Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
  • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
  • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
  • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
  • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

Definitions

• the invention pertains to the field of methods and reagents for detecting bacteria and fungus-yeast found in pharmaceutical, cosmetic and non clinical samples. More specifically, the present invention relates to a sample preparation, primer sets, probe sets and methods for one step real-time RT PCR kits for the universal detection of alive bacteria and fungus-yeast in sterile or non sterile industrial product in less than 24 hours.
• PCT publication W084/02721 published Jul. 19, 1984 describes the use of nucleic acid probes complementary to targeted nucleic acid sequences composed of ribosomal RNA, transfer RNA, or other RNA in hybridization procedures to detect the target nucleic acid sequence. While the assay may provide greater sensitivity and specificity than known DNA hybridization assays, hybridization procedures which require the use of a complementary probe are generally dependent upon the cultivation of a test organism and are, therefore, unsuitable for rapid analysis.
• RT-PCR Reverse Transcriptase Polymerase Chain Reaction
• RT-PCR is a powerful ribonucleic acid amplification technique that can be used for the detection of small numbers of ribonucleotide acid targets from bacteria and/or from fungus-yeast whose in vitro cultivation is difficult or lengthy.
• RT PCR requires the presence of living specimens for detection.
• RT PCR is an in vitro method for the enzymatic synthesis of specific cDNA sequences.
• RNA strand and flank the region of interest in the target cDNA are synthetised by Reverse Transcriptase.
• a repetitive series of cycles involving template denaturation, primer annealing, and extension of annealed primers by DNA polymerase results in the exponential accumulation of a specific fragment whose termini are defined by the 5' ends of the primers.
• PCR produce a selective enrichment of a specific DNA sequence by a factor of 10.sup.12. The PCR method is described in Saiki et al, 1985, Science 230:1350 and is the subject of U.S. Pat. Nos.
• Bacterial and fungus-yeast detection have traditionally been accomplished by pure culture isolation, followed by identification procedures that make use of knowledge of specimen source, growth requirements, visible (colony) growth features, microscopic morphology, staining reactions, and biochemical characteristics.
• the present invention pertains to methods and reagents for the rapid detection of bacteria and fungus -yeast in sterile and non sterile product in less than 24 hours.
• a target region from a one-step Reverse Transcriptase Polymerase Chain Reaction of RNA and the resultant amplified DNA is treated with probes which can hybridize to the amplified DNA of bacteria or fungus-yeast but not other organisms (mammalian, plant, insects...) or virus .
• the Tth DNA polymerase is a thermostable enzyme with RNA-dependent Reverse Transcriptase activity and with DNA-dependent Polymerase activity, allowing the combination of RT and PCR in a single-tube reaction resulting in a faster analysis of presence of RNA from bacteria, fungus-yeast.
• the invention enable the user to perform a rapid RT-PCR and simultaneously detect and quantify the presence of RNA from bacteria and/or fungus-yeast by monitoring fluorescence during real time polymerase chain reaction amplification with any risk of false positive due to opening tube between RT and PCR and from possible PCR product environmental contamination due to precedent amplification reactions in the laboratory.
• the methods of the present invention thus enable determination of the presence of bacteria and/or fungus-yeast more rapidly than technologies with prior art detection methods.
• the invention enable the user to perform a rapid RT-PCR and simultaneously analyse and quantify the presence of RNA from bacteria and/or fungus-yeast by monitoring fluorescence during real time polymerase chain reaction amplification with any risk of false positive due to opening tube between RT and PCR and from possible PCR product environmental contamination due to precedent amplification reactions.
• the basic RT PCR process is carried out as follows.
• a sample is provided which needs to be tested or which is suspected of contain a particular ribonucleic acid sequence of interest, the "target sequence.”
• the ribonucleic acid contained in the sample may be first reverse transcribed into cDNA (using enzyme like Tth DNA polymerase as purified enzyme and a oligonucleotide or PNA ), and then denatured, using physical means, which are known to those of skill in the art.
• a preferred physical means for strand separation involves heating the nucleic acid until it is completely (>99%) denatured.
• the denatured DNA strands are then incubated in the same tube with the selected oligonucleotide primers under hybridization conditions, conditions which enable the binding of the primers to the single DNA strands.
• the primers are selected so that their relative positions along a duplex sequence are such that an extension product synthesized from one primer, when it is separated from its complement, serves as a template for the extension of the other primer to yield a replicate chain of defined length.
• the primer must be sufficiently long to prime the synthesis of extension products in the presence of the agent for polymerization.
• the exact length of the primers will depend on many factors, including temperature, source of the primer and use of the method.
• Preferred oligonucleotide primers for use in the present invention are selected from the group consisting of
• Template-dependent extension of the oligonucleotide primer(s) is then catalyzed by the polymerizing agent ( in the presence of adequate amounts of the four deoxyribonucleoside triphosphates (dATP, dGTP, dCTP, and dTTP) or analogs), in a reaction medium which is comprised of the appropriate salts, metal cations, and pH buffering system.
• the products of the synthesis are duplex molecules consisting of the template strands and the primer extension strands, which include the target sequence. These products, in turn, serve as templates for another round of replication.
• the primer extension strand of the first cycle is annealed with its complementary primer; synthesis yields a "short" product which is bounded on both the 5'-and the 3'-ends by primer sequences or their complements.
• Repeated cycles of denaturation, primer annealing, and extension result in the exponential accumulation of the target region defined by the primers.
• Sufficient cycles are run to achieve the desired amount of polynucleotide containing the target region of nucleic acid. The desired amount may vary, and is determined by the function which the product polynucleotide is to serve.
• the PCR method is performed in a fashion where all of the reagents are added simultaneously, in one step.
• the RT PCR reaction is carried out as an automated process which utilizes a thermostable enzyme like Tth.
• RNA strand fragments with a size higher than 100 bp. All reagents used in the RT PCR reaction have to be processed before using.
• the target polynucleotides may be detected directly by hybridization with a probe polynucleotide which forms a stable hybrid with the target sequence under high stringency to low stringency hybridization and washing conditions.
• Probes are typically labeled with non-radioactive labeling systems, such as fluoresceins and derivated systems.
• the invention relates to a method and kit for determining the presence of bacteria or fungus-yeast ribonucleic acid (RNA) in a sample suspected of containing said bacteria and/or fungus, wherein said polynucleotide comprises a selected target region, said method comprising:
• RNA ribonucleic acid
• RNA-dependent Reverse Transcriptase activity RNA-dependent Reverse Transcriptase activity and with DNA-dependent Polymerase activity, allowing the combination of RT and PCR in a single-tube reaction, such as Tth DNA polymerase or an enzyme like Tth DNA polymerase, and polynucleotide primers with a nucleotide sequence selected from the group consisting of Seq ID No 2 TGCGGGACTTAACCCAACA [primer reverse] Seq ID No 4 TTACCCCACCTACTAGCTAAT [primer reverse] .
• composition for detecting bacteria comprises a polynucleotide primers and a probe consisting of the sequence
• composition for detecting bacteria comprises a polynucleotide primers and a probe consisting of the sequence
• composition for detecting bacteria which comprises a polynucleotide primers and a probe consisting of the sequence Seq ID No 5 GYGGAGCATGTGGYTTAATTCG [primer forward]
• composition for detecting fungus-yeast comprises a polynucleotide primers and a probe consisting of the sequence
• Seq ID No 7 GGGAAACTCACCAGGTCCA [primer forward]
• Seq ID No 8 CGTTATCGCAATTAAGCAGACA [primer reverse]
• composition for detecting fungus-yeast comprises a polynucleotide primers and a probe consisting of the sequence Seq ID No 9 GGTAACGGGGAATWAGGGTTC [primer forward]
• primers and probes used for detection all bacteria and/or fungus-yeast consists of the sequence :
• Seq ID No 5 Seq ID No 6 +Seq ID No 13 + Seq ID No 14 + Seq ID No 15 +Seq ID
• Seq ID No 5 Seq ID No 6 +Seq ID No 13 + Seq ID No 14 + Seq ID No 15 +Seq ID No 16 + Seq ID No 9+ Seq ID No 10 +Seq ID No 18 + Seq ID No 19
• polynucleotide primers and probes may be natural nucleic acid or Peptide Nucleic Acid (PNA) which can hybridize to nucleic acid (DNA and PNA).
• PNA Peptide Nucleic Acid
• the RNA may also be quantified and compared with quantified external standard
• oligonucleotide probes for use in the present invention are selected from the group consisting of
• Seq IDNo 11 TGCATGGYTGTCGTCAGCTCGTG [probe forward]
• Seq ID No 12 GAGTGGCGGACGGGTGAGTAA [probe forward]
• Seq IDNo 16 TCAGCTCGTGTTGTGAAATGTT [probe forward]
• Seq IDNo 17 AGGATTGACAGATTGAGAGCTCTT [probe forward]
• oligonucleotide primers and probes of the invention are based on the rRNA gene.
• Oligonucleotide rRNA gene for the detection of nucleic acids from various microorganisms have been described in the scientific literature. For example, universal bacterial probes have been described by Wilson et al., 1990, J. Clinical Microbiology 28:1942-1946, and Chem et al., 1989, FEMS Microbiology Letters 57:19-24.
• a panel of rRNA probes including a universal bacterial probe, gram- positive and gram-negative probes and species or group specific probes provides clinically useful information, not a single universal bacterial probe; since different pathologies, drugs and antibiotic therapy is recommended for various bacterial - fungus-yeast infections.
• universal bacterial probes are using only for positive controls.
• Universal primers for bacterial- fungus-yeast are using for identification after cloning and sequencing of the amplified product or hybridization on a DNA chip.
• the used of rRNA targets for sterility controls for detection of alive bacteria and fungus-yeast in sterile or non sterile industrial product has not been described before this invention.
• Preferred universal couple of primers for the one step RT PCR detection of bacteria and fungus-yeast comprise a probing nucleobase sequence selected from the group consisting of
• Preferred universal probes for the detection of bacteria and fungus-yeast comprise a probing nucleobase sequence selected from the group consisting of
• the probes and primer sets, methods and kits of this invention are particularly well suited for use in simplex or multiplex one step RT PCR assays wherein all the bacteria and/or fungus-yeast in a sample can be detected alive and quantitated.
• the total number of colony forming units (CFU) of bacteria and/or fungus-yeast can be directly determined.
• the liquid sample (up to 1000 mL) is passed through a polycarbonate membrane (up to 0,45 ⁇ m) or PVDF membrane (up to 0,45 ⁇ m) or PES membrane (up to 0,45 ⁇ m) via centrifugation (swing rotor) at 2000 g or a vacuum pump.
• RNA extraction kit is the " MagNaPure LC RNA isolation kit II " on the workstation MagNaPure LCTM (Roche Diagnostics).
• MagNaPure LC RNA isolation kit II on the workstation MagNaPure LCTM (Roche Diagnostics).
• the elution volume is up to 100 ⁇ L. Incubation with DNase is processed during the purification.
• RNA extract 5 - 2 ⁇ L (up to 5 ⁇ L) of pure RNA extract is used for the one step real time RT-PCR (LightCyclerTM ) with enzyme like Tth and the following program with Taqman Probe :
• RNA extract 6 - 2 ⁇ L (up to 5 ⁇ L) of pure RNA extract is used for the one step real time RT-PCR (LightCyclerTM ) with enzyme like Tth and the following program with Hybridization Probe :
• a preferred method for analysis of sample by centrifiigation ( non filterable liquids). Specificity of extraction from bacteria or fungus-yeast ribonucleotide from the sample up to 1000 mL by centrifiigation.
• RNA purification with commercial kits.
• Our preferred RNA extraction kit is the " MagNaPure LC RNA isolation kit II " on the workstation MagNaPure LCTM (Roche Diagnostics). The elution volume is up to 100 ⁇ L. Incubation with DNase is processed during the purification.
• RNA extract 5 - 2 ⁇ L (up to 5 ⁇ L) of pure RNA extract is used for the one step real time RT-PCR (LightCyclerTM ) with enzyme like Tth and the following program with Taqman Probe :
• RNA extract 6 - 2 ⁇ L (up to 5 ⁇ L) of pure RNA extract is used for the one step real time RT-PCR (LightCyclerTM ) with enzyme like Tth and the following program with Hybridization Probe :
• a preferred method for analysis of sample by direct lysis and recovery of RNA on DiEthylAminoEthyl cellulose DEAE membrane ( non filterable liquids). Specificity of extraction from bacteria or fungus-yeast ribonucleotide from the sample up to 1000 mL by centrifugation on DEAE membrane of the lysat following by an incubation with DNase.
• RNA extraction kit is the " MagNaPure LC RNA isolation kit II " on the workstation MagNaPure LCTM (Roche Diagnostics).
• MagNaPure LC RNA isolation kit II on the workstation MagNaPure LCTM (Roche Diagnostics).
• the elution volume is up to 100 ⁇ L. Incubation with DNase is processed during the purification.
• RNA extract 7 - 2 ⁇ L (up to 5 ⁇ L) of pure RNA extract is used for the one step real time RT-PCR (LightCyclerTM ) with enzyme like Tth and the following program with Taqman Probe :
• RNA extract 8 - 2 ⁇ L (up to 5 ⁇ L) of pure RNA extract is used for the one step real time RT-PCR (LightCyclerTM ) with enzyme like Tth and the following program with Hybridization Probe :

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Analytical Chemistry (AREA)
• Organic Chemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Engineering & Computer Science (AREA)
• Health & Medical Sciences (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Biotechnology (AREA)
• Immunology (AREA)
• Microbiology (AREA)
• Molecular Biology (AREA)
• Biophysics (AREA)
• Physics & Mathematics (AREA)
• Biochemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Mycology (AREA)
• Botany (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Priority Applications (6)

Applications Claiming Priority (2)

Publications (2)

Family

ID=32312970

Family Applications (1)

Country Status (8)

Cited By (38)

Families Citing this family (5)

Family Cites Families (12)

• 2003
  • 2003-11-03 US US10/534,647 patent/US20060257871A1/en not_active Abandoned
  • 2003-11-03 AU AU2003276634A patent/AU2003276634A1/en not_active Abandoned
  • 2003-11-03 WO PCT/IB2003/005312 patent/WO2004044247A2/en not_active Ceased
  • 2003-11-03 CN CN200380103046.6A patent/CN1711357A/zh active Pending
  • 2003-11-03 EP EP03811045A patent/EP1560932A2/en not_active Withdrawn
  • 2003-11-03 JP JP2004551109A patent/JP2006505275A/ja not_active Withdrawn
  • 2003-11-03 CA CA002506574A patent/CA2506574A1/en not_active Abandoned
• 2005
  • 2005-06-02 NO NO20052651A patent/NO20052651L/no not_active Application Discontinuation

Also Published As

Similar Documents

Legal Events