Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
  • A61P31/14—Antivirals for RNA viruses
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
  • A61K2039/53—DNA (RNA) vaccination
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2740/00—Reverse transcribing RNA viruses
  • C12N2740/00011—Details
  • C12N2740/10011—Retroviridae
  • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
  • C12N2740/15022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

• Vaccine against oncovirus infections such as feline feline leukemia virus
• the invention relates to a vaccine based on DNA, by means of which cats can be protected against infections with the feline leukosis virus.
• the feline leukosis virus (FeLV) is a cat-specific, globally distributed virus that triggers serious illnesses and is one of the main causes of death for the feline population. There is currently an infection rate of 12% to 16% of cats in both Europe and the United States.
• Some cats can overcome the infection; In contrast, however, lifelong virus persistence in the organism is also possible. Latently infected cats are then considered to be a pathogen reservoir.
• Antivirals are not able to inactivate the virus and therefore do not lead to healing.
• Preparations from inactivated viruses only lead to the desired immunity in some of the vaccinated animals.
• These vaccines are always protein mixtures in which highly immunogenic antigens have to "compete” with a large amount of other proteins for presentation by the immune system.
• strong side effects such as allergic reactions and autoimmune diseases can occur after vaccination.
• a recombinant vaccine consisting of FeLV's biotechnologically produced envelope protein and adjuvanted with aluminum hydroxide and saponin is currently a widely used vaccine. Vaccinations with this vaccine provide protection against leukosis in 80 to 95% of cats (Lutz et al., 1991, J Am Vet Med Asoc; 199 (10): 1446-52).
• Another example of a vaccine consisting of viruses capable of infection or replication is a recombinant canarypox virus expressing FeLV surface proteins. In test infections, 83% of the animals could be protected from the infection (Jarrett et al., 1993, J of Virology: 2370-2375).
• this vaccine has the disadvantages of a live vaccine with regard to unpredictable recombinations, it is also relatively complex and therefore expensive to manufacture and to characterize.
• deletion mutants or their genome for vaccination has the disadvantage that there is a risk that a deleted virus can result in infectious, novel pathogens by recombination with endogenous or exogenous virus sequences.
• Another problem is the application of the DNA encoding the immunogenic antigens or parts thereof.
• a disadvantage of the vectors currently used for DNA transport (transfection) is that either vectors of viral origin are used which pose security problems (Lehrman, 1999, Nature 401: 517-518), or plasmids are used. Since plasmids are obtained by bacterial fermentation, in addition to the desired gene, they also contain the DNA necessary for their replication and selection, and usually resistance genes against antibiotics used in the fermentation. The problem is discussed in detail in WO 98/21322. It should be mentioned that when gene expression constructs based on plasmid DNA are used, there is an inherent risk of the spread of antibiotic resistance genes, which is particularly unacceptable for large-scale vaccinations.
• DNA vectors are covalently closed minimalistic DNA constructs, as are disclosed in EP 0 914 318 B1.
• their use in the form of peptide-coupled DNA constructs leads to a surprising, qualitatively improved immune response compared to unmodified plasmid DNA (see also DE 101 56 679.4 and DE 101 56 678.6).
• this aim is achieved in that cats are immunized with a mixture (cocktail) of synthetically produced, codon- and splice-signal-optimized DNA sequences which are essential for structural proteins ("gag”) and the most important membrane protein (“env” ) of the FeLV.
• the codon and splice optimization is a strategy for changing the amino acid sequence of the structural proteins ("gag") and the most important membrane protein ("env") of the FeLV.
• End gene sequence which codes for the viral coat proteins of the inner viral packaging of the feline leukosis virus
• Gag gene sequence which codes for the viral structural proteins of the inner viral packaging of the feline leukosis virus
• FeLV feline leukemia virus
• ODN oligodeoxynucleotide
• the gene sequence "gag” codes for the viral structural proteins of the inner virus packaging, the gene sequence "env” for the viral envelope proteins.
• the protein that has the highest immunogenicity of the proteins encoded in the "env” sequence is the glycoprotein gp70.
• Virus-neutralizing antibodies against the gp70 are formed in the cat organism. These antibodies represent the first immune response after the pathogen has entered the body, which may be sufficient to overcome the infection.
• a vaccine that can induce both virus-neutralizing antibodies against the gp70 and a T-cell-mediated immune response is therefore a clear one Improvement compared to the previously available vaccines and could possibly also be used for the therapy of infected cats.
• Each amino acid can be encoded using several codons.
• the frequency with which the individual codons are read during transcription varies greatly between viruses, bacteria and vertebrates.
• the frequency of the corresponding tRNAs in the cell also varies accordingly.
• Viral genomes sometimes have a codon usage frequency that differs from the host cell, which is probably an element of the expression control of the viruses. By adapting the sequence to the host-specific codon usage pattern, these viral control mechanisms can be circumvented and the expression of antigen can be increased considerably.
• the aim of the experiments was to achieve a much stronger expression of the antigens by rewriting the viral sequences into sequences which represent an optimal codon usage for vertebrate genomes.
• a cloning strategy was developed that enabled the synthesis of this optimized DNA sequence from oligonucleotides.
• the synthetic sequences were inserted into plasmids, duplicated in E. coli, sequenced for control and then transfected into cells of a cat cell line in order to test the expression of the encoded proteins.
• the expression of the antigens was demonstrated using Western blots.
• mice were immunized with peptide-coupled expression constructs which coded for the codon-optimized and splice signal-optimized "env".
• peptide-coupled constructs which coded for the codon-optimized and splice signal-optimized "env”.
• both sequences according to the invention coding for "env” were used (Seq.ID 7, 8, and 9 and 10).
• the sera of the immunized mice were examined for specific antibodies against the FeL virus protein "env” using Western emblot.
• the synthetic constructs also lead to a strong stimulation of the antibody formation in vivo.
• five out of six group 4 mice showed a strong immune response to the antigen sequence according to the invention, whereas the WT (group 1) triggered a weak antibody response in only two out of six animals (see FIG. 3).
• Plasmids can be used as DNA expression constructs, but minimalistic immunologically defined gene expression constructs are preferably used according to the invention. These are linear, covalently closed expression cassettes which only consist of the CMV promoter, an intron, the corresponding gene sequence and a polyadenylation sequence. These covalently closed minimalistic DNA constructs are referred to below as midge vectors (MIDGE: MINIMALISTIC IMMUNOLOGI- CALLY DEFINED GENE EXPRESSION VECTOR); see. EP 0 941 318 B1.
• the Midge constructs have the advantage that they can be used to dispense with structures that are not essential for their medicinal effects, which avoids the disadvantages of conventional gene ferries.
• the transfection takes place by means of intradermal injection by syringes or needle-free injection devices.
• the subject of the invention is expression constructs which lead to the expression of antigens of the FeLV in mammalian cells.
• the invention thus provides a vaccine which leads to protection against infection with FeLV in cats and which takes into account the safety aspect.
• conventional adjuvants are dispensed with, so that the risk of fibrosarcombination at the injection site can thus be excluded.
• Biological transfection methods such as peptide-coupled gene transfer are further advantageous methods.
• a DNA expression construct which codes for at least the "env” and at least the "gag” sequence of FeLV according to the invention is covalently linked to an oligopeptide which preferably contains the Simian nuclear localization signal (NLS) SV-40 virus is.
• NLS Simian nuclear localization signal
• Seq.IDI DNA sequence of the wild type of the "env” gene
• Seq.ID2 DNA sequence of the wild type of the "gag” gene
• the gp70 sequence is extended by the nucleotide sequence coding for the immunogenic protein p15.
• Seq.ID9 protein sequence of the mutagenized "env” gene (gp85) Seq.IDI 0 protein sequence of the mutagenized "env” gene (gp70)
• Seq.ID11 DNA sequence of the wild type of the "env" gene (gp70), taken from the Seq.IDI (NCBI database, Acc. No. M12500).
• the invention therefore provides a DNA expression construct for the expression of gene products of the Feline Leukose Virus (FeLV) in cat cells, consisting of a promoter sequence operable in Felides and at least one nucleotide sequence which is related to one for an original structural protein ("gag”) and / or Membrane protein (“env”) of the wild-type nucleotide sequence coding for FeLV, wherein said nucleotide sequence of the FeLV is changed and has no open or hidden splice donor and / or acceptor sequences and for one with the encodes the original structural protein ("gag") and / or the original membrane protein ("env”) of the FeLV highly homologous but not identical protein or a highly homologous but not identical part thereof.
• FeLV Feline Leukose Virus
• the proteins which are highly homologous but not identical to the original structural protein (“gag”) and / or the original membrane protein (“env”) of the FeLV, have a homology to the corresponding wild type of at least 98%.
• An expression construct containing the sequences Seq.lD ⁇ , Seq.lD7 and / or Seq.lD ⁇ is preferred.
• the expression construct is either a plasmid or such a construct, in which the immunizing polynucleotide sequences are present as expression constructs which consist of covalently closed linear deoxyribonucleic acid molecules which have a linear double-strand region and the double-strand-forming single strands terminate through short single-strand loops Deoxyribonucleic acid nucleotides are linked, and the double-strand-forming single strands only consist of the coding sequence under the control of a promoter operable in the animal to be vaccinated and a terminator sequence.
• the expression construct can be covalently linked to one or more peptides.
• Preferred is a peptide of 3 to 30 amino acids, at least half of which are basic amino acids from the group arginine and lysine, in particular a peptide with the amino acid sequence PKKKRKV (poly-lysine-lysine-lysine-arginine-lysine-valine).
• proteins which contain a protein (Seq.ID6) which is highly homologous with the original structural protein (“gag”) of the Feline leukosis virus (FeLV) or with the original membrane protein gp85 (“env”) of the FeLV (Seq. ID9) or with the original membrane protein gp70 ("env") of FeLV (Seq.IDI 0).
• These proteins in turn can be used for antibody production (monoclonal or polyclonal antibodies), which in turn are part of diagnostic kits for diagnosing infections feline leukemia virus in cats.
• the expression construct according to the invention is intended as a component of a medicament, in particular a vaccine, for generating a preventive and / or therapeutic immunity in felids, in particular in the cat.
• Lane 1 u. 2 Expression vectors coding for "gag” -WT.
• Lane 3 Expression vectors coding for codon-optimized "gag”
• Lane 4 uninfected cat cells
• negative control Lane 5 empty
• Lane 6 virus-infected cat cells
• Lane 7 Boa protein marker Expression by the WT leads to very weak protein bands (1 and 2), whereas strong expression is achieved by the sequence according to the invention (3).
• Infected cat cells are used for comparison (6).
• the "gag” denotes a precursor protein which is broken down in the infected cell with the help of proteases into structural proteins of the FeLV.
• the most immunogenic structural protein is the p27, which is therefore very well recognized by an antiserum against the whole virus explainable that in track 6 both a 55 kDa for the entire "gag" and a 27 kDa band can be seen.
• lane 3 contains no virus particles, but cells transfected with the "gag” gene, this obviously does not lead to the degradation of the "gag” gene into the virus proteins with the aid of proteases, but to the non-specific degradation of the entire precursor protein by cell-specific proteases.
• Fig.2 In vitro expression comparison of the WT "env” gene and the kodon u. splice signal optimized "env” sequence (gp85). Cat cell lysates which had previously been transfected with the following constructs are applied: Lane 1: Boa protein marker
• Lane 3 virus-infected cat cells, lysate, positive control Lane 4: empty
• Lane 5 virus-infected cat cells, precipitate, positive control
• Lane 8 empty Lane 9: expression vectors coding for codon and splice signal-optimized FeLVenvgp85 (splice) Lane 10: empty
• Lane 11 expression vectors coding for codon-optimized FeLVenvgp70 (splice).
• the control in lane 5 leads to a clear protein band which can be used as a positive control for the expression of envgp85.
• Lane 9 shows that the FeLVenvgp85 (splice) sequence according to the invention leads to expression of the gp85 protein.
• the FeL-Venvgp70 (splice) according to the invention is plotted.
• the absence of the 70kDa gang is based assures that the envgp70, in contrast to the gp85, is a secretory protein that is difficult or hardly detectable in the cell lysate.
• Fig. 4 DNA sequence comparison wild-type "gag” gene (Seq.lD2) vs.: codon-optimized "gag” gene (Seq.lD ⁇ ). Similarity level: 74.51%
• ⁇ Protein sequence comparison: wild type of the "env” protein (Seq.ID3) vs. protein sequence of the codon and splice signal optimized "env” protein (gp70) (Seq.IDI 0). Similarity level: 9 ⁇ , 75% Fig. 9: Protein sequence comparison: wild type of the "env” protein (Seq.lD3) vs. protein sequence of the codon and splice signal optimized "env” protein (gp ⁇ 5) (Seq.lD ⁇ ). Similarity level: 9 ⁇ .60%
• the wild-type sequences of the selected antigens were obtained from the blood of infected cats.
• the DNA sequence for “env” WT is in Seq. ID 1 (NCBI database, Acc. No.: M12500 ), for "gag” WT in Seq. ID 2.
• gag-mut1-meu (Seq.IDI 2):
• gag-mut2-l (Seq.IDI 3):
• gag-mut3-r SEQ.ID14
• Felvgag-I (Seq.IDI 6): CGGATAAGGTACCATGGGCCAAACTATAACTACC
• the codon usage table for cats was selected from the Codon Usage Database (http: //www.kazusa.or.ip/codon/). For each amino acid of the two WT sequences, the codon that most often codes for this amino acid was used. There were the following restrictions:
• the oligonucleotides were ordered with a length between 18 and 28 bases (Tip-Molbiol). A total of 51 oligonucleotides were linked together by annealing and ligation. The overhang was 4 bases. Care was taken to ensure that the overhangs occurred only once and were not palindromic.
• Each individual oligonucleotide was hybridized with strand and counter strand by heating the two individual oligonucleotides (strand and counter strand) with kinase buffer to about 80 ° C. and then slowly cooling to room temperature. Then ATP and polynucleotide kinase (PNK) were added and the oligonucleotides were phosphorylated for one hour.
• oligonucleotide 1 + 2, oligonucleotide 3 + 4 adjacent oligonucleotides were combined and ligated (oligonucleotide 1 + 2, oligonucleotide 3 + 4).
• an aliquot from the ligation batch of oligonucleotides 1 + 2 and an aliquot from the ligation batch 3 + 4 were taken and combined.
• An aliquot of the last ligation batch was taken and a PCR was carried out with flanking primers. If a PCR was obtained with the correct expected length, it was cloned into the TOPO vector pCR 2.1 with TA cloning and the sequence was checked. This was done analogously for the other fragments of the complete gene. 4 fragments were obtained.
• the individual fragments were excised from the intermediate cloned plasmid with Eco R1 and then ligated with Eco 311 after ligation.
• the entire ligation product of the correct length was digested with Barn HI and Sac I and cloned into the vector which had also been cut after gel extraction in pMCV1.4. The sequence was then checked by sequencing. The resulting plasmid was called pMCV1.4-FeLVenv.
• a signal sequence (leader sequence) was cloned in front of the codon-optimized "env” sequence.
• This signal sequence was produced from a total of ⁇ ODN, with a length between 22-30 bp, by annealing and ligation.
• a PCR for the amplification of the leader sequence was carried out from the last ligation step. Primer for the entire signal sequence:
• the ligation product was used in a PCR in which a recognition sequence for Kpnl at the 5 ⁇ end and one for Sacl at the 3 * end were generated.
• the entire "env" polyprotein consisting of gp70 and p15 was cloned.
• the p15 WT sequence was amplified by means of PCR from the plasmid pMCV1.4-FeLVenvp15 and behind the sequence of the above-mentioned.
• pMCV1.4-LeadFeLVenv cloned The entire "env" polyprotein consisting of gp70 and p15 was cloned.
• a Kpnl recognition sequence was generated at the 5 ' end and a Sacl recognition sequence at the 3 ⁇ end. After digestion of the PCR product with Kpnl and Sacl, this was ligated into the pMCV1.4 cut in the same way and cloned. The resulting plasmid was called pMCV1.4-LeadFeLVenvgp35.
• the DNA sequence of the LeadFeLVenv was checked at http://www.fruitfly.org/seg tools / splice.html for possible splice signal sequences (splice sites).
• a splice site was found between bases 100 and 140 with a 97% probability.
• the generation and cloning of the mutated sequence were carried out as follows:
• a fragment (1) consisting of bases 1 - 123 of the LeadsynFeLVenv was amplified by PCR.
• the forward primer used generates the recognition sequence of the restriction enzyme Kpnl at the 5 end of the PCR product.
• the PCR generates the recognition sequence of the restriction enzyme Eco31 l-site at the 3 ⁇ end of the PCR product. Basically, Eco31 I creates a 4 base ⁇ ' overhang of bases 2-5 downstream of the recognition sequence.
• the 4 base 5 overhang which arises after digestion of the PCR product with Eco311 at the 3 'end of fragment 1, corresponds to bases 120-123 of the sequence of
• LeadFeLVenv This sequence in turn corresponds to the overhang, which also stands when LeadFeLVenv is cut with the restriction enzyme BgLII, since the bases 119-124 of the LeadFeLVenv represent the recognition sequence of BgLII.
• Bases 1 -123 are thus first cut out of the construct pMCV1.4-LeadFeLVenv using Kpnl and BgLII.
• PCR product fragment 1 was ligated and cloned in the pMCV1.4-LeadFeLVenvgp ⁇ (splice) cut and purified with Kpnl and BgLII.
• the resulting plasmid was called pMCV1.4-FeLVenvgp ⁇ (splice).
• FeLVgag was cloned in accordance with the procedure described under 3.
• the sequence was generated using oligonucleotides that were first annealed and ligated into three individual fragments.
• the sequence was composed of a total of 2 x 31 oligonucleotides (forward and reverse strand).
• the fragments were used as templates in a PCR and amplified with the following primers:
• ⁇ left primer (Seq. ID36): ATTATGGTCTCTGCACCTGAGGCTGTACAGGC
• Feline cells of the f3201 cell line were made with the plasmids, pMCV1.4-FeLVenvgp ⁇ (splice), pMCV1.4-FeLVenvgp70 (splice), FeLVgag and the WT-containing plasmids pMOK for "env” and "gag” by electroporation at 2 ⁇ 0 V and 10 ⁇ O ⁇ F transfected.
• the plasmids pMCV1.4-FeLVenvgp ⁇ 5 (splice), pMCV1.4-FeLVenvgp70 (splice) and pMCV1.4-FeLVgag were completely digested with the restriction enzyme Eco31 l overnight at 37 ° C.
• the restriction digestion generated two DNA ⁇ fragments.
• One consisted of the kanamycin resistance gene and other sequences necessary for the propagation of the plasmid in bacteria.
• the other fragment consisted of the sequences which were to become part of the Midge DNA: enhanced CMV promoter, chimeric intron, the corresponding gene sequence and the polyadenylation sequence from SV 40.
• the ⁇ 'phosphorylated hairpin-shaped oligodeoxynucleo were isolated using the enzyme T4-0 DNA ligase - tide (TIBMolBiol, Berlin) 5 '-PH- GGGAGTCCAGT xT TTCTGGAC -3' and 5 'PH- AGG GGT CCA GTT TTC TGG AC-3' in the presence of the restriction enzyme Eco31 I overnight at 37 ° C to which the midge DNA-forming DNA fragment ligated. The reaction was stopped by heating to 70 ° C. The resulting mixture 5 of nucleic acids was treated with the enzyme T7 DNA polymerase. The midge DNA was purified by anion exchange chromatography and precipitated with isopropanol (cf. EP 0 941 318 B1)
• the NLS peptide PKKKRKV was coupled to the ODN in two steps.
• the modified oligonucleotide 5'-PH-d (GGGAGTCCAGT xT TTCTGGAC, where xT amine-modified thymine base denotes C 2 - amino linker) (0.1 mM) was activated with sulfo-KMUS (5mM) in PBS at room temperature (RT). After 120 min.
• the cats of the first two groups are immunized twice with a total amount of 600 ⁇ g DNA, dissolved in PBS buffer.
• the peptide-linked expression constructs are administered by intradermal injection in the neck.
• the immune response is monitored over a period of 12 weeks.
• the second immunization takes place in week 4.
• IL-4 was used as an indicator of TH2; IL-2 and interferon-gamma determined as an indicator of a predominantly TH1-directed immune response.
• the vaccine Leucogen contains recombinant "env" protein and is used as a positive control.
• Antibodies against the antigens used were determined using Westemblot and ELISA methods.
• the amount of mRNA of the cytokines IL-2, IL-4 and interferon-gamma was determined using real-time PCR methods.
• Example 10b in vivo results after immunization of cats according to the vaccination regime described in Table 2.
• the strength of the bands represent the concentration of the antibodies in the plasma of the immunized cats.
• Cats are considered protected if they have no virus particles in the serum (seronegative cats) and no virus DNA in their blood cells.
• the cat serum was tested for the presence of the p27 antigen by means of ELISA.
• the amount of integrated virus DNA, the so-called provirus DNA was checked using a Taqman PCR method. The following vaccination regime has been formulated:
• PBS buffer was used as a negative control.
• Table 4 shows the results of the serum examination of the cats for the presence of the viral protein p27. This test is a generally accepted one Test to diagnose FeLV viremia. In parallel, white blood cells from the same cats were tested for the presence of proviral DNA (data not shown). All virus protein-free cats were also free of Proviraler DNA.
• control group All animals in group 1 (control group) showed virus particles in the blood, i.e. they were not protected and fully susceptible to the stress infection.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Virology (AREA)
• Medicinal Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Molecular Biology (AREA)
• Animal Behavior & Ethology (AREA)
• Biochemistry (AREA)
• General Chemical & Material Sciences (AREA)
• Pharmacology & Pharmacy (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Oncology (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Gastroenterology & Hepatology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Biophysics (AREA)
• Genetics & Genomics (AREA)
• Communicable Diseases (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
• Peptides Or Proteins (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Priority Applications (6)

Applications Claiming Priority (2)

Publications (2)

Family

ID=32038184

Family Applications (1)

Country Status (9)

Cited By (3)

Families Citing this family (3)

Family Cites Families (8)

• 2003
  • 2003-09-19 DE DE50304603T patent/DE50304603D1/de not_active Expired - Lifetime
  • 2003-09-19 DK DK03773451T patent/DK1553977T3/da active
  • 2003-09-19 EP EP03773451A patent/EP1553977B1/de not_active Expired - Lifetime
  • 2003-09-19 AT AT03773451T patent/ATE335507T1/de active
  • 2003-09-19 WO PCT/DE2003/003179 patent/WO2004028562A2/de not_active Ceased
  • 2003-09-19 ES ES03773451T patent/ES2270120T3/es not_active Expired - Lifetime
  • 2003-09-19 JP JP2004538747A patent/JP4411213B2/ja not_active Expired - Fee Related
  • 2003-09-19 DE DE10393824T patent/DE10393824D2/de not_active Expired - Fee Related
  • 2003-09-19 AU AU2003281917A patent/AU2003281917A1/en not_active Abandoned
  • 2003-09-23 US US10/528,748 patent/US7915035B2/en not_active Expired - Fee Related

Also Published As

Similar Documents

Legal Events