WO2003021273A2 - Diagnosis of carcinomas - Google Patents
Diagnosis of carcinomas Download PDFInfo
- Publication number
- WO2003021273A2 WO2003021273A2 PCT/EP2002/009653 EP0209653W WO03021273A2 WO 2003021273 A2 WO2003021273 A2 WO 2003021273A2 EP 0209653 W EP0209653 W EP 0209653W WO 03021273 A2 WO03021273 A2 WO 03021273A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antibody
- he4a
- polypeptide
- molecule
- subject
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57545—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the ovaries
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/18—Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/81—Protease inhibitors
- C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
- C07K14/811—Serine protease (E.C. 3.4.21) inhibitors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
- C07K16/3069—Reproductive system, e.g. ovaria, uterus, testes, prostate
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/40—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against enzymes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/5758—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
- G01N33/57585—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites involving compounds identifiable in body fluids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
Definitions
- the present invention relates generally to malignant conditions such as cancer, and in particular to methods and compositions for diagnosing certain carcinomas such as ovarian carcinoma.
- Cancer includes a broad range of diseases, affecting approximately one in four individuals worldwide. The severity of the adverse impact of cancer is profound, influencing medical policy and procedure as well as society generally. Because a hallmark of many types of cancer is rapid and unregulated proliferation of malignant cells, an overarching problem in improving approaches to cancer is the need for early detection and diagnosis. Numerous attempts have been made to develop accurate and reliable criteria for diagnosing the presence of a malignant condition. In particular, efforts have been directed to the use of serologically defined antigenic markers known as tumor associated antigens, which are either uniquely expressed by cancer cells or are present at markedly higher levels in subjects having a malignant condition.
- tumor associated antigens serologically defined antigenic markers
- carcinoma antigens due to the high heterogeneity of tumor associated antigen expression, for example the extreme diversity of carcinoma antigens, there is a need for additional tumor markers that are useful in cancer diagnosis.
- Many monoclonal antibodies reactive with carcinoma associated antigens are known (see, e.g., Papsidero, 1985 Semin. Surg. Oncol. 1 :171, Allum et al., 1986 Surg. Ann. 18:41). These and other described monoclonal antibodies bind to a variety of different carcinoma associated antigens including glycoproteins, glycolipids and mucins (see, e.g., Fink et al., 1984 Prog. Clin. Pathol. 9:121; U.S. Patent No. 4,737,579; U.S. Patent No.
- Monoclonal antibody B72.3 specifically binds to a high molecular mass (>10 Da) tumor-associated mucin antigen that is selectively expressed on a number of different carcinomas, including most if not all ovarian carcinomas and an overwhelming majority of non-small cell lung carcinomas, colon carcinomas and breast carcinomas (see, e.g., Johnston, 1987 Acta Cytol. 1 :537; U.S. 4,612,282). Nevertheless, detection of cell- associated tumor markers such as the mucin antigen recognized by B72.3 following surgical resection of a tumor may be of limited usefulness for diagnostic screening, in which early detection of a malignant condition prior to accumulation of substantial tumor mass is preferred.
- An alternative to the diagnosis of a particular type of cancer by screening surgically resected specimens for tumor associated antigens, where invasive surgery is usually indicated only after detection of an accumulated tumor mass, would be to provide compositions and methods for detecting such antigens in samples obtained from subjects by non-invasive or minimally invasive procedures.
- ovarian and other carcinomas for example, there are currently a number of soluble tumor associated antigens that are detectable in samples of readily obtained biological fluids such as serum or mucosal secretions.
- One such marker is CA125, a carcinoma associated antigen that is also shed into the bloodstream, where it is detectable in serum (e.g., Bast et al., 1983 N. Eng. J. Med.
- CA125 levels in serum and other biological fluids have been measured along with levels of other markers, for example, carcinoembryonic antigen (CEA), squamous cell carcinoma antigen (SCC), tissue polypeptide specific antigen (TPS), sialyl TN mucin (STN) and placental alkaline phosphatase (PLAP), in efforts to provide diagnostic and/or prognostic profiles of ovarian and other carcinomas (e.g., Sarandakou et al., 1997 Acta Oncol. 36:755; Sarandakou et al., 1998 Eur. J. Gynaecol. Oncol.
- CEA carcinoembryonic antigen
- SCC squamous cell carcinoma antigen
- TPS tissue polypeptide specific antigen
- STN sialyl TN mucin
- PLAP placental alkaline phosphatase
- Elevated levels of serum CA125 alone or in combination with other known indicators do not provide a definitive diagnosis of malignancy, or of a particular malignancy such as ovarian carcinoma.
- elevated CA125, CEA and SCC in vaginal fluid and serum correlate most strongly with inflammation in benign gynecological diseases, relative to cervical cancer and genital tract cancers (e.g., Moore et al., 1998 Infect. Dis. Obstet. Gynecol. 6:182; Sarandakou et al., 1997 Acta Oncol. 36:755).
- elevated serum CA125 may also accompany neuroblastoma (e.g., Hirokawa et al., 1998 Surg.
- markers useful in multi-factor diagnostic screening are apparent. (See, e.g., Sarandakou et al., 1998; Kudoh et al., 1999; Ind et al, 1997.)
- such additional markers might be usefully provided from within the "four-disulfide core" family of proteins, which comprises a heterogeneous group of small acid- and heat-stable molecules of divergent function and which includes human epididymal four-disulfide core protein, or "HE4" (Kirchhoff et al., 1991 Biol. Reprod. 45:350-357; Wang et al., 1999 Gene 229:101; Schummer et al., 1999 Gene 238:375).
- the conserved spacing of eight core cysteine residues in the amino acid sequences of four-disulfide core family member polypeptides is thought to direct the folding of these molecules into a compact and stable structure.
- members of the four-disulfide core family are protease inhibitors; however, for some family members, including HE4, no function has yet been definitively identified.
- Other members of the four-disulfide core family of proteins include Wp- protein, SLP-1, and ps20, and additional members of the four-disulfide core family of proteins have been isolated from several species. These proteins share several properties, including their small size and their heat- and acid-stable structure, which is stabilized by the four-disulfide core. These proteins are made by secretory cells, and are found in mucous secretions such as seminal plasma, milk, parotid, and cervical secretions.
- Wp-protein The prototype molecule of the four-disulfide core family, Wp-protein, is also known as the whey phosphoprotein, and has been cloned (Dandekar et al., 1982 Proc. Natl. Acad. Sci. USA 79: 3987-3991). Whey phosphoprotein is expressed in milk at approximately 1-2 mg/ml, but is not expressed by breast carcinomas, where the gene is hypermethylated. No inhibitory activity towards proteases has been found for whey phosphoprotein. However, overexpression of the gene in transgenic animals impairs development of mammary alveolar cells (Burdon et al, 1991 Mechanisms Dev. 36: 67- 74), suggesting an important role for this protein during lactation.
- SLP-1 secretory leukocyte protease inhibitor
- SLP-1 is a two domain protein of 12 kDa that is a potent inhibitor of trypsin, chymotrypsin, elastase, and cathepsin G.
- the crystal structure of SLP-1 complexed with chymotrypsin has been published (Grutter et al, 1988 EMBOJ. 7: 345-351).
- Elafin is a single domain protein member of the four-disulfide core family that was isolated from human psoriatic skin to determine the amino acid sequence of this polypeptide (Wiedow et al, 1990 J Biol. Chem. 265: 14791-14795). Elafin is a potent inhibitor of elastase, but does not exhibit apparent inhibitory activity toward other proteases such as trypsin, chymotrypsin, cathepsin G or plasmin. The amino acid sequence of elafin shows 38% homology with the C-terminal region (domain 1) of SLP-1.
- the gene encoding the ps20 protein was recently isolated from smooth muscle, and the ps20 protein was expressed by transfection of the gene into mammalian cells (Larsen et al, 1998 J. Biol. Chem. 273: 4574-4584).
- ps20 was found to inhibit growth of carcinoma cells, and ps20 has been referred to as a growth inhibitor; however, no direct functional activity such as inhibition of proteases has been described so far for this protein.
- HE4 cDNA was first isolated from human epididymis (Kirchhoff et al., 1991 Biol. Reprod. 45:350-357), and HE4 cDNA was later detected with high frequency in cDNA libraries constructed from ovarian carcinomas (Wang et al., 1999 Gene 229:101; Schummer et al., 1999 Gene 238:375).
- compositions and methods of the present invention overcome these limitations of the prior art by providing a method of screening for the presence of a malignant condition using antibodies specific for HE4 and/or HE4-related antigens to detect polypeptides that naturally occur in soluble form and/or on cell surfaces, and offer other related advantages.
- the present invention is directed to compositions and methods useful in screening for the presence of a malignant condition in a subject.
- the invention relates to the unexpected finding that soluble and cell surface forms of HE4 polypeptides referred to herein as HE4a, or HE4a molecules naturally occurring in soluble form and having an antigenic determinant reactive with at least one antibody that is specific for an HE4a polypeptide, can be detected in a biological sample from a subject.
- It is one aspect of the invention to provide a method of screening for the presence of a malignant condition in a subject comprising contacting a biological sample from a subject with at least one antibody specific for a HE4a antigen polypeptide to determine the presence in the biological sample of a molecule naturally occurring in soluble form in the sample, or occurring as a cell surface molecule in certain embodiments wherein the sample comprises at least one cell from the subject, the molecule having an antigenic determinant that is reactive with the at least one antibody, under conditions and for a time sufficient to detect binding of the antibody to the antigenic determinant, and therefrom detecting the presence of a malignant condition.
- the biological sample is blood, serum, serosal fluid, plasma, lymph, urine, cerebrospinal fluid, saliva, a mucosal secretion, a vaginal secretion, ascites fluid, pleural fluid, pericardial fluid, peritoneal fluid, abdominal fluid, culture medium, conditioned culture medium or lavage fluid.
- the HE4a antigen polypeptide comprises a polypeptide having the amino acid sequence set forth in any one of SEQ ID NOS:5, 7, 9 or 11, or a fragment or derivative thereof.
- the HE4a antigen polypeptide variant is a splice variant.
- the antibody comprises a polyclonal antibody, and in other embodiments the antibody comprises an affinity purified antibody.
- the antibody comprises a monoclonal antibody.
- the antibody comprises a recombinant antibody and in another embodiment the antibody comprises a chimeric antibody.
- the antibody comprises a humanized antibody.
- the antibody comprises a single chain antibody.
- detection of binding of the antibody to an antigenic determinant comprises detection of a radionuclide. In other embodiments, detection of binding of the antibody to an antigenic determinant comprises detection of a fluorophore. In another embodiment, detection of binding of the antibody to an antigenic determinant comprises detection of a binding event between an avidin molecule and a biotin molecule and in another embodiment detection of binding of the antibody to an antigenic determinant comprises detection of a binding event between a streptavidin molecule and a biotin molecule. In certain embodiments detection of binding of the antibody to an antigenic determinant comprises spectrophotometric detection of a product of an enzyme reaction. In some embodiments of the invention, the at least one antibody is detectably labeled, while in certain other embodiments the at least one antibody is not detectably labeled and detection of binding of the antibody to an antigenic determinant is indirect.
- the malignant condition may be adenocarcinoma, mesothelioma, ovarian carcinoma, pancreatic carcinoma or non-small cell lung carcinoma.
- It is another aspect of the invention to provide a method of screening for the presence of a malignant condition in a subject comprising contacting a biological sample from a subject with at least one antibody to determine the presence in the biological sample of a molecule selected from the group consisting of (i) a molecule naturally occurring in soluble form in the sample, and (ii) a cell surface molecule wherein the sample comprises a cell from the subject, the molecule having an antigenic determinant that is reactive with the at least one antibody, the antigen combining site of which competitively inhibits the immunospecific binding of a monoclonal antibody that is 2H5, 3D8 or 4H4, under conditions and for a time sufficient to detect binding of the antibody to the antigenic determinant, and therefrom detecting the presence of a malignant condition.
- Another aspect of the invention provides a method of screening for the presence of a malignant condition in a subject comprising contacting a biological sample from a subject with at least one antibody to determine the presence in the biological sample of a molecule selected from the group consisting of (i) a molecule naturally occurring in soluble form in the sample, and (ii) a cell surface molecule wherein the sample comprises a cell from the subject, the molecule having an antigenic determinant that is reactive with the antibody, the antigen combining site of which competitively inhibits the immunospecific binding of monoclonal antibody 3D8, under conditions and for a time sufficient to detect binding of the antibody to the antigenic determinant, and therefrom detecting the presence of a malignant condition.
- a molecule selected from the group consisting of (i) a molecule naturally occurring in soluble form in the sample, and (ii) a cell surface molecule wherein the sample comprises a cell from the subject, the molecule having an antigenic determinant that is reactive with the antibody, the antigen combining
- Still another aspect of the invention provides a method of screening for the presence of a malignant condition in a subject comprising contacting a biological sample from a subject with at least one antibody specific for a HE4a antigen polypeptide to determine the presence in the biological sample of a molecule selected from the group consisting of (i) a molecule naturally occurring in soluble form in the sample, and (ii) a cell surface molecule wherein the sample comprises a cell from the subject, the molecule having an antigenic determinant that is reactive with the antibody, under conditions and for a time sufficient to detect binding of the at least one antibody to the antigenic determinant, wherein the at least one antibody immunospecifically binds to HE4a antigen, and therefrom detecting the presence of a malignant condition.
- the HE4a antigen is also immunospecifically reactive with monoclonal antibody 3D8, 2H5 or 4H4.
- the invention provides a method of screening for the presence of a malignant condition in a subject comprising contacting a biological sample from a subject with at least one antibody specific for a HE4a antigen polypeptide to determine the presence in the biological sample of a molecule selected from the group consisting of (i) a molecule naturally occurring in soluble form in the sample, and (ii) a cell surface molecule wherein the sample comprises a cell from the subject, the molecule having an antigenic determinant that is reactive with the at least one antibody, the antigen combining site of which competitively inhibits the immunospecific binding of a monoclonal antibody that is 2H5 or 4H4, under conditions and for a time sufficient to detect binding of the antibody to the antigenic determinant, wherein the at least one antibody immunospecifically binds to HE4a antigen, and therefrom detecting the presence of a malignant condition.
- the mesothelin related antigen is also immunospecifically reactive with monoclonal antibody 3D
- the invention provides a method of screening for the presence of a malignant condition in a subject comprising contacting a biological sample from a subject with at least one immobilized first antibody specific for a HE4a antigen polypeptide to determine the presence in the biological sample of a molecule naturally occurring in soluble form in the sample, under conditions and for a time sufficient to specifically bind the at least one immobilized first antibody to the HE4a antigen polypeptide and thereby form an immune complex; removing constituents of the sample that do not specifically bind to the at least one immobilized first antibody; and contacting the immune complex with at least one second antibody specific for a HE4a antigen polypeptide, wherein the antigen combining site of the at least one second antibody does not competitively inhibit the antigen combining site of the at least one immobilized first antibody, under conditions and for a time sufficient to detect specific binding of the at least one second antibody to the HE4a antigen polypeptide, and therefrom detecting the presence of a malignant condition
- the invention provides a method of screening for the presence of a malignant condition in a subject comprising contacting a biological sample from a subject with at least one immobilized first antibody specific for a HE4a antigen polypeptide to determine the presence in the biological sample of a molecule naturally occurring in soluble form in the sample, wherein the antigen combining site of the at least one first antibody competitively inhibits the immunospecific binding of monoclonal antibody 3D8 under conditions and for a time sufficient to specifically bind the at least one immobilized first antibody to the HE4a antigen polypeptide and thereby form an immune complex; removing constituents of the sample that do not specifically bind to the at least one immobilized first antibody; and contacting the immune complex with at least one second antibody specific for a HE4a antigen polypeptide, wherein the antigen combining site of the at least one second antibody does not competitively inhibit the immunospecific binding of monoclonal antibody 2H5, under conditions and for a time sufficient to detect specific binding of the at least one second
- the invention provides a method of screening for the presence of a malignant condition in a subject comprising contacting a biological sample from a subject with at least one immobilized first antibody specific for a HE4a antigen polypeptide to determine the presence in the biological sample of a molecule naturally occurring in soluble form in the sample, wherein the antigen combining site of the at least one first antibody competitively inhibits the immunospecific binding of monoclonal antibody 3D8 under conditions and for a time sufficient to specifically bind the at least one immobilized first antibody to the HE4a antigen polypeptide and thereby form an immune complex; removing constituents of the sample that do not specifically bind to the at least one immobilized first antibody; and contacting the immune complex with at least one second antibody specific for a HE4a antigen polypeptide, wherein the antigen combining site of the at least one second antibody does not competitively inhibit the immunospecific binding of monoclonal antibody 4H4, under conditions and for a time sufficient to detect specific binding of the at least one second
- the subject invention method further comprises determining the presence in the sample of at least one soluble marker of a malignant condition, wherein the marker is a mesothelin related antigen, carcinoembryonic antigen, CA125, sialyl TN, squamous cell carcinoma antigen, tissue polypeptide antigen, or placental alkaline phosphatase.
- the marker is a mesothelin related antigen, carcinoembryonic antigen, CA125, sialyl TN, squamous cell carcinoma antigen, tissue polypeptide antigen, or placental alkaline phosphatase.
- It is another aspect of the invention to provide a method of screening for the presence of a malignant condition in a subject comprising contacting each of (i) a first biological sample from a first subject suspected of having a malignant condition, and (ii) a second biological sample from a second subject known to be free of a malignant condition, with at least one antibody specific for a HE4a antigen polypeptide to determine the presence in each of the first and second biological samples of a molecule selected from the group consisting of (i) a molecule naturally occurring in soluble form in the sample, and (ii) a cell surface molecule wherein the first and second biological samples each comprise, respectively, a cell from the first and second subjects, the molecule having an antigenic determinant that is reactive with the at least one antibody, under conditions and for a time sufficient to detect binding of the antibody to the antigenic determinant, and comparing a level of detectable binding of the antibody to the antigenic determinant in the first biological sample to a level of detectable binding of the antibody to
- the invention provides a method of screening for the presence of a malignant condition in a subject comprising detecting in a biological sample from the subject the presence of an antibody that immunospecifically binds to a HE4a antigen polypeptide.
- the mesothelin related antigen polypeptide comprises a polypeptide having the amino acid sequence set forth in any one of SEQ ID NOS:5, 7, 11 or 13.
- the invention provides an antibody specific for a HE4a antigen polypeptide, comprising a monoclonal immunoglobulin variable region that specifically binds to a HE4a antigen polypeptide comprising the amino acid sequence set forth in any one of SEQ ID NOS:5, 7, 11 or 13.
- the antibody is a fusion protein, while in certain other embodiments the antibody is a single chain antibody.
- the HE4a antigen polypeptide further comprises a glycosylated polypeptide.
- the antibody specifically binds to a HE4a antigen polypeptide sequence set forth in SEQ ID NO: 11 but does not specifically bind to a polypeptide sequence set forth in SEQ ID NO: 9, or the antibody specifically binds to both the HE4a antigen polypeptide sequence set forth in SEQ ID NO: 11 and to the polypeptide sequence set forth in SEQ ID NO:9.
- the antibody is monoclonal antibody 2H5, 3D8 or 4H4.
- the invention provides a method of screening for the presence of a malignant condition in a subject comprising contacting a biological sample from a subject with a detectably labeled HE4a polypeptide, under conditions and for a time sufficient to detect binding to the HE4a polypeptide of an antibody naturally occurring in soluble form in the sample, and therefrom detecting the presence of a malignant condition.
- the invention provides an isolated nucleic acid molecule that is a nucleic acid molecule encoding a HE4a antigen polypeptide, the polypeptide comprising an amino acid sequence set forth in SEQ ID NOS:5, 7, 11 or 13; or that is a nucleic acid molecule that encodes a HE4a antigen polypeptide or fusion protein or that is capable of hybridizing to such a nucleic acid molecule encoding a HE4a antigen under moderately stringent conditions, wherein the isolated nucleic acid molecule is not a nucleic acid molecule consisting of the nucleotide sequence set forth in SEQ ID NO:9.
- the invention provides an antisense oligonucleotide comprising at least 15 consecutive nucleotides complementary to the nucleic acid molecule encoding a HE4a antigen polypeptide.
- the present invention provides a fusion protein comprising a polypeptide sequence fused to a HE4a antigen polypeptide.
- the fusion domain is an immunoglobulin or a variant or fragment thereof.
- the polypeptide sequence fused to a HE4a antigen polypeptide is cleavable by a protease.
- the polypeptide sequence is an affinity tag polypeptide having affinity for a ligand.
- the invention provides a recombinant expression construct comprising at least one promoter operably linked to a nucleic acid molecule encoding a HE4a antigen polypeptide as described above.
- the promoter is a regulated promoter and in certain other embodiments the HE4a antigen polypeptide is expressed as a fusion protein with a polypeptide product of a second nucleic acid sequence.
- the polypeptide product of the second nucleic acid sequence is an immunoglobulin constant region.
- the expression construct is a recombinant viral expression construct.
- the invention provides a host cell comprising a recombinant expression construct as provided herein.
- the host cell is a prokaryotic cell and in another embodiment the host cell is a eukaryotic cell.
- the invention provides a method of producing a recombinant HE4a antigen polypeptide by culturing a host cell comprising a recombinant expression construct comprising at least one promoter operably linked to a nucleic acid molecule encoding a HE4a antigen polypeptide as provided herein.
- the promoter is a regulated promoter.
- the invention provides a method of producing a recombinant HE4a antigen polypeptide, by culturing a host cell infected with the recombinant viral expression construct as provided herein for expression of recombinant HE4a antigen polypeptide.
- the present invention also provides, in another embodiment, a method for detecting HE4a expression in a sample by contacting an antisense oligonucleotide as described above with a sample comprising a nucleic acid sequence encoding a HE4a polypeptide having the amino acid sequence set forth in SEQ ID NO:l 1, or a fragment or variant thereof; and detecting in the sample an amount of HE4a polypeptide-encoding nucleic acid that hybridizes to the antisense oligonucleotide, and therefrom detecting HE4a expression in the sample.
- the amount of HE4a polypeptide-encoding nucleic acid that hybridizes to the antisense oligonucleotide is determined using polymerase chain reaction.
- the amount of HE4a polypeptide-encoding nucleic acid that hybridizes to the antisense oligonucleotide is determined using a hybridization assay.
- the sample comprises an RNA or cDNA preparation.
- a method for treating a malignant condition comprising administering to a patient in need thereof a composition comprising an antibody specific for a HE4a antigen polypeptide, the antibody comprising a monoclonal immunoglobulin variable region that specifically binds to a HE4a antigen polypeptide having an amino acid sequence set forth in SEQ ID NO:l 1.
- the invention provides a method for treating a malignant condition, comprising administering to a patient in need thereof a composition comprising a HE4a polypeptide having an amino acid sequence set forth in SEQ ID NO: 11, or a fragment thereof.
- the composition induces production in the patient of an antibody that is capable of specifically binding to a HE4a polypeptide having an amino acid sequence set forth in SEQ ID NO: 11, or a fragment thereof, and in certain other further embodiments the composition induces in the patient a T lymphocyte that is capable of specifically recognizing a HE4a polypeptide having an amino acid sequence set forth in SEQ ID NO:l l, or a fragment thereof.
- compositions and methods that alter (e.g., increase or decrease in a statistically significant manner relative to an appropriate control) conception, contraception and/or fertility, comprising administering a HE4a polypeptide or fragment or variant thereof (including a fusion protein), or administering a composition comprising an immunoglobulin variable region that specifically binds to a HE4a polypeptide or fragment or variant thereof.
- Figure 1 shows real-time PCR detection of HE4a encoding cDNA in a panel of human samples.
- Figure 2 shows western blot analysis of expressed HE4a fusion proteins.
- Figure 3 depicts detection of antibodies reactive with HE4a-mIg fusion protein in sera from two immune mice (1605 and 1734) by ELISA.
- Figure 4 depicts representative results of screening hybridoma supernatants and detection of HE4a-specific hybridoma antibodies using ELISA.
- Figure 5 shows detection of HE4a-hIgG fusion protein by double- determinant sandwich ELISA using immobilized HE4a-specific monoclonal antibody 3D8 as the capture reagent and biotinylated HE4a-specific monoclonal antibody 2H5 as the detection reagent. Also shown is detection of soluble HE4a in supernatant fluid from ovarian carcinoma cell line 4007 ( ⁇ ).
- Figure 6 shows detection by sandwich ELISA of HE4a antigen in serially diluted ascites fluid from an ovarian carcinoma patient.
- the present invention pertains in part to the discovery of HE4a, a new member of the "four-disulfide core" family of proteins as described herein, which exhibits a sequence that is highly similar to, but distinct from, HE4 (Kirchhoff et al., 1991 Biol. Reproduct. 45:350-357).
- HE4a (and not HE4) is most unexpectedly shown to be overexpressed in certain malignancies, for example in ovarian carcinomas, as well as in a number of other human tissues, in marked contrast to the restricted expression pattern of HE4 in human epididymal epithelial cells (Kirchhoff et al., 1991).
- the present invention also pertains in part to surprising advantages that derive from compositions and methods described herein, which provide detection of cell surface and/or soluble forms of certain gene products referred to herein as HE4a polypeptides that occur naturally in subjects, including elevated levels of such polypeptides in subjects having certain carcinomas (e.g., ovarian carcinomas).
- the invention therefore provides useful compositions and methods for the detection and diagnosis of a malignant condition in a subject by specific detection of such cell surface and/or soluble HE4a polypeptides.
- certain embodiments of the invention relate to HE4a polypeptides, which include soluble and cell surface forms of HE4a and HE4 polypeptides, including HE4 and HE4a polypeptide antigens and fusion proteins.
- the invention relates to fragments, derivatives and/or analogs of HE4a polypeptides.
- a method of screening for the presence of a malignant condition in a subject by contacting a biological sample from the subject with an antibody specific for a human HE4a polypeptide.
- HE4a polypeptides and HE4a-Ig fusion proteins are disclosed herein, including the surprising observation that a nucleic acid molecule derived from ovarian carcinoma cDNA encodes an expressed product having a sequence distinct from HE4 as described by Kirchhoff et al. (1991), and the further unexpected observation that whereas HE4 expression as disclosed by Kirchhoff et al. is limited to epididymal epithelial cells, HE4a expression according to the present disclosure is readily detectable in ovarian carcinomas.
- monoclonal antibodies that specifically recognize HE4a polypeptides are provided, such that those having ordinary skill in the art may routinely and without undue experimentation immunize a host and screen for HE4a polypeptide-specific antibody production using the present teachings along with methodologies well known in the art.
- construction of recombinant HE4a expression vectors and host cells, including recombinant HE4a fusion proteins, is described herein and provides HE4a-specific antibodies.
- HE4a polypeptides From the physicochemical and immunochemical properties of HE4a polypeptides disclosed herein, and using the presently disclosed nucleic acid sequences encoding HE4a, a person having ordinary skill in the art may also prepare a recombinant HE4a polypeptide that can be used to produce and characterize specific antibodies according to well known methodologies.
- HE4a polypeptides can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the HE4a polypeptide DNA coding regions disclosed herein.
- HE4a polypeptides are expressed in mammalian cells.
- the nucleic acids of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
- the DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
- a coding sequence which encodes an HE4a polypeptide for use according to the invention may be identical to the coding sequences provided in SEQ ID NOS:3, 4, 6, 10 or 12 or may be a different coding sequence, which, as a result of the redundancy or degeneracy of the genetic code, encodes the same HE4a polypeptide as, for example, the cDNAs of SEQ ID NOS:10 and 12.
- the present invention therefore provides an isolated nucleic acid molecule that encodes a HE4a antigen polypeptide having the amino acid sequence of SEQ ID NOS:5, 7, 11 or 13, or a nucleic acid molecule capable of hybridizing to such an HE4a polypeptide-encoding nucleic acid, or a nucleic acid molecule having a sequence complementary thereto.
- Variants preferably exhibit at least about 70% identity, more preferably at least about 80%-85% identity and most preferably at least about 90%, 92%, 94%, 95%, 96%, 97%, 98% or 99% identity to a polynucleotide sequence that encodes a native HE4a antigen polypeptide or a portion thereof, such as, for example, the nucleic acid sequences set forth in SEQ ID NOS:10 and 12.
- the percent identity may be readily determined by comparing sequences using computer algorithms well known to those of ordinary skill in the art, such as Align or the BLAST algorithm (Altschul, J. Mol. Biol. 219:555-565, 1991; Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA ⁇ °P:10915- 10919, 1992), which is available at the NCBI website (http://www/ncbi.nlm.mh.gov/cgi-bin/BLAST). Default parameters may be used.
- Certain variants are substantially homologous to a native gene.
- Such polynucleotide variants are capable of hybridizing under moderately stringent conditions to a naturally occurring DNA or RNA sequence encoding a native HE4a antigen (or a complementary sequence).
- Suitable moderately stringent conditions include, for example, the following steps or their equivalent: prewashing in a solution of 5 X SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0); hybridizing at 50°C-65°C, 5 X SSC, overnight; followed by washing twice at 65°C for 20 minutes with each of 2X, 0.5X and 0.2X SSC containing 0.1 % SDS.
- conditions may include, for example, a wash in 0.1X SSC and 0.1% SDS at 60 °C for 15 minutes, or the equivalent.
- a wash in 0.1X SSC and 0.1% SDS at 60 °C for 15 minutes or the equivalent.
- a person having ordinary skill in the art will readily appreciate the parameters that may be varied as a routine matter to create appropriately stringent hybridization conditions that are in some way selective for a particular nucleic acid of interest, and will further appreciate that such conditions may be a function, ter alia, of the particular nucleic acid sequences involved in the hybridization, such as, for example, those disclosed herein as SEQ ID NOS:10 and 12, which encode HE4a polypeptides.
- the nucleic acids which encode HE4a polypeptides may include, but are not limited to: only the coding sequence for the HE4a polypeptide; the coding sequence for the HE4a polypeptide and additional coding sequence; the coding sequence for the HE4a polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequences 5' and/or 3' of the coding sequence for the HE4a polypeptide, which for example may further include but need not be limited to one or more regulatory nucleic acid sequences that may be a regulated or regulatable promoter, enhancer, other transcription regulatory sequence, repressor binding sequence
- nucleic acid encoding an HE4a polypeptide encompasses a nucleic acid which includes only coding sequence for the polypeptide as well as a nucleic acid which includes additional coding and/or non-coding sequence(s).
- the present invention further relates to variants of the herein described nucleic acids which encode for fragments, analogs and derivatives of an HE4a polypeptide, for example the human HE4a polypeptides having the deduced amino acid sequence of SEQ ID NO: 11.
- the variants of the nucleic acids encoding HE4a may be naturally occurring allelic variants of the nucleic acids or non-naturally occurring variants.
- an allelic variant is an alternate form of a nucleic acid sequence which may have at least one of a substitution, a deletion or an addition of one or more nucleotides, any of which does not substantially alter the function of the encoded HE4a polypeptide.
- the present invention includes nucleic acids encoding the same HE4a polypeptides as shown in SEQ ID NOS:5, 7 or 11, as well as variants of such nucleic acids, which variants may encode a fragment, derivative or analog of any of these polypeptides.
- Variants and derivatives of HE4a may be obtained by mutations of nucleotide sequences encoding HE4a polypeptides. Alterations of the native amino acid sequence may be accomplished by any of a number of conventional methods. Mutations can be introduced at particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites enabling ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution, or deletion.
- oligonucleotide-directed site-specific mutagenesis procedures can be employed to provide an altered gene wherein predetermined codons can be altered by substitution, deletion or insertion.
- Exemplary methods of making such alterations are disclosed by Walder et al. (Gene 42:133, 1986); Bauer et al. (Gene 37:13, 1985); Craik (BioTechniques, January 1985, 12-19); Smith et al. (Genetic Engineering: Principles and Methods, Plenum Press, 1981); Kunkel (Proc. Natl. Acad. Sci. USA £2:488, 1985); Kunkel et al. (Methods in Enzymol. 154:361, 1987); and U.S. Patent Nos.
- nucleic acid molecules for use as antisense agents which includes antisense oligonucleotides and ribozymes specific for nucleic acid sequences encoding HE4a polypeptides or variants or fragments thereof; and of DNA oligonucleotides encoding HE4a genes for targeted delivery for genetic therapy, involve methods well known in the art. For example, the desirable properties, lengths and other characteristics of such oligonucleotides are well known.
- such an antisense oligonucleotide comprises at least 15-30 consecutive nucleotides complementary to an isolated nucleic acid molecule encoding an HE4a polypeptide as provided herein, and in certain other preferred embodiments such an antisense olignucleotide may comprise at least 31-50, 51-75, 76-125 or more consecutive nucleotides complementary to an isolated nucleic acid molecule encoding an HE4a polypeptide as provided herein.
- Antisense oligonucleotides are typically designed to resist degradation by endogenous nucleolytic enzymes by using such linkages as: phosphorothioate, methylphosphonate, sulfone, sulfate, ketyl, phosphorodithioate, phosphoramidate, phosphate esters, and other such linkages (see, e.g., Agrwal et al., Tetrehedron Lett. 25:3539-3542 (1987); Miller et al., J Am. Chem. Soc. 93:6651-6665 (1971); Stec et al, Tetrehedron Lett. 25:2191-2194 (1985); Moody et al., Nucl. Acids Res.
- Antisense nucleotides are oligonucleotides that bind in a sequence- specific manner to nucleic acids, such as mRNA or DNA. When bound to mRNA that has complementary sequences, antisense prevents translation of the mRNA (see, e.g., U.S. Patent No. 5,168,053 to Altaian et al.; U.S. Patent No. 5,190,931 to Inouye, U.S. Patent No. 5,135,917 to Burch; U.S. Patent No. 5,087,617 to Smith and Clusel et al. (1993) Nucl. Acids Res. 27:3405-3411, which describes dumbbell antisense oligonucleotides).
- Triplex molecules refer to single DNA strands that bind duplex DNA forming a colinear triplex molecule, thereby preventing transcription (see, e.g., U.S. Patent No. 5,176,996 to Hogan et al., which describes methods for making synthetic oligonucleotides that bind to target sites on duplex DNA).
- particularly useful antisense nucleotides and triplex molecules are molecules that are complementary to or bind the sense strand of DNA or mRNA that encodes an HE4a polypeptide such that inhibition of translation of mRNA encoding the HE4a polypeptide is effected.
- a ribozyme is an RNA molecule that specifically cleaves RNA substrates, such as mRNA, resulting in specific inhibition or interference with cellular gene expression.
- RNA substrates such as mRNA
- Ribozymes can be targeted to any RNA transcript and can catalytically cleave such transcripts (see, e.g., U.S. Patent No. 5,272,262; U.S. Patent No. 5,144,019; and U.S. Patent Nos. 5,168,053, 5,180,818, 5,116,742 and 5,093,246 to Cech et al.).
- any such HE4a mRNA-specific ribozyme, or a nucleic acid encoding such a ribozyme may be delivered to a host cell to effect inhibition of HE4a gene expression.
- Ribozymes, and the like may therefore be delivered to the host cells by DNA encoding the ribozyme linked to a eukaryotic promoter, such as a eukaryotic viral promoter, such that upon introduction into the nucleus, the ribozyme will be directly transcribed.
- DNA constructs that encode various additions or substitutions of amino acid residues or sequences, or deletions of terminal or internal residues or sequences not needed for biological activity are also encompassed by the invention.
- sequences encoding Cys residues that are not essential for biological activity can be altered to cause the Cys residues to be deleted or replaced with other amino acids, preventing formation of incorrect intramolecular disulfide bridges upon renaturation.
- Other equivalents can be prepared by modification of adjacent dibasic amino acid residues to enhance expression in yeast systems in which KEX2 protease activity is present.
- EP 212,914 discloses the use of site-specific mutagenesis to inactivate KEX2 protease processing sites in a protein.
- KEX2 protease processing sites are inactivated by deleting, adding or substituting residues to alter Arg-Arg, Arg-Lys, and Lys-Arg pairs to eliminate the occurrence of these adjacent basic residues. Lys-Lys pairings are considerably less susceptible to KEX2 cleavage, and conversion of Arg-Lys or Lys-Arg to Lys-Lys represents a conservative and preferred approach to inactivating KEX2 sites.
- the appropriate DNA sequence(s) may be inserted into any of a number of well known vectors appropriate for the selected host cell by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art.
- Standard techniques for cloning, DNA isolation, amplification and purification, for enzymatic reactions involving DNA ligase, DNA polymerase, restriction endonucleases and the like, and various separation techniques are those known and commonly employed by those skilled in the art.
- a number of standard techniques are described, for example, in Ausubel et al. (1993 Current Protocols in Molecular Biology, Greene Publ. Assoc. Inc. & John Wiley & Sons, Inc., Boston, MA); Sambrook et al. (1989 Molecular Cloning, Second Ed., Cold Spring Harbor Laboratory, Plainview, NY); and elsewhere.
- mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell 23:175 (1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines.
- Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences.
- DNA sequences derived, for example, from SV40 splice and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
- the present invention further relates to HE4a polypeptides and in particular to methods for detecting a malignant condition.
- malignancy is detected by determining the presence in a biological sample of a naturally occurring soluble molecule, or in a sample comprising a cell the presence of a cell surface molecule, having an antigenic determinant reactive with at least one antibody specific for a HE4a polypeptide.
- malignancy is detected by determining the presence in a biological sample of at least one naturally occurring HE4a polypeptide.
- a "HE4a antigen polypeptide” or “HE4a polypeptide” includes any polypeptide having an amino acid sequence of SEQ ID NO:l l, including any fragment, derivative or analog thereof, and also includes any polypeptide encoded by a nucleic acid molecule comprising SEQ ID NO: 10 or 12, or by a nucleic acid molecule capable of hybridizing to a nucleic acid molecule of SEQ ID NO: 10 or 12, or a fragment, derivative or analog thereof.
- compositions and methods directed to HE4a sequences as provided herein e.g., SEQ ID NOS:10-13
- HE4a sequences as provided herein (e.g., SEQ ID NOS:10-13) but which expressly exclude, on the basis of differences in structure, function and/or cell type expression or tissue distribution, or the like (including antibody-defined detectable epitopes and also including oligonucleotide-defined hybridization detection), HE4 sequences disclosed in Kirchoff et al. (e.g., 1991 Biol. Reproduct. 45:350; SEQ ID NOS:8-9).
- the HE4a polypeptide of the invention may be an unmodified polypeptide or may be a polypeptide that has been posttranslationally modified, for example by glycosylation, phosphorylation, fatty acylation including glycosylphosphatidylinositol anchor modification or the like, phospholipase cleavage such as phosphatidylinositol- specific phospholipase c mediated hydrolysis or the like, protease cleavage, dephosphorylation or any other type of protein posttranslational modification such as a modification involving formation or cleavage of a covalent chemical bond.
- fragment when referring to HE4a polypeptides, HE4a antigen polypeptides or HE4a fusion proteins, refers to any HE4a polypeptide that retains essentially the same biological function and/or activity as such polypeptide.
- an analog may include a HE4a antigen polypeptide isoform such as a differentially posttranslationally modified HE4a polypeptide or a variant such as a splice variant.
- a "splice variant” includes variant or alternative forms of a polypeptide that arise from the differential intracellular processing of an RNA transcript.
- a HE4a polypeptide further includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active HE4a polypeptide.
- Biological functions and/or activities of fragments, derivatives and analogs of HE4a polypeptides or of HE4a antigen polypeptides include, but need not be limited to, the use of such polypeptides as markers in a method of screening for the presence of a malignant condition in a subject as disclosed herein. For example, by detecting in a sample from the subject a molecule naturally occurring in soluble form and having an antigenic determinant that is reactive with at least one antibody specific for a HE4a polypeptide, one skilled in the art may be monitoring a biological function and/or activity of an HE4a polypeptide.
- the subject invention method of screening is directed to comparing relative quantities, levels and/or amounts of a detectable molecule naturally occurring in soluble form and having an antigenic determinant that is reactive with at least one antibody specific for a HE4a polypeptide in each of (i) a first biological sample from a first subject suspected of having a malignant condition, and (ii) a second biological sample from a second subject known to be free of a malignant condition.
- the relative quantitative presence of a HE4a polypeptide in a biological sample may be a biological function and/or activity of a HE4a polypeptide, although such function and/or activity should not be so limited.
- a fragment, derivative or analog of a HE4a polypeptide may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non- conserved amino acid residue (preferably a conserved amino acid residue); (ii) one in which additional amino acids are fused to the HE4a polypeptide, including amino acids that may be employed for purification of the HE4a polypeptide or a proprotein sequence; or (iii) a truncated HE4a polypeptide.
- Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
- a truncated HE4a polypeptide may be any HE4a polypeptide molecule that comprises less than a full length version of the HE4a polypeptide.
- Truncated molecules provided by the present invention may include truncated biological polymers, and in preferred embodiments of the invention such truncated molecules may be truncated nucleic acid molecules or truncated polypeptides.
- Truncated nucleic acid molecules have less than the full length nucleotide sequence of a known or described nucleic acid molecule, where such a known or described nucleic acid molecule may be a naturally occurring, a synthetic or a recombinant nucleic acid molecule, so long as one skilled in the art would regard it as a full length molecule.
- truncated nucleic acid molecules that correspond to a gene sequence contain less than the full length gene where the gene comprises coding and non-coding sequences, promoters, enhancers and other regulatory sequences, flanking sequences and the like, and other functional and non-functional sequences that are recognized as part of the gene.
- truncated nucleic acid molecules that correspond to a mRNA sequence contain less than the full length mRNA transcript, which may include various translated and non-translated regions as well as other functional and non-functional sequences.
- truncated molecules are polypeptides that comprise less than the full length amino acid sequence of a particular protein.
- “deletion” has its common meaning as understood by those familiar with the art, and may refer to molecules that lack one or more of a portion of a sequence from either terminus or from a non-terminal region, relative to a corresponding full length molecule, for example, as in the case of truncated molecules provided herein.
- Truncated molecules that are linear biological polymers such as nucleic acid molecules or polypeptides may have one or more of a deletion from either terminus of the molecule or a deletion from a non-terminal region of the molecule, where such deletions may be deletions of 1-1500 contiguous nucleotide or amino acid residues, preferably 1-500 contiguous nucleotide or amino acid residues and more preferably 1-300 contiguous nucleotide or amino acid residues.
- similarity between two polypeptides is determined by comparing the amino acid sequence and conserved amino acid substitutes thereto of the polypeptide to the sequence of a second polypeptide.
- Similarity between two polypeptide or nucleotide sequences, or even the percent identity, may be readily determined by comparing sequences using computer algorithms well known to those of ordinary skill in the art, such as the BLAST algorithm (Altschul, J. Mol. Biol. 219:555- 565, 1991; Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915- 10919, 1992), which is available at the NCBI website (http://www/ncbi.nlm.nih.gov/cgi-bin/BLAST). Default parameters may be used.
- fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides.
- isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring).
- a naturally occurring polypeptide or polynucleotide present in a living animal is not isolated, but the same polypeptide or polynucleotide, separated from some or all of the co-existing materials in the natural system, is isolated.
- Such polypeptides or polynucleotides could be part of a composition, and still be isolated in that such composition is not part of its natural environment.
- Affinity techniques are particularly useful in the context of isolating HE4a polypeptides for use according to the methods of the present invention, and may include any method that exploits a specific binding interaction with a HE4a polypeptide to effect a separation.
- HE4a polypeptides may contain covalently attached oligosaccharide moieties (see, e.g., Fig. 2 as described in the Examples)
- an affinity technique such as binding of a HE4a polypeptide to a suitable immobilized lectin under conditions that permit carbohydrate binding by the lectin may be a particularly useful affinity technique.
- affinity techniques include immunological techniques for isolating a HE4a polypeptide, which techniques rely on specific binding interaction between antibody combining sites for antigen and antigenic determinants present in the complexes.
- Immunological techniques include, but need not be limited to, immunoaffinity chromatography, immunoprecipitation, solid phase immunoadsorption or other immunoaffinity methods.
- affinity techniques see, for example, Scopes, R.K., Protein Purification: Principles and Practice, 1987, Springer- Verlag, NY; Weir, D.M., Handbook of Experimental Immunology, 1986, Blackwell Scientific, Boston; and Hermanson, G.T.
- the invention provides a fusion protein comprising a polypeptide fused to a HE4a.
- HE4a fusion proteins are encoded by nucleic acids that have the HE4a coding sequence fused in frame to an additional coding sequence to provide for expression of a HE4a polypeptide sequence fused to an additional functional or non-functional polypeptide sequence that permits, for example by way of illustration and not limitation, detection, isolation and/or purification of the HE4a fusion protein.
- Such HE4a fusion proteins may permit detection, isolation and/or purification of the HE4a fusion protein by protein-protein affinity, metal affinity or charge affinity-based polypeptide purification, or by specific protease cleavage of a fusion protein containing a fusion sequence that is cleavable by a protease such that the HE4a polypeptide is separable from the fusion protein.
- HE4a fusion proteins may comprise affinity tag polypeptide sequences, which refers to polypeptides or peptides added to HE4a to facilitate detection and isolation of the HE4a via a specific affinity interaction with a ligand.
- the ligand may be any molecule, receptor, counterreceptor, antibody or the like with which the affinity tag may interact through a specific binding interaction as provided herein.
- Such peptides include, for example, poly-His or the antigenic identification peptides described in U.S. Patent No. 5,011,912 and in Hopp et al., (1988 Bio/Technology 5:1204), or the XPRESSTM epitope tag (Invitrogen, Carlsbad, CA).
- the affinity sequence may be a hexa-histidine tag as supplied, for example, by a pBAD/His (Invitrogen) or a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the affinity sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g., COS-7 cells, is used.
- the HA tag corresponds to an antibody defined epitope derived from the influenza hemagglutinin protein (Wilson et al., 1984 Cell 37:161).
- HE4a fusion proteins may, in particularly preferred embodiments and as described in greater detail below, further comprise immunoglobulin constant region polypeptides added to HE4a to facilitate detection, isolation and/or localization of HE4a.
- the immunoglobulin constant region polypeptide preferably is fused to the C- terminus of a HE4a polypeptide.
- inclusion of immunoglobulin (Ig) constant region domains in HE4a fusion proteins as provided herein may offer advantages, for example, those associated with the immunogenic/non- immunogenic properties of particular Ig regions when used in particular hosts (i.e., "self vs. "non-self), or those which facilitate isolation and/or detection of a fusion protein.
- Ig fusion proteins comprising heterologous polypeptides fused to various portions of antibody- derived polypeptides (including the Fc domain) has been described, e.g., by Ashkenazi et al. (PNAS USA ⁇ °5. 10535, 1991) and Byrn et al. (Nature 344:611, 1990).
- a gene fusion encoding the HE4a:Fc fusion protein is inserted into an appropriate expression vector.
- HE4a:Fc fusion proteins may be allowed to assemble much like antibody molecules, whereupon interchain disulfide bonds form between Fc polypeptides, yielding dimeric HE4a fusion proteins.
- HE4a fusion proteins having specific binding affinities for pre-selected antigens by virtue of fusion polypeptides comprising immunoglobulin V-region domains encoded by DNA sequences linked in-frame to sequences encoding HE4a are also within the scope of the invention, including variants and fragments thereof as provided herein.
- General strategies for the construction of fusion proteins having immunoglobulin V-region fusion polypeptides are disclosed, for example, in EP 0318554; U.S. 5,132,405; U.S. 5,091,513; and U.S. 5,476,786.
- the nucleic acid of the present invention may also encode a fusion protein comprising a HE4a polypeptide fused to other polypeptides having desirable affinity properties, for example an enzyme such as glutathione-S-transferase.
- HE4a fusion proteins may also comprise a HE4a polypeptide fused to a Staphylococcus aureus protein A polypeptide; protein A encoding nucleic acids and their use in constructing fusion proteins having affinity for immunoglobulin constant regions are disclosed generally, for example, in U.S. Patent 5,100,788.
- HE4a fusion proteins may include streptavidin fusion proteins, as disclosed, for example, in WO 89/03422; U.S. 5,489,528; U.S. 5,672,691; WO 93/24631; U.S. 5,168,049; U.S. 5,272,254 and elsewhere, and avidin fusion proteins (see, e.g., EP 511,747).
- streptavidin fusion proteins as disclosed, for example, in WO 89/03422; U.S. 5,489,528; U.S. 5,672,691; WO 93/24631; U.S. 5,168,049; U.S. 5,272,254 and elsewhere, and avidin fusion proteins (see, e.g., EP 511,747).
- HE4a polypeptide sequences may be fused to fusion polypeptide sequences that may be full length fusion polypeptides and that may alternatively be variants or fragments thereof.
- the present invention also contemplates HE4a fusion proteins that contain polypeptide sequences that direct the fusion protein to the cell nucleus, to reside in the lumen of the endoplasmic reticulum (ER), to be secreted from a cell via the classical ER-Golgi secretory pathway (see, e.g., von Heijne, J Membrane Biol.
- ER endoplasmic reticulum
- the present invention also relates to vectors and to constructs that include nucleic acids of the present invention, and in particular to "recombinant expression constructs" that include any nucleic acids encoding HE4a polypeptides according to the invention as provided above; to host cells which are genetically engineered with vectors and/or constructs of the invention and to the production of HE4a polypeptides and fusion proteins of the invention, or fragments or variants thereof, by recombinant techniques.
- HE4a proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
- recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
- promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), ⁇ -factor, acid phosphatase, or heat shock proteins, among others.
- PGK 3-phosphoglycerate kinase
- the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences.
- the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
- Useful expression constructs for bacterial use are constructed by inserting into an expression vector a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
- the construct may comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector construct and, if desirable, to provide amplification within the host.
- Suitable prokaryotic hosts for transformation include E. coli, Bacillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice. Any other plasmid or vector may be used as long as they are replicable and viable in the host.
- useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017).
- cloning vector pBR322 ATCC 37017
- Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wisconsin, USA). These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
- the selected promoter if it is a regulated promoter as provided herein, is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
- appropriate means e.g., temperature shift or chemical induction
- Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
- Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents; such methods are well know to those skilled in the art.
- the nucleic acids of the invention as provided herein may be included in any one of a variety of expression vector constructs as a recombinant expression construct for expressing a HE4a polypeptide.
- Such vectors and constructs include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA, such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
- any other vector may be used for preparation of a recombinant expression construct as long as it is replicable and viable in the host.
- the appropriate DNA sequence(s) may be inserted into the vector by a variety of procedures.
- the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art.
- Standard techniques for cloning, DNA isolation, amplification and purification, for enzymatic reactions involving DNA ligase, DNA polymerase, restriction endonucleases and the like, and various separation techniques are those known and commonly employed by those skilled in the art.
- a number of standard techniques are described, for example, in Ausubel et al. (1993 Current Protocols in Molecular Biology, Greene Publ. Assoc. Inc. & John Wiley & Sons, Inc., Boston, MA); Sambrook et al.
- the DNA sequence in the expression vector is operatively linked to at least one appropriate expression control sequences (e.g., a promoter or a regulated promoter) to direct mRNA synthesis.
- appropriate expression control sequences include LTR or SV40 promoter, the E. coli lac or trp, the phage lambda P promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
- Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
- Two appropriate vectors are pKK232-8 and pCM7.
- Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , P and trp.
- Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I.
- the vector may be a viral vector such as a retro viral vector.
- retroviruses from which the retro viral plasmid vectors may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor virus.
- the viral vector includes one or more promoters.
- Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalo virus (CMV) promoter described in Miller, et al., Biotechniques 7:980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and ⁇ - actin promoters).
- Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters.
- the retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines.
- packaging cells which may be transfected include, but are not limited to, the PE501, PA317, ⁇ -2, ⁇ -AM, PA12, T19- 14X, VT-19-17-H2, ⁇ CRE, ⁇ CRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy, 7:5-14 (1990), which is incorporated herein by reference in its entirety.
- the vector may transduce the packaging cells through any means known in the art.
- retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
- the producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the HE4a polypeptides or fusion proteins. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vitro or in vivo. The transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the HE4a polypeptide or fusion protein.
- Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, bronchial epithelial cells and various other culture-adapted cell lines.
- host cells transduced by a recombinant viral construct directing the expression of HE4a polypeptides or fusion proteins may produce viral particles containing expressed HE4a polypeptides or fusion proteins that are derived from portions of a host cell membrane incorporated by the viral particles during viral budding.
- HE4a encoding nucleic acid sequences are cloned into a baculovirus shuttle vector, which is then recombined with a baculovirus to generate a recombinant baculovirus expression construct that is used to infect, for example, Sf9 host cells, as described in Baculovirus Expression Protocols, Methods in Molecular Biology Vol. 39, C. D.
- the present invention relates to host cells containing the above described recombinant HE4a expression constructs.
- Host cells are genetically engineered (transduced, transformed or transfected) with the vectors and/or expression constructs of this invention which may be, for example, a cloning vector, a shuttle vector or an expression construct.
- the vector or construct may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
- the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying particular genes such as genes encoding HE4a polypeptides or HE4a fusion proteins.
- the culture conditions for particular host cells selected for expression such as temperature, pH and the like, will be readily apparent to the ordinarily skilled artisan.
- the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
- appropriate host cells include, but need not be limited to, bacterial cells, such as E. coli, Streptomyces, Salmonella typhimurium; fungal cells, such as yeast; insect cells, such as Drosophila S2 and Spodoptera Sf9; animal cells, such as CHO, COS or 293 cells; adenoviruses; plant cells, or any suitable cell already adapted to in vitro propagation or so established de novo.
- bacterial cells such as E. coli, Streptomyces, Salmonella typhimurium
- fungal cells such as yeast
- insect cells such as Drosophila S2 and Spodoptera Sf9
- animal cells such as CHO, COS or 293 cells
- a mammalian cell culture systems can also be employed to express recombinant protein.
- the invention is therefore directed in part to a method of producing a recombinant HE4a polypeptide, by culturing a host cell comprising a recombinant expression construct that comprises at least one promoter operably linked to a nucleic acid sequence encoding a HE4a.
- the promoter may be a regulated promoter as provided herein, for example a tetracylcine-repressible promoter.
- the recombinant expression construct is a recombinant viral expression construct as provided herein.
- mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell 23:175 (1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines.
- Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences, for example as described herein regarding the preparation of MRA expression constructs.
- DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
- constructs into the host cell can be effected by a variety of methods with which those skilled in the art will be familiar, including but not limited to, for example, calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation (Davis et al., 1986 Basic Methods in Molecular Biology).
- the expressed recombinant HE4a antigen polypeptides may be useful as immunogens in the form of intact host cells; intact organelles such as cell membranes, intracellular vesicles or other cellular organelles; or disrupted cell preparations including but not limited to cell homogenates or lysates, uni- and multilamellar membrane vesicles or other preparations.
- expressed recombinant mesothelin related antigen polypeptides or mesothelin polypeptides or fusion proteins can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography including immunoaffinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
- HPLC high performance liquid chromatography
- HE4a antigen polypeptides or HE4a polypeptides or fusion proteins may also be useful as target antigens in any of a number of assay configurations for routine antibody screening, which can be readily performed by those having ordinary skill in the art.
- the HE4a antigen polypeptide (or HE4a polypeptide) that is an immunogen for the production of a specific antibody to be used in the method of the present invention may thus be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or, preferably, a eukaryotic host.
- the polypeptides of the present invention may be glycosylated or otherwise posttranslationally modified as known in the art and as provided herein.
- a soluble human HE4a antigen polypeptide may be detected in a biological sample from a subject or biological source.
- Biological samples may be provided by obtaining a blood sample, biopsy specimen, tissue explant, organ culture, biological fluid or any other tissue or cell preparation from a subject or a biological source.
- the subject or biological source may be a human or non-human animal, a primary cell culture or culture adapted cell line including but not limited to genetically engineered cell lines that may contain chromosomally integrated or episomal recombinant nucleic acid sequences, immortalized or immortalizable cell lines, somatic cell hybrid cell lines, differentiated or differentiatable cell lines, transformed cell lines and the like.
- the subject or biological source may be suspected of having or being at risk for having a malignant condition, which in certain further preferred embodiments may be an ovarian cancer such as ovarian carcinoma, and in certain other preferred embodiments of the invention the subject or biological source may be known to be free of a risk or presence of such disease.
- the biological sample comprises at least one cell from a subject or biological source
- the biological sample is a biological fluid containing a soluble human mesothelin related antigen polypeptide.
- Biological fluids are typically liquids at physiological temperatures and may include naturally occurring fluids present in, withdrawn from, expressed or otherwise extracted from a subject or biological source. Certain biological fluids derive from particular tissues, organs or localized regions and certain other biological fluids may be more globally or systemically situated in a subject or biological source.
- biological fluids include blood, serum and serosal fluids, plasma, lymph, urine, cerebrospinal fluid, saliva, mucosal secretions of the secretory tissues and organs, vaginal secretions, ascites fluids such as those associated with non-solid tumors, fluids of the pleural, pericardial, peritoneal, abdominal and other body cavities, and the like.
- Biological fluids may also include liquid solutions contacted with a subject or biological source, for example, cell and organ culture medium including cell or organ conditioned medium, lavage fluids and the like.
- the biological sample is serum
- the biological sample is plasma.
- biological sample is a cell-free liquid solution.
- the biological sample comprises an intact cell, and in certain other preferred embodiments the biological sample comprises a cell extract containing a nucleic acid sequence encoding a HE4a antigen polypeptide having the amino acid sequence set forth in SEQ ID NOS:l l or 13, or a fragment or variant thereof.
- a "molecule naturally occurring in soluble form" in a sample may be a soluble protein, polypeptide, peptide, amino acid, or derivative thereof; a lipid, fatty acid or the like, or derivative thereof; a carbohydrate, saccharide or the like or derivative thereof, a nucleic acid, nucleotide, nucleoside, purine, pyrimidine or related molecule, or derivative thereof, or the like; or any combination thereof such as, for example, a glycoprotein, a glycolipid, a lipoprotein, a proteolipid, or any other biological molecule that is a soluble or cell-free constituent of a biological sample as provided herein.
- a "molecule naturally occurring in soluble form” further refers to a molecule that is in solution or present in a biological sample, including a biological fluid as provided herein, and that is not bound to the surface of an intact cell.
- a molecule naturally occurring in soluble form may include but need not be limited to a solute; a component of a macromolecular complex; a material that is shed, secreted or exported from a cell; a colloid; a microparticle or nanoparticle or other fine suspension particle; or the like.
- a malignant condition in a subject refers to the presence of dysplastic, cancerous and/or transformed cells in the subject, including, for example neoplastic, tumor, non-contact inhibited or oncogenically transformed cells, or the like.
- a malignant condition may refer further to the presence in a subject of cancer cells that are capable of secreting, shedding, exporting or releasing a HE4a antigen polypeptide (or a HE4a polypeptide) in such a manner that elevated levels of such a polypeptide are detectable in a biological sample from the subject.
- cancer cells are malignant epithelial cells such as carcinoma cells, and in particularly preferred embodiments such cancer cells are malignant mesothelioma cells, which are transformed variants of squamous cell epithelial or mesothelial cells that are found, for example, lining pleural, pericardial, peritoneal, abdominal and other body cavities.
- tumor cells are ovarian carcinoma cells, including primary and metastatic ovarian carcinoma cells. Criteria for classifying a malignancy as ovarian carcinoma are well known in the art (see, e.g., Bell et al., 1998 Br. J. Obstet. Gynaecol. 105:1136; Meier et al, 1997 Anticancer Res. 17(4B):3019; Meier et al. 1997 Anticancer Res.
- the malignant condition may be mesothelioma, pancreatic carcinoma, non-small cell lung carcinoma or another form of cancer, including any of the various carcinomas such as squamous cell carcinomas and adenocarcinomas, and also including sarcomas and hematologic malignancies (e.g., leukemias, lymphomas, myelomas, etc.).
- squamous cell carcinomas and adenocarcinomas and also including sarcomas and hematologic malignancies (e.g., leukemias, lymphomas, myelomas, etc.).
- sarcomas and hematologic malignancies e.g., leukemias, lymphomas, myelomas, etc.
- the method of screening for the presence of a malignant condition in a subject may feature the use of an antibody specific for a HE4a antigen polypeptide or an antibody specific for a HE4a polypeptide.
- Antibodies that are specific for a HE4a antigen polypeptide (or a HE4a polypeptide) are readily generated as monoclonal antibodies or as polyclonal antisera, or may be produced as genetically engineered immunoglobulins (Ig) that are designed to have desirable properties using methods well known in the art.
- antibodies may include recombinant IgGs, chimeric fusion proteins having immunoglobulin derived sequences or "humanized" antibodies (see, e.g., U.S. Patent Nos. 5,693,762; 5,585,089; 4,816,567; 5,225,539; 5,530,101; and references cited therein) that may all be used for detection of a human HE4a polypeptide according to the invention.
- Such antibodies may be prepared as provided herein, including by immunization with HE4a polypeptides as described below.
- nucleic acid sequences encoding HE4a polypeptides are disclosed, such that those skilled in the art may routinely prepare these polypeptides for use as immunogens.
- monoclonal antibodies such as 2H5, 3D8 and 4H4, which are described in greater detail below, may be used to practice certain methods according to the present invention.
- antibodies includes polyclonal antibodies, monoclonal antibodies, fragments thereof such as F(ab') , and Fab fragments, as well as any naturally occurring or recombinantly produced binding partners, which are molecules that specifically bind a HE4a polypeptide.
- Antibodies are defined to be "immunospecific” or specifically binding if they bind HE4a polypeptide with a K a of greater than or equal to about 10 4 M" 1 , preferably of greater than or equal to about 10 5 M" 1 , more preferably of greater than or equal to about 10 6 M" 1 and still more preferably of greater than or equal to about 10 7 M" 1 .
- Affinities of binding partners or antibodies can be readily determined using conventional techniques, for example those described by Scatchard et al., Ann. NY. Acad. Sci. 51:660 (1949). Determination of other proteins as binding partners of a HE4a polypeptide can be performed using any of a number of known methods for identifying and obtaining proteins that specifically interact with other proteins or polypeptides, for example, a yeast two-hybrid screening system such as that described in U.S. Patent No. 5,283,173 and U.S. Patent No. 5,468,614, or the equivalent.
- the present invention also includes the use of a HE4a polypeptide, and peptides based on the amino acid sequence of a HE4a polypeptide, to prepare binding partners and antibodies that specifically bind to a HE4a polypeptide.
- Antibodies may generally be prepared by any of a variety of techniques known to those of ordinary skill in the art (see, e.g., Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988).
- an immunogen comprising a HE4a polypeptide for example a cell having a HE4a polypeptide on its surface or an isolated HE4a polypeptide is initially injected into a suitable animal (e.g., mice, rats, rabbits, sheep and goats), preferably according to a predetermined schedule incorporating one or more booster immunizations, and the animals are bled periodically.
- a suitable animal e.g., mice, rats, rabbits, sheep and goats
- Polyclonal antibodies specific for the HE4a polypeptide may then be purified from such antisera by, for example, affinity chromatography using the polypeptide coupled to a suitable solid support.
- Monoclonal antibodies specific for HE4a polypeptides or variants thereof may be prepared, for example, using the technique of Kohler and Milstein (1976 Eur. J. Immunol. 5:511-519), and improvements thereto. Briefly, these methods involve the preparation of immortal cell lines capable of producing antibodies having the desired specificity (i.e., reactivity with the mesothelin polypeptide of interest). Such cell lines may be produced, for example, from spleen cells obtained from an animal immunized as described above. The spleen cells are then immortalized by, for example, fusion with a myeloma cell fusion partner, preferably one that is syngeneic with the immunized animal.
- the spleen cells and myeloma cells may be combined with a membrane fusion promoting agent such as polyethylene glycol or a nonionic detergent for a few minutes, and then plated at low density on a selective medium that supports the growth of hybrid cells, but not myeloma cells.
- a preferred selection technique uses HAT (hypoxanthine, aminopterin, thymidine) selection. After a sufficient time, usually about 1 to 2 weeks, colonies of hybrids are observed. Single colonies are selected and tested for binding activity against the polypeptide. Hybridomas having high reactivity and specificity are preferred. Hybridomas that generate monoclonal antibodies that specifically bind to HE4a polypeptides are contemplated by the present invention.
- Monoclonal antibodies may be isolated from the supernatants of growing hybridoma colonies.
- various techniques may be employed to enhance the yield, such as injection of the hybridoma cell line into the peritoneal cavity of a suitable vertebrate host, such as a mouse.
- Monoclonal antibodies may then be harvested from the ascites fluid or the blood.
- Contaminants may be removed from the antibodies by conventional techniques, such as chromatography, gel filtration, precipitation, and extraction.
- antibodies may be purified by chromatography on immobilized Protein G or Protein A using standard techniques.
- antigen-binding fragments of antibodies may be preferred.
- Such fragments include Fab fragments, which may be prepared using standard techniques (e.g., by digestion with papain to yield Fab and Fc fragments).
- the Fab and Fc fragments may be separated by affinity chromatography (e.g., on immobilized protein A columns), using standard techniques. See, e.g., Weir, D.M., Handbook of Experimental Immunology, 1986, Blackwell Scientific, Boston.
- Multifunctional fusion proteins having specific binding affinities for preselected antigens by virtue of immunoglobulin V-region domains encoded by DNA sequences linked in-frame to sequences encoding various effector proteins are known in the art, for example, as disclosed in EP-B 1-0318554, U.S. Patent No. 5,132,405, U.S. Patent No. 5,091,513 and U.S. Patent No. 5,476,786.
- effector proteins include polypeptide domains that may be used to detect binding of the fusion protein by any of a variety of techniques with which those skilled in the art will be familiar, including but not limited to a biotin mimetic sequence (see, e.g., Luo et al., 1998 J. Biotechnol.
- Single chain antibodies for use in the present invention may also be generated and selected by a method such as phage display (see, e.g., U.S. Patent No. 5,223,409; Schlebusch et al., 1997 Hybridoma 16:47; and references cited therein). Briefly, in this method, DNA sequences are inserted into the gene III or gene VIII gene of a filamentous phage, such as Ml 3. Several vectors with multicloning sites have been developed for insertion (McLafferty et al., Gene 128:29-36, 1993; Scott and Smith, Science 249:386-390, 1990; Smith and Scott, Methods Enzymol. 277:228-257, 1993).
- the inserted DNA sequences may be randomly generated or may be variants of a known binding domain for binding to a HE4a polypeptide. Single chain antibodies may readily be generated using this method. Generally, the inserts encode from 6 to 20 amino acids.
- Unbound phage are removed by a wash, typically containing 10 mM Tris, 1 mM EDTA, and without salt or with a low salt concentration. Bound phage are eluted with a salt containing buffer, for example. The NaCl concentration is increased in a step-wise fashion until all the phage are eluted. Typically, phage binding with higher affinity will be released by higher salt concentrations. Eluted phage are propagated in the bacteria host. Further rounds of selection may be performed to select for a few phage binding with high affinity. The DNA sequence of the insert in the binding phage is then determined.
- sufficient peptide for use herein as an antibody specific for a HE4a polypeptide may be made either by recombinant means or synthetically. Recombinant means are used when the antibody is produced as a fusion protein.
- the peptide may also be generated as a tandem array of two or more similar or dissimilar peptides, in order to maximize affinity or binding.
- the detection reagent is typically an antibody, which may be prepared as described herein.
- an antibody which may be prepared as described herein.
- assay formats known to those of ordinary skill in the art for using an antibody to detect a polypeptide in a sample, including but not limited to enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunofluorimetry, immunoprecipitation, equilibrium dialysis, immunodiffusion and other techniques. See, e.g., Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988; Weir, D.M., Handbook of Experimental Immunology, 1986, Blackwell Scientific, Boston.
- the assay may be performed in a Western blot format, wherein a protein preparation from the biological sample is submitted to gel electrophoresis, transferred to a suitable membrane and allowed to react with the antibody. The presence of the antibody on the membrane may then be detected using a suitable detection reagent, as is well known in the art and described below.
- the assay involves the use of an antibody immobilized on a solid support to bind to the target HE4a polypeptide and remove it from the remainder of the sample.
- the bound HE4a polypeptide may then be detected using a second antibody reactive with a distinct HE4a polypeptide antigenic determinant, for example, a reagent that contains a detectable reporter moiety.
- a second antibody reactive with a distinct HE4a polypeptide antigenic determinant for example, a reagent that contains a detectable reporter moiety.
- the immobilized antibody and the second antibody which recognize distinct antigenic determinants may be any two of the monoclonal antibodies described herein selected from the monoclonal antibodies 2H5, 3D8 and 4H4.
- a competitive assay may be utilized, in which a HE4a polypeptide is labeled with a detectable reporter moiety and allowed to bind to the immobilized HE4a polypeptide specific antibody after incubation of the immobilized antibody with the sample.
- the extent to which components of the sample inhibit the binding of the labeled polypeptide to the antibody is indicative of the reactivity of the sample with the immobilized antibody, and as a result, indicative of the level of HE4a in the sample.
- the solid support may be any material known to those of ordinary skill in the art to which the antibody may be attached, such as a test well in a microtiter plate, a nitrocellulose filter or another suitable membrane.
- the support may be a bead or disc, such as glass, fiberglass, latex or a plastic such as polystyrene or polyvinylchloride.
- the antibody may be immobilized on the solid support using a variety of techniques known to those in the art, which are amply described in the patent and scientific literature.
- the assay for detection of HE4a antigen polypeptide in a sample is a two-antibody sandwich assay.
- This assay may be performed by first contacting a HE4a polypeptide-specific antibody (e.g., a monoclonal antibody such as 2H5, 3D8 or 4H4) that has been immobilized on a solid support, commonly the well of a microtiter plate, with the biological sample, such that a soluble molecule naturally occurring in the sample and having an antigenic determinant that is reactive with the antibody is allowed to bind to the immobilized antibody (e.g., a 30 minute incubation time at room temperature is generally sufficient) to form an antigen- antibody complex or an immune complex.
- a HE4a polypeptide-specific antibody e.g., a monoclonal antibody such as 2H5, 3D8 or 4H4
- Unbound constituents of the sample are then removed from the immobilized immune complexes.
- a second antibody specific for a HE4a antigen polypeptide is added, wherein the antigen combining site of the second antibody does not competitively inhibit binding of the antigen combining site of the immobilized first antibody to a HE4a polypeptide (e.g., a monoclonal antibody such as 2H5, 3D8 or 4H4 that is not the same as the monoclonal antibody immobilized on the solid support).
- the second antibody may be detectably labeled as provided herein, such that it may be directly detected.
- the second antibody may be indirectly detected through the use of a detectably labeled secondary (or "second stage") anti- antibody, or by using a specific detection reagent as provided herein.
- the subject invention method is not limited to any particular detection procedure, as those having familiarity with immunoassays will appreciate that there are numerous reagents and configurations for immunologically detecting a particular antigen (e.g., a mesothelin polypeptide) in a two-antibody sandwich immunoassay.
- the first, immobilized antibody specific for a HE4a antigen polypeptide is a polyclonal antibody and the second antibody specific for a HE4a antigen polypeptide is a polyclonal antibody.
- the first, immobilized antibody specific for a HE4a antigen polypeptide is a monoclonal antibody and the second antibody specific for a HE4a antigen polypeptide is a polyclonal antibody.
- the first, immobilized antibody specific for a HE4a antigen polypeptide is a polyclonal antibody and the second antibody specific for a HE4a antigen polypeptide is a monoclonal antibody.
- the first, immobilized antibody specific for a HE4a antigen polypeptide is a monoclonal antibody and the second antibody specific for a HE4a antigen polypeptide is a monoclonal antibody.
- monoclonal antibodies 2H5, 3D8 and 4H4 as provided herein recognize distinct and non- competitive antigenic determinants (e.g., epitopes) on HE4a polypeptides, such that any pairwise combination of these monoclonal antibodies may be employed.
- the first, immobilized antibody specific for a HE4a antigen polypeptide and/or the second antibody specific for a HE4a antigen polypeptide may be any of the kinds of antibodies known in the art and referred to herein, for example by way of illustration and not limitation, Fab fragments, F(ab') 2 fragments, immunoglobulin V-region fusion proteins or single chain antibodies.
- Fab fragments fragments, F(ab') 2 fragments, immunoglobulin V-region fusion proteins or single chain antibodies.
- the second antibody may contain a detectable reporter moiety or label such as an enzyme, dye, radionuclide, luminescent group, fluorescent group or biotin, or the like.
- a detectable reporter moiety or label such as an enzyme, dye, radionuclide, luminescent group, fluorescent group or biotin, or the like.
- the amount of the second antibody that remains bound to the solid support is then determined using a method appropriate for the specific detectable reporter moiety or label. For radioactive groups, scintillation counting or autoradiographic methods are generally appropriate.
- Antibody- enzyme conjugates may be prepared using a variety of coupling techniques (for review see, e.g., Scouten, W.H., Methods in Enzymology 135:30-65, 1987). Spectroscopic methods may be used to detect dyes (including, for example, colorimetric products of enzyme reactions), luminescent groups and fluorescent groups.
- Biotin may be detected using avidin or streptavidin, coupled to a different reporter group (commonly a radioactive or fluorescent group or an enzyme). Enzyme reporter groups may generally be detected by the addition of substrate (generally for a specific period of time), followed by spectroscopic, spectrophotometric or other analysis of the reaction products. Standards and standard additions may be used to determine the level of mesothelin polypeptide in a sample, using well known techniques.
- the invention contemplates the use of a HE4a antigen polypeptide as provided herein to screen for the presence of a malignant condition by detection of immunospecifically reactive antibodies in a biological sample from a biological source or subject.
- a HE4a antigen polypeptide (or a fragment or variant thereof including a truncated HE4a antigen polypeptide as provided herein) is detectably labeled and contacted with a biological sample to detect binding to the HE4a antigen polypeptide of an antibody naturally occurring in soluble form in the sample.
- the HE4a antigen polypeptide may be labeled biosynthetically by using the sequences disclosed herein in concert with well known methods such as incorporation during in vitro translation of a readily detectable (e.g., radioactively labeled) amino acid, or by using other detectable reporter moieties such as those described above.
- a readily detectable amino acid e.g., radioactively labeled amino acid
- this embodiment of the invention contemplates that certain HE4a polypeptides such as the HE4a fusion polypeptides disclosed herein, may provide peptides that are particularly immunogenic and so give rise to specific and detectable antibodies.
- certain HE4a fusion polypeptides may represent "non-self antigens that provoke an avid immune response, while HE4a polypeptides that lack fusion domains may be viewed by the immune system as more resembling "self antigens that do not readily elicit humoral or cell-mediated immunity.
- the present invention pertains in part to the surprising finding that soluble forms of HE4a antigen polypeptides occur naturally in subjects, including elevated levels of such soluble HE4a polypeptides in subjects having certain carcinomas.
- a method of screening for the presence of a malignant condition according to the present invention may be further enhanced by the detection of more than one tumor associated marker in a biological sample from a subject.
- the present invention provides a method of screening that, in addition to detecting reactivity of a naturally occurring soluble sample component with an antibody specific for a HE4a antigen polypeptide, also includes detection of at least one additional soluble marker of a malignant condition using established methods as known in the art and provided herein.
- certain embodiments of the invention relate to human mesothelin polypeptides, which include polypeptides such as the novel soluble mesothelin related antigen (MRA) polypeptide described in Scholler et al. (1999 Proc. Nat. Acad. Sci. USA 96:11531) and as also described in U.S. Application No. 09/513,597.
- MRA novel soluble mesothelin related antigen
- a “mesothelin polypeptide” is a soluble polypeptide having an amino acid sequence that includes the peptide:
- MAb K-l is available from, e.g., Signet Laboratories, Inc., Dedham, MA) or of monoclonal antibodies OV569, 4H3, 3G3 or 1A6 as provided in U.S.A.N. 09/513,597.
- these additional soluble tumor associated antigens for use according to the present invention may include, but need not be limited to, mesothelin and mesothelin related antigen, CEA, CA125, sialyl TN, SCC, TPS and PLAP, (see e.g., Bast et al, 1983 N Eng. J. Med. 309:883; Lloyd et al., 1997 Int. J. Cane. 71:842; Sarandakou et al., 1997 Acta Oncol. 36:755; Sarandakou et al., 1998 Eur. J. Gynaecol. Oncol. 19:73; Meier et al., 1997 Anticanc. Res.
- nucleic acid sequences encoding HE4a polypeptides may be detected, using standard hybridization and/or polymerase chain reaction (PCR) techniques. Suitable probes and primers may be designed by those of ordinary skill in the art based on the HE4a cDNA sequences provided herein. Assays may generally be performed using any of a variety of samples obtained from a biological source, such as eukaryotic cells, bacteria, viruses, extracts prepared from such organisms and fluids found within living organisms. The following Examples are offered by way of illustration and not by way of limitation.
- RNA samples from biopsies were obtained according to the procedures approved by the institutional review boards of the University of Washington, Swedish Hospital and Fred Hutchinson Cancer Research Center, all of Seattle, Washington.
- Samples from normal tissues (adrenal gland, bone marrow, brain, colon, endometrium, stomach, heart, kidney, liver, lung, lung, mammary gland, skeletal muscle, skeletal muscle, myometrium, peripheral nerve, peripheral blood lymphocyte preparations, salivary gland, skin, small intestine, spinal cord, spleen, spleen, trachea, thymus, uterus, peripheral blood lymphocyte cluture, and 40 normal ovaries), from benign ovarian lesions (13 serous cystadenomas), from 2 ovarian tumors of borderline malignancy, from 3 stage I mucinous ovarian carcinomas, 3 stage I serous ovarian carcinomas, 37 stage III serous ovarian carcinomas, 7 stage rv serous ova
- RNA from an ovarian surface epithelial culture (OSE, obtained from B. Karlan, Cedars Sinai Hospital, Los Angeles, CA), and three additional OSE samples (obtained from R. Hernandez, University of Washington, Seattle, WA) were also included.
- OSE ovarian surface epithelial culture
- 151 94 non- malignant tissues and 57 cancers
- Real-time quantitative PCR was performed as follows.
- the HE4 realtime PCR primers were:
- reverse primer ATGGAAGCCCAAGCTGCTGA SEQ ID NO: 18.
- the negative controls consisted of total RNA from an ovarian carcinoma which was reverse transcribed without the enzyme and one well containing all components of the PCR without any template. All runs were performed in duplicate.
- Figure 1 The expression values, as shown in Figure 1 , were depicted in arbitrary units relative to the internal standard and did not reflect absolute quantities of mRNA molecules in standard units of measure. Based on the amplitude of the mean HE4a expression levels and comparison of these values to those of other known genes (notably beta actin as a highly expressed gene), Figure 1 shows that transcripts encoding HE4a were expressed at moderate-to-high relative levels.
- HE4a cDNA clone The cDNA sequence for HE4 (SEQ ID NO: 8) as originally published by Kirchoff et al., (1991) was deposited in GenBank Accession # X63187 and provided the basis for oligonucleotide primer design to clone cDNA encoding HE4a (SEQ ID NO: 10), as described herein.
- the cDNA for HE4a identified and isolated as a differentially expressed gene product using high throughput cDNA arrays, was cloned in pSPORT as an 840 base pair fragment. This cDNA was used as template in PCR reactions to amplify HE4a in a form appropriate for creating synthetic fusion protein genes, as described in this Example.
- HE4a A portion of the HE4 coding sequence (SEQ ID NO: 8) appeared to encode a presumed secretory signal peptide; therefore, this native leader peptide was used in initial constructs to preserve as much of the molecule's structure as possible.
- a fusion protein was designed that incorporated the complete HE4a gene product fused to the human IgGl Fc domain. Primers were designed that encoded appropriate restriction sites for cloning and created the necessary in-frame fusions of protein domains for the final construct.
- the 5' primer (SEQ ID NO:l, or HE4-5') was a 39-mer that included a Hindlll site, a Kozak sequence to improve expression adjacent to the first ATG, and a portion of the HE4a leader peptide based on the previously published HE4 sequence.
- the 3' primer (SEQ ID NO:2, or HE4-3'-l) was a 36-mer that included an in-frame BamHI site for fusion to the human -Ig tail cDNA, with the 3' end of the HE4 coding sequence truncated just before the STOP codon. PCR amplification reactions were performed using these two primers at 50 pmol and 1 ng HE4/pSPORT plasmid as template.
- Fifty microliter reactions also included 2.5 units (0.5 ml) ExTaq DNA polymerase (TaKaRa Shuzo Biomedical, Otsu, Shiga, Japan), diluted buffers and nucleotides according to package insert directions. Reactions were amplified for 30 cycles, with an amplification profile of 94°C, 30 seconds, 60°C, 30 seconds, and 72°C, 30 seconds. PCR products of the expected size (approximately 400 base pairs) for the full length HE4 were obtained. These fragments were restriction digested, purified, and ligated into the appropriately digested mammalian expression plasmid already containing the human IgGl insert.
- Ligation products were transformed into DH5 ⁇ bacterial cells and transformants screened for the presence of HE4-hIgGl fusion gene inserts. Plasmid DNA from several isolates was then sequenced using the BigDye Terminator Cycle Sequencing Kit (PE Biosystems, Foster City, CA) on an ABI Prism 310 (PE Biosystems) sequencer. In addition, plasmid DNA from these isolates was also transfected by DEAE-Dextran transient transfections of COS7 cells as described (Hayden et al., 1994 Ther. Immunol. 1:3).
- HE4 cDNA was PCR amplified from the random primed cDNA in 50 ⁇ l reactions containing 1 ⁇ g cDNA, 2.5 units (0.5 ml) ExTaq DNA polymerase (TaKaRa Shuzo Biomedical, Otsu, Shiga, Japan), diluted buffers and nucleotides according to insert directions, and HE4-5' and HE4-3'-l specific primers. Reactions were amplified for 30 cycles, with an amplification profile of 94°C, 30 seconds, 60°C, 30 seconds, and 72°C, 30 seconds.
- HE4-5' and HE4-3'-l oligonucleotides were again used for PCR amplification of HE4 from the tumor derived cDNAs.
- PCR products of the expected size for the full length HE4 were obtained and the fragments were cloned into pT-AdvanTAge vectors (Clontech, Palo Alto, CA) for sequence analysis.
- Clones with inserts were sequenced as described above, and the PCR fragments from the tumor RNA samples were found to encode HE4a sequence identical to the original clones described above; these HE4a sequences differed from the published sequence for HE4 (Kirchhoff et al., 1991).
- HE4a coding sequence was obtained from normal epidymis (SEQ ID NO: 10) and from primary tumor tissue cDNAs (SEQ ID NO: 12) , and thus matched the new HE4a sequence desribed above but differed from the HE4 sequence (SEQ ID NO:8) of Kirchoff et al. (1991).
- CHO-DG44 cells (Urlaub et al. 1986 Somat. Cell. Mol. Genet. 12: 55) were used to construct stable lines expressing high levels of the fusion proteins of interest Stable CHO lines expressing HE4Ig were created by high copy electroporation in the pD18 vector (Hayden et al., 1996 Tissue Antigens 48: 242; Barsoum, 1990 DNA Cell Biol.
- Spent supernatants were harvested from large-scale cultures and HE4Ig was purified by protein A affinity chromatography over a 2-ml protein A-agarose (Repligen, Cambridge, MA) column. Fusion protein was eluted from the column as 0.8-ml fractions in 0.1 M citrate buffer (pH 2.7), and neutralized using 100 ⁇ l of 1 M Tris base (pH 10.5). Eluted fractions were assayed for absorbance at 280 nm, and fractions containing fusion protein were pooled, dialyzed overnight in several liters of PBS (pH 7.4), and filter sterilized through 0.2- ⁇ m syringe filter units (Millipore, Bedford, MA).
- mice were initially injected intraperitoneally (IP) with 10 micrograms of purified HE4-hIgGl fusion protein at 4 week intervals. After a primary injection and two boosts using this immunization protocol, mice were subsequently injected with 10 ⁇ g protein plus TiterMax Gold adjuvant IP and then SC for two more boosts prior to harvest of spleens. Hybridomas were made by fusing spleen cells from immunized mice with the myeloma partner P3-X63-Ag8-653.
- the membranes were incubated with HRP-goat anti-human IgG (1/10,000) or with HRP-Streptavidin (1:5000) (Caltag) in TBS-T for 1 h at room temperature or 4°C, with gentle agitat iioonn.
- Immuneprecipitates were washed and resuspended in SDS-PAGE reducing sample loading buffer, boiled, then resolved by SDS-PAGE electrophoresis on a 10% Tris/Bis NOVEX gel (Invitrogen, San Diego CA), and transferred by semi-dry blotting onto PVDF membranes (Millipore). The membranes were blocked to prevent nonspecific antibody binding by incubation in 5% nonfat dry milk (Carnation) in PBS/0.25% NP-40 or TBS-T (50 mM Tris HCl, pH 7.6, 0.15 M NaCl, and 0.05% Tween-20) from 1 hour to overnight at 4 C.
- Carnation 5% nonfat dry milk
- TBS-T 50 mM Tris HCl, pH 7.6, 0.15 M NaCl, and 0.05% Tween-20
- the HE4-hIgGl fusion protein rans at an apparent Mr of approximately 48 kDa on reduced gels or Western blots, larger than the 39 kDa expected based on the predicted amino acid sequence, suggesting that the molecule was glycosylated.
- HE4-mIgG2a Fusion Proteins A similar construction to the HE4-hIgGl fusion gene was also made, but substituting the murine -IgG2a domain for the human IgG Fc fragment. The alternate tail was used so that immunizations of mice would not be affected by immunogenicity of the human Ig tail fusion domain.
- Existing cDNA clones of the mIgG2a tail were out of frame with respect to the HE4a clone described above, so the -mIgG2a cassette was reamplified from such plasmids to create an in-frame fusion domain.
- the forward, sense primer used was
- the template used contained murine CTLA4 fused to the murine IgG2a Fc domain, but with the restriction site at the fusion junction out of frame with respect to the codon spacing.
- the new oligonucleotides created a frameshift, altering the reading frame at the BamHI site so that the fusion gene with HE4 would result in expression of a complete HE4-mIgG2a fusion protein.
- PCR products were amplified, subcloned, and processed as described for the human fusion genes. Molecules were subcloned into the pD18 mammalian expression vector, stable CHO clones generated, and fusion protein expressed as described above for the HE4-human IgGl fusion proteins.
- HE4a-specific hybridomas were prepared by standard methodologies using spleen cells from mice exhibiting high HE4a-specific antibody titers.
- Figure 4 shows the initial testing, by ELISA, of hybridomas made by using spleen cells from mouse 1605 (whose serum data are shown in Fig. 3).
- Three wells displayed high reactivity against HE4a-hIg.
- Three hybridomas, 2H5, 3D8 and 4H4 were subsequently isolated from these wells following cloning by limiting dilution.
- Hybridomas 2H5 and 3D8 were found to identify different epitopes according to competition assays.
- FIG. 1 shows an example of a standard curve, prepared by using HE4a-hIgG diluted in DMEM culture medium. As illustrated in the figure, a signal was detected at the 1 ng level of HE4a-hIgG.
- Fig. 1 A double determinant (“sandwich”) ELISA was constructed, using a similar approach as that employed to make an ELISA which measures mesothelin/MPF and related antigens in serum and other fluids (Scholler et al., Proc. Natl. Acad. Sci. USA 96, 11531, 1999) using the two MAbs 2H5 and 3D8 referred to above.
- Figure 5 shows an example of a standard curve, prepared by using HE4a-hIgG diluted in DMEM culture medium. As illustrated in the figure, a signal was detected at the 1 ng level of HE4a-hIgG.
- FIG. 5 also shows that undiluted culture medium from an ovarian carcinoma line (4007) gave a detectable signal.
- Figure 6 shows that ascites fluid from a patient (designated OV50) diagnosed with ovarian carcinoma contained HE4a antigen which was still detectable at the highest dilution tested (1 : 1280).
- the initial HE4a ELISA was improved by establishing the optimal amounts of the two antibodies used.
- One of these antibodies, 2H5 was biotinylated and the other antibody, 3D8 was immobilized by permitting it to become bound to the bottom of the test plate; the respective doses of the two monoclonal antibodies for the assay were 2.5 and 100 ⁇ g/ml.
- the assay methods were identical to those described for mesothelin/MPF and related molecules (Scholler et al., 1999 Proc. Natl. Acad. Sci. USA 96:11531).
- the ELISA has so far been investigated with respect to its ability to aid the diagnosis of ovarian carcinoma, it should be equally applicable to any tumor that overexpresses the HE4a encoded antigen.
- the same ELISA, or a modification of it, should also be applicable for studies of HE4- related molecules, if future studies will identify such.
- HE4a protein at the cell surface may, according to non-limiting theory, provide a target for immunotherapeutic strategies such as HE4a-specific antibody- mediated and/or HE4a-specific T-cell mediated therapies.
- Detection of the amplification of HE4a-encoding nucleic acid sequences and/or of HE4a overexpression in certain tumors is performed employing the compositions and methods described above, and HE4a expression levels are compared to those in normal tissues.
- HE4a-specific monoclonal antibody-defined epitopes in tumors provides for the identification of HE4a epitopes that are used as targets for prophylactic or preventive vaccines with applicability in cancer therapy; such vaccines may also usefully alter (e.g., increase or decrease in a statistically significant manner relative to a suitable control) fertilization (which may in certain embodiments be reflected by demonstration of HE4a protease-inhibitory or protease-enhancing activity using well known assays for protease inhibition by members of the four-disulfide core family, such as Slp-1).
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Hematology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Cell Biology (AREA)
- Animal Behavior & Ethology (AREA)
- General Physics & Mathematics (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Reproductive Health (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Gastroenterology & Hepatology (AREA)
- Gynecology & Obstetrics (AREA)
- Pregnancy & Childbirth (AREA)
- Endocrinology (AREA)
- Oncology (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BR0212211A BR0212211A (pt) | 2001-08-29 | 2002-08-29 | Diagnóstico de carcinomas |
| KR10-2004-7003017A KR20040062534A (ko) | 2001-08-29 | 2002-08-29 | 암 진단 |
| JP2003525305A JP2005501549A (ja) | 2001-08-29 | 2002-08-29 | 癌腫の診断 |
| CA2459077A CA2459077C (en) | 2001-08-29 | 2002-08-29 | Diagnosis of ovarian carcinomas |
| CNA028192680A CN1813188A (zh) | 2001-08-29 | 2002-08-29 | 癌的诊断 |
| EP20020797648 EP1421388A2 (en) | 2001-08-29 | 2002-08-29 | Diagnosis of carcinomas |
| MXPA04001963A MXPA04001963A (es) | 2001-08-29 | 2002-08-29 | Diagnostico de carcinomas. |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US31653701P | 2001-08-29 | 2001-08-29 | |
| US60/316,537 | 2001-08-29 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP14179937.9A Previously-Filed-Application EP2913673B1 (en) | 2001-08-29 | 2002-08-29 | Diagnosis of ovarian carcinoma |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2003021273A2 true WO2003021273A2 (en) | 2003-03-13 |
| WO2003021273A3 WO2003021273A3 (en) | 2003-12-04 |
Family
ID=23229467
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2002/009653 Ceased WO2003021273A2 (en) | 2001-08-29 | 2002-08-29 | Diagnosis of carcinomas |
Country Status (11)
| Country | Link |
|---|---|
| US (4) | US7270960B2 (https=) |
| EP (3) | EP2913673B1 (https=) |
| JP (5) | JP2005501549A (https=) |
| KR (1) | KR20040062534A (https=) |
| CN (1) | CN1813188A (https=) |
| BR (1) | BR0212211A (https=) |
| CA (1) | CA2459077C (https=) |
| ES (1) | ES2628952T3 (https=) |
| MX (1) | MXPA04001963A (https=) |
| RU (1) | RU2004109149A (https=) |
| WO (1) | WO2003021273A2 (https=) |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008112514A1 (en) * | 2007-03-09 | 2008-09-18 | Tripath Imaging, Inc. | He4 monoclonal antibodies and methods for their use |
| EP1846768A4 (en) * | 2006-01-04 | 2009-04-08 | Fujirebio America Inc | Use of he4 and other biochemical markers for assessment of ovarian cancers |
| EP1714151A4 (en) * | 2004-01-21 | 2009-06-10 | Fujirebio America Inc | DETECTION OF PEPTIDES RELATED TO MESOTHELIN / MEGAKARYOCYTIC POTENTIAL FACTOR IN PERITONEAL LIQUID FOR THE ASSESSMENT OF THE PERITONEUM AND PERITONEAL CAVE |
| EP1716168A4 (en) * | 2004-01-21 | 2009-06-24 | Fujirebio America Inc | DETECTION OF PEPTIDES RELATED TO THE URINARY MESOTHELIN / MEGAKARYOCYTE POTENTIATING FACTOR FOR THE STUDY OF MESOTHELIOMES |
| EP2609429A4 (en) * | 2010-08-26 | 2014-03-19 | Univ Washington Ct Commerciali | Methods for detecting anti-he4 antibodies and methods of diagnosis and/or prognosis of conditions associated with he4-expressing cells |
| EP2717901A4 (en) * | 2011-06-06 | 2015-01-21 | Women And Infants Hospital Of Rhode Island | HE4-BASED THERAPY FOR MALIGNINE DISEASES |
| US9090712B2 (en) | 2001-08-29 | 2015-07-28 | Pacific Northwest Research Institute | Diagnosis of carcinomas |
| EP2726093A4 (en) * | 2011-06-28 | 2015-08-19 | Inhibrx Llc | WAP DOMAIN FUSION POLYPEPTIDES AND METHOD FOR THEIR USE |
| EP2726092A4 (en) * | 2011-06-28 | 2015-08-19 | Inhibrx Llc | SERPINFUSION POLYPEPTIDES AND METHOD OF USE THEREOF |
| US9499606B2 (en) | 2003-08-26 | 2016-11-22 | The Regents Of The University Of Colorado, A Body Corporate | Compositions of, and methods for, alpha-1 anti trypsin Fc fusion molecules |
| US9938353B2 (en) | 2011-06-24 | 2018-04-10 | The Regents Of The University Of Colorado, A Body Corporate | Compositions, methods and uses for alpha-1 antitrypsin fusion molecules |
| RU2650778C2 (ru) * | 2011-02-17 | 2018-04-17 | Фуджиребио Диагностикс, Инк | Композиции и способы применения для определения не4а |
| US10400029B2 (en) | 2011-06-28 | 2019-09-03 | Inhibrx, Lp | Serpin fusion polypeptides and methods of use thereof |
| US10478508B2 (en) | 2012-01-10 | 2019-11-19 | The Regents Of The University Of Colorado, A Body Corporate | Compositions, methods and uses for alpha-1 antitrypsin fusion molecules |
| EP4169941A4 (en) * | 2020-06-23 | 2024-06-12 | Mitsui Chemicals, Inc. | METHODS FOR DETECTION OF ADENOCARCINOMAS AND EXAMINATION KIT |
Families Citing this family (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2002258518A1 (en) * | 2001-03-14 | 2002-09-24 | Millennium Pharmaceuticals, Inc. | Nucleic acid molecules and proteins for the identification, assessment, prevention, and therapy of ovarian cancer |
| WO2004106495A2 (en) * | 2003-05-29 | 2004-12-09 | Millennium Pharmaceuticals, Inc. | Compositions, kits, and methods for identification, assessment, prevention, and therapy of breast cancer |
| CA2761987A1 (en) * | 2003-10-07 | 2005-04-21 | Millennium Pharmaceuticals, Inc. | Nucleic acid molecules and proteins for the identification, assessment, prevention, and therapy of ovarian cancer |
| BRPI0514259A (pt) * | 2004-08-11 | 2008-06-03 | Trubion Pharmaceuticals Inc | proteìna de fusão de domìnio de ligação |
| EP1877795A4 (en) * | 2005-05-02 | 2010-04-28 | Brigham & Womens Hospital | DIAGNOSTIC PROFILE MANUFACTURE OF SERUM ANTIBODIES |
| JP5159619B2 (ja) * | 2005-06-22 | 2013-03-06 | ザ・ジョンズ・ホプキンス・ユニバーシティ | 卵巣癌のバイオマーカー:ctap3関連タンパク質 |
| EP2363711A1 (en) * | 2006-01-27 | 2011-09-07 | Tripath Imaging, Inc. | Methods for identifying patients with an increased likelihood of having ovarian cancer and compositions therefor |
| RU2328735C2 (ru) * | 2006-08-16 | 2008-07-10 | Федеральное государственное учреждение "Российский научно-исследовательский институт травматологии и ортопедии им. Р.Р. Вредена Федерального агентства по высокотехнологичной медицинской помощи" (ФГУ "РНИИТО им. Р.Р. Вредена Росмедтехнологий") | Способ тестирования трупов-доноров на пригодность их тканей к трансплантации |
| US7811778B2 (en) | 2006-09-06 | 2010-10-12 | Vanderbilt University | Methods of screening for gastrointestinal cancer |
| JP5144742B2 (ja) * | 2007-03-29 | 2013-02-13 | フジレビオ ダイアグノスティックス インコーポレイテッド | 乳がんの評価のためのhe4の使用 |
| US8642347B2 (en) * | 2008-01-31 | 2014-02-04 | The Brigham And Women's Hospital, Inc. | Urinary CA125 peptides as biomarkers of ovarian cancer |
| US8476026B2 (en) * | 2008-04-01 | 2013-07-02 | The Brigham And Women's Hospital, Inc. | Biomarkers of ovarian cancer |
| US8993347B2 (en) * | 2009-12-17 | 2015-03-31 | Cornell University | Methods for detecting antibodies in mucosal samples and device for sampling mucosal material |
| US20130095503A1 (en) * | 2010-01-05 | 2013-04-18 | University Of Cincinnati | Serum spla2-iia as diagnosis marker for prostate and lung cancer |
| KR20140024860A (ko) * | 2011-02-24 | 2014-03-03 | 버밀리언, 인코포레이티드 | 난소암에 대한 바이오마커 패널,진단 방법 및 시험 키트 |
| PL2731972T3 (pl) | 2011-07-15 | 2018-06-29 | Eisai R&D Management Co., Ltd. | Przeciwciała skierowane przeciwko receptorowi folianowemu alfa i ich zastosowania |
| CN103575902B (zh) * | 2012-08-03 | 2015-07-29 | 河南生生医疗器械有限公司 | 一种时间分辨荧光法四项综合检测卵巢癌试剂盒及其应用 |
| WO2016011143A1 (en) * | 2014-07-15 | 2016-01-21 | Temple University Of The Commonwealth System Of Higher Education | Stabilized peptide fragments from redoxin proteins as cancer biomarkers |
| CN106467573B (zh) * | 2015-08-21 | 2021-05-25 | 佧珐药业有限公司 | 抗间皮素全人抗体以及靶向间皮素的免疫效应细胞 |
| RU2641094C1 (ru) * | 2016-12-22 | 2018-01-15 | Федеральное государственное бюджетное учреждение "Национальный медицинский исследовательский центр акушерства, гинекологии и перинатологии имени академика В.И. Кулакова" Министерства здравоохранения Российской Федерации | Способ ранней диагностики серозной карциномы яичника высокой степени злокачественности на основании изменения клеточного состава эпителия маточной трубы |
| WO2019060716A1 (en) | 2017-09-25 | 2019-03-28 | Freenome Holdings, Inc. | SAMPLE EXTRACTION METHODS AND SYSTEMS |
| WO2020018381A1 (en) | 2018-07-18 | 2020-01-23 | The Regents Of The University Of California | Kidney injury treatment |
| JP7539369B2 (ja) * | 2019-04-02 | 2024-08-23 | 大塚製薬株式会社 | 病態情報生成方法、病態情報生成システム、he4糖鎖分析キット及びhe4 |
| AU2020283042B2 (en) | 2019-05-31 | 2026-02-19 | Freenome Holdings, Inc. | Methods and systems for high-depth sequencing of methylated nucleic acid |
| CA3178302A1 (en) | 2020-03-31 | 2021-10-07 | Freenome Holdings, Inc. | Methods and systems for detecting colorectal cancer via nucleic acid methylation analysis |
| WO2022076237A1 (en) | 2020-10-05 | 2022-04-14 | Freenome Holdings, Inc. | Markers for the early detection of colon cell proliferative disorders |
| AU2021409465A1 (en) | 2020-12-21 | 2023-08-03 | Freenome Holdings, Inc. | Markers for the early detection of colon cell proliferative disorders |
| EP4403634A1 (en) * | 2021-09-16 | 2024-07-24 | Qmine Co., Ltd. | Antisense compound that regulates expression of wfdc2 |
| US20240376473A1 (en) * | 2021-09-16 | 2024-11-14 | Qmine Co., Ltd. | Antisense compound for modulating wfdc2 expression |
Family Cites Families (71)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4713352A (en) | 1981-08-31 | 1987-12-15 | Sloan-Kettering Institute For Cancer Reseach | Monoclonal antibody panel for early diagnosis and therapy of renal carcinoma |
| US4612282A (en) | 1981-12-15 | 1986-09-16 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Monoclonal antibodies reactive with human breast cancer |
| US4737462A (en) | 1982-10-19 | 1988-04-12 | Cetus Corporation | Structural genes, plasmids and transformed cells for producing cysteine depleted muteins of interferon-β |
| SE8300693L (sv) | 1983-02-09 | 1984-08-10 | Sven Lofdahl | Sett att framstella och isolera proteiner och polypeptider samt en hybridvektor for detta |
| US4579827A (en) | 1983-03-11 | 1986-04-01 | Sloan-Kettering Institute For Cancer Research | Monoclonal antibodies to human gastrointestinal cancers and hybridoma method of production of the monoclonal antibodies |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US4518584A (en) | 1983-04-15 | 1985-05-21 | Cetus Corporation | Human recombinant interleukin-2 muteins |
| US5190931A (en) | 1983-10-20 | 1993-03-02 | The Research Foundation Of State University Of New York | Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA |
| US4753894A (en) | 1984-02-08 | 1988-06-28 | Cetus Corporation | Monoclonal anti-human breast cancer antibodies |
| WO1986002077A1 (en) | 1984-10-02 | 1986-04-10 | Meade Harry M | Production of streptavidin-like polypeptides |
| US5272254A (en) | 1984-10-02 | 1993-12-21 | Biogen Inc. | Production of streptavidin-like polypeptides |
| ZA858371B (en) | 1984-11-02 | 1987-03-25 | Oncogen | Monoclonal antibodies for human non-small cell lung carcinomas |
| US5391485A (en) | 1985-08-06 | 1995-02-21 | Immunex Corporation | DNAs encoding analog GM-CSF molecules displaying resistance to proteases which cleave at adjacent dibasic residues |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| US5116742A (en) | 1986-12-03 | 1992-05-26 | University Patents, Inc. | RNA ribozyme restriction endoribonucleases and methods |
| US4987071A (en) | 1986-12-03 | 1991-01-22 | University Patents, Inc. | RNA ribozyme polymerases, dephosphorylases, restriction endoribonucleases and methods |
| US5011912A (en) | 1986-12-19 | 1991-04-30 | Immunex Corporation | Hybridoma and monoclonal antibody for use in an immunoaffinity purification system |
| ATE243754T1 (de) | 1987-05-21 | 2003-07-15 | Micromet Ag | Multifunktionelle proteine mit vorbestimmter zielsetzung |
| US5132405A (en) | 1987-05-21 | 1992-07-21 | Creative Biomolecules, Inc. | Biosynthetic antibody binding sites |
| US5091513A (en) | 1987-05-21 | 1992-02-25 | Creative Biomolecules, Inc. | Biosynthetic antibody binding sites |
| GB8723661D0 (en) | 1987-10-08 | 1987-11-11 | British Bio Technology | Synthetic gene |
| US5093245A (en) | 1988-01-26 | 1992-03-03 | Applied Biosystems | Labeling by simultaneous ligation and restriction |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| US5176996A (en) | 1988-12-20 | 1993-01-05 | Baylor College Of Medicine | Method for making synthetic oligonucleotides which bind specifically to target sites on duplex DNA molecules, by forming a colinear triplex, the synthetic oligonucleotides and methods of use |
| US5530101A (en) | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5087617A (en) | 1989-02-15 | 1992-02-11 | Board Of Regents, The University Of Texas System | Methods and compositions for treatment of cancer using oligonucleotides |
| US5168053A (en) | 1989-03-24 | 1992-12-01 | Yale University | Cleavage of targeted RNA by RNAase P |
| US5272262A (en) | 1989-06-21 | 1993-12-21 | City Of Hope | Method for the production of catalytic RNA in bacteria |
| US5144019A (en) | 1989-06-21 | 1992-09-01 | City Of Hope | Ribozyme cleavage of HIV-I RNA |
| US5283173A (en) | 1990-01-24 | 1994-02-01 | The Research Foundation Of State University Of New York | System to detect protein-protein interactions |
| DE4002981C2 (de) | 1990-02-01 | 1998-03-12 | Ihf Inst Fuer Hormon Und Fortp | Humane, Epididymis-spezifische Polypeptide und deren Verwendung zur Therapie und Diagnose männlicher Infertilität |
| US5180818A (en) | 1990-03-21 | 1993-01-19 | The University Of Colorado Foundation, Inc. | Site specific cleavage of single-stranded dna |
| US5135917A (en) | 1990-07-12 | 1992-08-04 | Nova Pharmaceutical Corporation | Interleukin receptor expression inhibiting antisense oligonucleotides |
| US6072039A (en) | 1991-04-19 | 2000-06-06 | Rohm And Haas Company | Hybrid polypeptide comparing a biotinylated avidin binding polypeptide fused to a polypeptide of interest |
| DE4135543A1 (de) | 1991-10-28 | 1993-04-29 | Boehringer Mannheim Gmbh | Rekombinantes core-streptavidin |
| DE69334070T2 (de) * | 1992-05-26 | 2007-01-04 | Immunex Corp., Thousand Oaks | Neue zytokine die cd30 binden |
| WO1993024631A1 (en) | 1992-05-29 | 1993-12-09 | E.I. Du Pont De Nemours And Company | PRODUCTION OF STREPTAVIDIN FROM $i(BACILLUS SUBTILIS) |
| US5935824A (en) * | 1996-01-31 | 1999-08-10 | Technologene, Inc. | Protein expression system |
| US6313269B1 (en) | 1997-03-14 | 2001-11-06 | Smithkline Beecham Corporation | Tumor necrosis factor related receptor, TR6 |
| EP1033402A4 (en) | 1997-11-05 | 2003-01-02 | Sumitomo Electric Industries | P16 BINDING PROTEINS, CODING GENES AND ANTIBODIES AGAINST THAT |
| US6783961B1 (en) * | 1999-02-26 | 2004-08-31 | Genset S.A. | Expressed sequence tags and encoded human proteins |
| GB9810040D0 (en) * | 1998-05-11 | 1998-07-08 | Univ Nottingham | Blood borne tumour markers |
| CA2349444A1 (en) * | 1998-11-03 | 2000-05-11 | Mitokor | Production of adenine nucleotide translocator (ant), novel ant ligands and screening assays therefor |
| US6737056B1 (en) * | 1999-01-15 | 2004-05-18 | Genentech, Inc. | Polypeptide variants with altered effector function |
| DE60028361T2 (de) | 1999-02-26 | 2007-05-10 | Pacific Northwest Research Institute, Seattle | Verfahren und zusammensetzungen zur karzinomdiagnose |
| CA2296792A1 (en) | 1999-02-26 | 2000-08-26 | Genset S.A. | Expressed sequence tags and encoded human proteins |
| US6770445B1 (en) * | 1999-02-26 | 2004-08-03 | Pacific Northwest Research Institute | Methods and compositions for diagnosing carcinomas |
| US20030143234A1 (en) | 1999-08-20 | 2003-07-31 | Wenyuan Shi | Anti-microbial targeting chimeric pharmaceutical |
| CA2382783A1 (en) * | 1999-08-24 | 2001-03-01 | Texas Biotechnology Corporation | A polynucleotide encoding a human junctional adhesion protein (jam-2) |
| WO2001016354A1 (en) | 1999-09-02 | 2001-03-08 | Gene Logic, Inc. | Modulation of he4 in inflammatory and renal diseases |
| WO2001018542A2 (en) * | 1999-09-03 | 2001-03-15 | Millennium Pharmaceuticals, Inc. | Identification, assessment, prevention, and therapy of ovarian cancer |
| CA2395872A1 (en) | 2000-01-31 | 2001-08-02 | Human Genome Sciences, Inc. | Nucleic acids, proteins, and antibodies |
| US7279294B2 (en) * | 2000-04-03 | 2007-10-09 | The United States Of America As Represented By The Secretary, Dept. Of Health And Human Services, Nih | Tumor markers in ovarian cancer |
| AU2001266787A1 (en) | 2000-06-07 | 2002-01-08 | Human Genome Sciences, Inc. | Nucleic acids, proteins, and antibodies |
| WO2002046765A2 (en) * | 2000-11-08 | 2002-06-13 | Millennium Pharmaceuticals, Inc. | Compositions, kits, and methods for identification, assessment, prevention, and therapy of ovarian cancer |
| AU2002258518A1 (en) | 2001-03-14 | 2002-09-24 | Millennium Pharmaceuticals, Inc. | Nucleic acid molecules and proteins for the identification, assessment, prevention, and therapy of ovarian cancer |
| EP1390497A2 (en) * | 2001-05-25 | 2004-02-25 | Genset | Human cdnas and proteins and uses thereof |
| US7270960B2 (en) | 2001-08-29 | 2007-09-18 | Pacific Northwest Research Institute | Diagnosis of ovarian carcinomas |
| JP2006515065A (ja) | 2002-08-16 | 2006-05-18 | ディシジョン バイオマーカーズ インコーポレイテッド | 蛍光配列の読み取り |
| WO2004063355A2 (en) | 2003-01-10 | 2004-07-29 | Protein Design Labs, Inc. | Novel methods of diagnosis of metastatic cancer, compositions and methods of screening for modulators of matastatic cancer |
| US7666583B2 (en) * | 2004-02-19 | 2010-02-23 | Yale University | Identification of cancer protein biomarkers using proteomic techniques |
| DE102004014645A1 (de) * | 2004-03-25 | 2005-10-13 | Mitsubishi Polyester Film Gmbh | Transparente, elektrisch leitfähige, beschichtete Polyesterfolie, Verfahren zu ihrer Herstellung sowie ihre Verwendung |
| BRPI0514259A (pt) * | 2004-08-11 | 2008-06-03 | Trubion Pharmaceuticals Inc | proteìna de fusão de domìnio de ligação |
| CA2597271A1 (en) | 2005-02-16 | 2006-08-24 | Dana-Farber Cancer Institute | Methods of detecting ovarian cancer |
| WO2006135886A2 (en) | 2005-06-13 | 2006-12-21 | The Regents Of The University Of Michigan | Compositions and methods for treating and diagnosing cancer |
| WO2007002535A2 (en) | 2005-06-24 | 2007-01-04 | Ciphergen Biosystems, Inc. | Biomarkers for ovarian cancer |
| CN101473041B (zh) | 2006-01-04 | 2017-11-14 | 富士瑞必欧美国公司 | He4与其它生化标记物在评估子宫内膜癌和子宫癌中的应用 |
| EP2087152B1 (en) * | 2006-10-27 | 2015-03-11 | Walfish, Paul | Endometrial biomarkers |
| CN101802014A (zh) * | 2007-03-09 | 2010-08-11 | 三路影像公司 | He4单克隆抗体和它们的使用方法 |
| US20130224772A1 (en) * | 2010-08-26 | 2013-08-29 | University Of Washington Through Its Center For Commercialization | Method for detecting anti-he4 antibodies and methods of diagnosis and/or prognosis of conditions associated with he4-expressing cells |
| JP5887364B2 (ja) * | 2011-02-17 | 2016-03-16 | フジレビオ ダイアグノスティックス インコーポレイテッド | HE4aの測定のための組成物および使用方法 |
-
2002
- 2002-08-28 US US10/233,150 patent/US7270960B2/en not_active Expired - Lifetime
- 2002-08-29 MX MXPA04001963A patent/MXPA04001963A/es unknown
- 2002-08-29 EP EP14179937.9A patent/EP2913673B1/en not_active Expired - Lifetime
- 2002-08-29 EP EP20100184645 patent/EP2322933A1/en not_active Withdrawn
- 2002-08-29 JP JP2003525305A patent/JP2005501549A/ja not_active Withdrawn
- 2002-08-29 WO PCT/EP2002/009653 patent/WO2003021273A2/en not_active Ceased
- 2002-08-29 EP EP20020797648 patent/EP1421388A2/en not_active Withdrawn
- 2002-08-29 CA CA2459077A patent/CA2459077C/en not_active Expired - Lifetime
- 2002-08-29 KR KR10-2004-7003017A patent/KR20040062534A/ko not_active Withdrawn
- 2002-08-29 ES ES14179937.9T patent/ES2628952T3/es not_active Expired - Lifetime
- 2002-08-29 CN CNA028192680A patent/CN1813188A/zh active Pending
- 2002-08-29 BR BR0212211A patent/BR0212211A/pt not_active Application Discontinuation
- 2002-08-29 RU RU2004109149/15A patent/RU2004109149A/ru not_active Application Discontinuation
-
2007
- 2007-08-08 US US11/890,896 patent/US20090104684A1/en not_active Abandoned
-
2009
- 2009-04-23 JP JP2009104717A patent/JP5188443B2/ja not_active Expired - Lifetime
- 2009-08-06 US US12/536,975 patent/US9090712B2/en not_active Expired - Lifetime
-
2012
- 2012-03-14 JP JP2012056979A patent/JP5797136B2/ja not_active Expired - Lifetime
-
2014
- 2014-01-17 JP JP2014006581A patent/JP2014081386A/ja not_active Withdrawn
-
2015
- 2015-07-27 US US14/809,498 patent/US20160033512A1/en not_active Abandoned
- 2015-10-26 JP JP2015209823A patent/JP2016065870A/ja active Pending
Cited By (34)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9090712B2 (en) | 2001-08-29 | 2015-07-28 | Pacific Northwest Research Institute | Diagnosis of carcinomas |
| US9695229B2 (en) | 2003-08-26 | 2017-07-04 | The Regents Of The University Of Colorado, A Body Corporate | Compositions of, and methods for, alpha-1 antitrypsin Fc fusion molecules |
| US9499606B2 (en) | 2003-08-26 | 2016-11-22 | The Regents Of The University Of Colorado, A Body Corporate | Compositions of, and methods for, alpha-1 anti trypsin Fc fusion molecules |
| US10913790B2 (en) | 2003-08-26 | 2021-02-09 | The Regents Of The University Of Colorado, A Body Corporate | Compositions of, and methods for, alpha-1 anti trypsin Fc fusion molecules |
| EP1714151A4 (en) * | 2004-01-21 | 2009-06-10 | Fujirebio America Inc | DETECTION OF PEPTIDES RELATED TO MESOTHELIN / MEGAKARYOCYTIC POTENTIAL FACTOR IN PERITONEAL LIQUID FOR THE ASSESSMENT OF THE PERITONEUM AND PERITONEAL CAVE |
| EP1716168A4 (en) * | 2004-01-21 | 2009-06-24 | Fujirebio America Inc | DETECTION OF PEPTIDES RELATED TO THE URINARY MESOTHELIN / MEGAKARYOCYTE POTENTIATING FACTOR FOR THE STUDY OF MESOTHELIOMES |
| EP2444805A3 (en) * | 2004-01-21 | 2012-06-20 | Fujirebio America, Inc. | Detection of mesothelin-/megakaryocyte potentiating factor-related peptides in peritoneal fluid for assessment of the peritoneum and the peritoneal cavity |
| EP2420576A3 (en) * | 2006-01-04 | 2012-03-14 | Fujirebio America, Inc. | Use of HE4 and other biochemical markers for assessment of ovarian cancers |
| EP2423321A3 (en) * | 2006-01-04 | 2012-03-14 | Fujirebio America, Inc. | Use of HE4 and other biochemical markers for assessment of endometrial and uterine cancers |
| EP1969136A4 (en) * | 2006-01-04 | 2009-04-15 | Fujirebio America Inc | USE OF HE4 AND OTHER BIOCHEMICAL MARKERS FOR THE ASSESSMENT OF ENDOMETRIC AND BEARNUT CANCER |
| EP3026119A1 (en) * | 2006-01-04 | 2016-06-01 | Fujirebio America, Inc. | Use of he4 and other biochemical markers for assessment of ovarian cancers |
| EP1846768A4 (en) * | 2006-01-04 | 2009-04-08 | Fujirebio America Inc | Use of he4 and other biochemical markers for assessment of ovarian cancers |
| EP2982761A1 (en) * | 2006-01-04 | 2016-02-10 | Fujirebio America, Inc. | Use of he4 and other biochemical markers for assessment of endometrial and uterine cancers |
| US7846692B2 (en) | 2007-03-09 | 2010-12-07 | Tripath Imaging, Inc. | HE4 monoclonal antibodies and methods for their use |
| WO2008112514A1 (en) * | 2007-03-09 | 2008-09-18 | Tripath Imaging, Inc. | He4 monoclonal antibodies and methods for their use |
| EP2609429A4 (en) * | 2010-08-26 | 2014-03-19 | Univ Washington Ct Commerciali | Methods for detecting anti-he4 antibodies and methods of diagnosis and/or prognosis of conditions associated with he4-expressing cells |
| RU2650778C2 (ru) * | 2011-02-17 | 2018-04-17 | Фуджиребио Диагностикс, Инк | Композиции и способы применения для определения не4а |
| EP2717901A4 (en) * | 2011-06-06 | 2015-01-21 | Women And Infants Hospital Of Rhode Island | HE4-BASED THERAPY FOR MALIGNINE DISEASES |
| US9980982B2 (en) | 2011-06-06 | 2018-05-29 | Women & Infants Hospital Of Rhode Island | HE4 based therapy for malignant disease |
| US12030958B2 (en) | 2011-06-24 | 2024-07-09 | The Regents Of The University Of Colorado | Compositions and methods of use of alpha-1 antitrypsin fusion polypeptides |
| US9938353B2 (en) | 2011-06-24 | 2018-04-10 | The Regents Of The University Of Colorado, A Body Corporate | Compositions, methods and uses for alpha-1 antitrypsin fusion molecules |
| AU2012275295B2 (en) * | 2011-06-28 | 2016-11-10 | Inhibrx, Lp | WAP domain fusion polypeptides and methods of use thereof |
| US9920109B2 (en) | 2011-06-28 | 2018-03-20 | Inhibrx Lp | Serpin fusion polypeptides and methods of purification thereof |
| US9914765B2 (en) | 2011-06-28 | 2018-03-13 | Inhibrx Lp | WAP domain fusion polypeptides and methods of use thereof |
| US10400029B2 (en) | 2011-06-28 | 2019-09-03 | Inhibrx, Lp | Serpin fusion polypeptides and methods of use thereof |
| US10723785B2 (en) | 2011-06-28 | 2020-07-28 | Inhibrx, Inc. | Serpin fusion polypeptides and methods of use thereof |
| US10730929B2 (en) | 2011-06-28 | 2020-08-04 | Inhibrx Lp | Serpin fusion polypeptides and methods of use thereof |
| EP2726092A4 (en) * | 2011-06-28 | 2015-08-19 | Inhibrx Llc | SERPINFUSION POLYPEPTIDES AND METHOD OF USE THEREOF |
| US11046752B2 (en) | 2011-06-28 | 2021-06-29 | Inhibrx, Inc. | Serpin fusion polypeptides and methods of use thereof |
| US11827691B2 (en) | 2011-06-28 | 2023-11-28 | Inhibrx, Inc. | Serpin fusion polypeptides and methods of use thereof |
| US11965017B2 (en) | 2011-06-28 | 2024-04-23 | Inhibrx, Inc. | Serpin fusion polypeptides and methods of use thereof |
| EP2726093A4 (en) * | 2011-06-28 | 2015-08-19 | Inhibrx Llc | WAP DOMAIN FUSION POLYPEPTIDES AND METHOD FOR THEIR USE |
| US10478508B2 (en) | 2012-01-10 | 2019-11-19 | The Regents Of The University Of Colorado, A Body Corporate | Compositions, methods and uses for alpha-1 antitrypsin fusion molecules |
| EP4169941A4 (en) * | 2020-06-23 | 2024-06-12 | Mitsui Chemicals, Inc. | METHODS FOR DETECTION OF ADENOCARCINOMAS AND EXAMINATION KIT |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2322933A1 (en) | 2011-05-18 |
| JP2005501549A (ja) | 2005-01-20 |
| WO2003021273A3 (en) | 2003-12-04 |
| JP2009195240A (ja) | 2009-09-03 |
| CA2459077A1 (en) | 2003-03-13 |
| JP5188443B2 (ja) | 2013-04-24 |
| US20100047818A1 (en) | 2010-02-25 |
| JP2014081386A (ja) | 2014-05-08 |
| EP1421388A2 (en) | 2004-05-26 |
| JP5797136B2 (ja) | 2015-10-21 |
| EP2913673B1 (en) | 2017-05-31 |
| ES2628952T3 (es) | 2017-08-04 |
| CN1813188A (zh) | 2006-08-02 |
| MXPA04001963A (es) | 2005-02-17 |
| US7270960B2 (en) | 2007-09-18 |
| JP2016065870A (ja) | 2016-04-28 |
| US20160033512A1 (en) | 2016-02-04 |
| BR0212211A (pt) | 2004-08-17 |
| US20030108965A1 (en) | 2003-06-12 |
| HK1214346A1 (en) | 2016-07-22 |
| US20090104684A1 (en) | 2009-04-23 |
| RU2004109149A (ru) | 2005-05-10 |
| US9090712B2 (en) | 2015-07-28 |
| JP2012161317A (ja) | 2012-08-30 |
| EP2913673A1 (en) | 2015-09-02 |
| CA2459077C (en) | 2018-06-05 |
| KR20040062534A (ko) | 2004-07-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9090712B2 (en) | Diagnosis of carcinomas | |
| EP1169645B1 (en) | Methods and compositions for diagnosing carcinomas | |
| US6770445B1 (en) | Methods and compositions for diagnosing carcinomas | |
| US20200325215A1 (en) | COMPOSITIONS AND METHODS OF USE FOR DETERMINATION OF HE4a | |
| US7745159B2 (en) | Methods and compositions for diagnosing carcinomas | |
| US20110104675A1 (en) | Methods and Compositions for Diagnosing Carcinomas | |
| AU2002333754A1 (en) | Diagnosis of carcinomas | |
| HK1158310A (en) | Diagnosis of carcinomas | |
| HK1214346B (en) | Diagnosis of ovarian carcinoma | |
| HK1191056B (en) | Compositions and methods of use for determination of he4a |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ OM PH PL PT RU SD SE SG SI SK SL TJ TM TN TR TZ UA UG US UZ VC VN YU ZA ZM Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2002333754 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2004/001963 Country of ref document: MX Ref document number: 2459077 Country of ref document: CA Ref document number: 2003525305 Country of ref document: JP Ref document number: 531432 Country of ref document: NZ Ref document number: 1020047003017 Country of ref document: KR |
|
| REEP | Request for entry into the european phase |
Ref document number: 2002797648 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002797648 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 20028192680 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 2002797648 Country of ref document: EP |