by one of skill in the art based on the vector backbone and the desired result.
  • a plasmid or cosmid for example, can be introduced into a prokaryote host cell for replication of many vectors.
  • Cell types available for vector replication and/or expression include, but are not limited to, bacteria, such as E. coli (e.g., E. coli strain RR1, E. coli LE392, E. coli B, E. coli X 1776 (ATCC No. 31537) as well as E. coli W3110 (F-, lambda-, prototrophic, ATCC No.
  • bacterial cells such as E. coli LE392 are particularly contemplated as host cells for phage viruses.
  • Examples of eukaryotic host cells for replication and/or expression of a vector include, but are not limited to, HeLa, NIH3T3, Jurkat, 293, COS, CHO, Saos, and PC12. Many host cells from various cell types and organisms are available and would be known to one of skill in the art. Similarly, a viral vector may be used in conjunction with either a eukaryotic or prokaryotic host cell, particularly one that is permissive for replication or expression ofthe vector. Test Proteins [0085] The present invention contemplates the use of any two proteins for which a physical interaction is known or suspected.
  • the proteins will exist as fusions proteins, a first test protein fused to a transcription factor, and the second test protein fused to a protease that recognizes a cleavage site in the first fusion protein, cleavage of which releases the transcription factor.
  • the only requirements for the test proteins/fusions are (a) that the first test protein cannot localize to the nucleus prior to cleavage, and (b) that the protease must remain active following both fusion to the second test protein and binding of the first test protein to the second test protein.
  • the first test protein may be, e.g., a naturally membrane bound protein, or one which has been engineered to become membrane bound, via standard techniques.
  • the first test protein may be, e.g., a transmembrane receptor such as any of the GPCRs, or any other transmembrane receptor of interest, including, but not being limited to, receptor tyrosine kinases, receptor serine threonine kinases, cytokine receptors, and so forth.
  • a transmembrane receptor such as any of the GPCRs, or any other transmembrane receptor of interest, including, but not being limited to, receptor tyrosine kinases, receptor serine threonine kinases, cytokine receptors, and so forth.
  • portions of proteins will function in the same manner as the full length first test protein, such active portions of a first test protein are encompassed by the definition of protein herein.
  • the present invention may be used to assay for interaction with any protein, and is not limited in its scope to assaying membrane bound receptor, like the GPCRs.
  • RTKs receptor tyrosine kinases
  • IGF1R such as the epidermal growth factor receptor (EGFR), ErbB2/HER2/Neu or related RTKs
  • receptor serine/threonine kinases such as Transforming Growth Factor-beta (TGF ⁇ ), activin, or Bone Morphogenetic Protein (BMP) receptors
  • TGF ⁇ Transforming Growth Factor-beta
  • BMP Bone Morphogenetic Protein
  • cytokine receptors such as receptors for the interferon family for interleukin, erythropoietin, G-CSF, GM-CSF, tumor necrosis factor (TNF) and leptin receptors
  • other receptors which are not necessarily normally membrane bound, such as estrogen receptor 1 (ESR1), and estrogen receptor 2 (ESR2).
  • the method involves transfecting a cell with a modified receptor construct that directs the expression of a chimeric protein containing the receptor of interest, to which is appended, a protease cleavage site followed by a nucleic acid molecule encoding a transcription factor.
  • the cell is co-transfected with a second construct that directs the expression of a chimeric protein consisting of an interacting protein fused, to the protease that recognizes and cleaves the site described supra.
  • this interacting protein may consist of a SH2 (Src homology domain 2) containing protein or portion thereof, such as phospholipase C (PLC) or Src homology 2 domain containing transforming protein 1 (SHC1).
  • SH2 Src homology domain 2
  • PLC phospholipase C
  • SHC1 Src homology 2 domain containing transforming protein 1
  • this interacting protein may be a Smad protein or portion thereof.
  • this interacting protein may be a signal transducer and activator of transcription (STAT) protein such as, but not being limited to, Statl, Stat2; Janus kinase (JAK) proteins Jakl, Jak2, or Tyk2; or portions thereof.
  • STAT signal transducer and activator of transcription
  • the transfected cell contains a reporter gene that is regulated by the transcription factor fused to the receptor.
  • An assay is then performed in which the transfected cells are treated with a test compound for a specific period and the reporter gene activity is measured at the end of the test period.
  • test compound activates the receptor of interest
  • interactions between the receptor of interest and the interacting protein are stimulated, leading to cleavage of the protease site and release of the fused transcription factor, which is in turn measurable as an increase in reporter gene activity.
  • Other possible test protein pairs include antibody-ligands, enzyme-substrates, dimerizing proteins, components of signal transduction cascades, and other protein pairs well known to the art. Reporters [0089]
  • the protein which activates a reporter gene may be any protein having an impact on a gene, expression or lack thereof which leads to a detectable signal.
  • Typical protein reporters include enzymes such as chloramphenicol acetyl transferase (CAT), ⁇ - glucuronidase (GUS) or ⁇ -galactosidase. Also contemplated are fluorescent and chemilluminescent proteins such as green fluorescent protein, red fluorescent protein, cyan fluorescent protein luciferase, beta lactamase, and alkaline phosphatase. Transcriptions Factors and Repressors [0090] In accordance with the present invention, transcription factors are used to activate expression of a reporter gene in an engineered host cell.
  • Transcription factors are typically classified according to the structure of their DNA-binding domain, which are generally (a) zinc fingers, (b) helix-turn-helix, (c) leucine zipper, (d) helix-loop-helix, or (e) high mobility groups.
  • the activator domains of transcription factors interact with the components of the transcriptional apparatus (RNA polymerase) and with other regulatory proteins, thereby affecting the efficiency of DNA binding.
  • RNA polymerase transcriptional apparatus
  • AP-1 Activating Protein- 1
  • transcription factor families include the heat shock/E2F family, POU family and the ATF family. Particular transcription factors, such as tTA and GAL4, are contemplated for use in accordance with the present invention.
  • transcription factors are one class of molecules that can be used, the assays may be modified to accept the use of transcriptional repressor molecules, where the measurable signal is downregulation of a signal generator, or even cell death.
  • Proteases and Cleavage Sites [0093] Proteases are well characterized enzymes that cleave other proteins at a particular site. One family, the Ser/Thr proteases, cleave at serine and threonine residues.
  • proteases include cysteine or thiol proteases, aspartic proteases, metalloproteinases, aminopeptidases, di & tripeptidases, carboxypeptidases, and peptidyl peptidases. The choice of these is left to the skilled artisan and certainly need not be limited to the molecules described herein. It is well known that enzymes have catalytic domains and these can be used in place of full length proteases. Such are encompassed by the invention as well.
  • a specific embodiment is the tobacco etch virus nuclear inclusion A protease, or an active portion thereof. Other specific cleavage sites for proteases may also be used, as will be clear to the skilled artisan.
  • the first test protein may be modified to enhance its binding to the interacting protein in this assay.
  • GPCRs bind arrestins more stably or with greater affinity upon ligand stimulation and this enhanced interaction is mediated by discrete domains, e.g., clusters of serine and threonine residues in the C-terminal tail (Oakley, et al, J. Biol. Chem.. 274:32248-32257, 1999 and Oakley, et al, J. Biol. Chem.. 276:19452-19460, 2001).
  • the receptor encoding sequence itself may be modified, so as to increase the affinity of the membrane bound protein, such as the receptor, with the protein to which it binds.
  • exemplary of such modifications are modifications of the C-terminal region of the membrane bound protein, e.g., receptor, such as those described supra, which involve replacing a portion of it with a corresponding region of another receptor, which has higher affinity for the binding protein, but does not impact the receptor function. Examples 16 and 20, supra, show embodiments of this feature ofthe invention.
  • the second test protein may be modified to enhance its interaction with the first test protein.
  • the assay may incorporate point mutants, truncations or other variants of the second test protein, e.g., arrestin that are known to bind agonist- occupied GPCRs more stably or in a phosphorylation-independent manner (Kovoor, et al, J. Biol. Chem.. 274:6831-6834. 1999).
  • a first construct comprises a sequence encoding a first protein, concatenated to a sequence encoding a cleavage site for a protease or protease portion, which is itself concatenated to a sequence encoding a reporter gene activator.
  • concatenated is meant that the sequences described are fused to produce a single, intact open reading frame, which may be translated into a single polypeptide which contains all the elements. These may, but need not be, separated by additional nucleotide sequences which may or may not encode additional proteins or peptides.
  • a second construct inserted into the recombinant cells is also as described supra, i.e., it contains both a sequence encoding a second protein, and the protease or protease portion. Together, these elements constitute the basic assay format when combined with a candidate agent whose effect on target protein interaction is sought.
  • the invention may also be used to assay more than one membrane bound protein, such as a receptor, simultaneously by employing different reporter genes, each of which is stimulated by the activation of a protein, such as the classes of proteins described herein. For example, this may be accomplished by mixing cells transfected with different receptor constructs and different reporter genes, or by fusing different transcription factors to each test receptor, and measuring the activity of each reporter gene upon treatment with the test compound.
  • a molecule of interest activates a first receptor and also determine if side effects should be expected as a result of interaction with a second receptor.
  • a first cell line encoding a first receptor and a first reporter, such as lacZ
  • a second cell line encoding a second receptor and a second reporter, such as GFP.
  • Preferred embodiments of such a system are seen in Examples 17 and 18.
  • the invention relates both to assays where a single pair of interacting test proteins is examined, but more preferably, what will be referred to herein as "multiplex" assays are used.
  • Such assays may be carried out in various ways, but in all cases, more than one pair of test proteins is tested simultaneously. This may be accomplished, e.g., by providing more than one sample of cells, each of which has been transformed or transfected, to test each interacting pair of proteins.
  • the different transformed cells may be combined, and tested simultaneously, in one receptacle, or each different type of transformant may be placed in a different well, and then tested.
  • the cells used for the multiplex assays described herein may be, but need not be, the same.
  • the reporter system used may, but need not be, the same in each sample.
  • the sample or samples are placed in receptacles, such as wells of a microarray, one or more compounds may be screened against the plurality of interacting protein pairs set out in the receptacles.
  • the fusion proteins expressed by the constructs are also a feature of the invention.
  • Other aspects of the invention which will be clear to the artisan, are antibodies which can identify the fusion proteins as well as various protein based assays for determining the presence of the protein, as well as hybridization assays, such as assays based on PCR, which determine expression ofthe gene.
  • kits Any of the compositions described herein may be comprised in a kit.
  • the kits will thus comprise, in suitable container means for the vectors or cells of the present invention, and any additional agents that can be used in accordance with the present invention.
  • the kits may comprise a suitably aliquoted compositions of the present invention.
  • the components of the kits may be packaged either in aqueous media or in lyophilized form.
  • the container means ofthe kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted.
  • the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed.
  • the kits ofthe present invention also will typically include a means for containing reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which the desired vials are retained.
  • the components of the kit are provided in one and/or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred.
  • the components of the kit may be provided as dried powder(s).
  • reagents and or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means.
  • EXAMPLE 1 A fusion construct was created, using DNA encoding human ⁇ 2 adrenergic receptor, referred to hereafter as "ADRB2", in accordance with standard nomenclature. Its nucleotide sequence can be found at GenBank, under Accession Number NM_000024 (SEQ ID NO: 1). The tetracycline controlled transactivator tTA, described by Gossen, et al, Proc. Natl. Acad. Sci. USA, 87:5547-5551 (1992), incorporated by reference, was also used. A sequence encoding the recognition and cleavage site for tobacco etch virus nuclear inclusion A protease, described by Parks, et al, Anal. Biochem..
  • a fusion construct was prepared by first generating a form of ADRB2 which lacked internal BamHI and Bglll restriction sites. Further, the endogenous stop codon was replaced with a unique BamHI site. [00107] Overlapping PCR was used to do this.
  • a 5' portion of the coding region was amplified with: gattgaagat ctgccttctt gctggc (SEQ ID NO: 2), and gcagaacttg gaagacctgc ggagtcc (SEQ ID NO: 3), while a 3 ' portion ofthe coding region was amplified with: ggactccgca ggtcttccaa gttctgc (SEQ ID NO: 4), and ttcggatcct agcagtgagt catttgt (SEQ ID NO: 5).
  • PCR products have 27 nucleotides of overlapping sequence and were purified via standard agarose gel electrophoresis. These were mixed together, and amplified with SEQ ID NO: 2, and SEQ ID NO: 5. [00109] PCR was also used to modify the coding region of tTA so that the endogenous start codon was replaced with a TEV Nla-Pro cleavage site.
  • the cleavage site defined by the seven amino acid sequence ENLYFQS (SEQ ID NO: 6), is taught by Parks, et al, Anal. Biochem.. 216:413-417 (1994), inco ⁇ orated by reference.
  • the seventh amino acid is known as PT position, and replacing it with other amino acids is known to reduce the efficiency of cleavage by TEV Nla-Pro. See Kapust, et al, Biochem. Biophys. Res. Commun.. 294:949-955 (2002).
  • a DNA sequence encoding the natural high efficiency site was added to the tTA coding region in two steps.
  • BamHI and Xbal restriction sites were added to the 5' end and a Xhol restriction site was added to the 3' end of the tTA coding region by PCR with ccggatcctc tagattagat aaaagtaag tg (SEQ ID NO: 7) and gactcgagct agcagtatcc tcgcgcccc taccc (SEQ ID NO: 8), and the TEV Nla-Pro cleavage site was added to the 5' end by ligating an oligonucleotide with the sequence gagaacctgt acttccag (SEQ ID NO: 9) between the BamHI and Xbal sites.
  • a Notl restriction site was introduced 5' to the start codon of the ADRB2 coding region, again via PCR, using gcggccgcca ccatgaacgg taccgaaggc cca (SEQ ID NO: 15), and ctggtgggtg gcccggtacc a (SEQ ID NO: 16).
  • the 5' fragment of modified ADRB2 coding region was isolated, via digestion with Notl and Pstl and was ligated into each of the constructs ofthe 3' fragment of ADRB2-TEV-NIa-Pro-cleavage site tTA fusions that had been digested previously, to produce three, full length constructs encoding fusion proteins.
  • Each construct was digested with Notl and Xhol, and was then inserted into the commercially available expression vector pcDNA 3, digested with Notl and Xhol.
  • EXAMPLE 2 A second construct was also made, whereby the coding sequence for " ⁇ arrestin 2 or ARRB2" hereafter (GenBank, NM_004313) (SEQ ID NO: 17), was ligated to the catalytic domain of the TEV NIa protease (i.e., amino acids 189-424 of mature NIa protease, residues 2040-2279) in the TEV protein. To do this, a DNA sequence encoding ARRB2 was modified, so as to add a BamHI restriction site to its 5' end.
  • sequence was modified to replace the endogenous stop codon with a BamHI site.
  • the oligonucleotides caggatcctc tggaatgggg gagaaacccg ggacc (SEQ ID NO: 18), and ggatccgcag agttgatcat catagtcgtc (SEQ ID NO: 19) were used.
  • the resulting PCR product was cloned into the commercially available vector pGEM-T EASY (Promega).
  • the multiple cloning site ofthe pGEM-T EASY vector includes an EcoRI site 5' to the start codon of ARRB2.
  • the TEV Nla-Pro coding region was then modified to replace the endogenous start codon with a Bglll site, and to insert at the 3' end a sequence which encodes influenza hemagluttinin epitope YPYDVPDYA (SEQ ID NO: 20) in accordance with Kolodziej, et al, Meth. Enzymol.. 194:508-519 (1991), followed by a stop codon, and a
  • Notl restriction site This was accomplished via PCR, using agatctagct tgtttaaggg accacgtg (SEQ ID NO: 21), and gcggccgctc aagcgtaatc tggaacatca tatgggtacg agtacaccaa ttcattcatg ag (SEQ ID NO: 22).
  • SEQ ID NO: 21 agatctagct tgtttaaggg accacgtg
  • EXAMPLE 3 Plasmids encoding ADRB2-TEV-NIa-Pro cleavage site-tTA and the ARRB2-TEV-NIa protease fusion proteins were transfected into HEK-293T cells, and into "clone 41," which is a derivative of HEK-293T, that has a stably integrated ⁇ -galactosidase gene under control of a tTA dependent promoter. About 5x10 4 cells were plated in each well of a 24 well plate, in DMEM medium supplemented with 10% fetal bovine serum, 2mM L- glutamine, 100 units/ml penicillin, 100 ⁇ g/ml G418, and 5 ⁇ g ml purimycin.
  • Cells were grown to reach 50% confluency the next day, and were then transfected, using 0.4 ⁇ g plasmid DNA, and 2 ⁇ l Fugene (a proprietary transfection reagent containing lipids and other material). The mix was combined in 100 ⁇ l of DMEM medium, and incubated for 15 minutes at room temperature prior to adding cells. Transfected cells were incubated for 8-20 hours before testing by adding drugs which are known agonists for the receptor, and then 16- 24 hours after drug addition.
  • Fugene a proprietary transfection reagent containing lipids and other material
  • EXAMPLE 4 The levels of ⁇ -galactosidase activity in the cells were first measured by staining the cells with a chromogenic substance, i.e., "X-gal," as taught by MacGregor, et ⁇ l, Somat. Cell Mol. Genet. 13:253-265 (1987), incorporated by reference. Following culture, cells were washed, twice, in D-PBS with calcium and magnesium, fixed for 5 minutes in 4% paraformaldehyde, and then washed two additional times with D-PBS, calcium and magnesium, for 10 minutes each time.
  • X-gal chromogenic substance
  • EXAMPLE 5 A set of experiments were carried out in order to quantify the level of reporter gene activity in the cells more precisely and to maximize the signal-to-background ratio ofthe assay. This was accomplished by measuring the level of reporter gene induction using a commercially available chemiluminescence assay for ⁇ -galactosidase activity.
  • Clone 41 cells were transfected with the ADRB2-tTA fusion constructs, containing either the high, medium or low efficiency cleavage sites, and the ARRB2-TEV-NIa protease expression plasmid described supra. Cells were either untreated or treated with 1 ⁇ M isoproterenol 20 hours after the transfection, and the luminescence assay was carried out 24 hours after the drug addition.
  • lysis buffer 100 mM potassium phosphate, pH7.8, 0.2% Triton X-100
  • the cells were lysed via incubation for 5 minutes, at room temperature, with mild agitation. Lysates were collected and analyzed via commercially available products.
  • treatment with agonist increased levels of ⁇ -galactosidase activity.
  • background level of reporter gene activity in untreated cells was lowest with the low efficiency cleavage site, relative to the medium and high efficiency sites.
  • agonist treatment resulted in a 4.8-fold stimulation of reporter gene activity in cells transfected with the low efficiency cleavage site, compared to 2.8-fold for the medium efficiency cleavage site and 1.2-fold for the high efficiency cleavage site.
  • the highest signal-to-background ratio is obtained by using the low efficiency protease cleavage site.
  • EXAMPLE 7 These experiments were designed to examine whether the agonist stimulated increase in reporter gene expression is dependent on fusion of TEV Nla-Pro to ARRB2. [00133] To do this, the levels of ⁇ -galactosidase activity were measured in clone 41 cells co-transfected with the ADRB2-tTA fusion construct containing the low efficiency cleavage site and either the ARRB2-TEV-NIa protease expression plasmid described supra. or a control TEV-NIa protease fusion to the SH2 domain of phospholipase C. The activity tests were carried out exactly as described, supra. The results indicated that agonist- stimulated increase in reporter gene expression was detected only when the TEV protease was fused to ARRB2 and not when fused to an unrelated polypeptide.
  • EXAMPLE 8 These experiments were designed to determine if gene expression is induced selectively by agonists ofthe target receptor, or if it can be stimulated by other molecules.
  • ATP is an agonist for G protein coupled receptors P2Y1 and P2Y2, which are expressed endogenously by HEK-293T cells,.
  • Experiments were carried out using clone 41 cells which were cotransfected with the ADRB2-tTA fusion construct containing the low efficiency cleavage site and the arrestin-TEV-NIa protease fusion as described supra, which were treated with isoproterenol, ATP, or untreated. The assays were carried out as described, supra.
  • EXAMPLE 9 A set of experiments were carried out using clone 41 cells which were cotransfected with the ADRB2-tTA fusion construct containing the low efficiency cleavage site and the ARRB2-TEV-NIa protease fusion as described supra, which were treated with varying amounts of one of the adrenergic receptor agonists isoproterenol and epinephrine. The assays were carried out as described, supra. The results presented in figure 2a show a dose-response curve for the stimulation of reporter gene expression by these two ligands. Each point represents the mean value obtained from three experiments.
  • EXAMPLE 10 A similar set of constructs were made to establish an assay for the G protein coupled arginine vasopressin receptor 2 (AVPR2).
  • the AVPR2 coding region (Genbank Accession Number: NM__000054) (SEQ ID NO: 23) was modified to place an EcoRI site at the 5' end and replace the stop codon with a BamHI site using PCR with the primers gaattcatgc tcatggcgtc caccac (SEQ ID NO: 24) and ggatcccgat gaagtgtcct tggccag (SEQ ID NO: 25).
  • EXAMPLE 11 A similar set of constructs were made to establish an assay for the G protein coupled serotonin receptor la (HTRIA).
  • the HTRIA coding region (Genbank Accession Number: NM_000524) (SEQ ID NO: 26) was modified to place an EcoRI site at the 5 5 end and replace the stop codon with a BamHI site using PCR with the primers gaattcatgg atgtgctcag ccctgg (SEQ ID NO: 27) and ggatccctgg cggcagaact tacac (SEQ ID NO: 28).
  • the modified HTRIA coding region was ligated into the AVPR2- tTA constructs described supra, which had been cut with EcoRI and BamHI. This replaced the entire coding sequence of AVPR2 with the coding sequence of HTRIA. The resulting construct will be referred to as "HTR1 A-tTA" hereafter.
  • Clone 41 cells were co-transfected with the HTRlA-tTA fusion construct containing the low efficiency cleavage site and the ARRB2-TEV-NIa protease fusion construct described supra, and assays were carried out using 10 ⁇ M 8-hydroxy-DPAT HBr (OH-DPAT), an agonist for the HTRIA, as well as with 10 ⁇ M serotonin, a natural agonist for HTRIA.
  • the assays were carried out as described, supra.
  • the maximal response to OH- DPAT resulted in a 6.3 -fold induction of reporter gene expression over background level and the maximal response to serotonin resulted in a 4.6-fold induction of reporter gene expression over background level.
  • EXAMPLE 12 Similar constructs were made to establish an assay for the G protein coupled m2 muscarinic acetylcholine receptor (CHRM2).
  • CHRM2 coding region Genbank Accession Number: NM_000739) (SEQ ID NO: 29) was modified to place an EcoRI site at the 5' end and replace the stop codon with a Bglll site using PCR with the primers gaattcatga ataactcaac aaactcc (SEQ ID NO: 30) and agatctcctt gtagcgccta tgttc (SEQ ID NO: 31).
  • the modified CHRM2 coding region was ligated into the AVPR2 - tTA constructs described supra, which had been cut with EcoRI and BamHI. This replaced the entire coding sequence of AVPR2 with the coding sequence of CHRM2.
  • Clone 41 cells were co-transfected with the CHRM2-tTA fusion construct containing the high efficiency cleavage site and the ARRB2-TEV-NIa protease fusion described supra, where the ARRB2-protease fusion protein was expressed under the control ofthe Herpes Simplex Virus thymidine kinase (HSV-TK) promoter, and assays were carried out using 10 ⁇ M carbamylcholine CI (carbochol), an agonist for CHRM2, as described supra. The maximal response to carbochol resulted in a 7.2-fold induction of reporter gene expression over background.
  • HSV-TK Herpes Simplex Virus thymidine kinase
  • EXAMPLE 13 [00149] ⁇ Constructs were also made to establish an assay for the G protein coupled chemokine (C-C motif) receptor 5 (CCR5).
  • CCR5 coding region Genbank Accession Number: NM_000579
  • SEQ ID NO: 32 was modified to place Not I site at the 5' end and replace the stop codon with a BamHI site using PCR with the primers gcggccgcat ggattatcaa gtgtcaagtc c (SEQ ID NO: 33) and ggatccctgg cggcagaact tacac (SEQ ID NO: 34).
  • the CCR5 coding region was also modified to place a Bsal site at the 5' end which, when cut, leaves a nucleotide overhang which is compatible with EcoRI cut DNA using the primers ggtctccaat tcatggatta tcaagtgtca agt (SEQ ID NO: 35) and gacgacagcc aggtacctat c (SEQ ID NO: 36).
  • the first modified coding region was cut with Clal and BamHI and the second was cut with Bsal and Clal. Both fragments were ligated into the AVPR2 - tTA constructs described supra, which had been cut with EcoRI and BamHI.
  • the CCR5-tTA fusion construct containing the low efficiency cleavage site was transfected into "clone 34" cells, which are a derivative ofthe HEK cell line “clone 41" described supra, but which contain a stably integrated ARRB2-TEV-NIa protease fusion gene under the control of the CMV promoter. Assays were carried out using 1 ⁇ g/ml "Regulated on Activation, Normal T-Cell Expressed and Secreted" (RANTES), a known agonist for CCR5. The maximal response to RANTES, measured as described supra resulted in an approximately 40-fold induction of reporter gene expression over the background.
  • RANTES Registered on Activation, Normal T-Cell Expressed and Secreted
  • EXAMPLE 14 [00153] Next, a set of constructs were made to establish an assay for the G protein coupled dopamine 2 receptor (DRD2).
  • DRD2 coding region (Genbank Accession Number: NM_000795) (SEQ ID NO: 37) was modified to place an EcoRI site at the 5' end and replace the stop codon with a Bglll site using PCR with the primers gaattcatgg atccactgaa tctgtcc (SEQ ID NO: 38) and agatctgcag tggaggatct tcagg (SEQ ID NO: 39).
  • the modified DRD2 coding region was ligated into the AVPR2 - tTA constructs described supra, cut with EcoRI and BamHI. This replaced the entire coding sequence of AVPR2 with the coding sequence of DRD2.
  • Clone 41 cells were co-transfected with the DRD2-tTA fusion construct containing the medium efficiency cleavage site and the ARRB2-TEV-NIa protease fusion described supra, and assays were carried out using 10 ⁇ M dopamine HC1 (dopamine), an agonist for DRD2. Results were measured as in the assays described supra. The maximal response to dopamine resulted in a 2.7-fold induction of reporter gene expression over the background.
  • ARRB1 Genbank Accession Number: NM_004041
  • SEQ ID NO: 40 The coding region of ARRB1 (Genbank Accession Number: NM_004041) (SEQ ID NO: 40) was modified to place an Asp718 site at the 5' end and replace the stop codon with a BamHI site using PCR with the primers ggtaccatgg gcgacaaagg gacgcgagtg (SEQ ID NO: 41) and ggatcctctg ttgagct gtggagagcc tcctcttttc (SEQ ID NO: 42).
  • the coding region of ⁇ -arrestin-1 was modified to place an Asp718 site at the 5' end and a BamHI site after amino acid 382 using PCR with SEQ ID NO: 41, supra and ggatccattt gtgtcaagtt ctatgag (SEQ ID NO: 43).
  • SEQ ID NO: 41 SEQ ID NO: 41, supra
  • ggatccattt gtgtcaagtt ctatgag SEQ ID NO: 43.
  • ARRBl ( ⁇ 383)
  • ARRBl The resulting modified ARRBl coding region, termed "ARRBl ( ⁇ 383)”
  • ARRBl was cut with Asp718 and EcoRI and with EcoRI and BamHI
  • TEV Nla-Pro coding region described supra was cut with Bglll and Notl. All three fragments were ligated into a commercially available pcDNA3 expression vector, digested with Asp718 and Notl.
  • EXAMPLE 16 This set of experiments was carried out to demonstrate enhancements of the assay using receptor modifications that are designed to increase affinity for the interacting protein.
  • the C-terminal tail domain of a test receptor was replaced with the corresponding tail domain from AVPR2, a receptor known to bind arrestins with high affinity.
  • the fusion junction was made 15-18 amino acids after the conserved NPXXY motif at the end of the seventh transmembrane helix, which typically corresponds to a position immediately after a putative palmitoylation site in the receptor C- terminus.
  • PCR was used to produce a DNA fragment encoding the C-terminal 29 amino acids from AVPR2, followed by the low efficiency TEV cleavage site and tTA transcription factor.
  • the fragment was also designed such that the first two amino acids (Ala, A and Arg, R) are encoded by the BssHII restriction site GCGCGC.
  • the modified ADRB2 receptor coding region was cut with EcoRI and BssHII and the AVPR2 C-terminal tail-low efficiency cleavage site-tTA fragment was cut with BssHII and BamHI. Both fragments were ligated into the AVPR2-low efficiency cleavage site-tTA construct described supra cut, with EcoRI and BamHI.
  • ADRB2-AVPR2 Tail-tTA (Also see published application U.S. 2002/0106379, supra. SEQ ID NO: 3 in particular.) [00173] Clone 41 cells were co-transfected with the ADRB2-AVPR2 Tail-tTA fusion construct containing the low efficiency TEV cleavage site and the ARRB2-TEV-NIa protease fusion described supra, and assays were carried out using 10 ⁇ M isoproterenol, an agonist for the ADRB2 receptor. The maximal response to isoproterenol resulted in an approximately 10-fold induction of reporter gene expression over the background.
  • a construct was made which modified the kappa opioid receptor (OPRK; Genbank Accession Number: NM_000912) (SEQ ID NO: 51) coding region by placing a BssHII site after Cys-345. This was done using PCR with the primers ggtctacttg atgaattcct ggcc (SEQ ID NO: 52) and gcgcgcacag aagtcccgga aacaccg (SEQ ID NO: 53) [00175] The modified OPRK receptor coding region was cut with EcoRI and BssHII and AVPR2 C-terminal tail-low efficiency cleavage site-tTA fragment was cut with BssHII and Xhol.
  • OPRK kappa opioid receptor
  • EXAMPLE 17 This experiment was designed to demonstrate the use of the assay to measure the activity of two test receptors simultaneously using a multiplex format.
  • Clone 41 cells and "clone 1H10" cells which are cells of an HEK-293T cell line containing a stable integration of the luciferase gene under the control of a tTA- dependent promoter, were each plated on 24-well culture dishes and were transiently transfected with the chimeric ADRB2-AVPR2 Tail-tTA or the DRD2-AVPR2 Tail-tTA fusion constructs described supra, respectively. Transient transfections were performed using lOO ⁇ l of media, 0.4 ⁇ g of DNA and 2 ⁇ l of FuGene reagent per well.
  • Clone 41 cells expressing ADRB2-AVPR2 Tail-tTA and clone 1H10 cells expressing DRD2-AVPR2 Tail-tTA were trypsinized, mixed in equal amounts, and replated in 12 wells of a 96-well plate. Triplicate wells were incubated without drug addition or were immediately treated with 1 ⁇ M isoproterenol, 1 ⁇ M dopamine, or a mixture of both agonists at I ⁇ M. Cells were assayed for reporter gene activity approximately 24 hours after ligand addition.
  • EXAMPLE 18 This experiment was designed to demonstrate the use of the assay to measure the activity of two test receptors simultaneously using a multiplex format.
  • "Clone 34.9" cells which are a derivative of clone 41 cells and containing a stably integrated ARRB2 - TEV NIa protease fusion protein gene, were transiently transfected with the chimeric OPRK-AVPR2 Tail- TEV-NIa-Pro cleavage (Leu)-tTA fusion construct described supra.
  • "clone HTL 5B8.1” cells which are an HEK-293T cell line containing a stable integrated luciferase gene under the control of a tTA-dependent promoter, were transiently transfected with the ADRB-AVPR2 Tail- TEV-NIa-Pro cleavage (Leu)-tTA fusion construct described supra.
  • 5x10 5 cells were plated in each well of a 6- well dish, and cultured for 24 hours in DMEM supplemented with 10% fetal bovine serum, 2 mM L-Glutamine, 100 units/ml penicillin, 500 ⁇ g/ml G418, and 3 ⁇ g/ml puromycin.
  • Cells were transiently transfected with 100 ⁇ l of DMEM, 0.5 ⁇ g of OPRK- AVPR2 Tail-TEV-NIa-Pro cleavage (Leu)-tTA DNA, and 2.5 ⁇ l Fugene ("clone 34.9 cells") or with 100 ⁇ l of DMEM, 0.5 ⁇ g of ADRB2-AVPR2 Tail-TEV-NIa-Pro cleavage (Leu)-tTA DNA, 0.5 ⁇ g of ARRB2-TEV NIa Protease DNA and 5 ⁇ l Fugene ("clone HTL 5B8.1 cells").
  • Transiently transfected cells were cultured for about 24 hours, and were then trypsinized, mixed in equal amounts and replated in wells of a 96 well plate. Cell were incubated for 24 hours before treatment with 10 ⁇ M U-69593, 10 ⁇ M isoproterenol or a mixture of both agonists at 10 ⁇ M. Sixteen wells were assayed for each experimental condition. After 24 hours, cells were lysed and the activity of both beta-galactosidase and luciferase reporter genes were assayed as described supra. The results are presented in Figure 6.
  • Treatment with U-69593 resulted in an approximately 15-fold induction of beta- galactosidase reporter gene activity, whereas luciferase activity remained unchanged.
  • Treatment with isoproterenol resulted in a 145-fold induction of luciferase activity, while beta-galactosidase activity remained unchanged.
  • Treatment with both U-69593 and isoproterenol resulted in nine-fold and 136-fold induction of beta-galactosidase and luciferase activity, respectively.
  • EXAMPLE 19 [00182] This experiment was carried out to demonstrate the use of a different transcription factor and promoter in the assay ofthe invention.
  • a fusion construct was created, comprising DNA encoding AVPR2, fused in frame to a DNA sequence encoding the amino acid linker GSENLYFQLR (SEQ ID NO: 54) which included the low efficiency cleavage site for TEN la-Pro described supra, fused in frame to a D ⁇ A sequence encoding amino acids 2-147 of the yeast GAL4 protein (GenBank Accession Number P04386) (SEQ ID NO: 55) followed by a linker, i.e., of the sequence PELGSASAELTMVF (SEQ ID NO: 56), followed by amino acids 368-549 of the murine nuclear factor kappa-B chain p65 protein (GenBank Accession Number A37932) (SEQ ID NO: 57).
  • HUL 5C1.1 is a derivative of HEK-293T cells, which contain a stably integrated luciferase reporter gene under the control of a GAL4 upstream activating sequence (UAS), commercially available pFR-LUC.
  • UAS GAL4 upstream activating sequence
  • This AVPR2-TEV-NIa-Pro cleavage (Leu)-GAL4 plasmid was co- transfected along with the ⁇ -arrestin2-TEV NIa Protease described supra into HUL 5C1.1 cells.
  • About 2.5 x IO 4 cells were plated into each well of a 96 well-plate, in DMEM medium supplemented with 10% fetal bovine serum, 2 mM L-Glutamine, 100 units/ml penicillin, 500 ⁇ g/ml G418, and 3 ⁇ g/ml puromycin.
  • Cells were grown to reach 50% confluency the next day and were transfected with 10 ⁇ l per well of a mixture consisting of 85 ⁇ l of DMEM, 0.1 ⁇ g of AVPR2-TEV-Nia-Pro cleavage (Leu)-GAL4 DNA, 0.1 ⁇ g of ARRB2-TEV NIa Protease DNA, and 1 ⁇ l Fugene, which had been incubated for 15 minutes at room temperature prior to addition to the cells.
  • Transfected cells were cultured for about 16 hours before treatment with 10 ⁇ M vasopressin. After six hours, cells were lysed and luciferase activity was assayed as described supra. Under these conditions, treatment with vasopressin resulted in a 180-fold increase in reporter gene activity.
  • EXAMPLE 20 [00186] This set of experiments were carried out to demonstrate enhancements ofthe assay using further receptor modifications that are designed to increase the affinity for the interacting protein.
  • the C-terminal tail domain of the test receptor is replaced with the corresponding tail domain of one of the following receptors: apelin J receptor - AGTRLI (accession number: NM_005161) (SEQ ID NO: 58), gastrin-releasing peptide receptor - GRPR (accession number: NM_005314) (SEQ ID NO: 59), proteinase- activated receptor 2 - F2RL1 (accession number: NM_005242) (SEQ ID NO: 60), CCR4 (accession number: NM_005508) (SEQ ID NO: 61), chemokine (C-X-C motif) receptor 4 - CXCR4 (accession number: NM_003467) (SEQ ID NO: 62), and interieukin 8 receptor, beta - CXCR
  • First PCR was used to produce a DNA fragment encoding the C-terminal tail of the above receptors. These fragments were designed such that the first two amino acids (Ala, A and Arg, R) are encoded by the BssHII restriction site. [00188] The AGTRLI C-terminal fragment was amplified with the primers tgtgcgcgcg gccagagcag gtgcgca (SEQ ID NO: 64) and gaggatccgt caaccacaag ggtctc (SEQ ID NO: 65).
  • the GRPR C-terminal fragment was amplified with the primers tgtgcgcgcg gcctgatcat ccggtct (SEQ ID NO: 66) and gaggatccga cataccgctc gtgaca (SEQ ID NO: 67).
  • the F2RL1 C-terminal fragment was amplified with the primers tgtgcgcgca gtgtccgcac tgtaagc (SEQ ID NO: 68) and gaggatccat aggaggtctt aacagt (SEQ ID NO: 69).
  • the CCR4 C-terminal fragment was amplified with the primers tgtgcgcgcg gccttttgt gctctgc (SEQ ID NO: 70) and gaggatccca gagcatcatg aagatc (SEQ ID NO: 71).
  • the CXCR2/IL8b C-terminal fragment was amplified with the primers tgtgcgcgcg gcttgatcag caagggac (SEQ ED NO: 72) and gaggatccga gagtagtgga agtgtg (SEQ ID NO: 73).
  • the CXCR4 C-terminal fragment was amplified with the primers tgtgcgcgcg ggtccagcct caagatc (SEQ ID NO: 74) and gaggatccgc tggagtgaaa acttga (SEQ ID NO: 75).
  • the resulting DNA fragments encoding the modified C-terminal tail domains of these receptors were cut with BssHII and BamHI and the fragments were ligated in frame to the OPRK receptor coding region, replacing the AVPR2- C-terminal tail fragment, in the OPRK-AVPR2 Tail- TEV-NIa-Pro cleavage (Leu)-tTA expression construct described supra.
  • HTL 5B8.1 cells described supra were co-transfected with each ofthe above modified OPRK coding region - TEV-NIa-Pro cleavage (Leu)- tTA constructs and the ⁇ - arrestin 2 - TEV NIa protease fusion described supra.
  • About 2.5 x 10 cells per well were plated onto a 96 well-plate, in DMEM medium supplemented with 10% fetal bovine serum, 2 mM L-Glutamine, 100 units/ml penicillin, 500 ⁇ g/ml G418, and 3 ⁇ g/ml puromycin.
  • Cells were grown to reach 50% confluency the next day and were transfected with 10 ⁇ l per well of a mixture consisting of 85 ⁇ l of DMEM, 0.25 ⁇ g of AVPR2-TEV-NIa-Pro cleavage (Leu)-GAL4 DNA, 0.25 ⁇ g of ARRB2-TEV NIa protease DNA, and 2.5 ⁇ l Fugene (a proprietary transfection reagent containing lipids and other material), which had been incubated for 15 minutes at room temperature prior to addition to the cells. Transfected cells were cultured for about 16 hours before treatment 10 ⁇ M U-69593. After six hours, cells were lysed and luciferase activity was assayed as described supra.
  • EXAMPLE 21 This experiment was designed to produce a cell line that stably expressed the ARRB2-TEV NIa protease fusion protein described supra.
  • a plasmid was made which expressed the ARRB2-TEV NIa protease fusion protein under the control of he EFl ⁇ promoter and also expressed the hygromycin resistance gene under the control ofthe thymidine kinase (TK) promoter.
  • TK thymidine kinase
  • Resistant clones were isolated and expanded and were screened by fransfection of the ADRB2-AVPR2 Tail- TEV-NIa-Pro cleavage (Leu)-tTA plasmid described supra. Three cell lines that were selected using this procedure were designated "HTLA 4C2.10", “HTLA 2C11.6” and "HTLA 5D4". About 2.5 x IO 4 cells per well were plated onto a 96 well-plate, in DMEM medium supplemented with 10% fetal bovine serum. 2 mM L-Glutamine, 100 units/ml penicillin, 500 ⁇ gml G418, 3 ⁇ g/ml puromycin, and 100 ⁇ g/ml hygromycin.
  • Cells were grown to reach 50% confluency the next day and were fransfected with 10 ⁇ l per well of a mixture consisting of 85 ⁇ l of DMEM, 0.25 ⁇ g of ADRB2-AVPR2-TEV-NIa-Pro cleavage (Leu)-GAL4 DNA and 0.5 ⁇ l Fugene, which had been incubated for 15 minutes at room temperature prior to addition to the cells.
  • Transfected cells were cultured for about 16 hours before treatment 10 ⁇ M isoproterenol. After six hours, cells were lysed and luciferase activity was assayed as described supra.
  • EXAMPLE 22 This experiment was designed to produce a cell line that stably expressed the ARRB2-TEV NIa protease and the ADRB2-AVPR2 Tail- TEV-NIa-Pro cleavage (Leu)- tTA fusion proteins described supra.
  • the ARRB2-TEN la protease plasmid containing the hygromycin resistance gene was transfected together with the ADRB2-ANPR2 Tail- TEN- ⁇ Ia-Pro cleavage (Leu)-tTA fusion protein plasmid described supra into HTL 5B8.1 cells and clones containing stable genomic integration of the plasmids were selected by culturing in the presence of 100 ⁇ g/ml hygromycin.
  • Resistant clones were isolated and expanded, and were screened by treating with 10 ⁇ M isoproterenol and measuring the induction of reporter gene activity as described supra.
  • Three cell lines that were selected using this procedure were designated "HTLAR 1E4", "HTLAR 1C10” and “HTLAR 2G2”.
  • Treatment with isoproterenol for 6 hours resulted in a 208-fold ("HTLAR 1E4"), 197-fold (“HTLAR 1C10”) and 390-fold (“HTLAR 2G2”) increase in reporter gene activity in the three cell lines, respectively.
  • EXAMPLE 23 This experiment was designed to demonstrate the use of the assay to measure the activity of the receptor tyrosine kinase epidermal growth factor receptor (EGFR).
  • EGFR receptor tyrosine kinase epidermal growth factor receptor
  • a first fusion construct was created, comprismg DNA encoding the human EGFR, which can be found at GenBank under the Accession Number NM_005228 (SEQ ID NO: 76), fused in frame to a DNA sequence encoding amino acids 3-335 ofthe tetracycline- controlled transactivator tTA, described supra.
  • GGSGSENLYFQL SEQ ID NO: 77
  • ENLYFQL SEQ ID NO: 14
  • the CMV promoter was placed upstream of the Epidermal Growth Factor Receptor coding region, and a polyA sequence was placed downstream of the tTA region. This construct is designated EGFR-TEV-NIa-Pro cleavage (Leu)-tTA.
  • a second fusion construct was created, comprising DNA encoding the two SH2 domains of human Phospholipase C Gamma 1, corresponding to amino acids 538-759 (GeneBank accession number NP_002651.2) (SEQ ID NO: 78) fused in frame to a DNA sequence encoding the catalytic domain of mature TEV NIa protease, described supra, corresponding to amino acids 2040-2279 (GeneBank accession number AAA47910) (SEQ ID NO: 79). Inserted between these sequences is a linker DNA sequence encoding the amino acids NSSGGNSGS (SEQ ID NO: 80).
  • the CMV promoter was placed upstream of the PLC-Gamma SH2 domain coding sequence and a polyA sequence was placed downsfream of the TEV NIa protease sequence.
  • This construct is designated PLC Gammal-TEV.
  • the EGFR-TEV-NIa-Pro cleavage (Leu)-tTA and PLC Gammal-TEV fusion constructs were fransfected into clone HTL5B8.1 cells described supra.
  • Cells were grown to reach 50% confluency the next day and were transfected with 15 ⁇ l per well of a mixture consisting of 100 ⁇ l of DMEM, 0.4 ⁇ g of pcDNA3 DNA ("carrier" vector DNA), 0.04 ⁇ g of EGFR-TEV-NIa-Pro cleavage (Leu)-tTA DNA, 0.04 ⁇ g of PLC Gammal-TEV DNA, and 2 ⁇ l Fugene (a proprietary fransfection reagent containing lipids and other material), which had been incubated for 15 minutes at room temperature prior to addition to the cells. Transfected cells were cultured for about 16 hours before treatment with specified receptor agonists and inhibitors.
  • EXAMPLE 24 This experiment was designed to demonstrate the use of the assay to measure the activity ofthe human Type I Interferon Receptor.
  • a fusion construct was created, comprising DNA encoding human Interferon Receptor I (IFNAR1) (557 amino acids), which can be found in Genbank under Accession Number NM__000629 (SEQ ID NO: 81), fused in frame to a DNA sequence encoding amino acids 3-335 of the tefracycline controlled transactivator tTA, described supra.
  • Inserted between these sequences is a DNA sequence encoding the amino acid sequence GSENLYFQL (SEQ ID NO: 82) which includes the low efficiency cleavage site for TEV Nla-Pro, ENLYFQL (SEQ ID NO: 14), described supra.
  • the CMV promoter was placed upstream ofthe Human Interferon Receptor I (IFNAR1) coding region, and a poly A sequence was placed downstream of the tTA region. This construct is designated IFNAR1- TEV- Nla-Pro cleavage (L)-tTA.
  • a second fusion construct was created, using DNA encoding Human Interferon Receptor 2, splice variant 2 (IFNAR2.2) (515 amino acids), which can be found at Genbank, under Accession Number L41942 (SEQ ID NO: 83), fused in frame to a DNA sequence encoding the catalytic domain of the TEV NIa protease, described supra. corresponding to amino acids 2040-2279 (GenBank accession number AAA47910) (SEQ ID NO: 84). Inserted between these sequences is a DNA sequence encoding the amino acid sequence RS (Arg-Ser).
  • the CMV promoter region was placed upstream of the Human Interferon Receptor 2 (IFNAR2.2) coding region, and a poly A sequence was placed downsfream ofthe TEV region. This construct is designated IFNAR2.2-TEV.
  • IFNAR2.2-TEV Human Interferon Receptor 2
  • Expression constructs were also generated in which the genes for Human Signal Transducer and Activator of Transcription 1 (STATl), found in Genbank, under Accession Number NM_007315 (SEQ ID NO: 85), Human Signal Transducer and Activator of Transcription 2 (STAT2) found in Genbank, under Accession Number NM_005419 (SEQ ED NO: 86), were expressed under the control of the CMV promoter region.
  • CMV-STATl and CMV-STAT2 were designated CMV-STATl and CMV-STAT2 respectively.
  • the IFNARl- TEV- Nla-Pro cleavage (L)-tTA and IFNAR2.2-TEV fusion constructs, together with CMV-STATl and CMV-STAT2 were transiently transfected into HTL5B8.1 cells described supra.
  • About 2.5 x IO 4 cells were seeded in each well of a 96 well plate and cultured in DMEM medium supplemented with 10% fetal bovine serum, 2mM L- glutamine, 100 units/ml penicillin, lOO ⁇ g/ml G418, and 5 ⁇ g/ml puromycin.
  • cells were fransfected with 15ng of each IFNARl- TEV- Nla-Pro cleavage (L)-tTA, IFNAR2.2-TEV, CMV-STATl and CMV-STAT2 DNA, or with 60ng control pcDNA plasmid, together with 0.3 ⁇ l Fugene per well.
  • Transfected cells were cultured for 8- 20 hours before treatment with 5000 U/ml human interferon-alpha or 5000 U/ml human interferon-beta.
  • Figure 9 shows a dose-response curve generated for IFN- ⁇ in HTL5B8.1 cells transfected with IFNARl (ENLYFQ(L)-tTa, IFNAR2.2-TEV, STATl and STAT2 expression constructs as described supra.
  • EXAMPLE 25 This experiment was designed to demonstrate the use of the assay to measure the activity of the human Type I Interferon Receptor using a different transcription factor and a different cell line.
  • a fusion construct was created, using DNA encoding Human Interferon Receptor I (IFNARl), fused in frame to a DNA sequence encoding the GAL4-NF- ⁇ B-fusion, described supra. Inserted between these sequences is a DNA sequence encoding the amino acid sequence GSENLYFQL (SEQ ID NO: 87), which includes the low efficiency cleavage site for TEN ⁇ la-Pro, E ⁇ LYFQL (SEQ ID NO: 14), described supra.
  • the CMV promoter was placed upstream of the Human Interferon Receptor I (IFNARl) coding region, and a poly A sequence was placed downstream of the GAL4-NF- ⁇ B region.
  • IFNARl Human Interferon Receptor I
  • This construct is designated IFNARl -TEV- Nla-Pro cleavage (L)-GAL4-NF- ⁇ B.
  • CHO-Kl cells were then transiently transfected with a mixture of five plasmids: IFNARl -TEV-NIa-Pro cleavage (L)-GAL4-NF- ⁇ B, IFNAR2.2-TEV, CMV- STATl, CMV-STAT2 and pFR-Luc, a luciferase reporter gene plasmid under the control of a GAL4-dependent promoter.
  • About 1.0 x IO 4 cells per well were seeded in a 96 well plate 24 hours prior to transfections in DMEM medium supplemented with 10% fetal bovine serum, 2mM L-glutamine, 100 units/ml penicillin.
  • Cells were transfected the following day with 10 ng of reporter plasmid (pFR-Luc), plus 20 ng of each of the expression constructs described supra, or with 10 ng reporter plasmid plus 80 ng of control pcDNA3 plasmid, together with 0.3 ⁇ l Fugene per well.
  • Transfected cells were cultured for 8-20 hours before treatment with 5000 U/ml human interferon-alpha. At the time of interferon addition, medium was aspirated and replaced with DMEM media supplemented with 2mM L- glutamine, 100 units/ml penicillin. Interferon-treated cells were cultured for an additional 6 hours before they were assayed for luciferase reporter gene activity as described supra. Results are shown in Figure 10.
  • IFN- ⁇ freatment of CHO-Kl cells transfected with the reporter, IFNAR and STAT constructs resulted in 3 -fold increase in reporter gene activity, while interferon treatment of cells transfected with the reporter and control plasmids had no effect on reporter gene activity.
  • EXAMPLE 26 This set of experiments was carried out to demonstrate additional enhancements of the assay using receptor modifications designed to increase the affinity of the test receptor for the interacting protein.
  • the fusion junction between the test receptor and a C-terminal tail domain of GRPR (Genbank Accession Number: NM_005314) (SEQ ID NO: 59) was made 17-23 amino acids after the conserved NPXXY motif at the end ofthe seventh transmembrane helix.
  • PCR was used to produce a DNA fragment encoding the C-terminal 42 amino acids from GRPR beginning 2 amino acids after the putative palmitoylation site (hereafter referred to as GRPR 42aa).
  • the fragment was designed such that the first amino acid of the C-terminal tail is preceded by two amino acids (Ser, S and Arg, R) which are encoded by the Xbal restriction site TCT AGA, and the stop codon is replaced by two amino acids (Gly, G and Ser, S) which are encoded by a BamHI restriction site GGATCC.
  • ADRAIA Genebank Accession Number: NM_000680
  • SEQ ID NO: 90 the coding region of ADRAIA (Genbank Accession Number: NM_000680) was modified to insert an Xbal site after Lys-349. This was done using PCR with the primers ctcggatatctaaacagctgcatcaa (SEQ ID NO: 91) and tctagactttctgcagagacactggattc (SEQ ID NO: 92)
  • DRD2 (Genbank Accession Number: NM_000795) (SEQ ID NO: 37) was modified to insert two amino acids (Leu and Arg) and an Xbal site after Cys-343. This was done using PCR with the primers gaattcatggatccactgaatctgtcc (SEQ ID NO: 38) and tctagatcgaaggcagtggaggatcttcagg (SEQ ID NO: 93) [00219] The modified OPRK receptor coding region was cut with EcoRI and Xbal and the GRPR 42aa C-terminal tail fragment was cut with Xbal and BamHI.
  • Both fragments were ligated into a plasmid containing the OPRK receptor with the AVPR2 C-terminal tail- low-efficiency cleavage site-tTA described supra which had been digested with EcoRI and BamHI.
  • the modified ADRAIA receptor coding region was cut with EcoRN and Xbal and the OPRK-GRPR 42aa Tail-tTA fusion construct containing the low efficiency cleavage site was cut with Xbal and Xhol. Both fragments were ligated into a plasmid containing the ADRAIA receptor which had been digested with EcoRN and Xhol.
  • the modified DRD2 receptor coding region was cut with EcoRI and Xbal and the OPRK-GRPR 42aa Tail-tTA fusion construct containing the low efficiency cleavage site was cut with Xbal and Xhol. Both fragments were ligated into a pcD ⁇ A6 plasmid digested with EcoRI and Xhol.
  • HTLA 2C11.6 cells described supra, were transfected with OPRK-GRPR 42aa Tail-tTA fusion construct containing the low efficiency cleavage site and assays were carried out using 10 ⁇ M U-69593, an agonist for OPRK. The maximal response to U-69593 resulted in an approximately 200-fold increase in reporter gene activity.
  • HTLA 2C11.6 cells were transfected with ADRA1A-GRPR 42aa Tail-tTA fusion construct containing the low efficiency cleavage site and assays were carried out using 10 ⁇ M epinephrine, an agonist for ADRAIA. The maximal response to epinephrine resulted in an approximately 14-fold increase in reporter gene activity.
  • HTLA 2C11.6 cells were transfected with DRD2-GRPR 42aa Tail-tTA fusion construct containing the low efficiency cleavage site and assays were carried out using 10 ⁇ M dopamine, an agonist for DRD2. The maximal response to dopamine resulted in an approximately 30-fold increase in reporter gene activity.
  • EXAMPLE 27 This set of experiments were carried out to demonstrate further enhancements of the assay using a different set of test receptor modifications designed to increase the affinity for the interacting protein. In these examples, the C-terminal domain of the test receptor was replaced with a portion of the endogenous C-terminal tail domain of GRPR. [00226] First, PCR was used to produce a DNA fragment encoding the truncated GRPR tail, specifically a sequence encoding 23 amino acids from Gly-343 to Asn-365.
  • the fragment was designed such that the first amino acid ofthe C-terminal tail is preceded by two amino acids (Ser, S and Arg, R) which are encoded by the Xbal restriction site TCTAGA, and the Ser-366 is replaced by two amino acids (Gly, G and Ser, S) which are encoded by a BamHI restriction site GGATCC.
  • GRPR 23aa Tail truncated GRPR fragment
  • OPRK-GRPR 42aa Tail-tTA fusion construct containing the low efficiency cleavage site described herein, digested with Xbal and BamHI.
  • GRPR 23aa Tail fragment was cut with Xbal and BamHI and inserted into the ADRA1A-GRPR 42aa Tail-tTA fusion construct containing the low efficiency cleavage site described herein, digested with Xbal and BamHI.
  • HTLA 2C11.6 cells were transfected with OPRK-GRPR 23aa Tail -tTA fusion construct containing the low efficiency cleavage site and assays were carried out using 10 ⁇ M U-69593, an agonist for OPRK. The maximal response to U-69593 resulted in an approximately 115-fold induction of reporter gene expression over the background.
  • HTLA 2C11.6 cells were fransfected with ADRA1A-GRPR 23aa Tail-tTA fusion construct containing the low efficiency cleavage site and assays were carried out using 10 ⁇ M epinephrine, an agonist for ADRAIA. The maximal response to epinephrine resulted in an approximately 102-fold induction of reporter gene expression over the background.
  • EXAMPLE 28 EXAMPLE 28
  • This experiment was designed to demonstrate the use of the assay to measure the activity of the receptor tyrosine kinase Insulin-like Growth Factor- 1 Receptor (IGF1R), specifically by monitoring the ligand-induced recruitment of the intracellular signaling protein SHC1 (Src homology 2 domain-containing transforming protein 1).
  • IGF1R insulin-like Growth Factor- 1 Receptor
  • SHC1 intracellular signaling protein
  • a first fusion construct was created, comprismg DNA encoding the human IGF-1R, which can be found at GenBank under the Accession Number NM_000875 (SEQ ID NO: 96), fused in frame to a DNA sequence encoding amino acids 3-335 ofthe tetracycline- controlled transactivator tTA, described supra.
  • Inserted between these sequences is a DNA sequence encoding the amino acid sequence GSENLYFQL (SEQ ID NO: 82) which includes the low efficiency cleavage site for TEV Nla-Pro, ENLYFQL (SEQ ID NO: 14), described supra.
  • the CMV promoter was placed upstream ofthe IGF1R coding region, and a polyA sequence was placed downstream of the tTA region. This construct is designated IGFlR-TEV-NIa-Pro cleavage (Leu)-tTA.
  • a second fusion construct was created, comprising DNA encoding the PTB domain of human SHC1, corresponding to amino acids 1-238 (GeneBank accession number BC014158) (SEQ ID NO: 97) fused in frame to a DNA sequence encoding the catalytic domain of mature TEV NIa protease, described supra, corresponding to amino acids 2040- 2279 (GeneBank accession number AAA47910) (SEQ ID NO: 79). Inserted between these sequences is a linker DNA sequence encoding the amino acids NSGS (SEQ ID NO: 98).
  • the CMV promoter was placed upstream ofthe SHC1 PTB domain coding sequence and a polyA sequence was placed downstream of the TEV NIa protease sequence.
  • This construct is designated SHC1 -TEV.
  • the IGFlR-TEV-NIa-Pro cleavage (Leu)-tTA and SHC1-TEV fusion constructs were transfected into clone HTL5B8.1 cells described supra. About 2.5 x IO 4 cells were plated into each well of a 96 well-plate, in DMEM medium supplemented with 10% fetal bovine serum, 2 mM L-Glutamine, 100 units/ml penicillin, 500 ⁇ g/ml G418, and 3 ⁇ g/ml puromycin.
  • EXAMPLE 29 This experiment was designed to demonstrate the use of the assay to measure the interaction of two test proteins that are not normally membrane bound.
  • the assay was used to measure the ligand-induced dimerization of the nuclear steroid hormone receptors, ESRl (estrogen receptor 1 or ER alpha) and ESR2 (estrogen receptor 2 or ER beta).
  • ESRl is fused to the transcription factor tTA, where the cleavage site for the TEV Nla-Pro protease is inserted between the ESRl and tTA sequences.
  • This ESRl-tTA fusion is tethered to the membrane by a fusion to the intracellular, C-terminal end of the transmembrane protein CD8.
  • CD8 essentially serves as an inert scaffold that tethers ESRl to the cytoplasmic side of the cell membrane. The transcription factor fused thereto cannot enter the nucleus until interaction with ESR2 and protease. Any transmembrane protein could be used.
  • This CD8-ESR1-TEV NIa Pro cleavage-tTA fusion protein is expressed together with a second fusion protein comprised of ESR2 and the TEV Nla-Pro protease in a cell line containing a tTA-dependent reporter gene.
  • a fusion construct was created, comprising DNA encoding human CD8 gene (235 amino acids), which can be found in Genbank under Accession Number NM_001768 (SEQ ID NO: 99), fused in frame to a DNA sequence encoding the human ESRl (596 amino acids), which can be found in Genbank under Accession Number NM_000125 (SEQ ID NO: 100). Inserted between these sequences is a DNA sequence encoding the amino acid sequence GRA (Gly- Arg- Ala).
  • the resulting construct is then fused in frame to a DNA sequence encoding amino acids 3-335 of the tefracycline controlled transactivator tTA, described supra. Inserted between these sequences is a DNA sequence encoding the amino acid sequence GSENLYFQL (SEQ ID NO: 82) which includes the low efficiency cleavage site for TEV Nla-Pro, ENLYFQL (SEQ ID NO: 14), described supra.
  • the CMV promoter was placed upstream of the Human CD8 coding region, and a poly A sequence was placed downstream of the tTA region. This construct is designated CD8- ESR1- TEV- Nla-Pro cleavage (L)-tTA.
  • a second fusion construct was created, using DNA encoding Human Estrogen Receptor beta (ESR2) (530 amino acids), which can be found at Genbank, under Accession Number NM_001437 (SEQ ID NO: 101), fused in frame to a DNA sequence encoding the catalytic domain of the TEV NIa protease, described supra, corresponding to amino acids 2040-2279 (GenBank accession number AAA47910) (SEQ ID NO: 84). Inserted between these sequences is a DNA sequence encoding the amino acid sequence RS (Arg-Ser). The CMV promoter region was placed upstream ofthe Human Estrogen Receptor beta (ESR2) coding region, and a poly A sequence was placed downstream of the TEV region.
  • ESR2 Human Estrogen Receptor beta
  • ESR2-TEV This construct is designated ESR2-TEV.
  • the CD8-ESR1- TEV-NIa-Pro cleavage (L)-tTA and ESR2-TEV fusion constructs, together with pCDNA3 were transiently fransfected into HTL5B8.1 cells described supra. About 2.0 x IO 4 cells were seeded in each well of a 96 well plate and cultured in phenol-free DMEM medium supplemented with 10% fetal bovine serum, 2mM L-glutamine, 100 units/ml penicillin, lOO ⁇ g ml G418, and 5 ⁇ g/ml puromycin.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • General Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2004/021887 2003-07-09 2004-07-09 Method for assaying protein-protein interaction Ceased WO2005007822A2 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
JP2006518902A JP4734498B2 (ja) 2003-07-09 2004-07-09 タンパク質−タンパク質相互作用を解析する方法
CN2004800248641A CN1894581B (zh) 2003-07-09 2004-07-09 检测蛋白-蛋白相互作用的方法
AT04756784T ATE534900T1 (de) 2003-07-09 2004-07-09 Verfahren zum testen einer protein-protein- wechselwirkung
CA002531698A CA2531698A1 (en) 2003-07-09 2004-07-09 Method for assaying protein-protein interaction
AU2004257228A AU2004257228B8 (en) 2003-07-09 2004-07-09 Method for assaying protein-protein interaction
EP04756784A EP1644734B1 (en) 2003-07-09 2004-07-09 Method for assaying protein-protein interaction
IL173023A IL173023A0 (en) 2003-07-09 2006-01-08 Method for assaying protein-protein interaction

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US48596803P 2003-07-09 2003-07-09
US60/485,968 2003-07-09
US51191803P 2003-10-15 2003-10-15
US60/511,918 2003-10-15
US56611304P 2004-04-27 2004-04-27
US60/566,113 2004-04-27

Publications (2)

Publication Number Publication Date
WO2005007822A2 true WO2005007822A2 (en) 2005-01-27
WO2005007822A3 WO2005007822A3 (en) 2005-03-31

Family

ID=34084516

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/021887 Ceased WO2005007822A2 (en) 2003-07-09 2004-07-09 Method for assaying protein-protein interaction

Country Status (9)

Country Link
US (3) US7049076B2 (enExample)
EP (2) EP1644734B1 (enExample)
JP (1) JP4734498B2 (enExample)
CN (1) CN1894581B (enExample)
AT (1) ATE534900T1 (enExample)
AU (1) AU2004257228B8 (enExample)
CA (1) CA2531698A1 (enExample)
IL (1) IL173023A0 (enExample)
WO (1) WO2005007822A2 (enExample)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007101274A3 (en) * 2006-03-02 2007-12-21 Uab Research Foundation Mycobacterial disease detection, treatment, and drug discovery
EP2002021A4 (en) * 2006-03-16 2009-04-22 Invitrogen Corp METHOD FOR THE STUDY OF PROTEIN-PROTEIN INTERACTIONS
EP1893627A4 (en) * 2005-05-27 2009-11-11 Sentigen Biosciences Inc MULTIPLEXARRAY SUITABLE FOR THE INVESTIGATION OF PROTEIN-PROTEIN INTERACTIONS
WO2010034773A1 (en) * 2008-09-25 2010-04-01 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Combinatorial synthesis and use of libraries of short expressed nucleic acid sequences for the analysis of cellular events
KR20100058526A (ko) * 2007-09-04 2010-06-03 사노피-아벤티스 프로테아제 활성화된 리포터를 사용한 단백질-단백질 상호작용 조절 분자의 확인 방법
US8017398B2 (en) 2003-07-09 2011-09-13 Life Technologies Corporation Method for assaying protein-protein interaction
WO2012117031A1 (en) * 2011-03-01 2012-09-07 Vib Vzw Kinase substrate sensor
WO2014195280A1 (en) 2013-06-05 2014-12-11 Glaxosmithkline Biologicals S.A. Immunogenic composition for use in therapy
US8999653B2 (en) 2008-07-31 2015-04-07 Cis-Bio International Method for detecting membrane protein internalization
US9856497B2 (en) 2016-01-11 2018-01-02 The Board Of Trustee Of The Leland Stanford Junior University Chimeric proteins and methods of regulating gene expression
EP3321287A1 (en) 2011-04-13 2018-05-16 GlaxoSmithKline Biologicals S.A. Fusion proteins & combination vaccines
US10160967B2 (en) 2005-07-21 2018-12-25 Aebi Ltd. Methods and compositions for identifying a peptide having an intermolecular interaction with a target of interest
US10336807B2 (en) 2016-01-11 2019-07-02 The Board Of Trustees Of The Leland Stanford Junior University Chimeric proteins and methods of immunotherapy
EP3831946A4 (en) * 2018-07-31 2022-08-10 The University of Tokyo METHOD OF MEASUREMENT OF MEMBRANE PROTEIN ACTIVITY

Families Citing this family (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070224615A1 (en) * 2003-07-09 2007-09-27 Invitrogen Corporation Methods for assaying protein-protein interactions
WO2007092938A2 (en) * 2006-02-08 2007-08-16 Invitrogen Corporation Cellular assays for signaling receptors
WO2007149807A1 (en) * 2006-06-20 2007-12-27 Invitrogen Corporation Methods for identifying modifiers of gpr1 activity
EP2078037A4 (en) * 2006-11-10 2010-01-27 Dimerix Bioscience Pty Ltd HETERODIMERS / OLIGOMERS OF THE RECEPTOR FOR THE THYROTROPIN RELEASING HORMONE OF THE OREXIN RECEPTOR
US9026409B2 (en) 2007-08-06 2015-05-05 Design Ready Controls, Inc. Systems, methods, and software for automated design and manufacturing of HVAC control panels
JP5586285B2 (ja) * 2009-03-18 2014-09-10 オリンパス株式会社 受容体相互作用検出方法およびサイクリックampセンサータンパク質
CN107899012A (zh) 2011-01-11 2018-04-13 戴麦里克斯生物科学有限公司 联合疗法
WO2013049398A2 (en) 2011-09-28 2013-04-04 H. Lee Moffitt Cancer Center & Research Institute, Inc. Protein-protein interaction as biomarkers
WO2014153044A1 (en) * 2013-03-14 2014-09-25 Temple University Of The Commonwealth System Of Higher Education Treatment of patients with hyponatremia and cardiac disease
US10226528B2 (en) * 2013-03-15 2019-03-12 The Trustees Of The University Of Pennsylvania Vaccines with biomolecular adjuvants
EP3103900B1 (en) * 2014-02-07 2020-09-09 Korea Research Institute Of Bioscience And Biotechnology High-throughput analysis method of interaction between materials, using protein fusion display technique
US10619155B2 (en) * 2015-03-17 2020-04-14 Brown University Methods for labeling and manipulating a cellular circuit
CN104991072B (zh) * 2015-06-16 2017-03-29 西北农林科技大学 一种昆虫体外蛋白质相互作用检测系统的制备方法及应用
GB201609604D0 (en) * 2016-06-01 2016-07-13 Ucl Business Plc Cell
CN107976411B (zh) * 2016-10-25 2020-10-23 中国科学院微生物研究所 包含别构转录因子调控系统的生物传感器、试剂盒及其在小分子检测中的用途
WO2019062744A1 (zh) * 2017-09-27 2019-04-04 北京大学 融合多肽
CN108191979B (zh) * 2017-12-08 2021-01-01 上海晶诺生物科技有限公司 一种荧光互补检测人趋化因子生物学活性的方法
CN110853712B (zh) * 2018-08-01 2022-06-07 清华大学 鉴定多对生物分子间相互作用调控因子的方法
KR102317202B1 (ko) * 2018-10-19 2021-10-25 주식회사 프로티나 유방암 재발 예측 방법
JP2022509850A (ja) * 2018-12-07 2022-01-24 オクタント,インク. タンパク質間相互作用スクリーニングのためのシステム
JP2022513606A (ja) * 2018-12-10 2022-02-09 イエール ユニバーシティ 宿主の生理機能を形成する微生物叢代謝産物
WO2022271264A1 (en) * 2021-06-21 2022-12-29 Massachusetts Institute Of Technology Real-time g-protein coupled receptor (gpcr) linked bioluminescent sensing of biological targets and processes

Citations (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4684611A (en) 1982-02-11 1987-08-04 Rijksuniversiteit Leiden Process for the in-vitro transformation of plant protoplasts with plasmid DNA
US4879236A (en) 1984-05-16 1989-11-07 The Texas A&M University System Method for producing a recombinant baculovirus expression vector
US4952500A (en) 1988-02-01 1990-08-28 University Of Georgia Research Foundation, Inc. Cloning systems for Rhodococcus and related bacteria
US5384253A (en) 1990-12-28 1995-01-24 Dekalb Genetics Corporation Genetic transformation of maize cells by electroporation of cells pretreated with pectin degrading enzymes
US5580859A (en) 1989-03-21 1996-12-03 Vical Incorporated Delivery of exogenous DNA sequences in a mammal
US5656610A (en) 1994-06-21 1997-08-12 University Of Southern California Producing a protein in a mammal by injection of a DNA-sequence into the tongue
US5702932A (en) 1992-07-20 1997-12-30 University Of Florida Microinjection methods to transform arthropods with exogenous DNA
US5736524A (en) 1994-11-14 1998-04-07 Merck & Co.,. Inc. Polynucleotide tuberculosis vaccine
US5780448A (en) 1995-11-07 1998-07-14 Ottawa Civic Hospital Loeb Research DNA-based vaccination of fish
US5789215A (en) 1991-08-20 1998-08-04 Genpharm International Gene targeting in animal cells using isogenic DNA constructs
US5871986A (en) 1994-09-23 1999-02-16 The General Hospital Corporation Use of a baculovirus to express and exogenous gene in a mammalian cell
US5891646A (en) 1997-06-05 1999-04-06 Duke University Methods of assaying receptor activity and constructs useful in such methods
US5925565A (en) 1994-07-05 1999-07-20 Institut National De La Sante Et De La Recherche Medicale Internal ribosome entry site, vector containing it and therapeutic use
US5928906A (en) 1996-05-09 1999-07-27 Sequenom, Inc. Process for direct sequencing during template amplification
US5935819A (en) 1992-08-27 1999-08-10 Eichner; Wolfram Process for producing a pharmaceutical preparation of PDGF-AB
US5945100A (en) 1996-07-31 1999-08-31 Fbp Corporation Tumor delivery vehicles
US5981274A (en) 1996-09-18 1999-11-09 Tyrrell; D. Lorne J. Recombinant hepatitis virus vectors
US5994624A (en) 1997-10-20 1999-11-30 Cotton Incorporated In planta method for the production of transgenic plants
US20020106379A1 (en) 1997-09-18 2002-08-08 Racquel Hernandez Membrane virus host range mutations and their uses as vaccine substrates
US20020132327A1 (en) 1998-03-20 2002-09-19 California Institute Of Technology Method for identifying proteases, protease target sites and regulators of protease activity in cells
US6528271B1 (en) 1997-06-05 2003-03-04 Duke University Inhibition of βarrestin mediated effects prolongs and potentiates opioid receptor-mediated analgesia
US20030143626A1 (en) 2000-11-13 2003-07-31 Pierre Colas Targeted modification of intracellular compounds
US20030157553A1 (en) 2000-03-03 2003-08-21 Gabriel Berstein Methods of assaying for G protein-coupled receptor ligands and modulators
US20040002119A1 (en) 2002-04-12 2004-01-01 Iannone Marie A. Method of predicting cell-based assay results using binding profiles

Family Cites Families (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2753377B1 (fr) 1996-09-19 1999-09-24 Rhone Merieux Nouvelle association parasiticide a base de 1-n-phenylpyra- zoles et de lactones macrocycliques endectocides
US3737901A (en) 1971-05-03 1973-06-05 Sierra Research Corp Redundant aircraft clock synchronization
JPS57139012A (en) 1981-02-23 1982-08-27 Sankyo Co Ltd Anthelmintic composition
US5168062A (en) * 1985-01-30 1992-12-01 University Of Iowa Research Foundation Transfer vectors and microorganisms containing human cytomegalovirus immediate-early promoter-regulatory DNA sequence
US5168061A (en) * 1986-05-15 1992-12-01 Board Of Regents, The University Of Texas System Human chorionic peptidase-1
US5283173A (en) * 1990-01-24 1994-02-01 The Research Foundation Of State University Of New York System to detect protein-protein interactions
US5284746A (en) * 1990-02-08 1994-02-08 Zymogenetics, Inc. Methods of producing hybrid G protein-coupled receptors
US5439924A (en) 1991-12-23 1995-08-08 Virbac, Inc. Systemic control of parasites
US5814618A (en) * 1993-06-14 1998-09-29 Basf Aktiengesellschaft Methods for regulating gene expression
US5464758A (en) * 1993-06-14 1995-11-07 Gossen; Manfred Tight control of gene expression in eucaryotic cells by tetracycline-responsive promoters
US5491084A (en) * 1993-09-10 1996-02-13 The Trustees Of Columbia University In The City Of New York Uses of green-fluorescent protein
NZ272574A (en) 1995-07-14 1999-02-25 Lilly Eli & Co Nz Ltd Aqueous base suspension concentrate containing at least one ionophore antibiotic and wetting agent and/or a surfactant and xanthan gum optionally with a suspension agent, an antifreeze agent and an antifoaming agent; drench for veterinary treatment
AU1283497A (en) * 1995-12-08 1997-06-27 Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The Method and compositions for monitoring dna binding molecules in living cells
US5773422A (en) 1996-01-29 1998-06-30 Komer; Gene Avermectin formulation
EP0959891A1 (en) 1996-07-30 1999-12-01 Ashmont Holdings Limited Anthelmintic formulations
DE19654079A1 (de) 1996-12-23 1998-06-25 Bayer Ag Endo-ekto-parasitizide Mittel
TR200001313T2 (tr) * 1997-11-10 2002-06-21 The General Hospital Corporation Protein etkileşimlerini ve fonksiyonel ilişkileri kaydeden tarama sistemleri
US6117639A (en) * 1998-08-31 2000-09-12 Vertex Pharmaceuticals Incorporated Fusion proteins, DNA molecules, vectors, and host cells useful for measuring protease activity
US6893827B1 (en) * 2000-02-07 2005-05-17 Applera Corporation Receptor function assay for G-protein coupled receptors and orphan receptors by reporter enzyme mutant complementation
US6333167B1 (en) * 2000-03-10 2001-12-25 American Home Products Corp. Methods and reagents for identifying inhibitors of proteolysis of membrane-associated proteins
US7018812B2 (en) * 2000-11-03 2006-03-28 Duke University Modified G-protein coupled receptors
US6562576B2 (en) * 2001-01-04 2003-05-13 Myriad Genetics, Inc. Yeast two-hybrid system and use thereof
US20030013137A1 (en) * 2001-03-13 2003-01-16 Barak Larry S. Automated methods of detecting receptor activity
EP1421210A4 (en) * 2001-07-31 2005-02-16 Clontech Lab Inc METHOD FOR DETECTING PROTEASE ACTIVITY IN ONE CELL
DE10211063A1 (de) * 2002-03-13 2003-10-09 Axaron Bioscience Ag Neue Verfahren zur Detektion und Analyse von Protein-Interaktionen in vivo
EP1492874B1 (en) * 2002-03-29 2011-01-19 XOMA Technology Ltd. Multigenic vector plasmids and methods for increasing expression of recombinant polypeptides
US7001889B2 (en) 2002-06-21 2006-02-21 Merial Limited Anthelmintic oral homogeneous veterinary pastes
KR100890579B1 (ko) * 2002-08-19 2009-04-27 프로테온 주식회사 Rna 결합 단백질의 유전자를 융합파트너로 이용한재조합 단백질의 제조방법
DE60325640D1 (de) * 2002-10-25 2009-02-12 Mds Analytical Technologies Us Verfahren zur identifizierung von transmembranrezeptoragonisten mit reduzierter internalisierung
CN1894581B (zh) 2003-07-09 2012-02-01 生命技术公司 检测蛋白-蛋白相互作用的方法

Patent Citations (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4684611A (en) 1982-02-11 1987-08-04 Rijksuniversiteit Leiden Process for the in-vitro transformation of plant protoplasts with plasmid DNA
US4879236A (en) 1984-05-16 1989-11-07 The Texas A&M University System Method for producing a recombinant baculovirus expression vector
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (enExample) 1985-03-28 1990-11-27 Cetus Corp
US4952500A (en) 1988-02-01 1990-08-28 University Of Georgia Research Foundation, Inc. Cloning systems for Rhodococcus and related bacteria
US5580859A (en) 1989-03-21 1996-12-03 Vical Incorporated Delivery of exogenous DNA sequences in a mammal
US5589466A (en) 1989-03-21 1996-12-31 Vical Incorporated Induction of a protective immune response in a mammal by injecting a DNA sequence
US5384253A (en) 1990-12-28 1995-01-24 Dekalb Genetics Corporation Genetic transformation of maize cells by electroporation of cells pretreated with pectin degrading enzymes
US5789215A (en) 1991-08-20 1998-08-04 Genpharm International Gene targeting in animal cells using isogenic DNA constructs
US5702932A (en) 1992-07-20 1997-12-30 University Of Florida Microinjection methods to transform arthropods with exogenous DNA
US5935819A (en) 1992-08-27 1999-08-10 Eichner; Wolfram Process for producing a pharmaceutical preparation of PDGF-AB
US5656610A (en) 1994-06-21 1997-08-12 University Of Southern California Producing a protein in a mammal by injection of a DNA-sequence into the tongue
US5925565A (en) 1994-07-05 1999-07-20 Institut National De La Sante Et De La Recherche Medicale Internal ribosome entry site, vector containing it and therapeutic use
US5871986A (en) 1994-09-23 1999-02-16 The General Hospital Corporation Use of a baculovirus to express and exogenous gene in a mammalian cell
US5736524A (en) 1994-11-14 1998-04-07 Merck & Co.,. Inc. Polynucleotide tuberculosis vaccine
US5780448A (en) 1995-11-07 1998-07-14 Ottawa Civic Hospital Loeb Research DNA-based vaccination of fish
US5928906A (en) 1996-05-09 1999-07-27 Sequenom, Inc. Process for direct sequencing during template amplification
US5945100A (en) 1996-07-31 1999-08-31 Fbp Corporation Tumor delivery vehicles
US5981274A (en) 1996-09-18 1999-11-09 Tyrrell; D. Lorne J. Recombinant hepatitis virus vectors
US5891646A (en) 1997-06-05 1999-04-06 Duke University Methods of assaying receptor activity and constructs useful in such methods
US6110693A (en) 1997-06-05 2000-08-29 Duke University Methods of assaying receptor activity and constructs useful in such methods
US6528271B1 (en) 1997-06-05 2003-03-04 Duke University Inhibition of βarrestin mediated effects prolongs and potentiates opioid receptor-mediated analgesia
US20020106379A1 (en) 1997-09-18 2002-08-08 Racquel Hernandez Membrane virus host range mutations and their uses as vaccine substrates
US5994624A (en) 1997-10-20 1999-11-30 Cotton Incorporated In planta method for the production of transgenic plants
US20020132327A1 (en) 1998-03-20 2002-09-19 California Institute Of Technology Method for identifying proteases, protease target sites and regulators of protease activity in cells
US20030157553A1 (en) 2000-03-03 2003-08-21 Gabriel Berstein Methods of assaying for G protein-coupled receptor ligands and modulators
US20030143626A1 (en) 2000-11-13 2003-07-31 Pierre Colas Targeted modification of intracellular compounds
US20040002119A1 (en) 2002-04-12 2004-01-01 Iannone Marie A. Method of predicting cell-based assay results using binding profiles

Non-Patent Citations (46)

* Cited by examiner, † Cited by third party
Title
AUSUBEL ET AL.: "Current Protocols In Molecular Biology", vol. 199 A, 1996, JOHN WILEY & SONS
CARBONELLI ET AL., FEMS MICROBIOL. LETT., vol. 172, no. 1, 1999, pages 75 - 82
CHEN, OKAYAMA, MOL. CELL BIOL., vol. 7, no. 8, 1987, pages 2745 - 2752
COCEA, BIOTECHNIQUES, vol. 23, no. 5, 1997, pages 814 - 816
FECHHEIMER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, no. 17, 1987, pages 8463 - 8467
FERGUSON, PHARMACOL. REV., vol. 53, 2001, pages 1 - 24
FRALEY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 76, 1979, pages 3348 - 3352
FREDRICKSSON ET AL., MOL. PHARMACOL., vol. 63, 2003, pages 1256 - 1272
GLUSMAN ET AL., GENOME. RES., vol. 11, 2001, pages 685 - 702
GOPAL, MOL. CELL BIOL., vol. 5, 1985, pages 1188 - 190
GOSSEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1992, pages 5547 - 5551
GRAHAM, VAN DER EB, VIROLOGY, vol. 52, 1973, pages 456 - 467
HARLAN, WEINTRAUB, J. CELL BIOL., vol. 101, no. 3, 1985, pages 1094 - 1099
INDEED, HOWARD ET AL., TRENDS PHARMACOL. SCI., vol. 22, 2001, pages 132 - 140
KANEDA ET AL., SCIENCE, vol. 243, 1989, pages 375 - 378
KAPUST ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 294, 2002, pages 949 - 955
KATO ET AL., J. BIOL. CHEM., vol. 266, 1991, pages 3361 - 3364
KOLODZIEJ ET AL., METH. ENZYMOL., vol. 194, 1991, pages 508 - 519
KOVOOR A., J. BIOL. CHEM., vol. 274, no. 11, 1999, pages 6831 - 6834
KOVOOR ET AL., J. BIOL: CHEM., vol. 274, 1999, pages 6831 - 6834
LEVENSON ET AL., HUM. GENE THER., vol. 9, no. 8, 1998, pages 1233 - 1236
LUTTRELL ET AL., J. CELL SCI., vol. 115, 2002, pages 455 - 465
MACEJAK, SARNOW, NATURE, vol. 353, 1991, pages 90 - 94
MACGREGOR ET AL., SOMAT. CELL MOL. GENET., vol. 13, 1987, pages 253 - 265
MANIATIS ET AL.: "Molecular Cloning, A Laboratory Manual", 1990, COLD SPRING HARBOR
NABEL ET AL., SCIENCE, vol. 244, 1989, pages 1342 - 1344
NICOLAU ET AL., METH. ENZVM., vol. 149, 1987, pages 157 - 176
NICOLAU, SENE, BIOCHEM. & BIOPHYS. ACTA., vol. 721, 1982, pages 185 - 190
OAKLEY ET AL., ASSAY DRUG DEV. TECHNOL., vol. 1, 2002, pages 21 - 30
OAKLEY ET AL., J. BIOL. CHEM., vol. 274, 1999, pages 32248 - 32257
OAKLEY ET AL., J. BIOL. CHEM., vol. 276, 2001, pages 19452 - 19460
OAKLEY, R., ASSAY AND DRUG DEVELOPMENT TECHNOLOGIES, vol. 1, 2002, pages 21 - 30
OMIRULLEH ET AL., PLANT MOL. BIOL., vol. 21, no. 3, 1987, pages 415 - 428
PARKS ET AL., ANAL. BIOCHEM., vol. 216, 1994, pages 413 - 417
PELLETIER, SONENBERG, NATURE, vol. 334, 1988, pages 320 - 325
POTRYKUS ET AL., MOL. GEN. GENET., vol. 199, no. 2, 1985, pages 169 - 177
POTTER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 71 1 - 7165
RIPPE ET AL., MOL. CELL BIOL., vol. 10, 1990, pages 689 - 695
STRADER ET AL., J. BIOL. CHEM., vol. 266, 1991, pages 5 - 8
TAKEDA ET AL., FEBS LETTERS, vol. 520, 2002, pages 97 - 101
TUR-KASPA ET AL., MOL. CELL BIOL., vol. 6, 1986, pages 716 - 718
VASSILATIS ET AL., PROC. NATL. ACAD. SCI. USA, vol. 100, 2003, pages 4903 - 4908
WILSON ET AL., SCIENCE, vol. 244, 1989, pages 1344 - 1346
WONG ET AL., GENE, vol. 10, 1980, pages 879 - 894
WU, WU, J. BIOL. CHEM., vol. 262, 1987, pages 4429 - 4432
ZOZULYA ET AL., GENOME BIOL., vol. 2, 2001, pages 0018.1 - 0018.12

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8017398B2 (en) 2003-07-09 2011-09-13 Life Technologies Corporation Method for assaying protein-protein interaction
EP1893627A4 (en) * 2005-05-27 2009-11-11 Sentigen Biosciences Inc MULTIPLEXARRAY SUITABLE FOR THE INVESTIGATION OF PROTEIN-PROTEIN INTERACTIONS
US10160967B2 (en) 2005-07-21 2018-12-25 Aebi Ltd. Methods and compositions for identifying a peptide having an intermolecular interaction with a target of interest
WO2007101274A3 (en) * 2006-03-02 2007-12-21 Uab Research Foundation Mycobacterial disease detection, treatment, and drug discovery
US8603751B2 (en) 2006-03-02 2013-12-10 The Uab Research Foundation Mycobacterial disease detection, treatment, and drug discovery
EP2002021A4 (en) * 2006-03-16 2009-04-22 Invitrogen Corp METHOD FOR THE STUDY OF PROTEIN-PROTEIN INTERACTIONS
KR101636306B1 (ko) * 2007-09-04 2016-07-05 사노피 프로테아제 활성화된 리포터를 사용한 단백질-단백질 상호작용 조절 분자의 확인 방법
US9023610B2 (en) 2007-09-04 2015-05-05 Sanofi Identifying molecules modulating protein-protein interactions using protease activated reporters
JP2010537669A (ja) * 2007-09-04 2010-12-09 サノフィ−アベンティス プロテアーゼ活性化レポーターを使用してのタンパク質−タンパク質相互作用を調節する分子の同定
KR20100058526A (ko) * 2007-09-04 2010-06-03 사노피-아벤티스 프로테아제 활성화된 리포터를 사용한 단백질-단백질 상호작용 조절 분자의 확인 방법
US8999653B2 (en) 2008-07-31 2015-04-07 Cis-Bio International Method for detecting membrane protein internalization
WO2010034773A1 (en) * 2008-09-25 2010-04-01 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Combinatorial synthesis and use of libraries of short expressed nucleic acid sequences for the analysis of cellular events
WO2012117031A1 (en) * 2011-03-01 2012-09-07 Vib Vzw Kinase substrate sensor
US10280410B2 (en) 2011-03-01 2019-05-07 Universiteit Gent Cytoplasmic protein complex comprising a kinase substrate sensor cells and associated detection methods
US11242511B2 (en) 2011-03-01 2022-02-08 Vib Vzw Cytoplasmic protein complex comprising a kinase substrate sensor, cells comprising the complex, and associated detection methods
EP3321287A1 (en) 2011-04-13 2018-05-16 GlaxoSmithKline Biologicals S.A. Fusion proteins & combination vaccines
WO2014195280A1 (en) 2013-06-05 2014-12-11 Glaxosmithkline Biologicals S.A. Immunogenic composition for use in therapy
US9856497B2 (en) 2016-01-11 2018-01-02 The Board Of Trustee Of The Leland Stanford Junior University Chimeric proteins and methods of regulating gene expression
US10336807B2 (en) 2016-01-11 2019-07-02 The Board Of Trustees Of The Leland Stanford Junior University Chimeric proteins and methods of immunotherapy
US10457961B2 (en) 2016-01-11 2019-10-29 The Board Of Trustees Of The Leland Stanford Junior University Chimeric proteins and methods of regulating gene expression
US11111287B2 (en) 2016-01-11 2021-09-07 The Board Of Trustees Of The Leland Stanford Junior University Chimeric proteins and methods of immunotherapy
US11773411B2 (en) 2016-01-11 2023-10-03 The Board Of Trustees Of The Leland Stanford Junior University Chimeric proteins and methods of regulating gene expression
EP3831946A4 (en) * 2018-07-31 2022-08-10 The University of Tokyo METHOD OF MEASUREMENT OF MEMBRANE PROTEIN ACTIVITY
US12247244B2 (en) 2018-07-31 2025-03-11 The University Of Tokyo Membrane protein activity measurement method

Also Published As

Publication number Publication date
JP2007528713A (ja) 2007-10-18
EP1644734B1 (en) 2011-11-23
AU2004257228B8 (en) 2009-01-08
US8017398B2 (en) 2011-09-13
CN1894581A (zh) 2007-01-10
EP1644734A2 (en) 2006-04-12
IL173023A0 (en) 2006-06-11
US20120077706A1 (en) 2012-03-29
US20060147975A1 (en) 2006-07-06
WO2005007822A3 (en) 2005-03-31
AU2004257228B2 (en) 2008-12-18
CA2531698A1 (en) 2005-01-27
ATE534900T1 (de) 2011-12-15
EP2336768A9 (en) 2011-08-10
EP2336768A1 (en) 2011-06-22
CN1894581B (zh) 2012-02-01
AU2004257228A1 (en) 2005-01-27
US20050100934A1 (en) 2005-05-12
EP1644734A4 (en) 2007-04-25
US7049076B2 (en) 2006-05-23
JP4734498B2 (ja) 2011-07-27

Similar Documents

Publication Publication Date Title
EP1644734B1 (en) Method for assaying protein-protein interaction
CN102187225B (zh) 使用蛋白酶活化的受体鉴别调节蛋白质-蛋白质相互作用的分子
EP2002021B1 (en) Methods for assaying protein-protein interaction
WO2007149807A1 (en) Methods for identifying modifiers of gpr1 activity
US20070224615A1 (en) Methods for assaying protein-protein interactions
EP1893627A1 (en) Multiplex array useful for assaying protein-protein interaction
HK1162664B (en) Identifying molecules that modulate protein- protein interactions using protease activated reporters
WO2007002641A2 (en) Method for identifying cart receptor and uses thereof

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200480024864.1

Country of ref document: CN

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2531698

Country of ref document: CA

Ref document number: 2004257228

Country of ref document: AU

Ref document number: 2006518902

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2004756784

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 162/DELNP/2006

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2004257228

Country of ref document: AU

Date of ref document: 20040709

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2004257228

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2004756784

Country of ref document: EP