WO2003064606A2 - Human monoclonal antibodies to prostate specific membrane antigen (psma) - Google Patents

Human monoclonal antibodies to prostate specific membrane antigen (psma) Download PDF

Info

Publication number
WO2003064606A2
WO2003064606A2 PCT/US2003/002448 US0302448W WO03064606A2 WO 2003064606 A2 WO2003064606 A2 WO 2003064606A2 US 0302448 W US0302448 W US 0302448W WO 03064606 A2 WO03064606 A2 WO 03064606A2
Authority
WO
WIPO (PCT)
Prior art keywords
human
antibody
psma
cells
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2003/002448
Other languages
English (en)
French (fr)
Other versions
WO2003064606A3 (en
Inventor
Yashwant M. Deo
Robert Graziano
Debra Hudson
Eric H. Holmes
William T. Tino
Amelia Black
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
ER Squibb and Sons LLC
Original Assignee
Medarex LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA002474616A priority Critical patent/CA2474616A1/en
Priority to NZ534687A priority patent/NZ534687A/en
Priority to MXPA04007262A priority patent/MXPA04007262A/es
Priority to JP2003564202A priority patent/JP2005518789A/ja
Priority to KR10-2004-7011643A priority patent/KR20040077889A/ko
Priority to AU2003224604A priority patent/AU2003224604B2/en
Application filed by Medarex LLC filed Critical Medarex LLC
Priority to BR0307216-9A priority patent/BR0307216A/pt
Priority to EP03721280A priority patent/EP1519747A4/en
Publication of WO2003064606A2 publication Critical patent/WO2003064606A2/en
Anticipated expiration legal-status Critical
Publication of WO2003064606A3 publication Critical patent/WO2003064606A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3069Reproductive system, e.g. ovaria, uterus, testes, prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/08Drugs for disorders of the urinary system of the prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/10Drugs for disorders of the urinary system of the bladder
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/283Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against Fc-receptors, e.g. CD16, CD32, CD64
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/54F(ab')2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/732Antibody-dependent cellular cytotoxicity [ADCC]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/77Internalization into the cell

Definitions

  • Prostate cancer is a leading cause of morbidity and mortality among men. Treatments for prostate cancer include surgery, hormones, radiation, and chemotherapy. There is little effective treatment for metastatic prostate disease. Therefore, the identification of genes and/or gene products that represent diagnostic and prognostic markers, as well as targets for therapy, is critical.
  • Prostate specific antigen PSA is one such cancer marker which is useful in the clinical diagnosis and staging of prostate cancer.
  • PSA cannot differentiate benign prostatic hype ⁇ lasia (BPH) from prostatitis or prostate cancer in the range of 4-10 ng/ml, thus, necessitating a cytologic and/or histologic assessment to confirm the proper diagnosis (Barren, RJ. et al. (1998) Prostate 36:181-188).
  • PSMA Prostate specific membrane antigen
  • PSMA is a 750 amino acid, type II transmembrane glycoprotein of approximately 110 kD that has 54% homology to the transferrin receptor.
  • PSMA has 3 structural domains, including a 19 amino acid intracellular domain, a 24 amino acid transmembrane domain, and a 707 amino acid extracellular domain.
  • the PSMA protein displays neurocarboxypeptidase and folate hydrolase activity and is reported to be involved in the neuroendocrine regulation of prostate growth and differentiation (Heston, W.D. (1996) Urologe-Ausgabe A. 35:400- 407).
  • PSM' is an alternatively spliced form of PSMA which is localized in the cytoplasm. PSMA is predominantly expressed by prostatic epithelial cells.
  • PSMA prostate cancer
  • Low level expression of PSMA is observed in extraprostatic tissues such as the small bowel, salivary gland, duodenal mucosa, proximal renal tubules, and brain (Silver, D.A. (1997) Clinical Cancer Research 3:81-85).
  • PSMA is also expressed in endothelial cells of capillary vessels in peritumoral and endotumoral areas of certain malignancies, including renal cell carcinomas, and colon carcinomas, but not in blood vessels from normal tissues.
  • PSMA is reported to be related to tumor angiogenesis (Silver, D.A. (1997) Clinical Cancer Research 3:81-85).
  • PSMA represents a valuable target for the treatment of prostate cancer and a variety of other diseases characterized by PSMA expression.
  • the present invention provides isolated human monoclonal antibodies which bind to human Prostate Specific Membrane Antigen (PSMA), as well as immunoconjugates, bispecific molecules, and other therapeutic compositions containing such antibodies, alone or in combination with additional therapeutic agents.
  • PSMA Prostate Specific Membrane Antigen
  • human antibodies of the present invention bind to a native protein epitope on human PSMA (e.g., an epitope located in the extracellular domain of human PSMA) and inhibit the growth and/or mediate killing of cells which express PSMA (e.g., via lysis or phagocytosis) in the presence of human effector cells, e.g., polymo ⁇ honuclear cells, monocytes, macrophages, and dendritic cells.
  • the antibodies can be used in a variety of methods for diagnosing, treating, and/or preventing diseases related to the expression of PSMA, particularly PSMA-expressing tumors and cancers, such as prostate cancer, colon cancer, and renal carcinoma.
  • Isolated human antibodies of the invention include a variety of antibody isotypes, such as IgGl, (e.g., IgGlk), IgG2, IgG3, IgG4, IgM, IgAl, IgA2, IgAsec, IgD, and IgE.
  • the antibodies can be full-length antibodies (e.g., IgGl or IgG3) or can include only an antigen-binding portion (e.g., a Fab, F(ab')2, Fv, or a single chain Fv fragment).
  • Particular therapeutic antibodies of the invention include human monoclonal antibody (HuMAb) 4A3, 7F12, 8A11, 8C12, 16F9, and functionally equivalent antibodies which, for example, (a) are encoded by human heavy chain and human light chain nucleic acids comprising nucleotide sequences in their variable regions as set forth in SEQ ID NOs: 1, 3, 5, 7 or 9 and SEQ ID NOs: 2, 4, 6, 8, or 10, respectively, and conservative modifications thereof, and/or (b) include heavy chain and light chain variable regions which comprise the amino acid sequence as set forth in SEQ ID NOs: 11, 12, 13, 14, or 15, and SEQ ID NOs:16, 17, 18, 19, or 20, respectively, and conservative modifications thereof.
  • Still other particular human antibodies of the invention include those which comprise a CDR domain having a human heavy and light chain CDRl region, a human heavy and light chain CDR2 region, and a human heavy and light chain CDR3 region, wherein
  • the CDRl , CDR2, and CDR3 of the human heavy chain regions comprise an amino acid sequence selected from the group consisting of the amino acid sequences of the CDRl, CDR2, and CDR3 regions shown in Figure 19 (SEQ ID NOs:21-35), and conservative sequence modifications thereof, and
  • the CDRl, CDR2, and CDR3 of the human light chain regions comprise an amino acid sequence selected from the group consisting of the amino acid sequences of the CDRl, CDR2, and CDR3 regions shown in Figures 22 and 23 (SEQ ID NOs:36-50), and conservative sequence modifications thereof.
  • antibodies of the invention include human monoclonal antibodies which bind to an epitope defined by antibody 4A3, 7F12, 8A1 1, 8C12, or 16F9, and/or which compete for binding to PSMA with antibody 4A3, 7F12, 8A11, 8C12, or 16F9, or which have other functional binding characteristics exhibited by antibody 4A3, 7F12, 8A11, 8C12, or 16F9.
  • Such antibodies include, for example, those which bind to PSMA with a dissociation constant (K D ) of 10 " M or less, such as of 10 ' M or less, 10 "9 M or less, 10 "10 M or less, or even lower (e.g., 10- 11 M or less).
  • Such antibodies further include those which cross react with murine anti-PSMA antibody 3C6 (ATCC Accession Number HB 12491), but exhibit no cross reactivity with murine anti- PSMA antibodies 4D4 (ATCC Accession Number HB 12493) or 1G9 (ATCC Accession Number HB 12495).
  • the human anti-PSMA antibodies are derivatized, linked to or co-expressed with another functional molecule, e.g., another peptide or protein (e.g., an Fab' fragment).
  • an antibody or antigen-binding portion of the invention can be functionally linked (e.g., by chemical coupling, genetic fusion, noncovalent association or otherwise) to one or more other molecular entities, such as another antibody (e.g., to produce a bispecific or a multispecif ⁇ c antibody), a cytotoxin, a cellular ligand or an antigen.
  • another antibody e.g., to produce a bispecific or a multispecif ⁇ c antibody
  • cytotoxin e.g., to produce a bispecific or a multispecif ⁇ c antibody
  • cytotoxin e.g., to produce a bispecific or a multispecif ⁇ c antibody
  • a cytotoxin e.g., to produce a bispecific or a multispecif ⁇ c antibody
  • cytotoxin e.g., to produce a bispecific or a multispecif ⁇ c antibody
  • cellular ligand or an antigen e.g., to produce
  • the invention includes a bispecific or multispecific molecule comprising at least one binding specificity for PSMA which is a human anti-PSMA antibody (or fragment or mimetic thereof), and a second binding specificity for an Fc receptor, e.g. , human Fc ⁇ RI or a human Fc ⁇ receptor, or another antigen on an antigen presenting cell (APC).
  • PSMA which is a human anti-PSMA antibody (or fragment or mimetic thereof)
  • Fc receptor e.g. , human Fc ⁇ RI or a human Fc ⁇ receptor
  • APC antigen presenting cell
  • the second binding specificity can also be an antibody or fragment thereof (e.g., an Fab, Fab', F(ab')2, F y > or a single chain Fv), such as a human antibody or a portion thereof, or a "chimeric” or a "humanized” antibody or a portion thereof (e.g., has a variable region, or at least a complementarity determining region (CDR), derived from a nonhuman antibody (e.g., murine) with the remaining portion(s) being human in origin).
  • an antibody or fragment thereof e.g., an Fab, Fab', F(ab')2, F y > or a single chain Fv
  • a human antibody or a portion thereof or a "chimeric” or a "humanized” antibody or a portion thereof (e.g., has a variable region, or at least a complementarity determining region (CDR), derived from a nonhuman antibody (e.g., murine) with the remaining portion(s
  • the present invention includes bispecific and multispecific molecules that bind to both human PSMA and to an Fc receptor, e.g., a human IgG receptor, e.g., an Fc-gamma receptor (Fc ⁇ R), such as Fc ⁇ RI (CD64), Fc ⁇ RII (CD32), and Fc ⁇ RIII (CD 16).
  • Fc receptors e.g., a human IgG receptor, e.g., an Fc-gamma receptor (Fc ⁇ R), such as Fc ⁇ RI (CD64), Fc ⁇ RII (CD32), and Fc ⁇ RIII (CD 16).
  • Fc receptors such as human IgA receptors (e.g. Fc ⁇ RI)
  • the Fc receptor is preferably located on the surface of an effector cell, e.g., a monocyte, macrophage or an activated polymo ⁇ honuclear cell.
  • the bispecific and multispecific molecules bind to an Fc receptor at a site which is distinct from the immunoglobulin Fc (e.g., IgG or IgA) binding site of the receptor. Therefore, the binding of the bispecific and multispecific molecules is not blocked by physiological levels of immunoglobulins.
  • the present invention provides an immunoconjugate, e.g., an immunotoxin, which includes a fully human anti-PSMA antibody conjugated to a therapeutic agent, e.g., a cytotoxic drug, an enzymatically active toxin, or a fragment thereof, a radioisotope, or a small molecule anti-cancer drug.
  • human antibodies of the invention can be co-administered with such therapeutic and cytotoxic agents, but not linked to them. They can be coadministered simultaneously with such agents (e.g., in a single composition or separately) or can be administered before or after administration of such agents.
  • agents can include chemotherapeutic agents, such as doxorubicin (adriamycin), cisplatin bleomycin sulfate, carmustine, chlorambucil, cyclophosphamide hydroxyurea and combinations thereof.
  • Human antibodies of the invention also can be administered in conjunction with radiation therapy.
  • the present invention provides compositions, e.g., pharmaceutical and diagnostic compositions/kits, comprising a pharmaceutically acceptable carrier and at least one human anti-PSMA antibody, or an antigen-binding portion thereof.
  • the composition comprises a combination of human antibodies or antigen-binding portions thereof, preferably each of which binds to a distinct epitope.
  • a pharmaceutical composition comprising a human monoclonal antibody that mediates highly effective killing of target cells in the presence of effector cells can be combined with another human monoclonal antibody that inhibits the growth of cells expressing PSMA.
  • the combination provides multiple therapies tailored to provide the maximum therapeutic benefit.
  • Compositions e.g., pharmaceutical compositions, comprising a combination of at least one human anti- PSMA antibody, or antigen-binding portion thereof, and at least one bispecific or multispecific molecule of the invention, are also within the scope of the invention.
  • the present invention provides a method for inhibiting the proliferation and/or growth of a cell expressing PSMA, and/or inducing killing of a cell expressing PSMA, by contacting the cells with (e.g., administering to a subject) one or more human antibodies of the invention and/or related therapeutic compositions, derivatives etc. containing the antibodies as described above.
  • the method comprises contacting cells expressing PSMA either in vitro or in vivo with one or a combination of human anti-PSMA antibodies of the invention in the presence of a human effector cell.
  • the method can be employed in culture, e.g. in vitro or ex vivo (e.g., cultures comprising cells expressing PSMA and effector cells).
  • a sample containing cells expressing PSMA and effector cells can be cultured in vitro, and combined with an antibody of the invention.
  • the method can be performed in a subject, e.g., as part of an in vivo (e.g., therapeutic or prophylactic) protocol.
  • human antibodies of the present invention are administered to patients (e.g., human subjects) at therapeutically effective dosages (e.g., to inhibit, eliminate or prevent growth of cells expressing PSMA) using any suitable route of administration for antibody-based clinical products as are well known in the art, such as by injection or infusion.
  • human antibodies of the present invention can be used to treat and/or prevent a variety of diseases characterized by PSMA expression by administering a suitable dosage (or series of dosages) of the antibodies to patients suffering from such diseases.
  • exemplary diseases that can be treated (e.g., ameliorated) or prevented using the methods and compositions of the invention include, but are not limited to, cancers, such as prostate cancer, colon cancer, and renal carcinoma.
  • the patient can be additionally treated with a chemotherapeutic agent, radiation, or an agent that modulates, e.g., enhances, the expression or activity of an Fc receptor, e.g., an Fc ⁇ receptor or an Fc ⁇ receptor, such as a cytokine.
  • Typical cytokines for administration during treatment include granulocyte colony-stimulating factor (G-CSF), granulocyte- macrophage colony-stimulating factor (GM-CSF), interferon- ⁇ (IFN- ⁇ ), and tumor necrosis factor (TNF).
  • Typical therapeutic agents include, among others, anti-neoplastic agents such as doxorubicin (adriamycin), cisplatin bleomycin sulfate, carmustine, chlorambucil, and cyclophosphamide hydroxyurea.
  • the present invention provides a method for detecting in vitro or in vivo the presence of PSMA or PSMA expressing cells, e.g., for diagnosing a PSMA-related disease.
  • This can be achieved by, for example, contacting a sample to be tested, optionally along with a control sample, with a human monoclonal antibody of the invention (or an antigen-binding portion thereof) under conditions that allow for formation of a complex between the antibody and PSMA.
  • Complex formation is then detected (e.g., using an ELISA).
  • complex is detected in both samples and any statistically significant difference in the formation of complexes between the samples is indicative of the presence of PSMA in the test sample.
  • the present invention provides a transgenic nonhuman animal, such as a transgenic mouse (also referred to herein as a "HuMAb mouse"), which expresses a fully human monoclonal antibody that binds to PSMA.
  • a transgenic nonhuman animal is a transgenic mouse having a genome comprising a human heavy chain transgene and a human light chain transgene encoding all or a portion of an anti-PSMA antibody of the invention.
  • the transgenic nonhuman animal can be immunized with a purified or enriched preparation of PSMA antigen and/or cells expressing PSMA.
  • the transgenic nonhuman animal e.g., the transgenic mouse
  • the transgenic nonhuman animal is capable of producing multiple isotypes of human monoclonal antibodies to PSMA (e.g., IgG, IgA and/or IgM) by undergoing V-D-J recombination and isotype switching.
  • Isotype switching may occur by, e.g., classical or non-classical isotype switching.
  • the invention provides isolated B- cells derived from a transgenic nonhuman animal as described above, e.g., a transgenic mouse, which express human anti-PSMA antibodies.
  • the isolated B-cells can then be immortalized to by fusion to an immortalized cell to provide a source (e.g. , a hybridoma) of human anti-PSMA antibodies.
  • a source e.g. , a hybridoma
  • hybridomas /. e. , which produce human anti-PSMA antibodies
  • human anti-PSMA antibodies can be obtained directly from hybridomas which express the antibody, or can be cloned and recombinantly expressed in a host cell, such as a transfectoma (e.g. , a transfectoma consisting of immortalized CHO cells or lymphocytic cells). Accordingly, the present invention provides methods for producing human monoclonal antibodies which bind to human PSMA.
  • a transfectoma e.g. , a transfectoma consisting of immortalized CHO cells or lymphocytic cells.
  • the method includes immunizing a transgenic nonhuman animal, e.g., a transgenic mouse, as previously described (e.g., having a genome comprising a human heavy chain transgene and a human light chain transgene encoding all or a portion of an anti-PSMA antibody), with a purified or enriched preparation of human PSMA antigen and/or cells expressing human PSMA.
  • B cells e.g., splenic B cells
  • myeloma cells to form immortal, hybridoma cells that secrete human monoclonal antibodies against PSMA.
  • the invention provides nucleic acid molecules encoding all or a portion of a human monoclonal anti-PSMA antibody (e.g., which encode at least one light or heavy chain of the antibody), as well as recombinant expression vectors which include such nucleic acids, and host cells transfected with such vectors. Methods of producing the antibodies by culturing such host cells are also encompassed by the invention.
  • nucleic acids provided by the invention comprise the nucleotide sequences shown in SEQ ID NOs:l, 3, 5, 7, or 9 and SEQ ID NOs:2, 4, 6, 8, or 10, which encode the heavy and light chains, respectively, of human anti-PSMA antibodies (HuMAbs) 4A3, 7F12, 8A11, 8C12, and 16F9.
  • Figure I is a bar graph showing the reactivity (solid phase ELISA) of HuMAb 11 CI 0 with full length PSMA and bacterially expressed fusion proteins containing PSMA fragments corresponding to amino acids 1-173, 134-437, and 438- 750.
  • the assays were conducted using the murine 7E11 antibody as a control.
  • Figure 2 is a graph showing the reactivity (solid phase ELISA) of human anti-PSMA monoclonal antibodies with membrane fractions from human prostatic adenocarcinoma LNCaP and PC3 cells. Background absorbance at 405 nm was 0.05.
  • Figure 3 is a bar graph showing the effect of heat denaturation of isolated PSMA on antibody binding.
  • Purified PSMA with and without heat denaturation, was coated onto 96-well plates and treated with the indicated antibodies. Bound antibody was detected by ELISA.
  • Figure 4 shows immunoprecipitation of PSMA from LNCaP cell detergent lysates using HuMAbs. Immunoprecipitated protein was separated by SDS gel electrophoresis, blotted onto PVDF membranes, and probed with the murine anti- PSMA 4D8 antibody (lanes 2-7). Lane 1 shows total LNCaP cell lysate. Lanes 2-7 show immunoprecipitation with the following antibodies, respectively: irrelevant human IgGl, 4A3, 7F12, 8A11, 8C12 and 16F9. The positions of PSMA and PSM' are indicated by arrows.
  • Figure 5 shows graphs measuring the antibody dependent cellular cytotoxicity (ADCC) response of HuMAbs 4A3, 7F12, 8A11, 8C12, and 16F9 using LNCaP cell targets with PBMC's from two donors (Panels A and B), each at an E:T ratio of 100:1.
  • ADCC antibody dependent cellular cytotoxicity
  • Figure 6 shows a fully human bispecific molecule, 14A8 x 8C12, which binds to CD89 (FcccR) and to PSMA.
  • the molecule contains an anti-CD89 F ab' antibody fragment (derived from human monoclonal anti-CD89 antibody, 14A8) chemically linked by disulfide bond to an anti-PSMA F ab' antibody fragment (derived from human monoclonal anti-PSMA antibody, 8C12).
  • Panel A is a graph showing monocyte-mediated antibody dependent cell cytotoxicity (ADCC) of PSMA-expressing cells via the 14A8 x 8C12 bispecific molecule shown in Figure 6 as a function bispecific molecule concentration. Results were measured as a percent of specific cell lysis using no added inhibitor, 50 ⁇ g/ml free anti-FcR ⁇ R (14A8) F(ab')2 and 50 ⁇ g/ml free anti-Fc ⁇ RI (H22) F(ab')2; Panel B is a graph showing monocyte-mediated antibody dependent cell cytotoxicity (ADCC) of LNCaP cells via the bispecific molecule 14A8 x 8C12 and monoclonal antibody 8C 12 at an effector:target ratio of 100:1; Panel C is a graph showing monocyte-mediated antibody dependent cell cytotoxicity (ADCC) of LNCaP cells via the 14A8 x 8C12 bispecific molecule in the absence of inhibitor, or in the presence of excess amounts of 14A8 F(ab')2 or
  • Panel A is a graph showing neutrophil-mediated antibody dependent cell cytotoxicity (ADCC) of PSMA-expressing cells via the 14A8 x 8C12 bispecific molecule shown in Figure 6 as a function bispecific molecule concentration. Results were measured as a percent of specific cell lysis using no added inhibitor, 25 ⁇ g/ml free anti-FcR ⁇ R (14A8) F(ab')2 and 25 ⁇ g/ml free anti-Fc ⁇ RI (H22) F(ab')2; Panel B is a graph showing neutrophil-mediated antibody dependent cell cytotoxicity (ADCC) of LNCaP cells via the 14A8 x 8C12 bispecific molecule in the absence of inhibitor, or in the presence of excess amounts of 14A8 F(ab')2 or H22 F(ab')2, and at an effector :target ratio of 200: 1.
  • ADCC neutrophil-mediated antibody dependent cell cytotoxicity
  • Panel A is a graph showing whole blood-mediated antibody dependent cell cytotoxicity (ADCC) of PSMA-expressing cells via the 14A8 x 8C12 bispecific molecule shown in Figure 6 as a function bispecific molecule concentration. Results were measured as a percent of specific cell lysis using no added inhibitor, 25 ⁇ g/ml free anti-FcR ⁇ R (14A8) F(ab')2 and 25 ⁇ g/ml free anti-Fc ⁇ RI (H22) F(ab')2; Panel B is a graph showing whole blood-mediated antibody dependent cell cytotoxicity (ADCC) of LNCaP cells via the 14A8 x 8C12 bispecific molecule in the absence of inhibitor, or in the presence of excess amounts of 14A8 F(ab')2 or H22 F(ab')2.
  • ADCC whole blood-mediated antibody dependent cell cytotoxicity
  • Figure 10 is a graph showing bispecific molecule (14A8 x 8C12) - mediated phagocytosis of PSMA expressing (LNCaP) cells by monocyte derived macrophages (MDM) (circles). Results were measured as a percent of phagocytosis both in the presence and absence of excess 14A8 antibody as an inhibitor (squares) and H22 antibody as a control (diamonds).
  • Figure 11 is a graph showing bispecific molecule (14A8 x 8C12)- mediated phagocytosis and antibody (8C12)- mediated phagocytosis of LNCaP tumor cells by monocyte derived macrophages (MDM).
  • Figure 12 is a graph showing bispecific molecule (14A8 x 8C12)- mediated phagocytosis of LNCaP tumor cells by monocyte derived macrophages (MDM) (circles).
  • the inset is a graph showing phagocytosis mediated by the 14A8 x 8C12 bispecific molecule (1 ⁇ g/ml) in the presence of excess 14A8 F(ab')2 or H22 F(ab')2 .
  • Figure ii is a bar graph showing the biodistribution of I-4A3 in nude mice with LNCaP cell tumors. Animals were injected with lOO ⁇ g of 125 I-4A3 through the tail vein and sacrificed at 0.25 and 24 hours after injection. The amount of radioactivity present in each tissue was determined. The data shows results from duplicate animals at each time point.
  • Figure 14 is a graph showing the internalization and processing of I- labeled HuMAb by LNCaP cells in culture.
  • LNCaP cells were labeled with iodinated antibody, washed extensively, and the amount of cell surface bound label internalized and converted to TCA soluble products was determined at the indicated times. Results are shown for three HuMAbs that retained antigen binding properties after iodination, as well as irrelevant human IgG] as a negative control.
  • Figure 15 is a graph showing the effect of iodination with I on the antigen binding ability of certain anti-PSMA HuMAbs. The results show the amount of 125 I-labeled HuMAb bound to immobilized native purified LNCaP PSMA, as a function of the dilution factor of the antibody.
  • Figure 16 include graphs showing the effect of DOTA-labeling on the antigen binding ability of certain anti-PSMA HuMAbs. The results show the amount of DOTA-labeled HuMAb, or unco ⁇ jugated antibody, bound to PSMA, as measured by ELISA, as a function of the titration of the amount of antibody (in ⁇ g/ml).
  • Figure 17 A and B shows the nucleotide sequence sequences of the V H - and V L -regions, respectively, from each HuMAb 4A3, 7F12, 8C12, 8A11, and 16F9.
  • Figure 18 is an alignment comparison of the nucleotide sequence of the heavy chain V regions of HuMAbs 4A3, 7F12, 8A11, 8C12, 16F9, and the corresponding chain V region of the germline nucleotide sequence.
  • Figure 19 is an alignment comparison of the amino acid sequence of the heavy chain V region of HuMAbs 4A3, 7F12, 8A11, 8C12, 16F9, and the corresponding chain V region of the germline amino acid sequence.
  • Figure 20 is an alignment comparison of the nucleotide sequence of the light (kappa) chain V region of HuMAbs 4 A3, 7F12, 8C12, and the corresponding chain V region of the germline nucleotide sequence.
  • Figure 21 is an alignment comparison of the nucleotide sequence of the light (kappa) chain V region of HuMAbs 8A11, 16F9, and the corresponding chain V region of the germline nucleotide sequence.
  • Figure 22 is an alignment comparison of the amino acid sequence of the light (kappa) chain V region of HuMAbs 4A3, 7F12, 8C12, and the corresponding chain V region of the germline amino acid sequence.
  • Figure 23 is an alignment comparison of the amino acid sequence of the light (kappa) chain V region of HuMAbs 8A11, 16F9, and the corresponding chain V region of the germline amino acid sequence.
  • the present invention provides novel antibody-based therapies for treating and diagnosing diseases characterized by expression of Prostate Specific Membrane Antigen (referred to herein as "PSMA").
  • PSMA Prostate Specific Membrane Antigen
  • Therapies of the invention employ isolated human monoclonal antibodies and/or related compositions containing the antibodies which bind to an epitope present on PSMA.
  • the human antibodies are produced in a nonhuman transgenic animal, e.g., a transgenic mouse, capable of producing multiple isotypes of human monoclonal antibodies to PSMA (e.g. , IgG, IgA and/or IgE) by undergoing V-D-J recombination and isotype switching.
  • aspects of the invention include not only antibodies, antibody fragments, and pharmaceutical compositions thereof, but also nonhuman transgenic animals, B-cells and hybridomas which produce monoclonal antibodies.
  • Methods of using the antibodies of the invention to detect a cell expressing PSMA, or to inhibit growth, differentiation and or motility of a cell expressing PSMA, either in vitro or in vivo, axe also encompassed by the invention.
  • certain terms are first defined. Additional definitions are set forth throughout the detailed description.
  • human antibodies of the invention may, in certain cases, cross-react with PSMA from species other than human, or other proteins which are structurally related to human PSMA (e.g., human PSMA homologs). In other cases, the antibodies may be completely specific for human PSMA and not exhibit species or other types of cross-reactivity.
  • the term "inhibits growth" is intended to include any measurable decrease in the growth of a cell when contacted with an anti-PSMA antibody as compared to the growth of the same cell not in contact with an anti-PSMA antibody, e.g., the inhibition of growth of a cell by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99%, or 100%.
  • antibody as referred to herein includes whole antibodies and any antigen binding fragment (i.e., "antigen-binding portion") or single chain thereof.
  • An “antibody” refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds, or an antigen binding portion thereof.
  • Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as V H ) and a heavy chain constant region.
  • the heavy chain constant region is comprised of three domains, C HI , C H2 and C H3 -
  • Each light chain is comprised of a light chain variable region (abbreviated herein as V L ) and a light chain constant region.
  • the light chain constant region is comprised of one domain, C -
  • CDR complementarity determining regions
  • FR framework regions
  • Each V H and V L is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDRl, FR2, CDR2, FR3, CDR3, FR4.
  • the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
  • the constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
  • the term "antigen-binding portion" of an antibody refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., PSMA). It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody.
  • binding fragments encompassed within the term "antigen- binding portion" of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the V L , V H , C L and C HI domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the V H and C HI domains; (iv) a Fv fragment consisting of the VL and V H domains of a single arm of an antibody, (v) a dAb fragment (Ward et al, (1989) Nature 341_: 544-546), which consists of a V H domain; and (vi) an isolated complementarity determining region (CDR).
  • a Fab fragment a monovalent fragment consisting of the V L , V H , C L and C HI domains
  • F(ab')2 fragment a bivalent fragment comprising two
  • V L and V H are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the V L and V H regions pair to form monovalent molecules
  • single chain Fv single chain Fv
  • scFv single chain Fv
  • antigen-binding portion of an antibody
  • epitope means a protein determinant capable of specific binding to an antibody.
  • Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics.
  • Conformational and nonconformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents.
  • non-native conformational epitope or “native protein epitope” are used interchangeably herein, and include protein epitopes resulting from conformational folding of the PSMA molecule which arise when amino acids from differing portions of the linear sequence of the PSMA molecule come together in close proximity in 3- dimensional space. Such conformational epitopes are distributed on the extracellular side of the plasma membrane.
  • bispecific molecule is intended to include any agent, e.g. , a protein, peptide, or protein or peptide complex, which has two different binding specificities. For example, the molecule may bind to, or interact with, (a) a cell surface antigen and (b) an Fc receptor on the surface of an effector cell.
  • multispecific molecule or “heterospecific molecule” is intended to include any agent, e.g., a protein, peptide, or protein or peptide complex, which has more than two different binding specificities.
  • the molecule may bind to, or interact with, (a) a cell surface antigen, (b) an Fc receptor on the surface of an effector cell, and (c) at least one other component.
  • the invention includes, but is not limited to, bispecific, trispecific, tetraspecific, and other multispecific molecules which are directed to cell surface antigens, such as PSMA, and to other targets, such as Fc receptors on effector cells.
  • bispecific antibodies also includes diabodies.
  • Diabodies are bivalent, bispecific antibodies in which the V H and V L domains are expressed on a single polypeptide chain, but using a linker that is too short to allow for pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain and creating two antigen binding sites (see e.g., Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, R.J., et al. (1994) Structure 2:1121-1123).
  • the term “human antibody derivatives” refers to any modified form of the antibody, e.g., a conjugate of the antibody and another agent or antibody.
  • a human antibody is "derived from” a particular germline sequence if the antibody is obtained from a system using human immunoglobulin sequences, e.g., by immunizing a transgenic mouse carrying human immunoglobulin genes or by screening a human immunoglobulin gene library.
  • a human antibody that is "derived from” a human germline immunoglobulin sequence can be identified as such by comparing the amino acid sequence of the human antibody to the amino acid sequence of human germline immunoglobulins.
  • a selected human antibody typically is at least 90% identical in amino acids sequence to an amino acid sequence encoded by a human germline immunoglobulin gene and contains amino acid residues that identify the human antibody as being human when compared to the germline immunoglobulin amino acid sequences of other species (e.g., murine germline sequences).
  • a human antibody may be at least 95%, or even at least 96%, 97%, 98%, or 99% identical in amino acid sequence to the amino acid sequence encoded by the germline immunoglobulin gene.
  • a human antibody derived from a particular human germline sequence will display no more than 10 amino acid differences from the amino acid sequence encoded by the human germline immunoglobulin gene.
  • the human antibody may display no more than 5, or even no more than 4, 3, 2, or 1 amino acid difference from the amino acid sequence encoded by the germline immunoglobulin gene.
  • heteroantibodies refers to two or more antibodies, antibody binding fragments (e.g., Fab), derivatives therefrom, or antigen binding regions linked together, at least two of which have different specificities. These different specificities include a binding specificity for an Fc receptor on an effector cell, and a binding specificity for an antigen or epitope on a target cell, e.g., a tumor cell.
  • human antibody as used herein, is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences.
  • human antibodies of the invention may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo).
  • human antibody as used herein, is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences.
  • the terms “monoclonal antibody” or “monoclonal antibody composition” as used herein refer to a preparation of antibody molecules of single molecular composition.
  • a monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
  • the term “human monoclonal antibody” refers to antibodies displaying a single binding specificity which have variable and constant regions derived from human germline immunoglobulin sequences.
  • the human monoclonal antibodies are produced by a hybridoma which includes a B cell obtained from a transgenic nonhuman animal, e.g. , a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene fused to an immortalized cell.
  • recombinant human antibody includes all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as (a) antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom (described further in Section I, below), (b) antibodies isolated from a host cell transformed to express the antibody, e.g., from a transfectoma, (c) antibodies isolated from a recombinant, combinatorial human antibody library, and (d) antibodies prepared, expressed, created or isolated by any other means that involve splicing of human immunoglobulin gene sequences to other DNA sequences.
  • Such recombinant human antibodies have variable and constant regions derived from human germline immunoglobulin sequences.
  • such recombinant human antibodies can be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the V H and V L regions of the recombinant antibodies are sequences that, while derived from and related to human germline V H and V L sequences, may not naturally exist within the human antibody germline repertoire in vivo.
  • a “heterologous antibody” is defined in relation to the transgenic nonhuman organism producing such an antibody. This term refers to an antibody having an amino acid sequence or an encoding nucleic acid sequence corresponding to that found in an organism not consisting of the transgenic nonhuman animal, and generally from a species other than that of the transgenic nonhuman animal.
  • a “heterohybrid antibody” refers to an antibody having a light and heavy chains of different organismal origins. For example, an antibody having a human heavy chain associated with a murine light chain is a heterohybrid antibody. Examples of heterohybrid antibodies include chimeric and humanized antibodies, discussed supra.
  • an "isolated antibody,” as used herein, is intended to refer to an antibody which is substantially free of other antibodies having different antigenic specificities (e.g., an isolated antibody that specifically binds to PSMA is substantially free of antibodies that specifically bind antigens other than PSMA).
  • An isolated antibody that specifically binds to an epitope, isoform or variant of human PSMA may, however, have cross-reactivity to other related antigens, e.g., from other species (e.g., PSMA species homologs).
  • an isolated antibody may be substantially free of other cellular material and/or chemicals.
  • a combination of "isolated" monoclonal antibodies having different specificities are combined in a well defined composition.
  • specific binding refers to antibody binding to a predetermined antigen.
  • the antibody binds with a dissociation constant (K D ) of 10 ⁇ 7 M or less , and binds to the predetermined antigen with a K D that is at least twofold less than its KD for binding to a non-specific antigen (e.g., BSA, casein) other than the predetermined antigen or a closely-related antigen.
  • K D dissociation constant
  • BSA casein
  • high affinity for an IgG antibody refers to an antibody having a Koof 10 " M or less, more preferably 10 " M or less and even more preferably 10 "10 M or less, binding affinity of at least about 10 7 M _1 , preferably at least about 10 9 M “ ', more preferably at least about 10 10 M “1 ,10 1 , M *1 , 10 12 M “ ' or greater, e.g., up tolO ⁇ M "1 or greater.
  • "high affinity” binding can vary for other antibody isotypes.
  • "high affinity” binding for an IgM isotype refers to an antibody having a KD of 10 "7 M or less, more preferably 10 "8 M or less..
  • K assoc or "K a ", as used herein, is intended to refer to the association rate of a particular antibody-antigen interaction
  • K ⁇ g or "K d ,” as used herein, is intended to refer to the dissociation rate of a particular antibody-antigen interaction
  • K D is intended to refer to the dissociation constant, which is obtained from the ratio of K ⁇ j to K a ( . e,. K ⁇ j/K a ) and is expressed as a molar concentration (M).
  • isotype refers to the antibody class (e.g., IgM or IgGl) that is encoded by heavy chain constant region genes.
  • isotype switching refers to the phenomenon by which the class, or isotype, of an antibody changes from one Ig class to one of the other Ig classes.
  • nonswitched isotype refers to the isotypic class of heavy chain that is produced when no isotype switching has taken place; the CH gene encoding the nonswitched isotype is typically the first CH gene immediately downstream from the functionally rearranged VDJ gene.
  • Isotype switching has been classified as classical or non-classical isotype switching.
  • Classical isotype switching occurs by recombination events which involve at least one switch sequence region in the transgene.
  • Non-classical isotype switching may occur by, for example, homologous recombination between human ⁇ ⁇ and human ⁇ ⁇ ( ⁇ -associated deletion).
  • Alternative non-classical switching mechanisms such as intertransgene and/or interchromosomal recombination, among others, may occur and effectuate isotype switching.
  • switch sequence refers to those DNA sequences responsible for switch recombination.
  • a "switch donor” sequence typically a ⁇ switch region, will be 5' (i.e., upstream) of the construct region to be deleted during the switch recombination.
  • the "switch acceptor” region will be between the construct region to be deleted and the replacement constant region (e.g. , ⁇ , ⁇ , etc.). As there is no specific site where recombination always occurs, the final gene sequence will typically not be predictable from the construct.
  • glycosylation pattern is defined as the pattern of carbohydrate units that are covalently attached to a protein, more specifically to an immunoglobulin protein.
  • a glycosylation pattern of a heterologous antibody can be characterized as being substantially similar to glycosylation patterns which occur naturally on antibodies produced by the species of the nonhuman transgenic animal, when one of ordinary skill in the art would recognize the glycosylation pattern of the heterologous antibody as being more similar to said pattern of glycosylation in the species of the nonhuman transgenic animal than to the species from which the CH genes of the transgene were derived.
  • the term "naturally-occurring" as used herein as applied to an object refers to the fact that an object can be found in nature.
  • a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally-occurring.
  • the term "rearranged” as used herein refers to a configuration of a heavy chain or light chain immunoglobulin locus wherein a V segment is positioned immediately adjacent to a D-J or J segment in a conformation encoding essentially a complete V H or V L domain, respectively.
  • a rearranged immunoglobulin gene locus can be identified by comparison to germline DNA; a rearranged locus will have at least one recombined heptamer/nonamer homology element.
  • nucleic acid molecule is intended to include DNA molecules and RNA molecules.
  • a nucleic acid molecule may be single-stranded or double-stranded, but preferably is double-stranded DNA.
  • isolated nucleic acid molecule as used herein in reference to nucleic acids encoding antibodies or antibody portions (e.g. , V H , V L , CDR3) that bind to PSMA, is intended to refer to a nucleic acid molecule in which the nucleotide sequences encoding the antibody or antibody portion are free of other nucleotide sequences encoding antibodies or antibody portions that bind antigens other than PSMA, which other sequences may naturally flank the nucleic acid in human genomic DNA.
  • the human anti-PSMA antibody includes the nucleotide or amino acid sequence of 4A3, 7F12, 8A11, 8C12, or 16F9, as well as heavy chain (V H ) and light chain (V L ) variable regions having the sequences shown in SEQ ID NOs:l, 3, 5, 7, or 9 and 2, 4, 6, 8, or 10, respectively.
  • sequences set forth in SEQ ID NOs: 1-58 include "conservative sequence modifications", i.e., nucleotide and amino acid sequence modifications which do not significantly affect or alter the binding characteristics of the antibody encoded by the nucleotide sequence or containing the amino acid sequence.
  • conservative sequence modifications include nucleotide and amino acid substitutions, additions and deletions.
  • Modifications can be introduced into SEQ ID NOs: 1-58 by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis.
  • Conservative amino acid substitutions include ones in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art.
  • amino acids with basic side chains e.g., lysine, arginine, histidine
  • acidic side chains e.g. , aspartic acid, glutamic acid
  • uncharged polar side chains e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan
  • nonpolar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine
  • beta-branched side chains e.g., threonine, valine, isoleucine
  • aromatic side chains e.g., tyrosine, phenylalanine, tryptophan, histidine
  • a predicted nonessential amino acid residue in a human anti-PSMA antibody is preferably replaced with another amino acid residue from the same side chain family.
  • mutations can be introduced randomly along all or part of a anti-PSMA antibody coding sequence, such as by saturation mutagenesis, and the resulting modified anti-PSMA antibodies can be screened for binding activity.
  • antibodies encoded by the (heavy and light chain variable region) nucleotide sequences disclosed herein and/or containing the (heavy and light chain variable region) amino acid sequences disclosed herein include substantially similar antibodies encoded by or containing similar sequences which have been conservatively modified. Further discussion as to how such substantially similar antibodies can be generated based on the partial (i.e., heavy and light chain variable regions) sequences disclosed herein as SEQ ID NOs: 1-50 is provided below.
  • nucleic acids For nucleic acids, the term "substantial homology" indicates that two nucleic acids, or designated sequences thereof, when optimally aligned and compared, are identical, with appropriate nucleotide insertions or deletions, in at least about 80% of the nucleotides, usually at least about 90% to 95%, and more preferably at least about 98% to 99.5% of the nucleotides. Alternatively, substantial homology exists when the segments will hybridize under selective hybridization conditions, to the complement of the strand.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm, as described in the non-limiting examples below.
  • the percent identity between two nucleotide sequences can be determined using the GAP program in the GCG software package (available at http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1 , 2, 3, 4, 5, or 6.
  • the percent identity between two nucleotide or amino acid sequences can also determined using the algorithm of E. Meyers and W. Miller (Comput. Appl. Bioscl, 4:11-17 (1988)) which has been inco ⁇ orated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J. Mol. Biol 48:444-453 (1970)) algorithm which has been inco ⁇ orated into the GAP program in the GCG software package (available at http://www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
  • the nucleic acid and protein sequences of the present invention can further be used as a "query sequence" to perform a search against public databases to, for example, identify related sequences.
  • Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. ( 1990) J. Mol Biol. 215:403-10.
  • Gapped BLAST can be utilized as described in Altschul et al, (1997) Nucleic Acids Res. 25(17):3389-3402.
  • the default parameters of the respective programs e.g., XBLAST and NBLAST
  • the nucleic acids may be present in whole cells, in a cell lysate, or in a partially purified or substantially pure form.
  • a nucleic acid is "isolated” or “rendered substantially pure” when purified away from other cellular components or other contaminants, e.g., other cellular nucleic acids or proteins, by standard techniques, including alkaline/SDS treatment, CsCl banding, column chromatography, agarose gel electrophoresis and others well known in the art. See, F. Ausubel, et al, ed. Current Protocols in Molecular Biology, Greene Publishing and Wiley Interscience, New York (1987).
  • nucleic acid compositions of the present invention while often in a native sequence (except for modified restriction sites and the like), from either cDNA, genomic or mixtures may be mutated, thereof in accordance with standard techniques to provide gene sequences. For coding sequences, these mutations, may affect amino acid sequence as desired.
  • DNA sequences substantially homologous to or derived from native V, D, J, constant, switches and other such sequences described herein are contemplated (where "derived" indicates that a sequence is identical or modified from another sequence).
  • a nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence.
  • a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence.
  • operably linked means that the DNA sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame.
  • operably linked indicates that the sequences are capable of effecting switch recombination.
  • vector as used herein, is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • vector refers to a circular double stranded DNA loop into which additional DNA segments may be ligated.
  • viral vector Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome.
  • Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
  • certain vectors are capable of directing the expression of genes to which they are operatively linked.
  • recombinant expression vectors Such vectors are referred to herein as "recombinant expression vectors” (or simply, “expression vectors”).
  • expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
  • plasmid and vector may be used interchangeably as the plasmid is the most commonly used form of vector.
  • the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adeno viruses and adeno-associated viruses), which serve equivalent functions.
  • recombinant host cell (or simply “host cell”), as used herein, is intended to refer to a cell into which a recombinant expression vector has been introduced. It should be understood that such terms are intended to refer not only to the particular subject cell but to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term “host cell” as used herein.
  • Recombinant host cells include, for example, CHO cells and lymphocytic cells.
  • the term “subject” includes any human or nonhuman animal.
  • nonhuman animal includes all vertebrates, e.g., mammals and non- mammals, such as nonhuman primates, sheep, dog, cow, chickens, amphibians, reptiles, etc.
  • transgenic, nonhuman animal refers to a nonhuman animal having a genome comprising one or more human heavy and/or light chain transgenes or transchromosomes (either integrated or non-integrated into the animal's natural genomic DNA) and which is capable of expressing fully human antibodies.
  • a transgenic mouse can have a human light chain transgene and either a human heavy chain transgene or human heavy chain transchromosome, such that the mouse produces human anti-PSMA antibodies when immunized with PSM antigen and/or cells expressing PSMA.
  • the human heavy chain transgene can be integrated into the chromosomal DNA of the mouse, as is the case for transgenic, e.g.
  • HuMAb mice, or the human heavy chain transgene can be maintained extrachromosomally, as is the case for transchromosomal (e.g., KM) mice as described in WO 02/43478.
  • transgenic and transchromosomal mice are capable of producing multiple isotypes of human monoclonal antibodies to PSMA (e.g., IgG, IgA and/or IgE) by undergoing V-D-J recombination and isotype switching.
  • Human monoclonal antibodies (mAbs) of the present invention can be produced by a variety of techniques, including conventional monoclonal antibody methodology e.g., the standard somatic cell hybridization technique of Kohler and Milstein (1975) Nature 256: 495. Although somatic cell hybridization procedures are preferred, in principle, other techniques for producing monoclonal antibody can be employed e.g. , viral or oncogenic transformation of B lymphocytes.
  • hybridomas The preferred animal system for preparing hybridomas is the murine system.
  • Hybridoma production in the mouse is a very well-established procedure. Immunization protocols and techniques for isolation of immunized splenocytes for fusion are known in the art. Fusion partners (e.g., murine myeloma cells) and fusion procedures are also known.
  • human monoclonal antibodies directed against PSMA can be generated using transgenic or transchromosomic mice carrying parts of the human immune system rather than the mouse system.
  • transgenic and transchromosomic mice include mice referred to herein as HuMAb mice and KM mice, respectively, and are collectively referred to herein as "transgenic mice.”
  • the HuMAb mouse contains a human immunoglobulin gene miniloci that encodes unrearranged human heavy ( ⁇ and ⁇ ) and K light chain immunoglobulin sequences, together with targeted mutations that inactivate the endogenous ⁇ and K chain loci (Lonberg, et al. (1994) N ⁇ twre 368(6474): 856-859). Accordingly, the mice exhibit reduced expression of mouse IgM or K, and in response to immunization, the introduced human heavy and light chain transgenes undergo class switching and somatic mutation to generate high affinity human IgG ⁇ monoclonal (Lonberg, ⁇ . et al. (1994), supra; reviewed in Lonberg, ⁇ . ( 1994) Handbook of Experimental Pharmacology
  • HuMAb mice The preparation of HuMAb mice is described in detail Section II below and in Taylor, L. et al. (1992) Nucleic Acids Research 20:6287-6295; Chen, J. et al. (1993) International Immunology 5: 647-656; Tuaillon et al. (1993) Proc. Natl Acad. Sci USA 90:3720-
  • HuMAb mice can be immunized with a purified or enriched preparation of PSMA antigen and/or cells expressing PSMA, as described by Lonberg, N. et al. (1994) Nature 368(6474): 856-859; Fishwild, D. et al (1996) Nature Biotechnology 14: 845-851 and WO 98/24884.
  • the mice will be 6-16 weeks of age upon the first infusion.
  • a purified or enriched preparation (5-20 ⁇ g) of PSMA antigen (e.g., purified from PSMA-expressing LNCaP cells) can be used to immunize the HuMAb mice intraperitoneally.
  • mice can also be immunized with cells expressing PSMA, e.g., a tumor cell line, to promote immune responses.
  • the HuMAb transgenic mice typically respond best when initially immunized intraperitoneally (IP) with antigen in complete Freund's adjuvant, followed by every other week i.p. immunizations (up to a total of 6) with antigen in incomplete Freund's adjuvant, followed by every other week IP/SC immunizations (up to a total of 10) with antigen in incomplete Freund's adjuvant.
  • IP intraperitoneally
  • the immune response can be monitored over the course of the immunization protocol with plasma samples being obtained by retroorbital bleeds.
  • the plasma can be screened by ELISA (as described below), and mice with sufficient titers of anti-PSMA human immunoglobulin can be used for fusions.
  • mice can be boosted intravenously with antigen 3 days before sacrifice and removal of the spleen. It is expected that 2-3 fusions for each antigen may need to be performed. Several mice will be immunized for each antigen. For example, a total of twelve HuMAb mice of the HC07 and HC012 strains can be immunized.
  • splenocytes and lymph node cells from immunized mice can be isolated and fused to an appropriate immortalized cell line, such as a mouse myeloma cell line.
  • an appropriate immortalized cell line such as a mouse myeloma cell line.
  • the resulting hybridomas can be screened for the production of antigen-specific antibodies.
  • single cell suspensions of splenic lymphocytes from immunized mice can be fused to one-sixth the number of P3X63-Ag8.653 nonsecreting mouse myeloma cells (ATCC, CRL 1580) with 50% PEG.
  • Cells are plated at approximately 2 x 10 5 in flat bottom microtiter plate, followed by a two week incubation in selective medium containing 20% fetal Clone Serum, 18% "653" conditioned media, 5% origen (IGEN), 4 mM L-glutamine, 1 mM L-glutamine, 1 mM sodium pyruvate, 5mM HEPES, 0.055 mM 2-mercaptoethanol, 50 units/ml penicillin, 50 mg/ml streptomycin, 50 mg/ml gentamycin and IX HAT (Sigma; the HAT is added 24 hours after the fusion). After approximately two weeks, cells can be cultured in medium in which the HAT is replaced with HT.
  • selective medium containing 20% fetal Clone Serum, 18% "653" conditioned media, 5% origen (IGEN), 4 mM L-glutamine, 1 mM L-glutamine, 1 mM sodium pyruvate, 5mM HEPES,
  • Human antibodies of the invention also can be produced in a host cell transfectoma using, for example, a combination of recombinant DNA techniques and gene transfection methods as is well known in the art (e.g., Morrison, S. (1985) Science 229:1202).
  • DNAs encoding partial or full-length light and heavy chains can be obtained by standard molecular biology techniques (e.g., PCR amplification, site directed mutagenesis) and can be inserted into expression vectors such that the genes are operatively linked to transcriptional and translational control sequences.
  • operatively linked is intended to mean that an antibody gene is ligated into a vector such that transcriptional and translational control sequences within the vector serve their intended function of regulating the transcription and translation of the antibody gene.
  • the expression vector and expression control sequences are chosen to be compatible with the expression host cell used.
  • the antibody light chain gene and the antibody heavy chain gene can be inserted into separate vector or, more typically, both genes are inserted into the same expression vector.
  • the antibody genes are inserted into the expression vector by standard methods (e.g., ligation of complementary restriction sites on the antibody gene fragment and vector, or blunt end ligation if no restriction sites are present).
  • the light and heavy chain variable regions of the antibodies described herein can be used to create full-length antibody genes of any antibody isotype by inserting them into expression vectors already encoding heavy chain constant and light chain constant regions of the desired isotype such that the V H segment is operatively linked to the C H segment(s) within the vector and the Vi, segment is operatively linked to the C L segment within the vector.
  • the recombinant expression vector can encode a signal peptide that facilitates secretion of the antibody chain from a host cell.
  • the antibody chain gene can be cloned into the vector such that the signal peptide is linked in-frame to the amino terminus of the antibody chain gene.
  • the signal peptide can be an immunoglobulin signal peptide or a heterologous signal peptide (i. e. , a signal peptide from a non-immunoglobulin protein).
  • the recombinant expression vectors of the invention carry regulatory sequences that control the expression of the antibody chain genes in a host cell.
  • the term "regulatory sequence” is intended to includes promoters, enhancers and other expression control elements (e.g., polyadenylation signals) that control the transcription or translation of the antibody chain genes.
  • Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology. Methods in Enzymology 185, Academic Press, San Diego, CA (1990). It will be appreciated by those skilled in the art that the design of the expression vector, including the selection of regulatory sequences may depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc.
  • Preferred regulatory sequences for mammalian host cell expression include viral elements that direct high levels of protein expression in mammalian cells, such as promoters and or enhancers derived from cytomegalovirus (CMV), Simian Virus 40 (SV40), adenovirus, (e.g., the adenovirus major late promoter (AdMLP)) and polyoma.
  • CMV cytomegalovirus
  • SV40 Simian Virus 40
  • AdMLP adenovirus major late promoter
  • nonviral regulatory sequences may be used, such as the ubiquitin promoter or ⁇ -globin promoter.
  • the recombinant expression vectors of the invention may carry additional sequences, such as sequences that regulate replication of the vector in host cells (e.g., origins of replication) and selectable marker genes.
  • the selectable marker gene facilitates selection of host cells into which the vector has been introduced (see, e.g. , U.S. Pat. Nos. 4,399,216, 4,634,665 and 5,179,017, all by Axel et al).
  • the selectable marker gene confers resistance to drugs, such as G418, hygromycin or methotrexate, on a host cell into which the vector has been introduced.
  • Preferred selectable marker genes include the dihydrofolate reductase (DHFR) gene (for use in dhfr- host cells with methotrexate selection/amplification) and the neo gene (for G418 selection).
  • DHFR dihydrofolate reductase
  • the expression vector(s) encoding the heavy and light chains is transfected into a host cell by standard techniques.
  • the various forms of the term "transfection" are intended to encompass a wide variety of techniques commonly used for the introduction of exogenous DNA into a prokaryotic or eukaryotic host cell, e.g. , electroporation, calcium-phosphate precipitation, DEAE-dextran transfection and the like.
  • Preferred mammalian host cells for expressing the recombinant antibodies of the invention include Chinese Hamster Ovary (CHO cells) (including dhfr- CHO cells, described in Urlaub and Chasin, (1980) Proc. Natl. Acad. Sci. USA 77:4216- 4220, used with a DHFR selectable marker, e.g., as described in R. J. Kaufman and P. A. Sha ⁇ (1982) Mol. Biol. 159:601-621), NSO myeloma cells, COS cells and SP2 cells.
  • another preferred expression system is the GS gene expression system disclosed in WO 87/04462, WO 89/01036 and EP
  • the antibodies are produced by culturing the host cells for a period of time sufficient to allow for expression of the antibody in the host cells or, more preferably, secretion of the antibody into the culture medium in which the host cells are grown.
  • Antibodies can be recovered from the culture medium using standard protein purification methods.
  • Antibodies interact with target antigens predominantly through amino acid residues that are located in the six heavy and light chain complementarity determining regions (CDRs). For this reason, the amino acid sequences within CDRs are more diverse between individual antibodies than sequences outside of CDRs. Because CDR sequences are responsible for most antibody-antigen interactions, it is possible to express recombinant antibodies that mimic the properties of specific naturally occurring antibodies by constructing expression vectors that include CDR sequences from the specific naturally occurring antibody grafted onto framework sequences from a different antibody with different properties (see, e.g., Riechmann, L. et al, 1998, Nature 332:323-327; Jones, P. et al, 1986, Nature 321 :522-525; and Queen, C.
  • Such framework sequences can be obtained from public DNA databases that include germline antibody gene sequences. These germline sequences will differ from mature antibody gene sequences because they will not include completely assembled variable genes, which are formed by V(D)J joining during B cell maturation. Germline gene sequences will also differ from the sequences of a high affinity secondary repertoire antibody at individual evenly across the variable region. For example, somatic mutations are relatively infrequent in the amino-terminal portion of framework region. For example, somatic mutations are relatively infrequent in the amino terminal portion of framework region 1 and in the carboxy-terminal portion of framework region 4.
  • variable region can be synthesized as a set of short, overlapping, oligonucleotides and combined by PCR amplification to create an entirely synthetic variable region clone. This process has certain advantages such as elimination or inclusion or particular restriction sites, or optimization of particular codons.
  • the nucleotide sequences of heavy and light chain transcripts from a hybridomas are used to design an overlapping set of synthetic oligonucleotides to create synthetic V sequences with identical amino acid coding capacities as the natural sequences.
  • the synthetic heavy and kappa chain sequences can differ from the natural sequences in three ways: strings of repeated nucleotide bases are interrupted to facilitate oligonucleotide synthesis and PCR amplification; optimal translation initiation sites are inco ⁇ orated according to Kozak's rules (Kozak, 1991, J. Biol. Chem. 266:19867- 19870); and, Hindlll sites are engineered upstream of the translation initiation sites.
  • the optimized coding, and corresponding non-coding, strand sequences are broken down into 30 - 50 nucleotide approximately the midpoint of the corresponding non-coding oligonucleotide.
  • the oligonucleotides can be assemble into overlapping double stranded sets that span segments of 150 - 400 nucleotides. The pools are then used as templates to produce PCR amplification products of 150 - 400 nucleotides.
  • a single variable region oligonucleotide set will be broken down into two pools which are separately amplified to generate two overlapping PCV products. These overlapping products are then combined by PCT amplification to form the complete variable region.
  • the heavy and light chain expression constructs can be combined into a single vector, co-transfected, serially transfected, or separately transfected into host cells which are then fused to form a host cell expressing both chains.
  • Plasmids for use in construction of expression vectors for human IgG ⁇ are described below.
  • the plasmids were constructed so that PCR amplified V heavy and V kappa light chain cDNA sequences could be used to reconstruct complete heavy and light chain minigenes.
  • These plasmids can be used to express completely human, or chimeric IgGjK or IgG 4 ⁇ antibodies.
  • Similar plasmids can be constructed for expression of other heavy chain isotypes, or for expression of antibodies comprising lambda light chains.
  • an human anti-PSMA antibodies of the invention 4A3, 7F12, 8A11, 8C12 or 16F9
  • structurally related human anti-PSMA antibodies that retain at least one functional property of the antibodies of the invention, such as binding to PSMA.
  • one or more CDR regions of 4A3, 7F12, 8A11, 8C12 or 16F9 can be combined recombinantly with known human framework regions and CDRs to create additional, recombinantly-engineered, human anti-PSMA antibodies of the invention.
  • the invention provides a method for preparing an anti-PSMA antibody comprising: preparing an antibody comprising (1) human heavy chain framework regions and human heavy chain CDRs, wherein at least one of the human heavy chain CDRs comprises an amino acid sequence selected from the amino acid sequences of CDRs shown in Figure 19 (SEQ ID NOs: 21-35); and (2) human light chain framework regions and human light chain CDRs, wherein at least one of the human heavy chain CDRs comprises an amino acid sequence selected from the amino acid sequences of CDRs shown in Figures 22 and 23 (SEQ ID NOs: 36-50); wherein the antibody retains the ability to bind to PSMA.
  • the ability of the antibody to bind PSMA can be determined using standard binding assays, such as those set forth in the Examples (e.g., an ELISA). Since it is well known in the art that antibody heavy and light chain CDR3 domains play a particularly important role in the binding specificity/affinity of an antibody for an antigen, the recombinant antibodies of the invention prepared as set forth above preferably comprise the heavy and light chain CDR3s of 4 A3, 7F12, 8A11, 8C12 or 16F9. The antibodies further can comprise the CDR2s of 4A3, 7F12, 8A11, 8C12 or 16F9. The antibodies further can comprise the CDRls of 4A3, 7F12, 8A1 1, 8C12 or 16F9.
  • the invention further provides anti-PSMA antibodies comprising: (1) human heavy chain framework regions, a human heavy chain CDRl region, a human heavy chain CDR2 region, and a human heavy chain CDR3 region, wherein the human heavy chain CDR3 region is selected from the CDR3s of 4A3, 7F12, 8A11, 8C12 and 16F9 as shown in Figure 19 (SEQ ID NOs: 23, 26, 29, 32, or 35); and (2) human light chain framework regions, a human light chain CDRl region, a human light chain CDR2 region, and a human light chain CDR3 region, wherein the human light chain CDR3 region is selected from the CDR3s of 4A3, 7F12, 8A11, 8C12 and 16F9 as shown in Figures 22 and 23 (SEQ ID NOs: 38, 41, 44, 47, or 50), wherein the antibody binds PSMA.
  • the antibody may further comprise the heavy chain CDR2 and/or the light chain CDR2 of 4A3, 7F12, 8A11, 8C12 or 16F9.
  • the antibody may further comprise the heavy chain CDRl and/or the light chain CDRl of 4A3, 7F12, 8Al l, 8C12 or l6F9.
  • the CDRl, 2, and/or 3 of the engineered antibodies described above comprise the exact amino acid sequence(s) as those of 4 A3, 7F12, 8A11, 8C12 or 16F9 disclosed herein.
  • the engineered antibody may be composed of one or more CDRs that are, for example, 90%, 95%, 98% or 99.5% identical to one or more CDRs of 4A3, 7F12, 8A11, 8C12 or 16F9
  • engineered antibodies such as those described above may be selected for their retention of other functional properties of antibodies of the invention, such as:
  • Human monoclonal antibodies of the invention can be tested for binding to PSMA by, for example, standard ELISA. Briefly, microtiter plates are coated with purified PSMA at 0.25 ⁇ g/ml in PBS, and then blocked with 5% bovine serum albumin in PBS. Dilutions of plasma from PSMA-immunized mice are added to each well and incubated for 1-2 hours at 37°C. The plates are washed with PBS/Tween and then incubated with a goat-anti-human IgG Fc-specific polyclonal reagent conjugated to alkaline phosphatase for 1 hour at 37°C. After washing, the plates are developed with pNPP substrate (1 mg/ml), and analyzed at OD of 405-650. Preferably, mice which develop the highest titers will be used for fusions.
  • An ELISA assay as described above can also be used to screen for hybridomas that show positive reactivity with PSMA immunogen. Hybridomas that bind with high avidity to PSMA will be subcloned and further characterized. One clone from each hybridoma, which retains the reactivity of the parent cells (by ELISA), can be chosen for making a 5-10 vial cell bank stored at -140 °C, and for antibody purification.
  • selected hybridomas can be grown in two-liter spinner-flasks for monoclonal antibody purification.
  • Supernatants can be filtered and concentrated before affinity chromatography with protein A- sepharose (Pharmacia, Piscataway, NJ).
  • Eluted IgG can be checked by gel electrophoresis and high performance liquid chromatography to ensure purity.
  • the buffer solution can be exchanged into PBS, and the concentration can be determined by OD 80 using 1.43 extinction coefficient.
  • the monoclonal antibodies can be aliquoted and stored at -80 °C.
  • each antibody can be biotinylated using commercially available reagents (Pierce, Rockford, IL). Competition studies using unlabeled monoclonal antibodies and biotinylated monoclonal antibodies can be performed using PSMA coated-ELISA plates as described above. Biotinylated mAb binding can be detected with a strep-avidin-alkaline phosphatase probe.
  • isotype ELISAs can be performed. Wells of microtiter plates can be coated with 10 ⁇ g/ml of anti-human Ig overnight at 4°C. After blocking with 5% BSA, the plates are reacted with 10 ⁇ g/ml of monoclonal antibodies or purified isotype controls, at ambient temperature for two hours. The wells can then be reacted with either human IgGl or human IgM-specific alkaline phosphatase-conjugated probes. Plates are developed and analyzed as described above.
  • flow cytometry can be used. Briefly, cell lines expressing PSMA (grown under standard growth conditions) are mixed with various concentrations of monoclonal antibodies in PBS containing 0.1% Tween 80 and 20% mouse serum, and incubated at 37°C for 1 hour. After washing, the cells are reacted with Fluorescein- labeled anti-human IgG antibody under the same conditions as the primary antibody staining. The samples can be analyzed by FACScan instrument using light and side scatter properties to gate on single cells. An alternative assay using fluorescence microscopy may be used (in addition to or instead of) the flow cytometry assay. Cells can be stained exactly as described above and examined by fluorescence microscopy. This method allows visualization of individual cells, but may have diminished sensitivity depending on the density of the antigen.
  • Anti-PSMA human IgGs can be further tested for reactivity with PSMA antigen by Western blotting. Briefly, cell extracts from cells expressing PSMA can be prepared and subjected to sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis. After electrophoresis, the separated antigens will be transferred to nitrocellulose membranes, blocked with 20% mouse serum, and probed with the monoclonal antibodies to be tested. Human IgG binding can be detected using anti- human IgG alkaline phosphatase and developed with BCIP/NBT substrate tablets (Sigma Chem. Co., St. Louis, MO). Phagocytic and Cell Killing Activities of Human Monoclonal Antibodies to PSMA
  • human monoclonal anti- PSMA antibodies can be tested for their ability to mediate phagocytosis and killing of cells expressing PSMA.
  • the testing of monoclonal antibody activity in vitro will provide an initial screening prior to testing in vivo models. Briefly, polymo ⁇ honuclear cells (PMN), or other effector cells, from healthy donors can be purified by Ficoll Hypaque density centrifugation, followed by lysis of contaminating erythrocytes.
  • PMN polymo ⁇ honuclear cells
  • Washed PMNs can be suspended in RPMI supplemented with 10% heat-inactivated fetal calf serum and mixed with 51 Cr labeled cells expressing PSMA, at various ratios of effector cells to tumor cells (-effector cells:tumor cells).
  • Purified human anti-PSMA IgGs can then be added at various concentrations. Irrelevant human IgG can be used as negative control.
  • Assays can be carried out for 0-120 minutes at 37°C. Samples can be assayed for cytolysis by measuring 51 Cr release into the culture supernatant.
  • Anti- PSMA monoclonal can also be tested in combinations with each other to determine whether cytolysis is enhanced with multiple monoclonal antibodies.
  • Human monoclonal antibodies which bind to PSMA also can be tested in an in vivo model (e.g., in mice) to determine their efficacy in mediating phagocytosis and killing of cells expressing PSMA, e.g., tumor cells.
  • These antibodies can be selected, for example, based on the following criteria, which are not intended to be exclusive:
  • human monoclonal antibodies of the invention meet one or more, and preferably all, of these criteria.
  • the human monoclonal antibodies are used in combination, e.g., as a pharmaceutical composition comprising two or more anti-PSMA monoclonal antibodies or fragments thereof.
  • human anti-PSMA monoclonal antibodies having different, but complementary activities can be combined in a single therapy to achieve a desired therapeutic or diagnostic effect.
  • An illustration of this would be a composition containing an anti-PSMA human monoclonal antibody that mediates highly effective killing of target cells in the presence of effector cells, combined with another human anti-PSMA monoclonal antibody that inhibits the growth of cells expressing PSMA.
  • the invention provides transgenic and transchromosomal nonhuman animals, such as transgenic or transchromosomal mice, which are capable of expressing human monoclonal antibodies that specifically bind to PSMA.
  • the invention provides a transgenic or transchromosomal mouse having a genome comprising a human heavy chain transgene, such that the mouse produces human anti-PSMA antibodies when immunized with PSMA and/or cells expressing PSMA.
  • the human heavy chain transgene can be integrated into the chromosomal DNA of the mouse, as is the case for transgenic, e.g., HuMAb mice, as described in detail herein and exemplified.
  • the human heavy chain transgene can be maintained extrachromosomally, as is the case for transchromosomal (e.g., KM) mice as described in WO 02/43478.
  • transgenic and transchromosomal animals are capable of producing multiple isotypes of human monoclonal antibodies to PSMA (e.g., IgG, IgA and/or IgE) by undergoing V-D-J recombination and isotype switching. Isotype switching may occur by, e.g., classical or non-classical isotype switching.
  • transgenes are constructed so as to produce isotype switching and one or more of the following: (1) high level and cell-type specific expression, (2) functional gene rearrangement, (3) activation of and response to allelic exclusion, (4) expression of a sufficient primary repertoire, (5) signal transduction, (6) somatic hypermutation, and (7) domination of the transgene antibody locus during the immune response.
  • the transgene need not activate allelic exclusion.
  • the transgene comprises a functionally rearranged heavy and/or light chain immunoglobulin gene
  • the second criteria of functional gene rearrangement is unnecessary, at least for that transgene which is already rearranged.
  • the transgenic or transchromosomal nonhuman animals used to generate the human monoclonal antibodies of the invention contain rearranged, unrearranged or a combination of rearranged and unrearranged heterologous immunoglobulin heavy and light chain transgenes in the germline of the transgenic animal.
  • Each of the heavy chain transgenes comprises at least one C H gene.
  • the heavy chain transgene may contain functional isotype switch sequences, which are capable of supporting isotype switching of a heterologous transgene encoding multiple C H genes in the B-cells of the transgenic animal.
  • Such switch sequences may be those which occur naturally in the germline immunoglobulin locus from the species that serves as the source of the transgene C H genes, or such switch sequences may be derived from those which occur in the species that is to receive the transgene construct (the transgenic animal).
  • a human transgene construct that is used to produce a transgenic mouse may produce a higher frequency of isotype switching events if it inco ⁇ orates switch sequences similar to those that occur naturally in the mouse heavy chain locus, as presumably the mouse switch sequences are optimized to function with the mouse switch recombinase enzyme system, whereas the human switch sequences are not.
  • Switch sequences may be isolated and cloned by conventional cloning methods, or may be synthesized de novo from overlapping synthetic oligonucleotides designed on the basis of published sequence information relating to immunoglobulin switch region sequences (Mills et al, Nucl. Acids Res. 15:7305-7316 (1991); Sideras et al., Intl. Immunol. 1 :631-642 (1989), which are inco ⁇ orated herein by reference).
  • heterologous heavy and light chain immunoglobulin transgenes are found in a significant fraction of the B-cells of the transgenic animal (at least 10 percent).
  • the transgenes used to generate the transgenic animals of the invention include a heavy chain transgene comprising DNA encoding at least one variable gene segment, one diversity gene segment, one joining gene segment and at least one constant region gene segment.
  • the immunoglobulin light chain transgene comprises DNA encoding at least one variable gene segment, one joining gene segment and at least one constant region gene segment.
  • the gene segments encoding the light and heavy chain gene segments are heterologous to the transgenic nonhuman animal in that they are derived from, or correspond to, DNA encoding immunoglobulin heavy and light chain gene segments from a species not consisting of the transgenic nonhuman animal.
  • the transgene is constructed such that the individual gene segments are unrearranged, i.e., not rearranged so as to encode a functional immunoglobulin light or heavy chain.
  • Such unrearranged transgenes support recombination of the V, D, and J gene segments (functional rearrangement) and preferably support inco ⁇ oration of all or a portion of a D region gene segment in the resultant rearranged immunoglobulin heavy chain within the transgenic nonhuman animal when exposed to PSMA antigen.
  • the transgenes comprise an unrearranged "mini-locus." Such transgenes typically comprise a substantial portion of the C, D, and J segments as well as a subset of the V gene segments.
  • the various regulatory sequences e.g. promoters, enhancers, class switch regions, splice- donor and splice-acceptor sequences for RNA processing, recombination signals and the like, comprise corresponding sequences derived from the heterologous DNA.
  • Such regulatory sequences may be inco ⁇ orated into the transgene from the same or a related species of the nonhuman animal used in the invention.
  • human immunoglobulin gene segments may be combined in a transgene with a rodent immunoglobulin enhancer sequence for use in a transgenic mouse.
  • synthetic regulatory sequences may be inco ⁇ orated into the transgene, wherein such synthetic regulatory sequences are not homologous to a functional DNA sequence that is known to occur naturally in the genomes of mammals. Synthetic regulatory sequences are designed according to consensus rules, such as, for example, those specifying the permissible sequences of a splice-acceptor site or a promoter/enhancer motif.
  • a minilocus comprises a portion of the genomic immunoglobulin locus having at least one internal (i.e., not at a terminus of the portion) deletion of a non-essential DNA portion (e.g., intervening sequence; intron or portion thereof) as compared to the naturally-occurring germline Ig locus.
  • a non-essential DNA portion e.g., intervening sequence; intron or portion thereof
  • the transgenic or transchromosomal animal used to generate human antibodies to PSMA contains at least one, typically 2-10, and sometimes 25-50 or more copies of the transgene described in Example 12 of WO 98/24884 (e.g., pHCl or pHC2) bred with an animal containing a single copy of a light chain transgene described in Examples 5, 6, 8, or 14 of WO 98/24884, and the offspring bred with the J H deleted animal described in Example 10 of WO 98/24884, the contents of which are hereby expressly inco ⁇ orated by reference. Animals are bred to homozygosity for each of these three traits.
  • WO 98/24884 e.g., pHCl or pHC2
  • Such animals have the following genotype: a single copy (per haploid set of chromosomes) of a human heavy chain unrearranged mini-locus (described in Example 12 of WO 98/24884), a single copy (per haploid set of chromosomes) of a rearranged human K light chain construct (described in Example 14 of WO 98/24884), and a deletion at each endogenous mouse heavy chain locus that removes all of the functional J H segments (described in Example 10 of WO 98/24884).
  • Such animals are bred with mice that are homozygous for the deletion of the J H segments (Examples 10 of WO 98/24884) to produce offspring that are homozygous for the J H deletion and hemizygous for the human heavy and light chain constructs.
  • the resultant animals are injected with antigens and used for production of human monoclonal antibodies against these antigens.
  • B cells isolated from such an animal are monospecific with regard to the human heavy and light chains because they contain only a single copy of each gene. Furthermore, they will be monospecific with regards to human or mouse heavy chains because both endogenous mouse heavy chain gene copies are nonfunctional by virtue of the deletion spanning the J H region introduced as described in Example 9 and 12 of WO 98/24884. Furthermore, a substantial fraction of the B cells will be monospecific with regards to the human or mouse light chains because expression of the single copy of the rearranged human K light chain gene will allelically and isotypically exclude the rearrangement of the endogenous mouse K and lambda chain genes in a significant fraction of B-cells.
  • the total immunoglobulin levels will range from about 0.1 to 10 mg/ml of serum, preferably 0.5 to 5 mg/ml, ideally at least about 1.0 mg/ml.
  • the adult mouse ratio of serum IgG to IgM is preferably about 10:1.
  • the IgG to IgM ratio will be much lower in the immature mouse. In general, greater than about 10%, preferably 40 to 80% of the spleen and lymph node B cells express exclusively human IgG protein.
  • the repertoire will ideally approximate that shown in a native mouse, usually at least about 10% as high, preferably 25 to 50% or more.
  • immunoglobulins ideally IgG
  • 10 4 to 10 or more will be produced, depending primarily on the number of different V, J and D regions introduced into the mouse genome.
  • These immunoglobulins will typically recognize about one-half or more of highly antigenic proteins, e.g., staphylococcus protein A.
  • the immunoglobulins will exhibit an affinity for preselected antigens of at least about 10 7 M “1 , preferably at least about 10 9 M “ ', more preferably at least about 10 10 M “1 ,10 11 M “1 , 10 12 M “ ', or greater, e.g., up tol0 13 M " ' or greater.
  • a heavy chain transgene having a predetermined repertoire may comprise, for example, human V H genes which are preferentially used in antibody responses to the predetermined antigen type in humans.
  • some V H genes may be excluded from a defined repertoire for various reasons (e.g., have a low likelihood of encoding high affinity V regions for the predetermined antigen; have a low propensity to undergo somatic mutation and affinity sha ⁇ ening; or are immunogenic to certain humans).
  • V H genes may be excluded from a defined repertoire for various reasons (e.g., have a low likelihood of encoding high affinity V regions for the predetermined antigen; have a low propensity to undergo somatic mutation and affinity sha ⁇ ening; or are immunogenic to certain humans).
  • such gene segments may be readily identified, e.g. by hybridization or DNA sequencing, as being from a species of organism other than the transgenic animal.
  • transgenic and transchromosomal nonhuman animals e.g., mice, as described above can be immunized with, for example, a purified or recombinant preparation of PSMA and/or cells expressing PSMA as described previously.
  • the transgenic animals can be immunized with DNA encoding human PSMA.
  • the animals will then produce B cells which undergo class-switching via intratransgene switch recombination (cis-switching) and express immunoglobulins reactive with PSMA.
  • the immunoglobulins can be human antibodies (also referred to as "human sequence antibodies”), wherein the heavy and light chain polypeptides are encoded by human transgene sequences, which may include sequences derived by somatic mutation and V region recombinatorial joints, as well as germline-encoded sequences; these human antibodies can be referred to as being substantially identical to a polypeptide sequence encoded by a human V or V H gene segment and a human J L or J L segment, even though other non-germline sequences may be present as a result of somatic mutation and differential V-J and V-D-J recombination joints.
  • variable regions of each antibody chain are typically at least 80 percent encoded by human germline V, J, and, in the case of heavy chains, D, gene segments; frequently at least 85 percent of the variable regions are encoded by human germline sequences present on the transgene; often 90 or 95 percent or more of the variable region sequences are encoded by human germline sequences present on the transgene.
  • non-germline sequences are introduced by somatic mutation and VJ and VDJ joining, the human sequence antibodies will frequently have some variable region sequences (and less frequently constant region sequences) which are not encoded by human V, D, or J gene segments as found in the human transgene(s) in the germline of the mice.
  • non-germline sequences or individual nucleotide positions
  • Human antibodies which bind to the predetermined antigen can result from isotype switching, such that human antibodies comprising a human sequence ⁇ chain (such as ⁇ l, ⁇ 2, ⁇ 3, or ⁇ 4) and a human sequence light chain (such as K) are produced.
  • Such isotype-switched human sequence antibodies often contain one or more somatic mutation(s), typically in the variable region and often in or within about 10 residues of a CDR) as a result of affinity maturation and selection of B cells by antigen, particularly subsequent to secondary (or subsequent) antigen challenge.
  • 7 o affinity human sequence antibodies may have KDS of 10 M or less, such as 10 " M or less, 10 "9 M or less, or 10 "10 M or less, or even lower.
  • Another aspect of the invention pertains to the B cells derived from transgenic or transchromosomal nonhuman animals as described herein. The B cells can be used to generate hybridomas expressing human monoclonal antibodies which bind with high affinity (e.g., a KD of 10 "7 M or less) to PSMA.
  • the invention provides a hybridoma which produces a human antibody having a KD of 10 "7 M or less, such as 10 "8 M or less, 10 '9 M or less, 10 "10 M or less, or even lower, , wherein the antibody comprises: a human sequence light chain composed of (1) a light chain variable region having a polypeptide sequence which is substantially identical to a polypeptide sequence encoded by a human V L gene segment and a human J L segment, and (2) a light chain constant region having a polypeptide sequence which is substantially identical to a polypeptide sequence encoded by a human C L gene segment; and a human sequence heavy chain composed of a (1) a heavy chain variable region having a polypeptide sequence which is substantially identical to a polypeptide sequence encoded by a human V H gene segment, optionally a D region, and a human JH segment, and (2) a constant region having a polypeptide sequence which is substantially identical to a polypeptide sequence encoded by a human CH gene segment.
  • V region transgene is a yeast artificial chromosome comprising a portion of a human V H or V L (V K ) gene segment array, as may naturally occur in a human genome or as may be spliced together separately by recombinant methods, which may include out-of-order or omitted V gene segments.
  • V gene segments are contained on the YAC.
  • the V repertoire expansion method wherein the mouse expresses an immunoglobulin chain comprising a variable region sequence encoded by a V region gene segment present on the V region transgene and a C region encoded on the human Ig transgene.
  • V repertoire expansion method transgenic mice having at least 5 distinct V genes can be generated; as can mice containing at least about 24 V genes or more.
  • Some V gene segments may be non-functional (e.g., pseudogenes and the like); these segments may be retained or may be selectively deleted by recombinant methods available to the skilled artisan, if desired.
  • the trait can be propagated and bred into other genetic backgrounds, including backgrounds where the functional YAC having an expanded V segment repertoire is bred into a mouse germline having a different human Ig transgene.
  • Multiple functional YACs having an expanded V segment repertoire may be bred into a germline to work with a human Ig transgene (or multiple human Ig transgenes).
  • YAC transgenes when integrated into the genome may substantially lack yeast sequences, such as sequences required for autonomous replication in yeast; such sequences may optionally be removed by genetic engineering (e.g., restriction digestion and pulsed-field gel electrophoresis or other suitable method) after replication in yeast in no longer necessary (i.e., prior to introduction into a mouse ES cell or mouse prozygote).
  • Methods of propagating the trait of human sequence immunoglobulin expression include breeding a transgenic mouse having the human Ig transgene(s), and optionally also having a functional YAC having an expanded V segment repertoire. Both V H and VL gene segments may be present on the YAC.
  • the transgenic mouse may be bred into any background desired by the practitioner, including backgrounds harboring other human transgenes, including human Ig transgenes and/or transgenes encoding other human lymphocyte proteins.
  • the invention also provides a high affinity human sequence immunoglobulin produced by a transgenic mouse having an expanded V region repertoire YAC transgene.
  • Transgenic animals containing rearranged heavy and rearranged light immunoglobulin transgenes are preferred. Of these categories of transgenic animal, the preferred order of preference is as follows II > I > III > IV where the endogenous light chain genes (or at least the K gene) have been knocked out by homologous recombination (or other method) and I > II > III >IV where the endogenous light chain genes have not been knocked out and must be dominated by allelic exclusion.
  • human monoclonal antibodies to PSMA, or antigen-binding portions thereof can be derivatized or linked to another functional molecule, e.g., another peptide or protein (e.g., an Fab' fragment) to generate a bispecific or multispecific molecule which binds to multiple binding sites or target epitopes.
  • another functional molecule e.g., another peptide or protein (e.g., an Fab' fragment) to generate a bispecific or multispecific molecule which binds to multiple binding sites or target epitopes.
  • an antibody or antigen-binding portion of the invention can be functionally linked (e.g., by chemical coupling, genetic fusion, noncovalent association or otherwise) to one or more other binding molecules, such as another antibody, antibody fragment, peptide or binding mimetic.
  • the present invention includes bispecific and multispecific molecules comprising at least one first binding specificity for PSMA and a second binding specificity for a second target epitope.
  • the second target epitope is an Fc receptor, e.g., human Fc ⁇ RI (CD64) or a human Fc ⁇ receptor (CD89). Therefore, the invention includes bispecific and multispecific molecules capable of binding both to Fc ⁇ R, Fc ⁇ R or Fc ⁇ R expressing effector cells (e.g., monocytes, macrophages or polymo ⁇ honuclear cells (PMNs)), and to target cells expressing PSMA.
  • effector cells e.g., monocytes, macrophages or polymo ⁇ honuclear cells (PMNs)
  • bispecific and multispecific molecules target PSMA expressing cells to effector cell and, like the human monoclonal antibodies of the invention, trigger Fc receptor-mediated effector cell activities, such as phagocytosis of a PSMA expressing cells, antibody dependent cell-mediated cytotoxicity (ADCC), cytokine release, or generation of superoxide anion.
  • Fc receptor-mediated effector cell activities such as phagocytosis of a PSMA expressing cells, antibody dependent cell-mediated cytotoxicity (ADCC), cytokine release, or generation of superoxide anion.
  • Bispecific and multispecific molecules of the invention can further include a third binding specificity, in addition to an anti-Fc binding specificity and an anti-PSMA binding specificity.
  • the third binding specificity is an anti-enhancement factor (EF) portion, e.g., a molecule which binds to a surface protein involved in cytotoxic activity and thereby increases the immune response against the target cell.
  • EF anti-enhancement factor
  • the "anti-enhancement factor portion” can be an antibody, functional antibody fragment or a ligand that binds to a given molecule, e.g., an antigen or a receptor, and thereby results in an enhancement of the effect of the binding determinants for the F c receptor or target cell antigen.
  • the "anti-enhancement factor portion” can bind an F c receptor or a target cell antigen.
  • the anti-enhancement factor portion can bind to an entity that is different from the entity to which the first and second binding specificities bind.
  • the anti-enhancement factor portion can bind a cytotoxic T-cell (e.g. via CD2, CD3, CD8, CD28, CD4, CD40, ICAM-1 or other immune cell that results in an increased immune response against the target cell).
  • the bispecific and multispecific molecules of the invention comprise as a binding specificity at least one antibody, or an antibody fragment thereof, including, e.g., an Fab, Fab', F(ab')2, Fv, or a single chain Fv.
  • the antibody may also be a light chain or heavy chain dimer, or any minimal fragment thereof such as a Fv or a single chain construct as described in Ladner et al. U.S. Patent No. 4,946,778, issued August 7, 1990, the contents of which is expressly inco ⁇ orated by reference.
  • bispecific and multispecific molecules of the invention comprise a binding specificity for an Fc ⁇ R or an Fc ⁇ R present on the surface of an effector cell, and a second binding specificity for a target cell antigen, e.g., PSMA.
  • the binding specificity for an Fc receptor is provided by a human monoclonal antibody, the binding of which is not blocked by human immunoglobulin G (IgG).
  • IgG receptor refers to any of the eight ⁇ -chain genes located on chromosome 1.
  • Fc ⁇ RI CD64
  • Fc ⁇ RII CD32
  • Fc ⁇ RIII CD 16
  • the Fc ⁇ receptor a human high affinity Fc ⁇ RI.
  • the human Fc ⁇ RI is a 72 kDa molecule, which shows high affinity for monomeric IgG (10 8 - 10 9 M-').
  • the anti-Fc ⁇ receptor antibody is a humanized form of monoclonal antibody 22 (H22).
  • H22 monoclonal antibody 22
  • the production and characterization of the H22 antibody is described in Graziano, R.F. et al. (1995) J. Immunol 155 (10): 4996-5002 and PCT/US93/10384.
  • the H22 antibody producing cell line was deposited at the American Type Culture Collection under the designation HA022CL1 and has the accession no. CRL 11177.
  • the binding specificity for an Fc receptor is provided by an antibody that binds to a human IgA receptor, e.g., an Fc-alpha receptor (Fc ⁇ RI (CD89)), the binding of which is preferably not blocked by human immunoglobulin A (IgA).
  • IgA receptor is intended to include the gene product of one ⁇ -gene (Fc ⁇ RI) located on chromosome 19. This gene is known to encode several alternatively spliced transmembrane isoforms of 55 to 110 kDa.
  • Fc ⁇ RI (CD89) is constitutively expressed on monocytes/macrophages, eosinophilic and neutrophilic granulocytes, but not on non-effector cell populations.
  • Fc ⁇ RI has medium affinity (« 5 x 10 7 M- 1 ) for both IgAl and IgA2, which is increased upon exposure to cytokines such as G-CSF or GM-CSF (Morton, H.C. et al. (1996) Critical Reviews in Immunology 16:423-440).
  • cytokines such as G-CSF or GM-CSF
  • Fc ⁇ RI and Fc ⁇ RI are preferred trigger receptors for use in the invention because they are (1) expressed primarily on immune effector cells, e.g., monocytes, PMNs, macrophages and dendritic cells; (2) expressed at high levels (e.g., 5,000- 100,000 per cell); (3) mediators of cytotoxic activities (e.g., ADCC, phagocytosis); (4) mediate enhanced antigen presentation of antigens, including self-antigens, targeted to them.
  • immune effector cells e.g., monocytes, PMNs, macrophages and dendritic cells
  • mediators of cytotoxic activities e.g., ADCC, phagocytosis
  • bispecific and multispecific molecules of the invention further comprise a binding specificity which recognizes, e.g., binds to, a target cell antigen, e.g., PSMA.
  • the binding specificity is provided by a human monoclonal antibody of the present invention.
  • An "effector cell specific antibody” as used herein refers to an antibody or functional antibody fragment that binds the Fc receptor of effector cells. Preferred antibodies for use in the subject invention bind the Fc receptor of effector cells at a site which is not bound by endogenous immunoglobulin.
  • effector cell refers to an immune cell which is involved in the effector phase of an immune response, as opposed to the cognitive and activation phases of an immune response.
  • exemplary immune cells include a cell of a myeloid or lymphoid origin, e.g., lymphocytes (e.g., B cells and T cells including cytolytic T cells (CTLs)), killer cells, natural killer cells, macrophages, monocytes, eosinophils, neutrophils, polymo ⁇ honuclear cells, granulocytes, mast cells, and basophils.
  • lymphocytes e.g., B cells and T cells including cytolytic T cells (CTLs)
  • killer cells e.g., natural killer cells, macrophages, monocytes, eosinophils, neutrophils, polymo ⁇ honuclear cells, granulocytes, mast cells, and basophils.
  • an effector cell is capable of inducing antibody-dependent cell-mediated cytotoxicity (ADCC), e.g., a neutrophil capable of inducing ADCC.
  • ADCC antibody-dependent cell-mediated cytotoxicity
  • monocytes, macrophages, which express FcR are involved in specific killing of target cells and presenting antigens to other components of the immune system, or binding to cells that present antigens.
  • an effector cell can phagocytose a target antigen, target cell, or microorganism.
  • the expression of a particular FcR on an effector cell can be regulated by humoral factors such as cytokines.
  • Fc ⁇ RI has been found to be up-regulated by interferon gamma (IFN- ⁇ ). This enhanced expression increases the cytotoxic activity of Fc ⁇ RI-bearing cells against targets.
  • An effector cell can phagocytose or lyse a target antigen or a target cell.
  • Target cell shall mean any undesirable cell in a subject (e.g., a human or animal) that can be targeted by a composition (e.g., a human monoclonal antibody, a bispecific or a multispecific molecule) of the invention.
  • the target cell is a cell expressing or overexpressing PSMA.
  • Cells expressing PSMA typically include tumor cells, such as bladder, breast, colon, kidney, ovarian, prostate, renal cell, squamous cell, lung (non-small cell), and head and neck tumor cells.
  • Other target cells include synovial fibroblast cells.
  • Chimeric mouse-human monoclonal antibodies i.e., chimeric antibodies
  • the chimeric antibody can be further humanized by replacing sequences of the Fv variable region which are not directly involved in antigen binding with equivalent sequences from human Fv variable regions.
  • General reviews of humanized chimeric antibodies are provided by Morrison, S. L., 1985, Science 229:1202-1207 and by Oi et al, 1986, BioTechniques 4:214. Those methods include isolating, manipulating, and expressing the nucleic acid sequences that encode all or part of immunoglobulin Fv variable regions from at least one of a heavy or light chain.
  • Sources of such nucleic acid are well known to those skilled in the art and, for example, may be obtained from 7E3, an anti-GPIIbIII a antibody producing hybridoma.
  • the recombinant DNA encoding the chimeric antibody, or fragment thereof, can then be cloned into an appropriate expression vector.
  • Suitable humanized antibodies can alternatively be produced by CDR substitution U.S. Patent 5,225,539; Jones et al. 1986 Nature 321 :552- 525; Verhoeyan et al. 1988 Science 239:1534; and Beidler et al. 1988 J. Immunol. 141 :4053-4060.
  • All of the CDRs of a particular human antibody may be replaced with at least a portion of a nonhuman CDR or only some of the CDRs may be replaced with nonhuman CDRs. It is only necessary to replace the number of CDRs required for binding of the humanized antibody to the Fc receptor.
  • An antibody can be humanized by any method, which is capable of replacing at least a portion of a CDR of a human antibody with a CDR derived from a nonhuman antibody. Winter describes a method which may be used to prepare the humanized antibodies of the present invention (UK Patent Application GB 2188638 A, filed on March 26, 1987), the contents of which is expressly inco ⁇ orated by reference.
  • the human CDRs may be replaced with nonhuman CDRs using oligonucleotide site- directed mutagenesis as described in International Application WO 94/10332 entitled, Humanized Antibodies to Fc Receptors for Immunoglobulin G on Human Mononuclear Phagocytes.
  • chimeric and humanized antibodies in which specific amino acids have been substituted, deleted or added.
  • preferred humanized antibodies have amino acid substitutions in the framework region, such as to improve binding to the antigen.
  • amino acids located in the human framework region can be replaced with the amino acids located at the corresponding positions in the mouse antibody.
  • modified antibodies in which amino acids have been added, deleted, or substituted are referred to herein as modified antibodies or altered antibodies.
  • modified antibody is also intended to include antibodies, such as monoclonal antibodies, chimeric antibodies, and humanized antibodies which have been modified by, e.g., deleting, adding, or substituting portions of the antibody.
  • an antibody can be modified by deleting the constant region and replacing it with a constant region meant to increase half-life, e.g., serum half-life, stability or affinity of the antibody. Any modification is within the scope of the invention so long as the bispecific and multispecific molecule has at least one antigen binding region specific for an Fc ⁇ R and triggers at least one effector function.
  • Bispecific and multispecific molecules of the present invention can be made using chemical techniques (see e.g., D. M. Kranz et al. (1981) Proc. Natl. Acad. Sci. USA 78:5807), "polydoma” techniques (See U.S. Patent 4,474,893, to Reading), or recombinant DNA techniques.
  • bispecific and multispecific molecules of the present invention can be prepared by conjugating the constituent binding specificities, e.g., the anti-FcR and anti-PSMA binding specificities, using methods known in the art and described in the examples provided herein. For example, each binding specificity of the bispecific and multispecific molecule can be generated separately and then conjugated to one another.
  • cross-linking agents include protein A, carbodiimide, N-succinimidyl-S-acetyl- thioacetate (SATA), 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB), o- phenylenedimaleimide (oPDM), N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP), and sulfosuccinimidyl 4-(N-maleimidomethyl) cyclohaxane-1 -carboxylate (sulfo- SMCC) (see e.g., Ka ⁇ ovsky et al.
  • the binding specificities are antibodies (e.g., two humanized antibodies), they can be conjugated via sulfhydryl bonding of the C-terminus hinge regions of the two heavy chains.
  • the hinge region is modified to contain an odd number of sulfhydryl residues, preferably one, prior to conjugation.
  • both binding specificities can be encoded in the same vector and expressed and assembled in the same host cell.
  • This method is particularly useful where the bispecific and multispecific molecule is a mAb x mAb, mAb x Fab, Fab x F(ab')2 or ligand x Fab fusion protein.
  • a bispecific and multispecific molecule of the invention e.g., a bispecific molecule can be a single chain molecule, such as a single chain bispecific antibody, a single chain bispecific molecule comprising one single chain antibody and a binding determinant, or a single chain bispecific molecule comprising two binding determinants.
  • Bispecific and multispecific molecules can also be single chain molecules or may comprise at least two single chain molecules.
  • Binding of the bispecific and multispecific molecules to their specific targets can be confirmed by enzyme-linked immunosorbent assay (ELISA), a radioimmunoassay (RIA), FACS analysis, a bioassay (e.g. , growth inhibition), or a Western Blot Assay.
  • ELISA enzyme-linked immunosorbent assay
  • RIA radioimmunoassay
  • FACS analysis e.g. , FACS analysis
  • bioassay e.g. , growth inhibition
  • Western Blot Assay e.g., Western Blot Assay.
  • Each of these assays generally detects the presence of protein- antibody complexes of particular interest by employing a labeled reagent (e.g., an antibody) specific for the complex of interest.
  • the FcR-antibody complexes can be detected using e.g., an enzyme-linked antibody or antibody fragment which recognizes and specifically binds to the antibody-FcR complexes.
  • the complexes can be detected using any of a variety of other immunoassays.
  • the antibody can be radioactively labeled and used in a radioimmunoassay (RIA) (see, for example, Weintraub, B., Principles of Radioimmunoassays, Seventh Training Course on Radiohgand Assay Techniques, The Endocrine Society, March, 1986, which is inco ⁇ orated by reference herein).
  • the radioactive isotope can be detected by such means as the use of a ⁇ counter or a scintillation counter or by autoradiography.
  • the present invention features a human anti-PSMA monoclonal antibody, or a fragment thereof, conjugated to another therapeutic moiety, such as a cytotoxin, a drug or a radioisotope.
  • a cytotoxin conjugated to a cytotoxin
  • these antibody conjugates are referred to as "immunotoxins.”
  • a cytotoxin or cytotoxic agent includes any agent that is detrimental to (e.g., kills) cells or which inhibits their growth.
  • Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1- dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof.
  • Therapeutic agents also include, for example, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis- dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g., vincri
  • Human antibodies of the present invention also can be conjugated to a radioisotope, e.g., radioactive iodine, to generate cytotoxic or non-cytotoxic radiopharmaceuticals for treating or diagnosing PSMA-related disorders (e.g., tumors).
  • a radioisotope e.g., radioactive iodine
  • Antibody conjugates of the invention can be used to modify a given biological response, and the drug moiety is not to be construed as limited to classical chemical therapeutic agents.
  • the drug moiety may be a protein or polypeptide possessing a desired biological activity.
  • Such proteins may include, for example, an enzymatically active toxin, or active fragment thereof, such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor or interferon- ⁇ ; or, biological response modifiers such as, for example, lymphokines, interleukin-1 ("IL-1”), interleukin-2 (“IL-2”), interleukin-6 (“IL-6”), granulocyte macrophage colony stimulating factor (“GM-CSF”), granulocyte colony stimulating factor (“G-CSF”), or other growth factors.
  • IL-1 interleukin-1
  • IL-2 interleukin-2
  • IL-6 interleukin-6
  • GM-CSF granulocyte macrophage colony stimulating factor
  • G-CSF granulocyte colony stimulating factor
  • the present invention provides a composition, e.g., a pharmaceutical composition, containing one or a combination of human monoclonal antibodies, or antigen-binding portion(s) thereof, of the present invention, formulated together with a pharmaceutically acceptable carrier.
  • a pharmaceutical composition e.g., a pharmaceutical composition, containing one or a combination of human monoclonal antibodies, or antigen-binding portion(s) thereof, of the present invention, formulated together with a pharmaceutically acceptable carrier.
  • Such compositions may include one or a combination of (e.g., two or more different) human antibodies of the invention.
  • the invention provides a therapeutic composition comprising a combination of human anti-PSMA antibodies which bind to different epitopes on human PSMA and have complementary activities, e.g., as a pharmaceutical composition.
  • a human monoclonal antibody that mediates highly effective killing of target cells in the presence of effector cells can be combined with another human monoclonal antibody that inhibits the growth of cells expressing PSMA.
  • the therapeutic composition comprises one or a combination of immunoconjugates or bispecific (or multispecific) molecules of the invention.
  • compositions of the invention also can be administered in combination therapy, i.e., combined with other agents.
  • the combination therapy can include a composition of the present invention with at least one anti-tumor agent or other conventional therapy.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and abso ⁇ tion delaying agents, and the like that are physiologically compatible.
  • the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion).
  • the active compound i.e., antibody, bispecific and multispecific molecule, may be coated in a material to protect the compound from the action of acids and other natural conditions that may inactivate the compound.
  • a “pharmaceutically acceptable salt” refers to a salt that retains the desired biological activity of the parent compound and does not impart any undesired toxicological effects (see e.g., Berge, S.M., et al. (1977) J. Pharm. Sci. 66:1-19).
  • Acid addition salts include those derived from nontoxic inorganic acids, such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous and the like, as well as from nontoxic organic acids such as aliphatic mono- and dicarboxylic acids, phenyl- substituted alkanoic acids, hydroxy alkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids and the like.
  • Base addition salts include those derived from alkaline earth metals, such as sodium, potassium, magnesium, calcium and the like, as well as from nontoxic organic amines, such as N,N'-dibenzylethylenediamine, N- methylglucamine, chloroprocaine, choline, diethanolamine, ethylenediamine, procaine and the like.
  • a composition of the present invention can be administered by a variety of methods known in the art. As will be appreciated by the skilled artisan, the route and/or mode of administration will vary depending upon the desired results.
  • the active compounds can be prepared with carriers that will protect the compound against rapid release, such as a controlled release formulation, including implants, transdermal patches, and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Many methods for the preparation of such formulations are patented or generally known to those skilled in the art. See, e.g., Sustained and Controlled Release Drug Delivery Systems, J.R. Robinson, ed., Marcel Dekker, Inc., New York, 1978.
  • the compound may be administered to a subject in an appropriate carrier, for example, liposomes, or a diluent.
  • suitable diluents include saline and aqueous buffer solutions.
  • Liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes (Strejan et al. (1984) J. Neuroimmunol. 7:27).
  • Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • the use of such media and agents for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions of the invention is contemplated. Supplementary active compounds can also be inco ⁇ orated into the compositions.
  • Therapeutic compositions typically must be sterile and stable under the conditions of manufacture and storage.
  • the composition can be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.
  • Prolonged abso ⁇ tion of the injectable compositions can be brought about by including in the composition an agent that delays abso ⁇ tion, for example, monostearate salts and gelatin.
  • Sterile injectable solutions can be prepared by inco ⁇ orating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by sterilization microfiltration.
  • dispersions are prepared by inco ⁇ orating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze- drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Dosage regimens are adjusted to provide the optimum desired response (e.g., a therapeutic response). For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage.
  • Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subjects to be treated; each unit contains a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • the specification for the dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individuals.
  • antioxidants examples include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
  • water soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like
  • oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), le
  • formulations of the present invention include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal and/or parenteral administration.
  • the formulations may conveniently be presented in unit dosage form and may be prepared by any methods known in the art of pharmacy.
  • the amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the subject being treated, and the particular mode of administration.
  • the amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the composition which produces a therapeutic effect. Generally, out of one hundred per cent, this amount will range from about 0.01 per cent to about ninety-nine percent of active ingredient, preferably from about 0.1 per cent to about 70 per cent, most preferably from about 1 per cent to about 30 per cent.
  • Formulations of the present invention which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate.
  • Dosage forms for the topical or transdermal administration of compositions of this invention include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants.
  • the active compound may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required.
  • parenteral administration and “administered parenterally” as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion.
  • aqueous and nonaqueous carriers examples include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate.
  • polyols such as glycerol, propylene glycol, polyethylene glycol, and the like
  • vegetable oils such as olive oil
  • injectable organic esters such as ethyl oleate.
  • Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
  • These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents.
  • Prevention of presence of microorganisms may be ensured both by sterilization procedures, supra, and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged abso ⁇ tion of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay abso ⁇ tion such as aluminum monostearate and gelatin.
  • the compounds of the present invention are administered as pharmaceuticals, to humans and animals, they can be given alone or as a pharmaceutical composition containing, for example, 0.01 to 99.5% (more preferably, 0.1 to 90%) of active ingredient in combination with a pharmaceutically acceptable carrier.
  • the compounds of the present invention which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art.
  • Actual dosage levels of the active ingredients in the pharmaceutical compositions of the present invention may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
  • the selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular compositions of the present invention employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.
  • a physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required.
  • the physician or veterinarian could start doses of the compounds of the invention employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
  • a suitable daily dose of a compositions of the invention will be that amount of the compound which is the lowest dose effective to produce a therapeutic effect.
  • Such an effective dose will generally depend upon the factors described above. It is preferred that administration be intravenous, intramuscular, intraperitoneal, or subcutaneous, preferably administered proximal to the site of the target.
  • the effective daily dose of a therapeutic compositions may be administered as two, three, four, five, six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms. While it is possible for a compound of the present invention to be administered alone, it is preferable to administer the compound as a pharmaceutical formulation (composition).
  • compositions can be administered with medical devices known in the art.
  • a therapeutic composition of the invention can be administered with a needleless hypodermic injection device, such as the devices disclosed in U.S. Patent Nos. 5,399,163; 5,383,851; 5,312,335; 5,064,413; 4,941,880; 4,790,824; or 4,596,556.
  • a needleless hypodermic injection device such as the devices disclosed in U.S. Patent Nos. 5,399,163; 5,383,851; 5,312,335; 5,064,413; 4,941,880; 4,790,824; or 4,596,556.
  • Examples of well-known implants and modules useful in the present invention include: U.S. Patent No. 4,487,603, which discloses an implantable micro-infusion pump for dispensing medication at a controlled rate; U.S. Patent No. 4,486,194, which discloses a therapeutic device for administering medicants through the skin; U.S. Patent No.
  • the human monoclonal antibodies of the invention can be formulated to ensure proper distribution in vivo.
  • the blood-brain barrier excludes many highly hydrophilic compounds.
  • the therapeutic compounds of the invention cross the BBB (if desired)
  • they can be formulated, for example, in liposomes.
  • liposomes For methods of manufacturing liposomes, see, e.g., U.S. Patents 4,522,811; 5,374,548; and 5,399,331.
  • the liposomes may comprise one or more moieties which are selectively transported into specific cells or organs, thus enhance targeted drug delivery (see, e.g., V.V. Ranade (1989) J. Clin. Pharmacol. 29:685).
  • Exemplary targeting moieties include folate or biotin (see, e.g., U.S. Patent 5,416,016 to Low et al); mannosides (Umezawa et al, (1988) Biochem. Biophys. Res. Commun. 153:1038); antibodies (P.G. Bloeman et al. (1995) FEBS Lett. 357:140; M. Owais et al. (1995) Antimicrob. Agents Chemother. 39:180); surfactant protein A receptor (Briscoe et al. (1995) Am. J. Physiol.
  • the therapeutic compounds of the invention are formulated in liposomes; in a more preferred embodiment, the liposomes include a targeting moiety. In a most preferred embodiment, the therapeutic compounds in the liposomes are delivered by bolus injection to a site proximal to the tumor or infection.
  • a "therapeutically effective dosage" preferably inhibits tumor growth by at least about 20%, more preferably by at least about 40%, even more preferably by at least about 60%, and still more preferably by at least about 80% relative to untreated subjects.
  • the ability of a compound to inhibit cancer can be evaluated in an animal model system predictive of efficacy in human tumors. Alternatively, this property of a composition can be evaluated by examining the ability of the compound to inhibit, such inhibition in vitro by assays known to the skilled practitioner.
  • a therapeutically effective amount of a therapeutic compound can decrease tumor size, or otherwise ameliorate symptoms in a subject.
  • One of ordinary skill in the art would be able to determine such amounts based on such factors as the subject's size, the severity of the subject's symptoms, and the particular composition or route of administration selected.
  • the composition must be sterile and fluid to the extent that the composition is deliverable by syringe.
  • the carrier can be an isotonic buffered saline solution, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof.
  • Proper fluidity can be maintained, for example, by use of coating such as lecithin, by maintenance of required particle size in the case of dispersion and by use of surfactants.
  • isotonic agents for example, sugars, polyalcohols such as mannitol or sorbitol, and sodium chloride in the composition.
  • Long-term abso ⁇ tion of the injectable compositions can be brought about by including in the composition an agent which delays abso ⁇ tion, for example, aluminum monostearate or gelatin.
  • the compound When the active compound is suitably protected, as described above, the compound may be orally administered, for example, with an inert diluent or an assimilable edible carrier.
  • Human monoclonal anti-PSMA antibodies and related derivatives/conjugates and compositions of the present invention have a variety of in vitro and in vivo diagnostic and therapeutic utilities.
  • these molecules can be administered to cells in culture, e.g. in vitro or ex vivo.
  • they can be administered to a subject, e.g., in vivo, to treat, prevent or diagnose a variety of PSMA- related disorders.
  • the term "subject" is intended to include both human and nonhuman animals.
  • Preferred subjects include human patients exhibiting disorders characterized by expression of PSMA, typically aberrant expression (e.g., overexpression) of PSMA.
  • the methods and compositions of the present invention can be used to treat subjects with tumorigenic disorders characterized by the presence of tumor cells expressing PSMA including, for example, prostate cancer, colon cancer, and renal carcinoma.
  • nonhuman animals of the invention includes all vertebrates, e.g., mammals and non-mammals, such as nonhuman primates, sheep, dog, cow, chickens, amphibians, reptiles, etc.
  • the invention provides a method for treating prostate cancer in a subject comprising administering to the subject one of the anti- PSMA antibodies of the invention.
  • the anti-PSMA antibody is administered as a conjugate, wherein the antibody is linked to, for example, a radioactive agent or a cytotoxic drug.
  • the anti-PSMA antibody is administered as a bispecific molecule, e.g., linked to anti-Fc ⁇ RI or anti-Fc ⁇ .
  • Human antibodies of the invention can be initially tested for binding activity associated with therapeutic or diagnostic use in vitro.
  • compositions of the invention can be tested using the ELISA and flow cytometric assays described in the Examples below.
  • the activity of these molecules in triggering at least one effector-mediated effector cell activity, including cytolysis of cells expressing PSMA can be assayed. Protocols for assaying for effector cell- mediated phagocytosis are described in the Examples below.
  • Human antibodies of the invention also have additional utility in therapy and diagnosis of PSMA-related diseases.
  • the human monoclonal antibodies, the multispecific or bispecific molecules can be used, for example, to elicit in vivo or in vitro one or more of the following biological activities: to opsonize a cell expressing PSMA; to mediate phagocytosis or cytolysis of a cell expressing PSMA in the presence of human effector cells; or to inhibit the growth of a cell expressing PSMA.
  • Suitable methods for administering antibodies and compositions of the present invention are well known in the art. Suitable dosages also can be determined within the skill in the art and will depend on the age and weight of the subject and the particular drug used.
  • Human anti-PSMA antibodies of the invention also can be co- administered with other therapeutic agents, e.g., a chemotherapeutic agent, or can be co- administered with other known therapies, e.g. , an anti-cancer therapy, e.g. , radiation.
  • therapeutic agents include, among others, anti-neoplastic agents such as doxorubicin (adriamycin), cisplatin bleomycin sulfate, carmustine, chlorambucil, and cyclophosphamide hydroxyurea which, by themselves, are only effective at levels which are toxic or subtoxic to a patient.
  • Cisplatin is intravenously administered as a 100 mg/m dose once every four weeks and adriamycin is intravenously administered as a 60-75 mg/m dose once every 21 days.
  • Co-administration of the human anti-PSMA antibodies, or antigen binding fragments thereof, of the present invention with chemotherapeutic agents provides two anti-cancer agents which operate via different mechanisms which yield a cytotoxic effect to human tumor cells. Such co- administration can solve problems due to development of resistance to drugs or a change in the antigenicity of the tumor cells which would render them unreactive with the antibody.
  • Target-specific effector cells e.g. , effector cells linked to human antibodies, multispecific or bispecific molecules of the invention, also can also be used as therapeutic agents.
  • Effector cells for targeting can be human leukocytes such as macrophages, neutrophils or monocytes. Other cells include eosinophils, natural killer cells and other IgG- or IgA-receptor bearing cells. If desired, effector cells can be obtained from the subject to be treated.
  • the target-specific effector cells can be administered as a suspension of cells in a physiologically acceptable solution.
  • the number of cells administered can be in the order of 10°-l ⁇ " but will vary depending on the therapeutic pu ⁇ ose. In general, the amount will be sufficient to obtain localization at the target cell, e.g., a tumor cell expressing PSMA, and to effect cell killing by, e.g., phagocytosis. Routes of administration can also vary.
  • Target-specific effector cells can be performed in conjunction with other techniques for removal of targeted cells.
  • anti- tumor therapy using the compositions (e.g., human antibodies, multispecific and bispecific molecules) of the invention and/or effector cells armed with these compositions can be used in conjunction with chemotherapy.
  • combination immunotherapy may be used to direct two distinct cytotoxic effector populations toward tumor cell rejection.
  • anti-PSMA antibodies linked to anti-Fc-gammaRI or anti-CD3 may be used in conjunction with IgG- or IgA-receptor specific binding agents.
  • Bispecific and multispecific molecules of the invention can also be used to modulate Fc ⁇ R or Fc ⁇ R levels on effector cells, such as by capping and elimination of receptors on the cell surface.
  • compositions e.g., human antibodies, multispecific and bispecific molecules
  • complement binding sites such as portions from IgGl, -2, or -3 or IgM which bind complement
  • ex vivo treatment of a population of cells comprising target cells with a binding agent of the invention and appropriate effector cells can be supplemented by the addition of complement or serum containing complement.
  • Phagocytosis of target cells coated with a binding agent of the invention can be improved by binding of complement proteins.
  • target cells coated with the compositions (e.g., human antibodies, multispecific and bispecific molecules) of the invention can also be lysed by complement.
  • the compositions of the invention do not activate complement.
  • compositions e.g., human antibodies, multispecific and bispecific molecules
  • compositions comprising human antibodies, multispecific or bispecific molecules and serum or complement. These compositions are advantageous in that the complement is located in close proximity to the human antibodies, multispecific or bispecific molecules.
  • the human antibodies, multispecific or bispecific molecules of the invention and the complement or serum can be administered separately.
  • kits comprising the compositions (e.g., human antibodies, multispecific and bispecific molecules) of the invention and instructions for use.
  • the kit can further contain a least one additional reagent, such as complement, or one or more additional human antibodies of the invention (e.g., a human antibody having a complementary activity which binds to an epitope in PSMA antigen distinct from the first human antibody).
  • a least one additional reagent such as complement
  • one or more additional human antibodies of the invention e.g., a human antibody having a complementary activity which binds to an epitope in PSMA antigen distinct from the first human antibody.
  • the subject can be additionally treated with an agent that modulates, e.g., enhances or inhibits, the expression or activity of Fc ⁇ or Fc ⁇ receptors by, for example, treating the subject with a cytokine.
  • cytokines for administration during treatment with the multispecific molecule include of granulocyte colony-stimulating factor (G-CSF), granulocyte- macrophage colony-stimulating factor (GM-CSF), interferon- ⁇ (IFN- ⁇ ), and tumor necrosis factor (TNF).
  • G-CSF granulocyte colony-stimulating factor
  • GM-CSF granulocyte- macrophage colony-stimulating factor
  • IFN- ⁇ interferon- ⁇
  • TNF tumor necrosis factor
  • the compositions (e.g., human antibodies, multispecific and bispecific molecules) of the invention can also be used to target cells expressing Fc ⁇ R or PSMA, for example for labeling such cells.
  • the binding agent can be linked to a molecule that can be detected.
  • the invention provides methods for localizing ex vivo or in vitro cells expressing Fc receptors, such as Fc ⁇ R, or PSMA.
  • the detectable label can be, e.g., a radioisotope, a fluorescent compound, an enzyme, or an enzyme co- factor.
  • Human antibodies of the invention also can be used to detect the presence of PSMA antigen in a sample, or to measure the amount of PSMA antigen in a sample, by contacting the sample (e.g., along with a control sample) with the human monoclonal antibody under conditions that allow for formation of a complex between the antibody and PSMA. The formation of a complex is then detected, wherein a difference complex formation between the sample compared to the control sample is indicative the presence of PSMA antigen in the sample.
  • the invention provides a method for detecting the presence or quantifying the amount of Fc-expressing cells in vivo or in vitro.
  • the method comprises (i) administering to a subject a composition (e.g., a multi- or bispecific molecule) of the invention or a fragment thereof, conjugated to a detectable marker; (ii) exposing the subject to a means for detecting said detectable marker to identify areas containing Fc-expressing cells.
  • a composition e.g., a multi- or bispecific molecule
  • exposing the subject to a means for detecting said detectable marker to identify areas containing Fc-expressing cells.
  • PSMA- HuMAbs were detected using a solid-phase ELISA-based assay. Immunoaffinity purified PSMA from LNCaP cells, or bacterially-expressed fusion proteins containing PSMA derived fragments, were coated onto Maxi-So ⁇ (Nunc, Rochester, NY) 96-well plates with an overnight incubation at 4°C. The plates were washed with PBS-O.2% Tween-20 and blocked with 5% BSA in PBS for 1 hour at room temperature. Fifty ⁇ l of supernatant from the hybridoma cultures was added to the PSMA-coated wells and the plates were incubated for 2 hours at room temperature.
  • the plates were washed as above and 50 ⁇ l of 1 : 1000 diluted rabbit-anti-human IgG H&L chain (ICN, Costa Mesa, CA) was added to each well. Following a one-hour incubation at room temperature, the plates were washed as above and 50 ⁇ l of a 1 :2000 dilution of HRP-conjugated Protein- A (Sigma, St. Louis, MO) was added to each well. Following a one-hour incubation at room temperature, the plates were washed as above and 100 ⁇ l of ABTS (150 mg 2,2'- azino-bis(3-ethylbenzthiazoline-6-sulfonic acid in 500 ml of 0.1 M citric acid, pH 4.
  • ABTS 150 mg 2,2'- azino-bis(3-ethylbenzthiazoline-6-sulfonic acid in 500 ml of 0.1 M citric acid, pH 4.
  • 35VH2O2 (10 ⁇ l 30%> H2O2 per 10 ml of ABTS solution) chromagen/substrate solution was added to each well. After a five minute incubation the reaction was stopped with the addition of 100 ⁇ l of stop solution (SDS/dimethylformamide) and the absorbance at 405 nm was read in a microplate reader. The hybridoma cells producing supernatants with high A 405 values were cloned by limiting dilution and subjected to additional analysis.
  • Monoclonal antibodies were isolated from a Cellmax bioreactor (Cellco, Website, CA) using RPMI- 1640 medium containing 1- to 5% Fetalclone (Hyclone, Logan, UT). Monoclonal antibodies were purified by chromatography on a Protein A-Agarose column according to manufacturer's specifications (KPL, Gaithersburg, MD).
  • LNCaP cells were scraped from plastic dishes, washed extensively in PBS, resuspended in 10 volumes of deionized water, and homogenized by three strokes with a Dounce homogenizer. The membrane fraction was isolated by centrifugation at 15,000 x g for 45 minutes and the pellet resuspended in PBS. Protein concentration of the membrane pellet was determined using the Pierce (Rockford, IL) BCA kit.
  • the blots were washed 5 times with TBS containing 0.5% Tween-20 (TBS-T), the blots were developed using the LumiGLO chemiluminescent substrate kit (KPL, Gaithersburg, MD), and visualized by exposing x-ray film.
  • TBS-T TBS containing 0.5% Tween-20
  • KPL LumiGLO chemiluminescent substrate kit
  • a detergent lysate of LNCaP cells was prepared by adding PBS containing 1% NP-40 to LNCaP cells, incubating for one hour, and centrifugation to remove particulate material.
  • the lysate was pre-cleared by adding 150 ⁇ g irrelevant human IgG t per ml of lysate, incubating for one hour at room temperature, followed by the addition of 150 ⁇ l of packed Protein G-Sepharose beads per ml lystae. The supernatant fraction was used after centrifugation to remove the beads. Aliquots, 100 ⁇ l each, of the pre-cleared lysate were mixed with 5 ⁇ g of antibody protein and incubated overnight at 4°C.
  • LNCaP and PC-3 cells were freshly harvested from tissue culture flasks and a single cell suspension prepared. LNCaP cell suspensions were either stained with primary antibody directly or after fixation with 1% paraformaldehyde in PBS. Approximately one million cells were resuspended in PBS containing 0.5% BSA and 50-200 ⁇ g/ml of primary antibody and incubated on ice for 30 minutes. The cells were washed twice with PBS containing 0.1% BSA, 0.01% NaN 3 , resuspended in 100 ⁇ l of 1 : 100 diluted FITC-conjugated goat-anti-human IgG (Jackson
  • FITC labeling of monoclonal antibodies Purified monoclonal antibodies were first extensively dialyzed against O.3M sodium carbonate buffer, pH 9.5. A stock fluorescein isothiocyanate (FITC) solution was prepared by dissolving 1 mg solid FITC in 1 ml of DMSO. Stock FITC was added dropwise with constant mixing in an amount to provide 50 ⁇ g FITC per mg of antibody protein. Once added, the solution was incubated in the dark at room temperature for 1-3 hours. FITC-labeled antibody was isolated by gel filtration on a Sephadex G-IO column equilibrated in PBS.
  • FITC fluorescein isothiocyanate
  • DOT A labeling of 4 A3 and 7F12 Five milligrams of 4A3 and 7F 12 antibody protein was DOTA labeled via direct coupling of one of the four carboxylic acid groups of DOTA to amino groups of the antibody protein.
  • DOTA tetraazacyclododecanetetraacidic acid
  • the protein in approximately 1.5 ml of PBS was first washed in a centrifugal concentrator with a M r 25,000 cut-off using 5 x 4ml of 1 %
  • DTP A diethylenetriaminepentaacetic acid
  • the antibody buffer was then changed to 0.1 M phosphate, pH 7.0 using the same procedure.
  • An active ester of DOTA was created by dissolving 30 mg of DOTA (0.072 mmol) in 0.4 ml water and the pH was adjusted to 7.3 with NaOH.
  • Ten mg of l-ethyl-3-(3- dimethylaminopropyl)carbodiimide was then added and the mixture cooled on ice for one hour and added to the antibody solution and stirred at 4°C overnight.
  • the resultant DOTA-antibody conjugate was separated from excess DOTA and other reactants by repeated washing with 0.3 M NH 4 Oac and centrifugal concentration.
  • Antibody inhibition studies Approximately one million LNCaP cells were initially treated with 200 ⁇ g/ml purified 4A3, 7F12, 8A11, 8C12, 16F9, or irrelevant human IgGj antibody in PBS for one hour on ice. After washing, the cells were incubated with 50 ⁇ g/ml FITC conjugated human or murine anti-PSMA monoclonal antibody for one hour on ice. After washing, the cells were stained with 10 ⁇ g/ml propidium iodide and analyzed by flow cytometry on a FACsCalibur with CellQuest software.
  • antibody protein was iodinated with 1- to 1.5 mCi of 125 1 using lodobeads (Pierce) according to manufacturer's instructions.
  • LNCaP cells were plated into 6- well plates and allowed to reach near confluency. The medium was then removed and the wells washed with PBS to remove non-adherant cells. The cells were then labeled with 125 I-labeled HuMAb or isotype matched irrelevant human IgG present at a concentration of 10 ⁇ g/ml in a total volume of 1.5 ml in fresh culture medium and incubated in a 37°C incubator for 10 minutes. At the end of this period the medium was removed, the cells washed extensively with PBS to remove unbound labeled antibody, 1.5 ml of culture medium was added, and the plates returned to the 37° incubator for the desired incubation time.
  • the culture medium was removed, centrifuged to eliminate non-adherent cells.
  • the supernatant fraction was cooled on ice, and subjected to TCA precipitation by addition of 100% TCA to yield a 10% final TCA concentration.
  • the fraction was centrifuged for 10 minutes at 1000 xg and the supernatant removed. The amount of radioactivity present in both the TCA soluble and insoluble fractions was determined in a gamma counter.
  • the adherent cells present in the wells after removal of the medium for TCA precipitation were released using trypsin and placed in a tube for counting along with a 1ml wash with 0.1N NaOH.
  • the radioactivity bound to the cells was also determined in a gamma counter. The proportion of the total counts originally bound to the cells which was internalized, processed, and distributed into the TCA soluble fraction with time was plotted.
  • ADCC and CDC tests were four hour 51 Cr release assays using LNCaP cells as target cells. Assays were conducted in 96-well plates with 2500 targets per well in triplicate using an effector to target cell ratio (E:T ratio) of 100: 1. Effector cells were PBMC's isolated from one male and one female donor. For CDC assays, fresh human plasma at a final concentration of 1 :200 was used as a complement source.
  • Tissue cross reactivity screening of HuMAbs by IHC Conditions for IHC cross reactivity screening were first optimized by use of a fixed concentration of purified unconjugated human monoclonal antibody (5 ⁇ g/ml) and varying concentrations of biotinylated goat-anti -human IgGl secondary antibody on frozen tissue sections fixed by treatment with acetone for 10 minutes after cryotomy or with 10% neutral-buffered formalin for 10 seconds immediately prior to staining. Based upon these conditions, a second test was conducted with the optimized secondary antibody concentration with varying concentrations of the HuMAb primary antibody.
  • tissue screening was conducted on human frozen sections after fixation in acetone for 10 minutes at the time of cryotomy followed by 10 seconds in 10% neutral-buffered formalin immediately prior to staining. Staining was done with primary antibody at a concentration of 5 ⁇ g/ml containing 1.5 mg/ml excess carrier IgG followed by 7.5 ⁇ g/ml biotinylated goat-anti-human IgG secondary antibody containing 1.5 mg/ml excess carrier IgG. Heat aggregated rabbit IgG (1 mg/ml), 5% normal goat serum, and 1% BSA were included in the protein block of the sections.
  • the plasmid pICEmu contains an EcoRI/XhoI fragment of the murine Ig heavy chain locus, spanning the mu gene, that was obtained from a Balb/C genomic lambda phage library (Marcu et al. Cell 22: 187, 1980). This genomic fragment was subcloned into the XhoI/EcoRI sites of the plasmid pICEMI9H (Marsh et al; Gene 32, 481-485, 1984).
  • the heavy chain sequences included in pICEmu extend downstream of the EcoRI site located just 3' of the mu intronic enhancer, to the Xhol site located approximately 1 kb downstream of the last transmembrane exon of the mu gene; however, much of the mu switch repeat region has been deleted by passage in E. coli.
  • the targeting vector was constructed as follows. A 1.3 kb Hindlll/Smal fragment was excised from pICEmu and subcloned into Hindlll/Smal digested pBluescript (Stratagene, La Jolla, CA). This pICEmu fragment extends from the Hindlll site located approximately 1 kb 5' of Cmul to the Smal site located within Cmul. The resulting plasmid was digested with Smal/Spel and the approximately 4 kb Smal/Xbal fragment from pICEmu, extending from the Smal site in Cmul 3' to the Xbal site located just downstream of the last Cmu exon, was inserted.
  • pTARl The resulting plasmid, pTARl, was linearized at the Smal site, and a neo expression cassette inserted.
  • This cassette consists of the neo gene under the transcriptional control of the mouse phosphoglycerate kinase (pgk) promoter (Xbal/Taql fragment; Adra et al. (1987) Gene 60: 65-74) and containing the pgk polyadenylation site (PvuII/Hindlll fragment; Boer et al. (1990) Biochemical Genetics 28: 299-308).
  • pgk mouse phosphoglycerate kinase
  • This cassette was obtained from the plasmid pKJl (described by Tybulewicz et al (1991) Cell 65: 1153-1163) from which the neo cassette was excised as an EcoRI/Hindlll fragment and subcloned into EcoRI/Hindlll digested pGEM-7Zf (+) to generate pGEM-7 (KJ1).
  • the neo cassette was excised from pGEM-7 (KJ1) by EcoRI/Sall digestion, blunt ended and subcloned into the Smal site of the plasmid pTARl, in the opposite orientation of the genomic Cmu sequences.
  • tk he ⁇ es simplex virus thymidine kinase cassette
  • This cassette consists of the coding sequences of the tk gene bracketed by the mouse pgk promoter and polyadenylation site, as described by Tybulewicz et al. (1991) Cell 65: 1153-1163.
  • the resulting CMD targeting vector contains a total of approximately 5.3 kb of homology to the heavy chain locus and is designed to generate a mutant mu gene into which has been inserted a neo expression cassette in the unique Smal site of the first Cmu exon.
  • the targeting vector was linearized with Pvul, which cuts within plasmid sequences, prior to electroporation into ES cells.
  • Generation and analysis of targeted ES cells AB-1 ES cells (McMahon,
  • Isolated genomic DNA was digested with Spel and probed with a 915 bp Sad fragment, probe A (see Figure 1), which hybridizes to a sequence between the mu intronic enhancer and the mu switch region.
  • Probe A detects a 9.9 kb Spel fragment from the wild type locus, and a diagnostic 7.6 kb band from a mu locus which has homologously recombined with the CMD targeting vector (the neo expression cassette contains a Spel site).
  • the CMD targeting vector the neo expression cassette contains a Spel site.
  • 3 displayed the 7.6 kb Spel band indicative of homologous recombination at the mu locus.
  • mice bearing the mutated mu gene The three targeted ES clones, designated number 264, 272, and 408, were thawed and injected into C57BL/6J blastocysts as described by Bradley (Bradley, A. (1987) in Teratocarcinomas and Embryonic Stem Cells: a Practical Approach. (E. J. Robertson, ed.) Oxford: IRL Press, p. 113-151). Injected blastocysts were transferred into the uteri of pseudopregnant females to generate chimeric mice representing a mixture of cells derived from the input ES cells and the host blastocyst.
  • ES cell contribution to the chimera can be visually estimated by the amount of agouti coat coloration, derived from the ES cell line, on the black C57BL/6J background.
  • Clones 272 and 408 produced only low percentage chimeras (i.e. low percentage of agouti pigmentation) but clone 264 produced high percentage male chimeras. These chimeras were bred with C57BL/6J females and agouti offspring were generated, indicative of germline transmission of the ES cell genome.
  • Screening for the targeted mu gene was carried out by Southern blot analysis of Bgll digested DNA from tail biopsies (as described above for analysis of ES cell DNA). Approximately 50% of the agouti offspring showed a hybridizing Bgll band of 7.7 kb in addition to the wild type band of 15.7 kb, demonstrating a germline transmission of the targeted mu gene.
  • Table 1 shows the levels of serum IgM, detected by ELISA, for mice carrying both the CMD and JHD mutations (CMD/JHD), for mice heterozygous for the JHD mutation (+/JHD), for wild type (129Sv x C57BL/6J)F1 mice (+/+), and for B cell deficient mice homozygous for the JHD mutation (JHD/JHD).
  • the HCO12 human heavy chain transgene was generated by coinjection of the 80 kb insert of pHC2 (Taylor et al, 1994, Int. Immunol., 6: 579-591) and the 25 kb insert of pVx6.
  • the plasmid pVx6 was constructed as described below.
  • a new cloning vector derived from pGPlf, pGPlk was digested with EcoRV/BamHI, and ligated to a 10 kb EcoRV/BamHI DNA fragment, comprising the germline human V H 3-23 (DP47) gene together with approximately 4 kb of 5' flanking and 5 kb of 3' flanking genomic sequence.
  • the resulting plasmid, pi 12.2RR.7 was digested with BamHI/Sall and ligated with the 7 kb purified BamHI/Sall insert of p251f.
  • the resulting plasmid, pVx4 was digested with Xhol and ligated with the 8.5 kb Xhol/Sall insert of p343.7.16.
  • a clone was obtained with the V H 1-18 gene in the same orientation as the other two V genes.
  • This clone, designated pVx6, was then digested with Notl and the purified 26 kb insert coinjected (together with the purified 80 kb Notl insert of pHC2 at a 1 :1 molar ratio) into the pronuclei of one-half day (C57BL/6J x DBA/2J)F2 embryos as described by Hogan et al. (B. Hogan et al, Manipulating the Mouse Embryo, A Laboratory Manual, 2 nd edition, 1994, Cold Spring Harbor Laboratory Press, Plainview NY).
  • mice Three independent lines of transgenic mice comprising sequences from both Vx6 and HC2 were established from mice that developed from the injected embryos. These lines are designated (HCO12)14881, (HCO12)15083, and (HCO12)15087. Each of the three lines were then bred with mice comprising the CMD mutation described in Example 1, the JKD mutation (Chen et al. 1993, EMBO J. 12: 811-820), and the
  • mice express human immunoglobulin heavy and kappa light chain transgenes in a background homozygous for disruption of the endogenous mouse heavy and kappa light chain loci.
  • Antigen Northwest Biotherapeutics, Inc was provided in two forms: (1) cell membranes and (2) purified protein (PSMA) isolated from LNCaP cells (Cat#CRL-1740; American Type Culture Collection, Rockville, MD). With purified antigen (1.05 mg/ml), one immunization and the final tail vein boosts were performed.
  • the monoclonal antibody 7E11.C5 was obtained from Cytogen, Inc, Princeton, NJ. Soluble PSMA and membranes from LNCaP cells were mixed with either complete or incomplete Freunds adjuvant (CFA and IF A). Mice were injected with 0.2cc prepared antigen into the intraperitoneal cavity. Final tail vein immunizations were performed with soluble PSMA in sterile PBS.
  • mice were housed in filter cages and were evaluated to be in good physical condition on dates of immunization, bleeds and the day of the fusion.
  • Hybridomas 4 A3, 7F12, 8A11, 8C12, and 16F9 were produced by a male mouse ID#17018 of the (CMD)++; (HCol2) 15087+; (JKD) ++; (KCo5) 9272+ genotype.
  • Individual transgene designations are in parentheses, followed by line numbers for randomly integrated transgenes.
  • mice are routinely screened using a PCR-based assay that does not allow distinction between heterozygosity and homozygosity for the randomly integrated human Ig transgenes, a + designation may be given to mice that are actually homozygous for these elements.
  • Immunization Procedure The immunization schedule is listed in Table 2. Mouse #17018 was fused on Day 112 included among a cohort often mice from HCo7 and HCol2 genotypes. All immunizations were injected into the intraperitoneal cavity. Three and two days prior to fusion, IV boosts were performed. TABLE 2
  • Hybridoma Preparation The P3 X63 ag8.653 myeloma cell line (ATCC CRL 1580, lot F-15183) was used for the fusions. The original ATCC vial was thawed and expanded in culture. A seed stock of frozen vials was prepared from this expansion. Cells are maintained in culture for 3-6 months, passed twice a week. P388D1 (ATCC TIB-63 FL) was expanded to 200mLs and exhausted. The supernatant was spun and filtered and used as a media addition for the hybridomas. This cell line is passed for 3-6 months when a new vial is thawed. High Glucose DMEM: (Mediatech Cellgro, # 1001233) containing 10%
  • FBS and Penicillin-Streptomycin (Gibco, #11K1763) was used to culture P388D1 cells and myeloma cells. Additional media supplements were added to the Hybridoma growth media.
  • the spleen from mouse number #17018 was normal in size and yielded 1.78 x 10 viable cells. The splenocytes were fused.
  • the initial ELISA screen for human IgG, ⁇ antibodies was performed 7- 10 days post fusion. Human IgG, ⁇ positive wells were then screened on soluble PSMA coated ELISA plates. Antigen positive hybridomas were then transferred to 24 well plates, and eventually to tissue culture flasks. PSMA specific hybridomas were subcloned by limiting dilution to assure monoclonality. Antigen positive hybridomas were preserved at several stages in the development process by freezing cells in DMEM, 50% FBS plus 10% DMSO (Sigma, D2650).
  • the titers for mouse #17018 are shown below in the table.
  • the titers are Hu- antigen specific- ⁇ .
  • the response to the antigen after repeated immunizations show a robust response level and the mouse was prepared for fusion.
  • the fusion resulted in 38 Hu- ⁇ , ⁇ hybridomas that were re-screened on antigen.
  • the bispecific molecule designated 14A8 x 8C12 was made by chemical conjugation of the Fab' 2 fragments from the human anti-CD89 antibody 14A8 or a subclone of the 14A8 antibody, designated 14A8, and the human anti-PSMA antibody, 8C12, via disulfide bonds using standard cross-linking procedures (Figure 6).
  • Figure 6 The bispecific molecule designated 14A8 x 8C12 was made by chemical conjugation of the Fab' 2 fragments from the human anti-CD89 antibody 14A8 or a subclone of the 14A8 antibody, designated 14A8, and the human anti-PSMA antibody, 8C12, via disulfide bonds using standard cross-linking procedures (Figure 6).
  • Figure 6 Example 4 Binding Characteristics of Human anti-PSMA Antibodies
  • Solid phase ELISA studies Binding characteristics of anti-PSMA specific antibodies were studied by comparing reactivities (solid phase ELISA) against full length PSMA and bacterially expressed fusion proteins containing portions of the PSMA protein.
  • HuMAbs 4A3, 7F12, 8A11, 8C12, and 16F9 reacted with purified PSMA but were unreactive with any fusion protein containing a portion of the PSMA sequence (results not shown).
  • the HuMAb 11C10 reacted strongly with both full length PSMA and the fusion protein containing the PSMA amino acid 1-173 sequence ( Figure 1). A lower level of binding of the 11 CIO antibody was also observed to the amino acid 134-437 PSMA fragment.
  • Binding characteristics of human anti-PSMA specific antibodies were also studied by solid phase ELISA using plasma membrane fractions derived from both LNCaP and PC3 cells. Membrane fractions were serially diluted in 96-well plates and air dried. The plates were blocked with 5% BSA and treated with 5 ⁇ g/ml antibody in PBS for one hour prior to detection using standard ELISA procedures.
  • FIG. 3 shows results from a solid phase ELISA with native and heat denatured PSMA.
  • the murine anti-PSMA monoclonal antibody 7E11 specific for an epitope composed of the first six amino acids from the N-terminal of the protein, was used as a positive control. The results indicate that heat denaturation has no impact on 7E11 binding, consistent with its recognition of a linear sequence epitope.
  • antibodies 4A3, 7F12, 8A11, 8C12, and 16F9 all strongly bound to native purified PSMA.
  • heat denaturation of PSMA virtually abolished antibody binding indicating a native protein conformation is required for antibody binding.
  • antibodies 4A3, 7F12, 8A11, 8C12, and 16F9 were ineffective in detecting PSMA in a Western blot analysis (results not shown).
  • HuMAbs 4A3, 7F12, 8A11, 8C12, and 16F9 do not recognize linear amino acid sequence epitopes but instead bind to protein conformational epitopes, i.e., native protein epitopes resulting from conformational folding of the PSMA molecules which arise when amino acids from differing portions of the linear sequence come together in close proximity in 3-dimensional space. Such conformational epitopes are distributed on the extracellular side of the plasma membrane.
  • Immunoprecipitation of PSMA from LNCaP Cells The binding specificity of antibodies 4A3, 7F12, 8A11, 8C12, and 16F9 was studied by immunoprecipitation of protein derived from a 1% NP-40 detergent lysate of LNCaP cells. The lysate was treated with antibody followed by addition of Protein G-Sepharose beads. The beads were washed extensively and the bound immune complex subjected to SDS gel electrophoresis and Western blotting with the murine linear PSMA sequence epitope specific antibody 4D8. The results are shown in Figure 4.
  • Lane 1 shows Western blot reactivity of PSMA and PSM' (an alternate splice variant missing the first 57 amino acids from the N-terminal) present in LNCaP cell lysate.
  • Lane 2 shows results from immunoprecipitation with an isotype matched (IgGi) irrelevant human antibody.
  • Lanes 3 through 7 show results from immunoprecipitation with antibodies 4A3, 7F12, 8A11, 8C12, and 16F9, respectively. In each case, intense bands corresponding to both PSMA and PSM' are observed indicating these antibodies bind to protein epitopes present within the extracellular domain of the protein.
  • HuMAb binding to PSMA expressed on live LNCaP cells Antibody binding to viable and non-viable (fixed) LNCaP cells was studied by flow cytometry using irrelevant human IgGj antibody as a control. Viable cells are a propidium iodide negative cell population. Fixed cells were treated with 1% paraformaldehyde in PBS prior to primary antibody treatment. Strong binding of antibodies 4 A3, 7F12, 8A11, 8C12, and 16F9 was observed to both live and fixed LNCaP cells. Negative staining was observed with PC3 cells or when an isotype matched irrelevant human antibody was used with LNCaP cells.
  • HuMAbs exhibit strong antibody binding to live LNCaP cells and bind to an epitope related to that bound by the murine conformational antibody 3C6.
  • HuMAb binding competition with murine PSMA conformational antibodies Murine PSMA-specific antibodies designated 1G9, 3C6, and 4D4 were developed which are also directed toward protein conformational epitopes. Antibody competition studies, as measured by flow cytometry, were conducted with antibodies 1G9, 3C6, and 4D4 to determine if the HuMAbs recognize epitopes in common with the murine antibodies. The ability of unlabeled HuMAbs to block binding of FITC-labeled 1G9, 3C6, and 4D4 was tested. Pretreatment of LNCaP cells with HuMAbs, followed by labeling with FITC -murine 4D4 and 1G9, indicated similar results with little or no apparent inhibition. In contrast, significant inhibition of FITC-3C6 was observed by HuMAbs 4A3, 7F12, 8A11, 8C12, and 16F9 indicating each binds to a similar or closely distributed epitope as recognized by 3C6.
  • PSMA HuMAbs are highly sensitive to the native conformation of PSMA. Numerous experiments to determine affinity constants using purified PSMA failed to provide reliable or reproducible results. Experiments were conducted to obtain some affinity binding information from native PSMA as expressed in viable LNCaP cells. To test the binding affinity of each antibody to native PSMA, a flow cytometric assay was used in which the primary antibody concentration was varied for a fixed number of LNCaP cells (1 x 10 ) with excess FITC-labeled secondary antibody. The data in Table 4 shows results expressed as the antibody concentration required to give half maximal shift in cell labeling intensity. These results demonstrate that the highest binding affinities were found with antibodies 4A3, 7F12, and 16F9. Antibody 8C12 had about a 3-fold lower binding affinity followed by antibody 8A11 with a binding affinity approximately 20- fold lower than the high affinity antibodies.
  • Antibody dependent cell-mediated cytotoxicity (ADCC) activity of human anti-PSMA antibodies The ability of anti-PSMA HuMAbs to mediate antibody dependent cellular cytotoxicity (ADCC) or complement dependent cytotoxicity (CDC) was tested for each conformational antibody described in the examples above in experiments using PBMC's from two donors. The results shown in Figure 5A and B indicate strong ADCC for each HuMAb. Each HuMAb has similar titer and has reactivity similar to Herceptin as a positive control ( Figure 5B). No CDC activity was observed for any HuMAb (data not shown),
  • ADCC antibody dependent cell-mediated cytotoxicity
  • mononuclear cells mononuclear cells (monocytes and neutrophils), as well as whole blood, were isolated from healthy donors and incubated with 51 Cr labeled PSMA expressing tumor cells in the presence of bispecific molecule 14A8 x 8C12. After approximately 4 hours, the culture supernatant from the wells was harvested and 51 Cr release measured on a gamma counter. The percent specific lysis was determined according the following formula: (experimental CPM - target leak CPM)/(detergent lysis CPM - target leak CPM) x 100%.
  • the results, shown in Figures 7A, 8 A and 9A demonstrate that 14A8 x 8C12 mediates dose dependent lysis of tumor cells by monocytes and neutrophils and whole blood, respectively, as compared to a control antibody.
  • LNCaP cells were labeled with 100 ⁇ Ci of 51 Cr for 1 hour at 37°C (5% CO 2 ) prior to incubation with mononuclear cells and whole blood, along with various concentrations of bispecific or monoclonal antibody. After an incubation of 16 hours, the supernatant was harvested and analyzed for radioactivity as described above.
  • Monocyte Induced ADCC As shown in Figure 7A, bispecific molecule 14A8 x 8C12 mediated cell killing of tumor cells expressing PSMA by monocytes in a dose dependent fashion. Addition of 50 ⁇ g/ml of 14A8 Fab' 2 completely blocked ADCC of the tumor cells by 1 ⁇ g/ml of the bispecific molecule 14A8 8C12, demonstrating that targeted cell killing was mediated exclusively by CD89 on the effector cells. As shown in Figure 7B, bispecific molecule 14A8 x 8C12 and monoclonal antibody 8C12 also mediated dose dependent lysis by monocytes of LNCaP tumor cells.
  • Neutrophil Induced ADCC As shown in Figure 8A, bispecific molecule 14A8 x 8C12 mediated cell killing of tumor cells expressing PSMA by neutrophils in a dose dependent fashion. Addition of 25 ⁇ g/ml of 14A8 Fab' 2 significantly blocked ADCC of the tumor cells by the bispecific molecule, demonstrating that targeted cell killing was mediated specifically by CD89 binding to the effector cells. As shown in Figure 8B, bispecific molecule 14A8 x 8C12 also mediated dose dependent lysis by neutrophils of LNCaP tumor cells.
  • Human anti-PSMA antibodies and bispecific antibodies mediate phagocytosis and killing of tumor cells expressing PSMA in the presence of human effector cells: Bispecific molecule 14A8 x 8C12 and the monoclonal antibody 8C12 were tested for their ability to mediate phagocytosis of labeled PSMA-expressing tumor cells (LNCaP cells) alone, as well as in the presence of excess 14A8 (human anti-Fc ⁇ R) Fab' 2 antibody or excess H22 (humanized anti-Fc ⁇ RI) Fab' 2 antibody as a control.
  • the labeled LNCaP cells were added to the wells containing MDM in the absence or presence of bispecific antibody (or control antibody) and incubated at 37° C for 5-24 hours (5% CO 2 ).
  • MDM and non-phagocytized LNCaP cells were recovered with trypsin, and stained with a FITC-labeled anti-CD33 mAb (251) and an anti-CD14 mAb (AML-2-23) for 1 hour on ice (4°C). Cells were washed and analyzed by two color fluorescence using the F ACScan. Percent phagocytosis was calculated as the number of dual-positive target cells (ingested by MDM) divided by the total number of target cells x 100%.
  • bispecific molecule 14A8 x 8C12 mediated increasing specific phagocytosis of tumor cells in a dose-dependent fashion.
  • Addition of 14A8 Fab' 2 significantly blocked phagocytosis of the tumor cells by the bispecific molecule, again demonstrating that targeted phagocytosis was mediated specifically by CD89 binding to the effector cells.
  • bispecific molecule 14A8 x 8C12 and monoclonal antibody 8C12 also mediated phagocytosis of LNCaP cells in a dose dependent fashion.
  • Figure 12 shows that 14A8 x 8C12 mediated phagocytosis of LNCaP tumor cells was mediated through CD89, as it was inhibited by the addition of excess 14A8 F(ab)' 2 , as compared to H22 F(ab)' 2 (humanized anti-Fc ⁇ RI) (see inset, Figure 12).
  • tumor labeling is highest compared to normal tissues (2-fold or greater labeling compared to normal tissues) after 24 hours.
  • significant biodistribution to tumor tissue occurs.
  • the extent of tumor labeling with time after uptake may be, in part, a function of diminished levels of circulating antibody and antibody internalization of bound antibody with the resultant release from the cell of labeled antibody protein fragments.
  • Antibodies were DOTA-labeled and the effect on antibody binding to antigen tested by ELISA.
  • DOTA tetraazacyclododecanetetraacidic acid
  • the results in Figure 16 demonstrate that DOTA-labeled antibodies retain high antigen binding capability indicating these antibodies will be useful in forming radiometal chelates.
  • Binding affinity of anti-PSMA HuMAbs was determined using flow cytometry with LNCaP cells wherein the HuMAb was diluted out over a series of tubes of cells. The amount of antibody bound was detected using an FITC-labeled secondary antibody present in saturating amounts. The data, analyzed as the amount of antibody protein required for Vz maximal shift (the shift seen with saturating HuMAb), was as follows:
  • PolyA + mRNA and first strand cDNA were prepared from the anti- PSMA hybridomas utilizing mRNA isolation and cDNA synthesis kits (Invitrogen, Carlsbad, C A).
  • the 4 A3, 7F 12 and 8C12 V regions were amplified by polymerase chain reaction (PCR) utilizing a panel of 5' primers that correspond to human VH and V L (or V K ) signal sequences.
  • the 8A11 and 16F9 V regions were amplified using primers that bind to the 5' end of the mature V region sequences in framework 1.
  • the 3' V H and V R PCR primers contained the following sequences, respectively: TGCCAGGGGGAAGACCGATGG (SEQ ID NO: 57) and
  • the foregoing examples demonstrate the production of five fully human monoclonal antibodies specific for conformational epitopes on human PSMA, as well as therapeutic bispecific agents containing the antibodies. All five antibodies had high antigen specificity and reactivity with native, but not denatured, PSMA. The antibodies are efficiently internalized into PSMA expressing cells, have strong antibody-dependent cell mediated cytotoxicity (ADCC) activity, bio-distribute to PSMA expressing tumors in animal models and have similar performance in immuno-histochemical studies of human tissues, supporting their therapeutic and diagnostic utility in human treatment.
  • ADCC antibody-dependent cell mediated cytotoxicity

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Urology & Nephrology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Pregnancy & Childbirth (AREA)
  • Reproductive Health (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2003/002448 2002-01-28 2003-01-28 Human monoclonal antibodies to prostate specific membrane antigen (psma) Ceased WO2003064606A2 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
NZ534687A NZ534687A (en) 2002-01-28 2003-01-28 Human monoclonal antibodies to prostate specific membrane antigen (PSMA) seq id 54
MXPA04007262A MXPA04007262A (es) 2002-01-28 2003-01-28 Anticuerpos monoclonales humanos para antigeno de membrana especifico de prostata (psma).
JP2003564202A JP2005518789A (ja) 2002-01-28 2003-01-28 前立腺特異性膜抗原(psma)に対するヒトモノクローナル抗体
KR10-2004-7011643A KR20040077889A (ko) 2002-01-28 2003-01-28 전립선 특이적 막 항원 (psma)에 대한 인간모노클로날 항체
AU2003224604A AU2003224604B2 (en) 2002-01-28 2003-01-28 Human monoclonal antibodies to prostate specific membrane antigen (PSMA)
CA002474616A CA2474616A1 (en) 2002-01-28 2003-01-28 Human monoclonal antibodies to prostate specific membrane antigen (psma)
BR0307216-9A BR0307216A (pt) 2002-01-28 2003-01-28 Anticorpos monoclonais humanos para antìgeno de membrana especìfica de próstata (psma)
EP03721280A EP1519747A4 (en) 2002-01-28 2003-01-28 HUMAN MONOCLONAL ANTIBODIES AGAINST PROSTATE-SPECIFIC MEMBRANE ANTIGEN (PSMA)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US5998902A 2002-01-28 2002-01-28
US10/059,989 2002-01-28

Publications (2)

Publication Number Publication Date
WO2003064606A2 true WO2003064606A2 (en) 2003-08-07
WO2003064606A3 WO2003064606A3 (en) 2005-02-03

Family

ID=27658271

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/002448 Ceased WO2003064606A2 (en) 2002-01-28 2003-01-28 Human monoclonal antibodies to prostate specific membrane antigen (psma)

Country Status (10)

Country Link
EP (1) EP1519747A4 (https=)
JP (1) JP2005518789A (https=)
KR (1) KR20040077889A (https=)
CN (1) CN1652821A (https=)
AU (1) AU2003224604B2 (https=)
BR (1) BR0307216A (https=)
CA (1) CA2474616A1 (https=)
MX (1) MXPA04007262A (https=)
NZ (1) NZ534687A (https=)
WO (1) WO2003064606A2 (https=)

Cited By (51)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005090407A1 (en) * 2004-03-19 2005-09-29 Imclone Systems Incorporated Human anti-epidermal growth factor receptor antibody
WO2006003179A2 (en) 2004-07-01 2006-01-12 Novo Nordisk A/S Antibodies binding to receptors kir2dl1, -2, 3 but not kir2ds4 and their therapeutic use
WO2006072626A1 (en) 2005-01-06 2006-07-13 Novo Nordisk A/S Kir-binding agents and methods of use thereof
WO2006089230A3 (en) * 2005-02-18 2006-11-16 Medarex Inc Human monoclonal antibodies to prostate specific membrane antigen (psma)
WO2006089231A3 (en) * 2005-02-18 2006-12-07 Medarex Inc Monoclonal antibodies against prostate specific membrane antigen (psma) lacking in fucosyl residues
US7201900B2 (en) 1996-03-25 2007-04-10 Medarex, Inc. Monoclonal antibodies specific for the extracellular domain of prostate-specific membrane antigen
JP2007514419A (ja) * 2003-12-10 2007-06-07 メダレックス インコーポレーティッド Ip−10抗体およびその用途
JP2007533330A (ja) * 2004-02-06 2007-11-22 ユニバーシティー オブ マサチューセッツ クロストリジウム・ディフィシル(Clostridiumdifficile)毒素に対する抗体およびその使用
JP2008508852A (ja) * 2004-04-13 2008-03-27 エフ.ホフマン−ラ ロシュ アーゲー 抗p−セレクチン抗体
US7381407B1 (en) 1996-03-25 2008-06-03 Medarex, Inc. Monoclonal antibodies specific for the extracellular domain of prostate-specific membrane antigen
US7399461B2 (en) 1993-11-05 2008-07-15 Sloan-Kettering Institute For Cancer Research Prostate-specific membrane antigen and uses thereof
JP2008541711A (ja) * 2005-05-27 2008-11-27 ユニベルシテーツクリニクム フライブルグ 細胞表面の前立腺特異的膜抗原に対するモノクローナル抗体および単鎖抗体フラグメント
US7850971B2 (en) 2001-10-23 2010-12-14 Psma Development Company, Llc PSMA antibodies and protein multimers
EP2287195A2 (en) 2004-07-01 2011-02-23 Novo Nordisk A/S Pan-KIR2DL NK-receptor antibodies and their use in diagnostik and therapy
EP2419451A4 (en) * 2009-04-14 2012-11-14 Proscan Rx Pharma Inc ANTIBODIES DIRECTED AGAINST THE PROSTATE-SPECIFIC MEMBRANE ANTIGEN
US8470330B2 (en) 2001-10-23 2013-06-25 Psma Development Company, Llc PSMA antibodies and uses thereof
WO2014057074A1 (en) 2012-10-12 2014-04-17 Spirogen Sàrl Pyrrolobenzodiazepines and conjugates thereof
JP2014077015A (ja) * 2005-05-09 2014-05-01 Ono Pharmaceut Co Ltd ProgrammedDeath1(PD−1)に対するヒトモノクローナル抗体および抗PD−1抗体単独または他の免疫療法と併用した癌治療方法
WO2014140174A1 (en) 2013-03-13 2014-09-18 Spirogen Sàrl Pyrrolobenzodiazepines and conjugates thereof
US9242012B2 (en) 2008-09-08 2016-01-26 Psma Development Company, Llc Methods for killing PSMA-expressing, taxane-resistant cancer cells
WO2016037644A1 (en) 2014-09-10 2016-03-17 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US9296708B2 (en) 2008-05-13 2016-03-29 Yale University Chimeric small molecules for the recruitment of antibodies to cancer cells
WO2017073981A1 (ko) * 2015-10-27 2017-05-04 (주)알테오젠 항체-약물 접합체 및 그 제조방법
US9782478B1 (en) 2011-04-22 2017-10-10 Aptevo Research And Development Llc Prostate-specific membrane antigen binding proteins and related compositions and methods
WO2018069289A1 (en) 2016-10-11 2018-04-19 Medimmune Limited Antibody-drug conjugates with immune-mediated therapy agents
WO2018098356A1 (en) * 2016-11-23 2018-05-31 Harpoon Therapeutics, Inc. Psma targeting trispecific proteins and methods of use
US10066016B2 (en) 2016-05-20 2018-09-04 Harpoon Therapeutics, Inc. Single chain variable fragment CD3 binding proteins
US10100106B2 (en) 2016-05-20 2018-10-16 Harpoon Therapeutics, Inc. Single domain serum albumin binding protein
US10287321B2 (en) 2011-03-17 2019-05-14 The University Of Birmingham Re-directed immunotherapy
WO2019224275A1 (en) 2018-05-23 2019-11-28 Adc Therapeutics Sa Molecular adjuvant
US10543271B2 (en) 2017-05-12 2020-01-28 Harpoon Therapeutics, Inc. Mesothelin binding proteins
EP3434690A4 (en) * 2016-03-23 2020-04-01 Seoul National University R&DB Foundation ANTIBODY BINDING TO HULL GLYCOPROTEIN OF HEAVY-FEVER-WITH-THROMBOZYTOPENIA-SYNDROME-VIRUS AND THE USE THEREOF
US10730954B2 (en) 2017-05-12 2020-08-04 Harpoon Therapeutics, Inc. MSLN targeting trispecific proteins and methods of use
US10815311B2 (en) 2018-09-25 2020-10-27 Harpoon Therapeutics, Inc. DLL3 binding proteins and methods of use
US10849973B2 (en) 2016-11-23 2020-12-01 Harpoon Therapeutics, Inc. Prostate specific membrane antigen binding protein
US10927180B2 (en) 2017-10-13 2021-02-23 Harpoon Therapeutics, Inc. B cell maturation antigen binding proteins
US10954311B2 (en) 2015-05-21 2021-03-23 Harpoon Therapeutics, Inc. Trispecific binding proteins and methods of use
GB202102396D0 (en) 2021-02-19 2021-04-07 Adc Therapeutics Sa Molecular adjuvant
US11136403B2 (en) 2017-10-13 2021-10-05 Harpoon Therapeutics, Inc. Trispecific proteins and methods of use
US11180563B2 (en) 2020-02-21 2021-11-23 Harpoon Therapeutics, Inc. FLT3 binding proteins and methods of use
WO2022079211A1 (en) 2020-10-16 2022-04-21 Adc Therapeutics Sa Glycoconjugates
US11352426B2 (en) 2015-09-21 2022-06-07 Aptevo Research And Development Llc CD3 binding polypeptides
US11535668B2 (en) 2017-02-28 2022-12-27 Harpoon Therapeutics, Inc. Inducible monovalent antigen binding protein
US11623958B2 (en) 2016-05-20 2023-04-11 Harpoon Therapeutics, Inc. Single chain variable fragment CD3 binding proteins
WO2023078273A1 (en) 2021-11-03 2023-05-11 Hangzhou Dac Biotech Co., Ltd. Specific conjugation for an antibody-drug conjugate
WO2023088966A1 (en) 2021-11-19 2023-05-25 Adc Therapeutics Sa Anti-psma conjugates
US11702482B2 (en) 2018-12-17 2023-07-18 Revitope Limited Twin immune cell engager
WO2024118940A1 (en) * 2022-12-01 2024-06-06 Twist Bioscience Corporation Anti-psma antibodies and uses thereof
US12195544B2 (en) 2018-09-21 2025-01-14 Harpoon Therapeutics, Inc. EGFR binding proteins and methods of use
US12415860B2 (en) 2018-05-14 2025-09-16 Harpoon Therapeutics, Inc. Binding moiety for conditional activation of immunoglobulin molecules
US12516128B2 (en) 2019-05-14 2026-01-06 Harpoon Therapeutics, Inc. EpCAM binding proteins and methods of use

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7105159B1 (en) 1992-11-05 2006-09-12 Sloan-Kettering Institute For Cancer Research Antibodies to prostate-specific membrane antigen
CA2645809C (en) * 2006-03-14 2015-05-26 Cancer Targeted Technology Llc Peptidomimetic inhibitors of psma, compounds comprising them, and methods of use
US20110293619A1 (en) * 2008-10-01 2011-12-01 Micromet Ag CROSS-SPECIES-SPECIFIC PSMAxCD3 BISPECIFIC SINGLE CHAIN ANTIBODY
CN101891818B (zh) * 2009-01-16 2012-07-25 中国人民解放军第四军医大学 抗人前列腺特异性膜抗原胞外区单链抗体及其应用
CN103333249A (zh) * 2013-06-14 2013-10-02 广州康合生物科技有限公司 一种抗前列腺特异性膜抗原(psma)的单克隆抗体及其应用
AR104484A1 (es) * 2015-03-10 2017-07-26 Sorrento Therapeutics Inc Anticuerpos anti-psma como agentes terapéuticos
WO2021164692A1 (zh) * 2020-02-18 2021-08-26 和铂医药(上海)有限责任公司 一种分离的结合抗原psma的蛋白及其用途

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2155854T3 (es) * 1993-06-09 2001-06-01 Unilever Nv Procedimiento de produccion de proteinas de fusion que comprende fragmentos de scfv con la ayuda de un molde transformado.
US7563874B2 (en) * 1998-08-31 2009-07-21 The Regents Of The University Of California Therapeutic monoclonal antibodies that neutralize botulinum neurotoxins
NZ517331A (en) * 1999-07-29 2004-02-27 Medarex Inc Human monoclonal antibodies to prostate specific membrane antigen and a transgenic mouse to produce the antibody
GB0001448D0 (en) * 2000-01-21 2000-03-08 Novartis Ag Organic compounds
PT2281843T (pt) * 2000-06-16 2017-01-02 Human Genome Sciences Inc Anticorpos que se ligam imunoespecificamente a blys
JP5355839B2 (ja) * 2001-10-23 2013-11-27 ピーエスエムエー デベロプメント カンパニー, エル.エル.シー. Psma抗体およびタンパク質マルチマー
ATE452650T1 (de) * 2002-08-30 2010-01-15 Biorexis Pharmaceutical Corp Transferrin-fusionsproteinbibliotheken
WO2004050850A2 (en) * 2002-12-02 2004-06-17 Abgenix, Inc. Antibodies directed to phospholipase a2 and uses thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
GONG M.C. ET AL.: 'Prostate-specific membrane antigen (PMSA)-specific monoclonal antibodies in the treatment of prostate and other cancers' CANCER METASTASIS REV. vol. 18, no. 4, 1999, pages 483 - 490, XP002982445 *
GREEN L.L. ET AL.: 'Antibody engineering via genetic engineering of the mouse: XenoMouse strains are a vehicle for the facile generation of therapeutic human monoclonal antibodies' J. IMMUNOL. METHODS vol. 231, 1999, pages 11 - 23, XP004187631 *
See also references of EP1519747A2 *

Cited By (88)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7399461B2 (en) 1993-11-05 2008-07-15 Sloan-Kettering Institute For Cancer Research Prostate-specific membrane antigen and uses thereof
US7476513B2 (en) 1996-03-25 2009-01-13 Medarex, Inc. Monoclonal antibody specific for the extracellular domain of prostate specific membrane antigen
US7201900B2 (en) 1996-03-25 2007-04-10 Medarex, Inc. Monoclonal antibodies specific for the extracellular domain of prostate-specific membrane antigen
US7381407B1 (en) 1996-03-25 2008-06-03 Medarex, Inc. Monoclonal antibodies specific for the extracellular domain of prostate-specific membrane antigen
US7850971B2 (en) 2001-10-23 2010-12-14 Psma Development Company, Llc PSMA antibodies and protein multimers
US9695248B2 (en) 2001-10-23 2017-07-04 Psma Development Company, Llc PSMA antibodies and uses thereof
US8470330B2 (en) 2001-10-23 2013-06-25 Psma Development Company, Llc PSMA antibodies and uses thereof
US8114965B2 (en) 2001-10-23 2012-02-14 Psma Development Company, Llc Compositions of PSMA antibodies
JP4942487B2 (ja) * 2003-12-10 2012-05-30 メダレックス インコーポレーティッド Ip−10抗体およびその用途
JP2007514419A (ja) * 2003-12-10 2007-06-07 メダレックス インコーポレーティッド Ip−10抗体およびその用途
JP2012100667A (ja) * 2003-12-10 2012-05-31 Medarex Inc Ip−10抗体およびその用途
JP2007533330A (ja) * 2004-02-06 2007-11-22 ユニバーシティー オブ マサチューセッツ クロストリジウム・ディフィシル(Clostridiumdifficile)毒素に対する抗体およびその使用
JP2011019516A (ja) * 2004-02-06 2011-02-03 Univ Of Massachusetts クロストリジウム・ディフィシル(Clostridiumdifficile)毒素に対する抗体およびその使用
EP2332990A1 (en) * 2004-03-19 2011-06-15 Imclone LLC Human anti-epidermal growth factor receptor antibody
WO2005090407A1 (en) * 2004-03-19 2005-09-29 Imclone Systems Incorporated Human anti-epidermal growth factor receptor antibody
US7598350B2 (en) * 2004-03-19 2009-10-06 Imclone Llc Human anti-epidermal growth factor receptor antibody
USRE44359E1 (en) 2004-04-13 2013-07-09 Hoffmann-La Roche Inc Nucleic acid molecules encoding anti-P-selectin antibodies
JP2008508852A (ja) * 2004-04-13 2008-03-27 エフ.ホフマン−ラ ロシュ アーゲー 抗p−セレクチン抗体
USRE44389E1 (en) 2004-04-13 2013-07-23 Hoffman-La Roche Inc. Methods of inhibiting the binding of P-selectin to PSGL-1 with anti-P-selectin antibodies
USRE43568E1 (en) 2004-04-13 2012-08-07 Hoffmann-La Roche Inc. Anti-P-selectin antibodies
EP2287195A2 (en) 2004-07-01 2011-02-23 Novo Nordisk A/S Pan-KIR2DL NK-receptor antibodies and their use in diagnostik and therapy
WO2006003179A2 (en) 2004-07-01 2006-01-12 Novo Nordisk A/S Antibodies binding to receptors kir2dl1, -2, 3 but not kir2ds4 and their therapeutic use
WO2006072626A1 (en) 2005-01-06 2006-07-13 Novo Nordisk A/S Kir-binding agents and methods of use thereof
RU2421466C2 (ru) * 2005-02-18 2011-06-20 Медарекс, Инк. Выделенное антитело против специфического мембранного антигена простаты (psma) и способ ингибирования роста клеток, экспрессирующих psma
WO2006089231A3 (en) * 2005-02-18 2006-12-07 Medarex Inc Monoclonal antibodies against prostate specific membrane antigen (psma) lacking in fucosyl residues
JP2008529556A (ja) * 2005-02-18 2008-08-07 メダレックス, インク. 前立腺特異的膜抗原(psma)に対するヒトモノクローナル抗体
US7875278B2 (en) 2005-02-18 2011-01-25 Medarex, Inc. Monoclonal antibodies against prostate specific membrane antigen (PSMA) lacking in fucosyl residues
US8461308B2 (en) 2005-02-18 2013-06-11 Medarex, Inc. Monoclonal antibodies against prostate specific membrane antigen (PSMA) lacking in fucosyl residues
WO2006089230A3 (en) * 2005-02-18 2006-11-16 Medarex Inc Human monoclonal antibodies to prostate specific membrane antigen (psma)
JP2008530243A (ja) * 2005-02-18 2008-08-07 メダレックス, インク. フコシル残基を欠く前立腺特異的膜抗原(psma)に対するモノクローナル抗体
JP2014077015A (ja) * 2005-05-09 2014-05-01 Ono Pharmaceut Co Ltd ProgrammedDeath1(PD−1)に対するヒトモノクローナル抗体および抗PD−1抗体単独または他の免疫療法と併用した癌治療方法
JP2012197278A (ja) * 2005-05-27 2012-10-18 Universitaetsklinikum Freiburg 細胞表面の前立腺特異的膜抗原に対するモノクローナル抗体および単鎖抗体フラグメント
JP2008541711A (ja) * 2005-05-27 2008-11-27 ユニベルシテーツクリニクム フライブルグ 細胞表面の前立腺特異的膜抗原に対するモノクローナル抗体および単鎖抗体フラグメント
JP2016190839A (ja) * 2005-05-27 2016-11-10 ユニベルシテーツクリニクム フライブルグ 細胞表面の前立腺特異的膜抗原に対するモノクローナル抗体および単鎖抗体フラグメント
JP2014141491A (ja) * 2005-05-27 2014-08-07 Universitaetsklinikum Freiburg 細胞表面の前立腺特異的膜抗原に対するモノクローナル抗体および単鎖抗体フラグメント
US9296708B2 (en) 2008-05-13 2016-03-29 Yale University Chimeric small molecules for the recruitment of antibodies to cancer cells
US10703823B2 (en) 2008-05-13 2020-07-07 Yale University Chimeric small molecules for the recruitment of antibodies to cancer cells
US11725064B2 (en) 2008-05-13 2023-08-15 Yale University Chimeric small molecules for the recruitment of antibodies to cancer cells
US12084517B2 (en) 2008-05-13 2024-09-10 Yale University Chimeric small molecules for the recruitment of antibodies to cancer cells
US10066026B2 (en) 2008-05-13 2018-09-04 Yale University Chimeric small molecules for the recruitment of antibodies to cancer cells
US11014992B2 (en) 2008-05-13 2021-05-25 Yale University Chimeric small molecules for the recruitment of antibodies to cancer cells
US9242012B2 (en) 2008-09-08 2016-01-26 Psma Development Company, Llc Methods for killing PSMA-expressing, taxane-resistant cancer cells
EP2419451A4 (en) * 2009-04-14 2012-11-14 Proscan Rx Pharma Inc ANTIBODIES DIRECTED AGAINST THE PROSTATE-SPECIFIC MEMBRANE ANTIGEN
US11236131B2 (en) 2011-03-17 2022-02-01 The University Of Birmingham Re-directed immunotherapy
US10287321B2 (en) 2011-03-17 2019-05-14 The University Of Birmingham Re-directed immunotherapy
US9782478B1 (en) 2011-04-22 2017-10-10 Aptevo Research And Development Llc Prostate-specific membrane antigen binding proteins and related compositions and methods
WO2014057074A1 (en) 2012-10-12 2014-04-17 Spirogen Sàrl Pyrrolobenzodiazepines and conjugates thereof
EP2839860A1 (en) 2012-10-12 2015-02-25 Spirogen Sàrl Pyrrolobenzodiazepines and conjugates thereof
WO2014140174A1 (en) 2013-03-13 2014-09-18 Spirogen Sàrl Pyrrolobenzodiazepines and conjugates thereof
WO2016037644A1 (en) 2014-09-10 2016-03-17 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10954311B2 (en) 2015-05-21 2021-03-23 Harpoon Therapeutics, Inc. Trispecific binding proteins and methods of use
US12084518B2 (en) 2015-05-21 2024-09-10 Harpoon Therapeutics, Inc. Trispecific binding proteins and methods of use
US11352426B2 (en) 2015-09-21 2022-06-07 Aptevo Research And Development Llc CD3 binding polypeptides
WO2017073981A1 (ko) * 2015-10-27 2017-05-04 (주)알테오젠 항체-약물 접합체 및 그 제조방법
EP3434690A4 (en) * 2016-03-23 2020-04-01 Seoul National University R&DB Foundation ANTIBODY BINDING TO HULL GLYCOPROTEIN OF HEAVY-FEVER-WITH-THROMBOZYTOPENIA-SYNDROME-VIRUS AND THE USE THEREOF
US10947299B2 (en) 2016-03-23 2021-03-16 Seoul National University R&Db Foundation Antibody that binds to envelope glycoprotein of severe fever with thrombocytopenia syndrome virus and use for same
US10544221B2 (en) 2016-05-20 2020-01-28 Harpoon Therapeutics, Inc. Single chain variable fragment CD3 binding proteins
US11623958B2 (en) 2016-05-20 2023-04-11 Harpoon Therapeutics, Inc. Single chain variable fragment CD3 binding proteins
US11453716B2 (en) 2016-05-20 2022-09-27 Harpoon Therapeutics, Inc. Single domain serum albumin binding protein
US10100106B2 (en) 2016-05-20 2018-10-16 Harpoon Therapeutics, Inc. Single domain serum albumin binding protein
US10066016B2 (en) 2016-05-20 2018-09-04 Harpoon Therapeutics, Inc. Single chain variable fragment CD3 binding proteins
US12528859B2 (en) 2016-05-20 2026-01-20 Harpoon Therapeutics, Inc. Single domain serum albumin binding protein
WO2018069289A1 (en) 2016-10-11 2018-04-19 Medimmune Limited Antibody-drug conjugates with immune-mediated therapy agents
US10844134B2 (en) 2016-11-23 2020-11-24 Harpoon Therapeutics, Inc. PSMA targeting trispecific proteins and methods of use
WO2018098356A1 (en) * 2016-11-23 2018-05-31 Harpoon Therapeutics, Inc. Psma targeting trispecific proteins and methods of use
US10849973B2 (en) 2016-11-23 2020-12-01 Harpoon Therapeutics, Inc. Prostate specific membrane antigen binding protein
CN110198737A (zh) * 2016-11-23 2019-09-03 哈普恩治疗公司 靶向psma的三特异性蛋白质及使用方法
US11535668B2 (en) 2017-02-28 2022-12-27 Harpoon Therapeutics, Inc. Inducible monovalent antigen binding protein
US10543271B2 (en) 2017-05-12 2020-01-28 Harpoon Therapeutics, Inc. Mesothelin binding proteins
US11607453B2 (en) 2017-05-12 2023-03-21 Harpoon Therapeutics, Inc. Mesothelin binding proteins
US10730954B2 (en) 2017-05-12 2020-08-04 Harpoon Therapeutics, Inc. MSLN targeting trispecific proteins and methods of use
US10927180B2 (en) 2017-10-13 2021-02-23 Harpoon Therapeutics, Inc. B cell maturation antigen binding proteins
US11136403B2 (en) 2017-10-13 2021-10-05 Harpoon Therapeutics, Inc. Trispecific proteins and methods of use
US12371504B2 (en) 2017-10-13 2025-07-29 Harpoon Therapeutics, Inc. Trispecific proteins and methods of use
US11976125B2 (en) 2017-10-13 2024-05-07 Harpoon Therapeutics, Inc. B cell maturation antigen binding proteins
US12415860B2 (en) 2018-05-14 2025-09-16 Harpoon Therapeutics, Inc. Binding moiety for conditional activation of immunoglobulin molecules
WO2019224275A1 (en) 2018-05-23 2019-11-28 Adc Therapeutics Sa Molecular adjuvant
US12195544B2 (en) 2018-09-21 2025-01-14 Harpoon Therapeutics, Inc. EGFR binding proteins and methods of use
US11807692B2 (en) 2018-09-25 2023-11-07 Harpoon Therapeutics, Inc. DLL3 binding proteins and methods of use
US10815311B2 (en) 2018-09-25 2020-10-27 Harpoon Therapeutics, Inc. DLL3 binding proteins and methods of use
US11702482B2 (en) 2018-12-17 2023-07-18 Revitope Limited Twin immune cell engager
US12516128B2 (en) 2019-05-14 2026-01-06 Harpoon Therapeutics, Inc. EpCAM binding proteins and methods of use
US11180563B2 (en) 2020-02-21 2021-11-23 Harpoon Therapeutics, Inc. FLT3 binding proteins and methods of use
WO2022079211A1 (en) 2020-10-16 2022-04-21 Adc Therapeutics Sa Glycoconjugates
GB202102396D0 (en) 2021-02-19 2021-04-07 Adc Therapeutics Sa Molecular adjuvant
WO2023078273A1 (en) 2021-11-03 2023-05-11 Hangzhou Dac Biotech Co., Ltd. Specific conjugation for an antibody-drug conjugate
WO2023088966A1 (en) 2021-11-19 2023-05-25 Adc Therapeutics Sa Anti-psma conjugates
WO2024118940A1 (en) * 2022-12-01 2024-06-06 Twist Bioscience Corporation Anti-psma antibodies and uses thereof

Also Published As

Publication number Publication date
CA2474616A1 (en) 2003-08-07
JP2005518789A (ja) 2005-06-30
CN1652821A (zh) 2005-08-10
KR20040077889A (ko) 2004-09-07
MXPA04007262A (es) 2004-10-29
EP1519747A2 (en) 2005-04-06
WO2003064606A3 (en) 2005-02-03
AU2003224604B2 (en) 2007-06-14
EP1519747A4 (en) 2006-03-29
BR0307216A (pt) 2005-12-20
NZ534687A (en) 2007-10-26

Similar Documents

Publication Publication Date Title
AU2003224604B2 (en) Human monoclonal antibodies to prostate specific membrane antigen (PSMA)
EP1210374B1 (en) Human monoclonal antibodies to prostate specific membrane antigen
US7247301B2 (en) Human monoclonal antibodies to epidermal growth factor receptor (EGFR)
US9458236B2 (en) Human monoclonal antibodies to epidermal growth factor receptor (EGFR)
EP1210372B1 (en) Human monoclonal antibodies to her2/neu
AU2003224604A1 (en) Human monoclonal antibodies to prostate specific membrane antigen (PSMA)
AU2003205055B8 (en) Human monoclonal antibodies against CD30
AU2002345673A1 (en) Human monoclonal antibodies to epidermal growth factor receptor (EGFR)
EP1471938A2 (en) Human monoclonal antibodies against cd30
AU2002240338A1 (en) Human monoclonal antibodies to FC alpha receptor (CD89)
EP1710256A1 (en) Human monoclonal antibodies to prostate specific membrane antigen
HK1096697A (en) Human monoclonal antibodies to prostate specific membrane antigen
HK1064685B (en) Human monoclonal antibodies to epidermal growth factor receptor (egfr)
AU2006201671A1 (en) Human monoclonal antibodies to HER2/neu

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 163115

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2003564202

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2474616

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: PA/a/2004/007262

Country of ref document: MX

Ref document number: 1020047011643

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2003224604

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 200406455

Country of ref document: ZA

Ref document number: 534687

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2003721280

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 1908/CHENP/2004

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 20038073714

Country of ref document: CN

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWP Wipo information: published in national office

Ref document number: 2003721280

Country of ref document: EP

ENP Entry into the national phase

Ref document number: PI0307216

Country of ref document: BR

WWW Wipo information: withdrawn in national office

Ref document number: 2003721280

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 2003224604

Country of ref document: AU