WO2002059353A2 - Amplification par reaction en chaine de la polymerase (pcr) asymetrique - Google Patents

Amplification par reaction en chaine de la polymerase (pcr) asymetrique Download PDF

Info

Publication number
WO2002059353A2
WO2002059353A2 PCT/CA2002/000057 CA0200057W WO02059353A2 WO 2002059353 A2 WO2002059353 A2 WO 2002059353A2 CA 0200057 W CA0200057 W CA 0200057W WO 02059353 A2 WO02059353 A2 WO 02059353A2
Authority
WO
WIPO (PCT)
Prior art keywords
primer
drt
dna
sequence
amplification
Prior art date
Application number
PCT/CA2002/000057
Other languages
English (en)
Other versions
WO2002059353A3 (fr
Inventor
Qinyin Cai
Peng Ling
Jin-Hao Liu
Original Assignee
Bio S & T
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from CA002332610A external-priority patent/CA2332610A1/fr
Application filed by Bio S & T filed Critical Bio S & T
Priority to AU2002231489A priority Critical patent/AU2002231489A1/en
Publication of WO2002059353A2 publication Critical patent/WO2002059353A2/fr
Publication of WO2002059353A3 publication Critical patent/WO2002059353A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes

Definitions

  • the present invention relates to a novel process for the amplification of DNA based on Polymerase Chain Reaction (PCR) DNA amplification. More specifically, the present invention is concerned with Asymmetrical PCR Amplification (APA), a process comprising the following steps: (1) the accumulation of single-stranded DNA using a set of specially-designed primers and (2) the amplification of double- stranded DNA.
  • APA may be used in a variety of molecular biological and biotechnological applications, including genomic sequencing projects.
  • PCR Polymerase Chain Reaction
  • the PCR is an in vitro cyclical process involving the enzymatic synthesis of double stranded DNA.
  • a thermostable DNA polymerase is involved and plays a key role in the amplification of DNA.
  • a pair of oligonucleotides termed "primers” and four depxyribonucleotides (dATP, dCTP, dTTP and dGTP) as well as buffer components are involved in the reaction. Both primers are significantly complementary to the template DNA sequences that flank the target DNA region to be amplified.
  • the primers In each cycle of the PCR, following the denaturing of the double-stranded DNA, the primers anneal to a single strand DNA template at a specified temperature level and initiate the extension, via DNA polymerase, of a new strand, which is complementary to the template strand. After a number of reaction cycles, DNA fragments with the termini defined by the 5' ends of the primers accumulate exponentially.
  • Genomic sequencing is the key part of genome projects. It is also the most costly. The Human Genome Project, for example, has spent billions of dollars on sequencing. One reason why it is so costly is that there is no reliable technique which can be used for directly sequencing large genomic DNA inserts.
  • Large genomic DNA clones have to be sub-cloned using a "shotgun" cloning procedure before being sequenced. In shotgun cloning, the large genomic DNA clones are sheared into smaller pieces, typically about 1 kilobase, and sub-cloned into a plasmid or phagemid vector. Subsequently, the colonies are randomly selected, and their cloned DNAs sequenced. Finally, all the sequencing data from the individual clones are compiled using computer programs. Normally, about four to six copies of genome have to be sequenced in order to fill in the gaps of a complete genome assembly. Thus, obtaining sequence information from genomic clones is a laborious and expensive process.
  • the present invention addresses a need for a DNA amplification process that is fast, efficient, accurate and inexpensive, and that accommodates small quantities of DNA.
  • a method for amplifying a target nucleic acid in a reaction mixture that also contains at least one Degenerate Random Tagging primer comprising: (A) performing an asymmetrical PCR, at a low annealing temperature, with the target nucleic acid as a template and the Degenerate Random Tagging primer as an amplification primer; and then (B) adding a specific primer and a tagging primer to the reaction mixture and performing a further PCR at a high annealing temperature.
  • the asymmetrical PCR comprises approximately 10-20 cycles of amplification. In another, the further PCR comprises approximately 30-50 cycles of amplification. In a preferred embodiment, a temperature of approximately 35°C to 40°C is used for a low annealing temperature, with 37°C being most preferred. Temperatures greater than 50°C are typically used for a high annealing temperature, and temperatures greater than 55°C are preferred, while 56°C is most preferred.
  • a DRT primer comprises at least two functionally distinct regions, including, from 5' to 3', (1 ) a tagging primer binding portion and (2) a primary binding portion.
  • a DRT primer further comprises a bi-nucleotide degenerate sequence portion, located between the tagging primer binding portion and the primary binding portion of the bi-nucleotide degenerate sequence portion.
  • a single DRT primer is used in an APA, while in another, a mixture of DRT primers is used.
  • one or more families of DRT primers can be used in the inventive method.
  • the present invention provides isolated polynucleotides encoding particular DRT primers.
  • a kit for amplifying target nucleic acids comprising at least one DRT primer, a tagging primer and reagents to effect amplification of nucleic acids.
  • the APA process may be used in a variety of molecular biological and biotechnological applications. It may be used, for example, for genomic sequencing projects such as the following:
  • the APA process may be utilized in such applications as sequencing- based virus diagnosis for HIV and crop hybrid identification.
  • APA allows sequencing information to be gathered in a much less costly and labor-intensive manner than has heretofore been possible. It also requires significantly less quantities of DNA than conventional methods (e.g., ng amounts as opposed to ⁇ g quantities of starting DNA).
  • FIG. 1 is a schematic representation of Degenerate Random Tagging (DRT) primers used in the APA process.
  • DRT Degenerate Random Tagging
  • A DRT primer comprising a tagging primer binding portion and a primary binding portion.
  • B DRT primer comprising three portions: P1 , the tagging primer binding portion; P2, bi-nucleotide degenerate sequence portion; and P3, the primary binding portion.
  • C A family of DRT primers comprising a bi-nucleotide degenerate sequence portion.
  • the bi-nucleotide degenerate sequence is represented by NN, wherein each N comprises one of four types of deoxynucleotides: dATP, dCTP, dGTP and dTTP.
  • Each nucleotide position of the primary binding portion is represented by R with the position defined with a subscript digit.
  • FIG. 2 provides a schematic depiction of the APA process.
  • APA involves two subsequent PCR.
  • the first reaction is an asymmetrical PCR performed with a low annealing temperature and a specially designed amplification primer, designated a Degenerate Random Tagging (DRT) primer.
  • DVT Degenerate Random Tagging
  • two additional amplification primers i.e., a specific primer and a tagging primer, are added to the reaction mixture.
  • a second PCR is performed at a high annealing temperature.
  • Figure 3 is a schematic representation of a BAC (bacterial artificial chromosome) clone insert and flanking DNA sequence of the pecBACI vector.
  • Figure 4 shows the effect of template concentration on the yield of APA- PCR products.
  • A T7-flanked end sequence amplification of clone C02-I17 with different amounts of DNA template using the Le1 DRT primer. The amount of DNA template varied from 0 ng to 10 ng. Lanes 1-6: APA product amplified, respectively, in 0, 0.5, 1.25, 2.5, 5 and 10 ng templates. Lane 7: 1 kb DNA marker.
  • B T7-flanked end sequence amplification of clone CE3-A1 using the Le1 DRT primer. Lane 1 , 1 kb DNA marker and lanes 2-4: APA product amplified, respectively, in 1.25, 2.5 and 5 ng templates.
  • Figure 5 shows the effect of annealing template during the first PCR round on APA products.
  • A T7-flanked end sequence amplification of clone CE3-A1 using the Le1 or Le2 DRT primer.
  • Lane 1 1 kb DNA marker;
  • lanes 2-4 the APA products derived from the Le1 at 35°C, 37°C, and 39°C;
  • lanes 5-7 the APA product derived from the Le2 amplification, respectively, at 35°C, 37°C and 39°C.
  • B T7-flanked end sequence amplification of clone CO2-G14 using the Le1 DRT primer.
  • Lanes 1-3 the APA product amplified with the Le1 respectively at 35°C, 37°C and 39°C; lane 4: 1 kb DNA marker.
  • C M13R-flanked end sequence amplification of clone C02-E9 with a Lg1 , Lg2 and Lg3 primer mixture.
  • Lane 1 1 kb DNA marker and lanes 2-4: the APA product derived, respectively, from amplification at 35°C, 37°C and 39°C.
  • Figure 6 shows APA of T7- and M13R-flanked end sequences of CE3-A1 using the Le1 , Le2 and Le3 DRT primers.
  • Lane 1 Le1 , T7; lane 2: Le1 , M13R; lane 3: Le2, T7; lane 4: Le2, M13R; lane 5: Le3, T7; lane 6: Le3, M13R; lane 8: 1 kb DNA marker.
  • Figure 7 shows APA products of the T7-flanked end of CO2-G14 using the Le1 , Le2 or Le3 DRT primer. Lanes 1-3, Le1 , Le2 and Le3, respectively; lane 4, 1 kb DNA marker.
  • Figure 8 is a comparison of partial sequencing gel images and chromatographs of APA products amplified from the T7-flanked end of the contaminated BAC clone C02-H16 using DRT primer Le1 (panel A), Le2 (panel B) and a Le1/Le2 mix (panel C).
  • the present invention provides a method of amplifying an uncharacterized, target nucleic acid.
  • the method termed "Asymmetrical PCR Amplification (APA),” involves two subsequent PCR.
  • the first reaction is an asymmetrical PCR performed with a low annealing temperature and a specially designed amplification primer, designated a Degenerate Random Tagging (DRT) primer.
  • DVT Degenerate Random Tagging
  • two additional amplification primers i.e., a specific primer and a tagging primer, are added to the reaction mixture.
  • a second PCR is performed at a high annealing temperature.
  • the inventive methods particularly are useful for generating DNA templates for sequencing reactions from uncharacterized nucleic acids.
  • the present invention significantly reduces the time and cost associated with sequencing genomic clones.
  • each cycle of amplification comprises three steps: (a) a denaturing step, (b) an annealing step and (c) an extension step.
  • a typical PCR reaction comprises a nucleic acid template, two amplification primers complementary to the two 3' borders of the duplex segment to be amplified, four deoxyribonucleotides (dATP, dCTP, dTTP and dGTP) and an appropriate buffer.
  • asymmetric PCR or “asymmetrical PCR” refers to a PCR in which a single amplification primer is used. As understood in the art, asymmetrical PCR produces linear amplification, as opposed to the geometric amplification achieved by regular PCR.
  • amplification primer refers to an oligonucleotide which hybridizes with a nucleic acid template and provides a free 3' hydroxyl group which is used by DNA polymerase to initiate extension of DNA fragments complementary to the template.
  • genomic DNA refers to chromosomal DNA and can include introns. An intron is an intervening sequence. It is a non-coding sequence of DNA within a gene that is transcribed into ⁇ RNA but is then removed by RNA splicing in the nucleus, leaving a mature mRNA which is then translated in the cytoplasm. The regions at the ends of an intron are self-complementary, allowing a hairpin structure to form naturally in the ?t?RNA.
  • vector refers to a DNA molecule, such as a plasmid, cosmid, phagemid, or bacteriophage or other virally-derived entity, which typically has a capability of replicating in a host cell and which is used to transform cells for gene manipulation.
  • Vectors typically contain one or more restriction endonuclease recognition sites at which foreign DNA sequences may be inserted in a determinable fashion without loss of an essential function of the vector, as well as a marker gene which is suitable for use in the identification and selection of cells transformed with the cloning vector.
  • Appropriate marker genes typically include genes that provide various antibiotic or herbicide resistance. A variety of markers are available to the skilled artisan.
  • the present invention uses three types of primers: a Degenerate Random Tagging primer, a specific primer and a tagging primer.
  • a Degenerate Random Tagging (DRT) primer is utilized.
  • a DRT primer comprises at least two functionally distinct regions portions. From the 5' to 3', these include (1 ) a tagging primer binding portion and (2) a primary binding portion.
  • Figure 1A provides a schematic representation of a DRT primer.
  • the tagging primer binding portion encodes a position for a later added tagging primer to bind during the second step of DNA amplification.
  • the primary binding portion comprises an arbitrary sequence of nucleotides ranging in length from approximately four to six nucleotides. The function of the primary binding portion is to bind to any portion of a single-stranded DNA template to which it matches under lower stringency conditions and to initiate extension of DNA fragments complementary to the template.
  • a DRT primer further comprises a bi-nucleotide degenerate sequence portion, located between the tagging primer binding portion and the primary binding portion. See Figure 1B. Any one of the four deoxyribonucleotides, i.e., dATP, dCTP, dGTP and dTTP, can occupy either position of the bi-nucleotide degenerate sequence portion. Thus, when a DRT primer comprising a bi-nucleotide degenerate sequence portion is synthesized, sixteen distinct oligonucleotides are produced.
  • the use of a bi- nucleotide degenerate sequence portion expands the number of individual DRT primers utilized in the asymmetric PCR step of the inventive method. Such an expansion increases the probability that at least one of the primers will hybridize to the uncharacterized target nucleic acid within an appropriate distance from one end of the target nucleic acid, e.g., preferably about 1-2 kb.
  • a family of DRT primers is used in the asymmetrical PCR.
  • the term "family of DRT primers" refers to two or more DRT primers which differ in the number of nucleotides present in the primary binding portion of the primer.
  • Figure 1C provides a schematic representation of a family of DRT primers comprising a bi-nucleotide degenerate sequence portion. As illustrated, the family comprises primers P6R, P5R and P4R, whose primary binding portions contain six, five and four nucleotides, respectively.
  • the symbol “N” denotes any one of the four deoxyribonucleotides and symbols “R ⁇ -R 6 " denote particular nucleotide positions in the primary binding portion designated R- ⁇ R 2 R 3 R R 5 R 6 .
  • the use of a family of DRT primers expansion further increases the probability that at least one primer will hybridize to the uncharacterized target nucleic acid within an appropriate distance from one end of the target nucleic acid.
  • the asymmetrical PCR utilizes a family of DRT primers comprising a bi-nucleotide degenerate sequence portion.
  • the primary binding portion of the largest member of such a family contains six nucleotides.
  • the other members of the family are derived by serially deleting the 3' end of the primer. See Figure 1C.
  • two or more families of DRT primers can be used the methods of the present invention.
  • telomere sequence refers to an oligonucleotide which is designed specifically to hybridize to a particular sequence of a known DNA template.
  • a specific primer is used as an amplification primer in the second PCR of the inventive method.
  • a specific primer is designed to hybridize to a specific sequence within the vector comprising the uncharacterized target nucleic acid.
  • Such a primer can be designed to bind to the vector on either side of the cloned fragment.
  • tagging primer refers to an oligonucleotide which is designed specifically to hybridize to a nucleic acid sequence which is complementary to the tagging primer binding portion of a DRT primer.
  • a tagging primer is used as an amplification primer in the second PCR of the inventive method.
  • the primers of the present invention can be prepared by direct chemical synthesis using the solid phase phosphoramidite triester method (Beaucage and Caruthers, Tetra. Letts. 22(20): 1859-1862 (1981)); an automated synthesizer (VanDevanter et al., Nucleic Acids Res., 12: 6159-6168 (1984)); or the solid support method of U.S. Patent No. 4,458,066. Chemical synthesis generally produces a single stranded oligonucleotide. Asymmetrical PCR Amplification
  • APA Asymmetrical PCR Amplification
  • the invention provides a method for amplifying a target nucleic acid in a reaction mixture that also contains at least one Degenerate Random Tagging primer, comprising: (A) performing an asymmetrical PCR, at a low annealing temperature, with the target nucleic acid as a template and the Degenerate Random Tagging primer as an amplification primer; and then (B) adding a specific primer and a tagging primer to the reaction mixture and performing a further PCR at a high annealing temperature.
  • APA comprises two steps: an asymmetrical PCR at low annealing temperature and a second PCR at high annealing temperature.
  • the first step of APA utilizes an asymmetrical PCR.
  • an uncharacterized, target nucleic acid located within a vector is contacted, under a low annealing temperature, with at least one Degenerate Random Tagging primer.
  • the primer is extended with polymerase to form a double-stranded nucleic acid molecule comprising a first extension product and the target nucleic acid.
  • the first extension products are separated from the target nucleic acids.
  • the contacting, extending and separating steps are repeated approximately 10-20 times, and more preferably 10-14 times.
  • a specific primer and a tagging primer are added to the reaction mixture, and a further PCR is performed.
  • the first extension product is contacted, under a high annealing temperature, with the specific primer.
  • the first extension product serves as a template for synthesizing a second extension product.
  • the specific primer then is extended with polymerase to form a double-stranded nucleic acid molecule comprising the first extension product and the second extension product.
  • the first and second extension products are separated.
  • the second extension product is contacted, under a high annealing temperature, with a tagging primer, wherein the second extension product serves as a template for synthesizing a third extension product.
  • the second and third extension products then are separated.
  • the contacting, extending and separating steps are repeated approximately 30-50 times.
  • Figure 2 provides a schematic representation of APA.
  • a low annealing temperature is used in the annealing step of the asymmetrical PCR to encourage hybridization between the primary binding portion of a DRT primer and the target nucleic acid.
  • a low annealing temperature yields a low stringency hybridization and typically refers to temperatures in the range of approximately 30°C to 45°C. In a preferred embodiment, a temperature of approximately 35°C to 40°C is used, and 37°C is most preferred.
  • the stringent hybridization conditions resulting from the high annealing temperature utilized in the second PCR ensure that the specific primer and the tagging primer bind specifically to their respective targets and inhibit non-specific amplification.
  • a high annealing temperature typically is considered to be greater than 50°C. In preferred embodiments, the annealing temperature is greater than 55°C, and 56°C is most preferred.
  • the goal of the inventive method is to generate many copies of a double stranded DNA fragment which is bounded on one end by the specific primer and the other end by the tagging primer.
  • a high annealing temperature furthers this goal by reducing non-specific amplification.
  • formation of "pan" structures by self-end annealing inhibits the undesired amplification of fragments bounded on both ends by a DRT primer. See U.S. Pat Nos. 5,759,822 and 5,565,340. Uses of APA
  • APA can be used in a variety of molecular applications.
  • the inventive method is useful for 1 ) BAC clone end sequencing for contig alignment or BAC clone full length sequencing, without the need for subcloning; 2) 5' RACE or 3' RACE to clone full-length sequences of cDNA; 3) upstream extensions to clone genomic sequences; and 4) sequencing-based genomic typing.
  • APA can be utilized in such applications as sequencing-based virus diagnosis of HIV and crop hybrid identification.
  • the subject invention is particularly useful for genomic bacterial artificial chromosome (BAC) clone end sequencing.
  • the BAC vector has been widely used to construct genomic platforms (BAC genomic libraries).
  • An essential step in BAC genomic library processing is the BAC clone contig alignment. Typically, this is accomplished through the identification of end-sequence overlapping between different clones. Sequence overlapping usually is identified via physical maps based on restriction endonuclease digestion patterns of BAC clone sequences.
  • BAC clone end sequencing has been attempted for BAC clone contig alignment. See Venter et al., Nature, 381:364-366 (1996).
  • BAC clone end sequencing data is useful for genomic clone contig alignment, two factors have limited the widespread use of direct BAC clone end sequencing.
  • a large amount of DNA is needed for each reaction. For example, a 130 kb BAC clone requires 5-10 ⁇ g of DNA for each sequencing reaction.
  • the BAC cloning vector is typically a single copy vector, making it hard to extract large amounts of
  • the inventive method simplifies the process for BAC clone end sequencing and, thereby, reduces the cost associated with processing BAC genomic libraries.
  • large genomic DNA clones including BAC clones, can be sequenced directly without sub-cloning.
  • both ends of the genomic DNA insert is amplified via APA using specific primers which hybridize to the vector.
  • the amplified fragments are sequenced using the vector-specific primer.
  • new specific primers can be designed and used for subsequent amplification and sequencing.
  • the entire genomic DNA of a clone can be resolved through primer walking from both ends.
  • the present invention provides a number of advantages over conventional procedures for primer walking and shotgun clone sequencing.
  • the invented process does not require sub-cloning for BAC clone sequencing.
  • APA avoids the labor and resource costs associated with these procedures.
  • the present invention reduces the required amount of sequencing. With shortgun clone sequencing, many of the sequenced clones contain the same fragment. Thus, the same region of DNA is sequenced multiple times. Since APA-associated sequencing can "walk" along large DNA templates, repetitive sequencing is avoided.
  • APA generates sufficient quantities of DNA for sequencing reactions using a limited amount of BAC clone template DNA (about 1-5 ng). Thus, the present invention minimizes the scale of BAC clone DNA extraction required for sequencing.
  • sequencing procedures using BAC clone DNA directly as a template required large quantities of BAC clone DNA, typically 5-10 ⁇ g of DNA for each reaction. This requirement made primer walking difficult, if not impossible.
  • APA simplifies the assembly and analysis of sequencing data. Unlike the data from shotgun clone sequencing, sequencing data derived from APA products comes in a known contig order. Thus, sequencing data can be easily assembled and processed.
  • the present invention also can be used to identify inter-clone contamination in a
  • a BAC clone can be tested for contamination by amplifying clone-derived DNA via APA using a family of DRT primers, e.g., Le1 , Le2 and Le3.
  • two or more unrelated DRT primers can be used in the amplification reaction.
  • the amplified fragments are sequenced using the vector-specific primer.
  • the sequences then are analyzed for the presence of overlapping bases. Such overlapping is indicative of a mixed sequence and suggests that the sample is contaminated.
  • APA reactions using single DRT primers are performed on DNA derived from the clone of interest.
  • a separate APA is performed with each DRT primer utilized in the initial APA.
  • the amplified fragments are sequenced, and the resulting sequences are compared. If sequence analysis reveals two or more sequences, the clone has been contaminated.
  • kits that are specially packaged for BAC clone sequencing, including end sequencing and full range sequencing.
  • the kit may optionally include reagents required for performing APA and the subsequent sequencing reactions of BAC clones, such as Taq DNA polymerase and its cofactors, optimal buffer components, various APA DRT primers, deoxyribonucleotide-5'-triphosphates and deoxy-deoxyribonucleotides-5'- triphosphates.
  • the kit can also provide BAC universal vector specific primers such as T7 and M13-reverse primers. Alternatively, the end-users can utilize their own specific primers depending on the genomic DNA or types of BAC vector.
  • thermostable DNA polymerases from different sources can be used with the present invention. These include Taq DNA polymerase from Thermus aquaticus, Tth DNA polymerase from Thermus thermophilus and pfu DNA polymerase from Pyrococcus furiosus. These enzymes are commercially available. Alternatively, the thermostable DNA polymerases from cloned gene expression can be used with the present invention.
  • Example 1 Asymmetrical PCR amplification of unknown sequences in chicken BAC clones
  • BAC clones CE3-A1 , CO2-E9, CO2-I17 and C02-G14 were randomly chosen from a chicken BAC library (Bio S&T Inc.) constructed using plasmid vector pecBACL These clones have insert sizes from 80 to 110 kb that were ligated into the Hind III site of the MCS region of pecBACI .
  • the T7 primer was used as a specific primer for the amplification of T7-flanked end of inserts using the APA process, while the Bad 1-R primer ( ⁇ '-GAGTTAGCTCACTCATT AGGCAC-3') next to M13R was used for the amplification of the M13R-flanked end sequence.
  • Plasmid DNA was extracted from 5 mis of overnight culture of E. coli DH10B cells harbouring a selected BAC clone.
  • the cell pellet was resuspended in 1 ml of cold GTE buffer (50 mM glucose, 25 mM Tris, pH 8.0 and 10 mM EDTA).
  • the cell suspension was mixed gently with 2 ml of lysis solution (0.2 M NaOH and 1 % SDS) and left at room temperature for 5 min.
  • 1.5 ml KacF (3 M K-acetate, 1.8 M formic acid) was added, mixed gently and left on ice for 10 min.
  • Plasmid DNA was pelletted by centrifuging as before. The pellet was air dried for 5 min and dissolved in 1 ml TE (50 mM Tris, 10 mM EDTA, pH 8.0). To remove RNA from the sample, 15 ⁇ l of 10 mg/ml RNase was added and incubated at 37°C for 30 min. Then, DNA was extracted with phenol/chloroform and precipitated with ethanol. The concentration of plasmid DNA was determined on a 1 % agarose gel stained with ethydium bromide using lambda DNA (Stratagen) as standard.
  • Table 1 lists the sequences of the two DRT primer families (Le and Lg series) and the tagging primer (EndSeq-T) used. All of the DRT primers comprise a primary binding portion at their 3' ends (bold letters), a bi-nucleotide degenerate region and a tagging primer binding portion (underlined). Each primer family contains three members. The primary binding portions of Le1 and Lg1 were determined arbitrarily. The other two members in each family resulted from a serial deletion of one deoxyribonuleotide from the 3' end of Le1 and Lg1 , respectively.
  • each APA reaction was performed in a total volume of 45 ⁇ l reaction mix which contained 60 nmol dNTP, 15 p mol DRT primer, 0.5 - 10 ng DNA and 4 U Taq DNA polymerase (QIAGEN) in 1 X reaction buffer. After 4 min denaturation at 94°C, the reaction was thermocycled for 14 cycles at 94°C for 45 sec, 37°C for 50 sec, and 72°C for 1 min in PTC-200 Thermal Cycler (M J Research). After the first step of APA, 5 ⁇ l of specific primer cocktail containing 15 p mol each of EndSeq-T and T7 or Bac11-R in 1 X Taq buffer was added.
  • the PCR in this step was performed as follows: 36 cycles at 94°C, 45 sec, 56°C, 50 sec and 72°C, 1 min, following by 72°C for 10 min.
  • the PCR product was purified using QIAprep Spin Miniprep Kit (QIAGEN). An aliquot of the samples was loaded onto a 1% agarose gel. All experiments were repeated at least once.
  • Figure 4A shows the APA product of the T7 end of clone CO2-I17 using the Le1 as a DRT primer and the T7 primer as a specific primer.
  • a dominant DNA fragment of about 1.5 kb in size was observed for all concentrations of C02-I17 DNA. The results indicate that the highest amount of product was obtained with 1.25 ng template DNA.
  • Le1 and the T7 primer amplified a DNA fragment of about 1 kb. No significant difference was observed in yield for template DNA from 1.25 to 5 ng ( Figure 4B).
  • annealing temperature during the first step APA was studied using clones CE3-A1 T7 end and CO2-G14 T7 end, as well as CO2-E9 M13R end.
  • the T7 end of the inserts in clones CE3-A1 and CO2-G14 were evaluated by using the T7 primer as a specific primer.
  • the M13R end of the insert in clone CO2-E9 was evaluated by using the M13R primer as a specific primer.
  • Figure 5A demonstrated that 37 °C was the most efficient temperature for DRT primers Le1 and Le2, among the temperatures tested. In the case of Le2, an increase or decrease of 2°C in annealing temperature not only reduced the yield of products but also reduced the specificity of the APA.
  • Experiments with clones C02-G14 and C02-E9 also showed that 37°C was more specific for T7 end APA than 35°C and 39°C ( Figures 5B and 5C).
  • Example 2 Length effect of primary binding portion of a DRT primer on APA
  • BAC clones CE3-A1 , CO2-E9, C02-I17 and C02-G14 were chosen randomly as APA DNA templates from a chicken BAC library (Bio S&T, Inc). These clones comprised inserts of 80, 100, 80, and 110 kb, respectively. Plasmid DNA was extracted using the process described in Example 1. End sequences were amplified by the APA procedures described in Example 1. The amount of template DNA was 2 ng, and the annealing temperature for the first round PCR was 37°C. The T7 primer was used for the APA reaction and for the sequencing of T7-flanked end of clones. To sequence the M13R primer-flanked end of the inserts, the Bac11-R primer was used for the APA reaction and the M13R primer was used for sequencing.
  • Le2 the quality of the sequencing resolution with Le3 was relatively poor. Some ambiguity in base calling was found in the sequencing data. This may be due to interference of some shorter fragments amplified by Le3. For example, the Le3 sequence also bound to the position denoted by nucleotide 102, causing noisy signals in this region.
  • Le1 the Le3 sequence also bound to the position denoted by nucleotide 102, causing noisy signals in this region.
  • a similar result was achieved with Le1 in the amplification and sequencing of the M13R-flanked end sequence. A dominant band of about 1.5 kb in size was shown in the DNA sample amplified with Le1 (Figure 6). Faint dominant bands along with some shorter bands were shown in the samples amplified with Le2 and Le3, respectively.
  • the sample generated with Le1 resulted in high quality sequencing data, readable up to 1 Kb, while the samples generated by the other two members (Le2 and Le3) showed low sequencing resolution readable to about only 470 bp (data not shown).
  • DRT primer containing 6 random nucleotide sequences resulted in better PCR amplification efficiency and sequencing resolution than the other two members with shorter random sequences.
  • the Le1 primer demonstrated the best performance sequencing resolution, followed by the Le2 primer, with some minor non-specific stops inside the sequence.
  • the Le3 primer showed the poorest sequencing resolution with a strong stop inside the sequence. Accordingly, these results suggest that a DRT primer comprising a six- nucleotide random sequence in its primary binding portion is the ideal candidate for use as a single primer in APA for BAC clone end sequencing.
  • APA using a combination of DRT primers also was evaluated using the above clones.
  • the following mixtures were evaluated: Le1/2, Le1/2/3, and Le1/Lg1.
  • mixed primers Le1/2 and Le1/Lg1 produced results comparable to those achieved by the Le1 primer alone.
  • the combination of Le1/2/3 showed poor APA performance.
  • the mixed primer Le1/Lg1 successfully amplified sequences that could not be amplified with the Le1 primer or Lg1 primer alone (data not shown). Accordingly, this suggest that the mixed primers of the P6R/P5R or P6R/P6R type (see Figure 1C) may best ensure the successful amplification of BAC clone end sequences.
  • DNA templates for sequencing reactions were prepared from a population of chicken BAC clones.
  • Chicken BAC clones were randomly selected from a chicken BAC library (Bio S&T Inc.) and amplified using APA.
  • Two DRT primer families were evaluated: Le1/2 and Lg1/2.
  • the individual sequences of each primer in the Le primer series and the Lg primer series are presented in Table 1.
  • the chicken BAC clones used for this test are listed in Table 2. All the DNA samples were amplified by APA using two mixed DRT primers, Le1/2 and Lg1/2, in the manner described in Example 1.
  • the APA amplified product was sequenced using a PCR sequencing kit purchased from Interscience and using the IRD800-labeled T7 and M13R primers. The sequences were resolved in LiCOR 4200L sequencer. All sequencing reactions were repeated at least once. The results are summarised in Table 3. The sequencing data had an accuracy of 99% (based on two repeats). These results demonstrate the effectiveness of APA in amplifying the end sequences of BAC clones.
  • the T7-flanked end of C02-H16 was amplified by APA using either a Le1 , Le2 or Le3 DRT primer.
  • a T7 promoter primer was used as the specific primer in the second step of the APA.
  • the reaction conditions described in Example 1 were utilized.
  • the photographed gel in Figure 7 shows that each DRT primers produced a different number of amplification products.
  • Subsequent sequencing analysis revealed that Le2 and Le3 produced identical amplification products, which differed from those generated by Le1. (Data not shown).
  • APA also was performed using a mixture of Le1 , Le2 and Le3 primers. Sequencing analysis of the resulting amplification demonstrated that the mixture of primers yielded a mixed sequence. Further examination of sequencing gel images derived from APA using both Le1 and Le2 revealed a mixed sequence. The dominant bands of the mixed sequence matched the sequence revealed by Le1 , and faint bands corresponding to the Le2 sequence also were observable ( Figure 8). This suggests that the C02-H16 clone may have been contaminated by one other BAC clone in the library.
  • new specific primers were designed for BAC clones Ce3- A1 and C02-I17.
  • the new specific primers referred to as walking primers, were designed using the sequences elucidated in previous BAC end sequencing.
  • Primer Ce3-A1T7-2 (5' CAGGTGTGTGAGTAGAGTTTAG 3') was selected from nt 750-771 of the sequence of the Ce3-A1 T7-flanked end.
  • Primer Ce3-A1 R2 (5' GAAAATAG- CCAGAGCATCACAGGGC 3') was selected from nt 700-724 of Ce3-A1 M13R- flanked end.
  • Primer CO2-I17T7-2 (5' GACGTAACGTGGCAGTGCAA 3') was designed to match the region of nt 684-703 of CO2-I17 T7-flanked end sequence.
  • APA and sequencing reactions were as described in Examples 1 and 2.
  • IR800- labeled walking primers were used for sequencing.
  • primer-walking sequencing was successful for Ce3-A1 , with primer Ce3-A1 R2, and CO2-I17, with primer CO2-I17T7-2.
  • Primer walker sequencing using Ce3-A1 R2 showed a 750 nt sequence that extended from nucleotide 747 of the Ce3-A1 M13R-flanked end.
  • Primer walker sequencing using C02-I17T7-2 revealed a near 800 nt sequence that extended from nucleotide 710 of the CO2-I17 T7-flanked end sequence.
  • Table 2 List of the randomly selected chicken BAC clones used for end sequencing test using APA procedure

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne une technique d'amplification d'ADN qui permet une amplification de cibles d'ADN à séquences inconnues, comprenant des étapes de PCR successives. Dans une première réaction, on réalise l'amplification linéaire de l'acide nucléique cible en utilisant une ou plusieurs amorces spécialement prévues. Dans une deuxième réaction, on ajoute des amorces additionnelles et on réalise l'amplification exponentielle d'ADN double brin. Associée à des procédures de séquençage classiques, on peut utiliser cette technique pour un séquençage direct d'ADN génomique, ce qui évite d'avoir à sous-cloner de gros fragments. On peut aussi, grâce à cette technique rassembler des informations de séquençage à coûts bien moindre et avec beaucoup moins de main d'oeuvre qu'auparavant.
PCT/CA2002/000057 2001-01-26 2002-01-16 Amplification par reaction en chaine de la polymerase (pcr) asymetrique WO2002059353A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002231489A AU2002231489A1 (en) 2001-01-26 2002-01-16 Two-step amplification using a program primer followed by specific primers

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
CA2,332,610 2001-01-26
CA002332610A CA2332610A1 (fr) 2001-01-26 2001-01-26 Amplification asymetrique de la reaction en chaine de la polymerase
US09/825,873 2001-04-05
US09/825,873 US20020155448A1 (en) 2001-01-26 2001-04-05 Asymmetrical PCR amplification

Publications (2)

Publication Number Publication Date
WO2002059353A2 true WO2002059353A2 (fr) 2002-08-01
WO2002059353A3 WO2002059353A3 (fr) 2003-08-21

Family

ID=25682361

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2002/000057 WO2002059353A2 (fr) 2001-01-26 2002-01-16 Amplification par reaction en chaine de la polymerase (pcr) asymetrique

Country Status (1)

Country Link
WO (1) WO2002059353A2 (fr)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004044240A2 (fr) * 2002-11-14 2004-05-27 November Aktiengesellschaft Procede d'identification parallele de differents acides nucleiques
WO2006094360A1 (fr) * 2005-03-11 2006-09-14 Molecular Plant Breeding Nominees Ltd Procede destine a amplifier les acides nucleiques
WO2008075519A1 (fr) * 2006-12-21 2008-06-26 Olympus Corporation Procédé d'amplification de l'acide nucléique et procédé d'analyse de l'acide nucléique à l'aide de celui-ci
EP1947196A1 (fr) * 2005-11-08 2008-07-23 Olympus Corporation Procédé d'amplification de plusieurs séquences d'acides nucléiques en vue de leur différenciation
US7833716B2 (en) 2006-06-06 2010-11-16 Gen-Probe Incorporated Tagged oligonucleotides and their use in nucleic acid amplification methods
CN102732609A (zh) * 2011-04-08 2012-10-17 博奥生物有限公司 一种检测寡核苷酸与目的基因组的相似性的方法
WO2013093530A1 (fr) * 2011-12-20 2013-06-27 Kps Orvosi Biotechnológiai És Egészségügyi Szolgáltató Kft. Procédé de détermination de la séquence d'acides nucléiques fragmentés
US9139870B2 (en) 2012-08-30 2015-09-22 Gen-Probe Incorporated Multiphase nucleic acid amplification
CN106715714A (zh) * 2014-10-17 2017-05-24 深圳华大基因研究院 一种用于核酸随机片段化的引物及核酸随机片段化方法
US10604800B2 (en) 2014-06-14 2020-03-31 Illumina Cambridge Limited Methods of increasing sequencing accuracy

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5104792A (en) * 1989-12-21 1992-04-14 The United States Of America As Represented By The Department Of Health And Human Services Method for amplifying unknown nucleic acid sequences
US5407799A (en) * 1989-09-14 1995-04-18 Associated Universities, Inc. Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides
WO1997030062A1 (fr) * 1996-02-14 1997-08-21 Akzo Nobel N.V. Isolation et amplification d'acides nucleiques
US5731171A (en) * 1993-07-23 1998-03-24 Arch Development Corp. Sequence independent amplification of DNA

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5407799A (en) * 1989-09-14 1995-04-18 Associated Universities, Inc. Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides
US5104792A (en) * 1989-12-21 1992-04-14 The United States Of America As Represented By The Department Of Health And Human Services Method for amplifying unknown nucleic acid sequences
US5731171A (en) * 1993-07-23 1998-03-24 Arch Development Corp. Sequence independent amplification of DNA
WO1997030062A1 (fr) * 1996-02-14 1997-08-21 Akzo Nobel N.V. Isolation et amplification d'acides nucleiques

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BOOTH CLAIRE ET AL: "Quantitative amplification of single-stranded DNA (QAOS) demonstrates that cdc13-1 mutants generate ssDNA in a telomere to centromere direction." NUCLEIC ACIDS RESEARCH, vol. 29, no. 21, 1 November 2001 (2001-11-01), pages 4414-4422, XP002242797 ISSN: 0305-1048 *
FRITZ J D ET AL: "A NOVEL 3' EXTENSION TECHNIQUE USING RANDOM PRIMERS IN RNA-PCR" NUCLEIC ACIDS RESEARCH, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 19, no. 13, 11 July 1991 (1991-07-11), page 3747 XP000371658 ISSN: 0305-1048 *
PODDAR SK: "Symmetric vs asymmetric PCR and molecular beacon probe in the detection of a target gene of adenovirus" MOLECULAR AND CELLULAR PROBES, ACADEMIC PRESS, LONDON, GB, vol. 14, February 2000 (2000-02), pages 25-32, XP000953250 ISSN: 0890-8508 *
TELENIUS H ET AL: "DEGENERATE OLIGONUCLEOTIDE-PRIMED PCR: GENERAL AMPLIFICATION OF TARGET DNA BY A SINGLE DEGENERATE PRIMER" GENOMICS, ACADEMIC PRESS, SAN DIEGO, US, vol. 13, 1992, pages 718-725, XP000199116 ISSN: 0888-7543 *
WELSH J ET AL: "FINGERPRINTING GENOMES USING PCR WITH ARBITRARY PRIMERS" NUCLEIC ACIDS RESEARCH, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 18, no. 24, 25 December 1990 (1990-12-25), pages 7213-7218, XP000310554 ISSN: 0305-1048 *

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004044240A3 (fr) * 2002-11-14 2004-07-29 November Ag Molekulare Medizin Procede d'identification parallele de differents acides nucleiques
WO2004044240A2 (fr) * 2002-11-14 2004-05-27 November Aktiengesellschaft Procede d'identification parallele de differents acides nucleiques
WO2006094360A1 (fr) * 2005-03-11 2006-09-14 Molecular Plant Breeding Nominees Ltd Procede destine a amplifier les acides nucleiques
EP1947196A1 (fr) * 2005-11-08 2008-07-23 Olympus Corporation Procédé d'amplification de plusieurs séquences d'acides nucléiques en vue de leur différenciation
EP1947196A4 (fr) * 2005-11-08 2009-09-09 Olympus Corp Procédé d'amplification de plusieurs séquences d'acides nucléiques en vue de leur différenciation
US8278052B2 (en) 2006-06-06 2012-10-02 Gen-Probe Incorporated Tagged oligonucleotides and their use in nucleic acid amplification methods
US7833716B2 (en) 2006-06-06 2010-11-16 Gen-Probe Incorporated Tagged oligonucleotides and their use in nucleic acid amplification methods
US8034570B2 (en) 2006-06-06 2011-10-11 Gen-Probe Incorporated Tagged oligonucleotides and their use in nucleic acid amplification methods
US9284549B2 (en) 2006-06-06 2016-03-15 Gen-Probe Incorporated Tagged oligonucleotides and their use in nucleic acid amplification methods
USRE48909E1 (en) 2006-06-06 2022-02-01 Gen-Probe Incorporated Tagged oligonucleotides and their use in nucleic acid amplification methods
US8580510B2 (en) 2006-06-06 2013-11-12 Gen-Probe Incorporated Tagged oligonucleotides and their use in nucleic acid amplification methods
US10167500B2 (en) 2006-06-06 2019-01-01 Gen-Probe Incorporated Tagged oligonucleotides and their use in nucleic acid amplification methods
JP2008154467A (ja) * 2006-12-21 2008-07-10 Olympus Corp 核酸の増幅方法とこれを用いた核酸の解析方法
WO2008075519A1 (fr) * 2006-12-21 2008-06-26 Olympus Corporation Procédé d'amplification de l'acide nucléique et procédé d'analyse de l'acide nucléique à l'aide de celui-ci
CN102732609A (zh) * 2011-04-08 2012-10-17 博奥生物有限公司 一种检测寡核苷酸与目的基因组的相似性的方法
WO2013093530A1 (fr) * 2011-12-20 2013-06-27 Kps Orvosi Biotechnológiai És Egészségügyi Szolgáltató Kft. Procédé de détermination de la séquence d'acides nucléiques fragmentés
US9139870B2 (en) 2012-08-30 2015-09-22 Gen-Probe Incorporated Multiphase nucleic acid amplification
US10196674B2 (en) 2012-08-30 2019-02-05 Gen-Probe Incorporated Multiphase nucleic acid amplification
US11859238B2 (en) 2012-08-30 2024-01-02 Gen-Probe Incorporated Multiphase nucleic acid amplification
US10604800B2 (en) 2014-06-14 2020-03-31 Illumina Cambridge Limited Methods of increasing sequencing accuracy
CN106715714A (zh) * 2014-10-17 2017-05-24 深圳华大基因研究院 一种用于核酸随机片段化的引物及核酸随机片段化方法

Also Published As

Publication number Publication date
WO2002059353A3 (fr) 2003-08-21

Similar Documents

Publication Publication Date Title
EP2906715B1 (fr) Compositions, procédés, systèmes et kits pour l'enrichissement d'acides nucléiques cibles
JP4289443B2 (ja) Ｐｃｒの過程でｄｎａ断片の増幅を抑制する方法
US5830712A (en) Selective template deletion method
US20210230670A1 (en) Solid phase nucleic acid target capture and replication using strand displacing polymerases
EP3630972B1 (fr) Marquage moléculaire par code-barres
KR101589483B1 (ko) 핵산과 신호 프로브의 비대칭 등온증폭을 이용한 핵산의 검출방법
JPH11113584A (ja) オリゴヌクレオチドバンク
JPH1189600A (ja) 核酸配列の増幅および検出
WO1992001813A1 (fr) Extension circulaire pour generer plusieurs copies complementaires d'un acide nucleique
KR101834565B1 (ko) 표고버섯 품종 산마루 1호 감별용 caps 마커 및 이의 용도
KR101997679B1 (ko) 표고버섯 품종 산마루 2호 판별용 caps 마커 및 이의 용도
KR20170138566A (ko) 가닥 특이적 cDNA 라이브러리를 작제하기 위한 조성물 및 방법
KR101906037B1 (ko) 표고버섯 품종 천장 3호 감별용 caps 마커 및 이의 용도
US20010044137A1 (en) Topoisomerase linker-mediated amplification methods
WO2002059353A2 (fr) Amplification par reaction en chaine de la polymerase (pcr) asymetrique
JPS63500006A (ja) エキソヌクレア−ゼ阻害による核酸の塩基配列決定法
KR20030045124A (ko) 핵산 염기서열의 결정방법
US20020155448A1 (en) Asymmetrical PCR amplification
CN107002290A (zh) 样品制备方法
EP3252168B1 (fr) Amorce pcr liée à une séquence nucléotidique complémentaire ou à une séquence nucléotidique complémentaire comprenant des nucléotides incompatibles et procédé pour l'amplification d'acide nucléique la faisant intervenir
JP7333171B2 (ja) Ｒｎａ検出方法、ｒｎａ検出用核酸及びｒｎａ検出用キット
JPH06327500A (ja) 核酸配列の増幅方法および検出方法
WO2004063373A1 (fr) Marqueurs de taille d'adn et leur procede de preparation
WO2001081630A2 (fr) Terminaison specifique d'une matrice dans une amplification en chaine par polymerase
KR102605843B1 (ko) 고온 내성 특성을 지니는 표고버섯 품종 판별을 위한 caps 마커 조성물 및 이의 용도

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP