WO2002038604A1 - Nouveau polypeptide, proteine associee a la racine ciliaire 45.98, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine associee a la racine ciliaire 45.98, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002038604A1
WO2002038604A1 PCT/CN2001/001543 CN0101543W WO0238604A1 WO 2002038604 A1 WO2002038604 A1 WO 2002038604A1 CN 0101543 W CN0101543 W CN 0101543W WO 0238604 A1 WO0238604 A1 WO 0238604A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
ciliated
protein
sequence
Prior art date
Application number
PCT/CN2001/001543
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2002221473A priority Critical patent/AU2002221473A1/en
Publication of WO2002038604A1 publication Critical patent/WO2002038604A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, cilibrofilin 45. 98, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • Fibroblasts are widespread from Klebsiella pathogens, Drosophila to rodents, and humans, and they are associated with tactile receptor cilia.
  • Silk fibroin has been found in human brain, retina, melanocytes, and at least 13 other tissues.
  • filament protein has a special domain.
  • a pair of microtubules with nine cilia and flagella are connected to the outer part of the silk-forming protein, thus forming some special-purpose filaments.
  • Dichotomin A and B are assembled to form the core protofilament of filaments of fibroin, and filament protein C synthesizes a homodimer, assembled outside these core filaments or synthesizes a second independent filament protein Filament. '
  • silk fibroin is related to the existence of motor cilia and primary immobilized cilia. It is highly expressed in the adult brain and choroid bundles, during the formation of retinal and embryonic olfactory receptor nerves, and is related to the formation and function of these tissues .
  • the human gene of the present invention is 81% identical and 90% similar to the silk protein gene tekin 1 at the protein level. Based on the above points, it is considered that the new gene of the present invention is a silk fibroin gene and named as ciliated silk fibroin 45. 98. Based on this, it is inferred that it is similar to tekin 1, a member of the filokin family, and has similar biological functions.
  • the ciliated filament protein 45.98 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there is always a need to identify more involved in these The cilia filament protein 45. 98 protein, especially the amino acid sequence of this protein is identified. Isolation of 45. 98 protein encoding genes for new ciliated silk protein Identifying the role of this protein in health and disease states provides the basis. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for D1. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another 7 "object of the present invention is to provide a recombinant vector comprising a polynucleotide encoding a cilibrofilin 45.98.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a cilibrofilin 45.98.
  • Another object of the present invention is to provide a method for producing ciliated filament protein 45.98.
  • Another object of the present invention is to provide an antibody against the cilibrofilin 45.98 polypeptide of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, ciliated filament protein 45.98.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with an abnormality of ciliated filament protein 45.98. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 60-1316 in SEQ ID NO: 1; and (b) a sequence having 1-1398 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; a package
  • the method of preparing the polypeptide of the present invention includes culturing the host cell and recovering the expressed product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit cilibrofilin 45.98 protein activity, which comprises utilizing the polypeptide of the present invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of the ciliated filament protein 45.98 protein, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for the treatment of cancer, developmental disease or immune disease, or other diseases caused by abnormal expression of fibroin 45.98.
  • FIG. 1 is a comparison diagram of amino acid sequence homology of ciliated silk protein 45. 98 and ciliated silk protein of the present invention.
  • the upper sequence is ciliated filament protein 45. 98, and the lower sequence is ciliated filament protein.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated ciliated filament protein 45.98. 45. 98kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with ciliated filament protein 45.98, causes the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds ciliated filament protein 45.98.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of ciliated filament protein 45.98 when combined with ciliated filament protein 45.98.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds ciliated filament protein 45.98.
  • Regular refers to a change in the function of ciliated filament protein 45.98, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of ciliated filament protein 45.98. change.
  • Substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can purify ciliated filament protein 45. 98 using standard protein purification techniques. Basically pure ciliated filament protein 45. 98 produces a single main band on a non-reducing polyacrylamide gel.
  • Ciliated filament protein 45. 98 The purity of the polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to a polynucleotide that naturally binds by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence CRC-T
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • Homology refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid.
  • the inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
  • the MEGALIGN program can compare two or more sequences (Hi ggins, D. G. and
  • the Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art, such as Jotun He in (Hein J., (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab,) 2 and Fv, which can specifically bind to the epitope of ciliated filament protein 45.98.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated ciliated filament protein 45. 98 means ciliated filament protein 45. 98 is essentially free of other proteins, lipids, sugars or other substances that are naturally associated with it. Those skilled in the art can purify ciliated filament protein 45. 98 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Ciliated filament protein 45. 98 The purity of the peptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide ciliated filament protein 45. 98, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of cilibrofilin 45.98.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the cilibrofilin 45.98 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ) A type in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1398 bases, and its open reading frame 60-1316 encodes 418 amino acids. According to the amino acid sequence homology comparison, it was found that this peptide has 81% homology with the ciliated filament protein. It can be inferred that the ciliated filament protein 45. 98 has a similar structure and function to the ciliated filament protein.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDM, genomic DNA, or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • "degenerate variant" in the present invention refers to a nucleic acid sequence that encodes an egg'white matter or polypeptide having SEQ ID NO: 2 but is different from the coding region sequence shown in SEQ ID NO: 1 .
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • the invention also relates to nucleic acid fragments that hybridize to the sequences described above.
  • nucleic acid fragment contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding ciliostatin 45.98.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the cilibrofilin 45. 98 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the D fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • isolating genomic DNA is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDM of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RM hybridization; (2) the presence or absence of a marker gene function; (3) determination of the level of cilia protein 45.98 transcripts; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • MA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product expressed by the ciliated filament protein 45. 98 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the ciliated silk protein 45.98 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods. .
  • a polynucleotide sequence encoding the cilibrofilin 45. 98 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, eta l.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct an expression vector containing a DNA sequence encoding ciliostatin 45.98 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, eta l. Molecular Cloning, a Laboratory Manua, Cold Cold Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will allow it to be used in higher eukaryotic cells Transcription is enhanced.
  • Enhancers are cis-acting factors for D expression, usually about 10 to 300 base pairs that act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a ciliated filament protein 45.98 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as insect cells such as Fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant cilibrofilin 45. 98 (Science, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the physical, chemical, and other properties can be used to isolate and purify the recombinant protein through various separation methods. These methods are well known to those skilled in the art.
  • These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat neurological developmental abnormalities, paralysis, arrhythmia, bronchial asthma, peptic ulcer, dementia diseases, and the like.
  • motor or primary cilia in many types of neural tissues and sensory cells.
  • the expression of silk fibroin is related to the existence of motor cilia and primary immobile cilia. It is found in the brain and choroid bundles of adults in the retinal and embryonic stages. Highly expressed in the olfactory nerve. In vivo, its abnormal expression can cause nervous system dysfunction, and then cause related diseases.
  • the polypeptide and silk-forming protein of the present invention are ciliated silk-forming protein, which contains characteristic sequences of the protein family, and both have similar biological functions.
  • the abnormal expression of the polypeptide in the body can cause nervous system dysfunction, and then cause related Diseases, including but not limited to:
  • Peripheral nervous system includes: 12 pairs of cerebral nerves, 31 pairs of spinal nerves, and autonomic nerves (sympathetic and parasympathetic). Its functional disorders can cause related diseases or / and clinical symptoms. These diseases or / and clinical symptoms include, but are not limited to:
  • Loss of olfactory taste olfactory nerve
  • visual impairment and / or visual field defect ophthalmoplegia
  • diplopia changes in pupil size / reflexes (eye movement nerve, pulley nerve, abductor nerve), facial sensory disorders, masticatory muscles Paralysis, neuroparalytic keratitis (trigeminal nerve), facial paralysis (facial nerve), deafness, tinnitus, vertigo, balance disorders, nystagmus (auditory nerve), hoarseness, dysphagia, loss of pharyngeal reflex (glossopharyngeal nerve, vagus nerve), shoulder Sagging, neck / shrug fatigue (collateral nerve), lingual muscle paralysis (sublingual nerve), etc .;
  • Paresthesia Inhibitory paresthesia (lack of sensation, hypoparesis), irritating paresthesia (allergy, paresthesia, pain), etc .;
  • arrhythmias such as atrial early, ventricular early, sinus tachycardia, supraventricular tachycardia, ventricular tachycardia, atrial flutter, atrial fibrillation, sinus bradycardia, sinus arrest, sick sinus syndrome, indoor conduction block, etc .;
  • Pulmonary edema respiratory muscle paralysis, respiratory failure, bronchial asthma, etc .
  • Gastrointestinal neurosis Hydatid disease, psychogenic vomiting, neurogenic belching, anorexia nervosa, irritable bowel syndrome, etc .;
  • Diabetes hypoglycemia, hyperlipidemia, hyperlipoproteinemia, obesity, pheochromocytoma, etc .;
  • dysmenorrhea dysmenorrhea, glaucoma, visual impairment and ischemic necrosis of multiple organs, such as renal necrosis (renal failure), liver necrosis, intestinal necrosis, etc .;
  • Frontal lobe dementia, personality changes (frontal frontal), strabismus, inability to write (back middle frontal gyrus), motor aphasia (back frontal subfrontal gyrus), loss of smell (bottom of frontal lobe), limb paralysis, Convulsions (central gyrus), etc .;
  • Parietal lobe sensory disturbance (central posterior gyrus), dyslexia (left corner gyrus), body image disorder (right parietal lobe), etc .;
  • Temporal lobe Hookback attack (anterior temporal lobe), sensory / amnestic aphasia (left temporal lobe), hearing impairment (rear superior temporal gyrus), etc.
  • Occipital lobe hemianopia, hallucinations, visual disagreement, etc.
  • Limbic system emotional symptoms, memory loss, disturbance of consciousness, hallucinations, etc .;
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used for the treatment of various diseases, such as nervous system developmental malformation, paralysis, arrhythmia, bronchial asthma, peptic ulcer, dementia and the like.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) ciliated filament protein 45.98.
  • Agonists increase ciliated filament protein 45. 98 stimulates biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing ciliated filament protein 45. 98 can be cultured together with labeled ciliated filament protein 45. 98 in the presence of a drug. The ability of the drug to increase or block this interaction is then measured.
  • Antagonists of cilibrofilin 45. 98 include antibodies, compounds, receptor deletions, and the like that have been screened.
  • the antagonist of ciliated filament protein 45. 98 can bind to ciliated filament protein 45. 98 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology.
  • ciliated filament protein 45. 98 can be added to a bioanalytical assay to determine whether the compound is a compound by measuring the effect of the compound on the interaction between ciliated filament protein 45. 98 and its receptor. Antagonist. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.
  • Peptide molecules capable of binding to ciliated filament protein 45. 98 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, 45. 98 molecules of cilibrofilin should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the ciliated filament protein 45.98 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
  • polyclonal antibodies can be obtained by immunizing animals (such as rabbits, mice, rats, etc.) with ciliated filament protein 45.98.
  • ciliated filament protein 45.98 A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
  • Techniques for preparing monoclonal antibodies to ciliated filament protein 45. 98 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
  • Synthetic antibodies can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single-chain antibodies against ciliated filament protein 45.98.
  • Antibodies against ciliated filament protein 45. 98 can be used in immunohistochemical techniques to detect ciliated filament protein 45. 98 in biopsy specimens.
  • Monoclonal antibodies that bind to ciliated filament protein 45. 98 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins against a specific bead site in the body. Such as ciliated filament protein 45. 98.
  • High-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill the ciliated filament protein 45. cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to ciliated filament protein 45.98.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of ciliated filament protein 45.98.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of ciliated filament protein 45.98.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of ciliated filament protein 45. 98 detected in the test can be used to explain the importance of ciliated filament protein 45. 98 in various diseases and to diagnose diseases where ciliated filament protein 45. 98 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding ciliated filament protein 45.98 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of ciliated filament protein 45.98.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express the variant ciliated filament protein 45.98 to inhibit the endogenous ciliated filament protein 45.98 activity.
  • a variant ciliated filament protein 45. 98 may be a shortened ciliated filament protein 45. 98, which lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of ciliated filament protein 45.98.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer polynucleotides encoding the cilibrofilin 45.98 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a ciliated filament protein 45.98 can be found in There is literature (Sambrook, et al.).
  • the polynucleotide encoding the cilibrofilin 45. 98 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit ciliated filament protein 45.98 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as the solid-phase phosphoramidite synthesis method for oligonucleotide synthesis, which is widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of the D sequence encoding the RM. This DNA sequence has been integrated into the vector. Downstream of the RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding ciliated filament protein 45. 98 can be used for the diagnosis of diseases related to ciliated filament protein 45. 98.
  • the polynucleotide encoding ciliated filament protein 45. 98 can be used to detect the expression of ciliated filament protein 45. 98 or abnormal expression of ciliated filament protein 45. 98 in a disease state.
  • the D sequence encoding ciliated filament protein 45. 98 can be used to hybridize biopsy specimens to determine the expression of ciliated filament protein 45. 98.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on. These techniques and methods are all mature and open technologies, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
  • RNA-polymerase chain reaction RT-PCR was performed using ciliated filament protein 45.98 specific primers for in vitro amplification to detect the transcription product of ciliated filament protein 45.98.
  • ciliated filament protein 45. 98 mutations can also be used to diagnose ciliated filament protein 45. 98-related diseases.
  • the forms of the ciliated filament protein 45.98 mutation include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type ciliated filament protein 45.98 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. At present, the specificity of each gene on the chromosome needs to be identified Site. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • containers there can be medicines manufactured, used or sold by Instructions given by the government regulatory agency for the product or biological product, which reflects the permission of the government regulatory agency for production, use, or sale to be administered to the human body.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Ciliated filament protein 45. 98 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of ciliated filament protein 45.98 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) m bands were isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech
  • Dye terminate cycle react ion sequencing Kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequences were compared with the existing public DNA sequence database (Genebank). The comparison showed that the CDM sequence of one of the clones 3059el0 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragment in both directions.
  • the sequence of the ciliated filament protein 45. 98 of the present invention and the protein sequence encoded by the ciliated filament protein were coded using the Blas t program (Basic loc l al ignment search tool) [Al tschul, SF et al. J. Mol. Biol. 1990; 215 : 403-10], perform homology search in databases such as Genbank, Switzerland, and so on.
  • the most homologous gene for silk protein 45.98 is a known ciliated silk-forming protein, and its accession number is af081947 in Genbank.
  • the protein homology results are shown in Figure 1. The two are highly homologous with 81% identity; 90% similarity.
  • Example 3 Cloning of a gene encoding ciliated filament protein 45.98 by RT-PCR
  • CD was synthesized by reverse transcription reaction using total RM of fetal brain cells as a template and ol igo-dT as a primer. After purification with Qiagene's kit, PCR amplification was performed with the following primers:
  • Primer2 5'- CATAGGCCGAGGCGGCCGACATGT -3, (SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • a reaction volume of 50 ⁇ 1 contains 50 mmol / L KCl, 1 Oramol / L Tri s-HCl pH 8.5, 1.5 ol / L MgCl 2 , 200
  • the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55. C 30sec; 72 ° C 2min 0 During RT-PCR, ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen). DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1398 bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of ciliated filament protein 45.98 gene expression
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159].
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidinium isothiocyanate-25 mM sodium citrate, 0.2! ⁇ 1 sodium acetate (114. 0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol were added. (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • 32P-labeled probes (approximately 2 x 10 6 cpm / ml) were hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7. 4) -5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in lx SSC-0.1% SDS at 55 ° C for 30 minutes. Then, Analysis and quantification were performed using a Phosphor Imager.
  • Example 5 In Vitro Expression, Isolation and Purification of Recombinant Ciliated Silk Fibroin 45. 98 According to the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:
  • Primer3 5 -CCCCATATGATGGCTAAACTATTACAACCTCCA-3 (Seq ID No: 5)
  • Primer4 5'-CATGGATCCTTAGCAGACAGCATCAGGGCGGAG-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3). Endonuclease site.
  • the PCR reaction was performed using pBS-3059el O plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of pBS-3059el 0 plasmid in a total volume of 50 ⁇ 1, Primer-3 and Primer-4 were lpmol Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 C 20s 60 C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • Ligation products were transformed by the calcium chloride method Escherichia bacteria DH5 a, the (final concentration of 30 ⁇ 8 ⁇ 1) LB plates incubated overnight positive clones by colony PCR method containing kanamycin, and sequenced. A positive clone (pET-3059elO) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • Polypeptide synthesizer (product of PE company) was used to synthesize the following pectin-forming protein 45.
  • 98 NH2-Met-Ala-Lys-Leu-Leu-Gln-Pro-Pro-Lys-Phe-Leu- Pro-Ser-Glu-0H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences Compare its homology with its complementary region. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • Steps 8-13 below are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the sample membrane was placed in a plastic bag and 3-10 mg of prehybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)) was added. After closing the bag, 68. C water bath for 2 hours.
  • prehybridization solution lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Toxicology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention porte sur un nouveau polypeptide, une protéine associée à la racine ciliaire 45.98, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention porte également sur les applications de ce polypeptide dans le traitement de maladies, notamment des malformations survenant lors du développement du système nerveux, de paralysie, d'arythmie, d'asthme, d'ulcère digestif et de démence. L'invention porte en outre sur l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine associée à la racine ciliaire 45.98.
PCT/CN2001/001543 2000-11-10 2001-11-09 Nouveau polypeptide, proteine associee a la racine ciliaire 45.98, et polynucleotide codant ce polypeptide WO2002038604A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002221473A AU2002221473A1 (en) 2000-11-10 2001-11-09 A new polypeptide-cicliary rootlet protein 45.98 and the polynucleotide encodingit

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00127410.4 2000-11-10
CN00127410A CN1352041A (zh) 2000-11-10 2000-11-10 一种新的多肽——纤毛筑丝蛋白 45.98和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002038604A1 true WO2002038604A1 (fr) 2002-05-16

Family

ID=4592426

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001543 WO2002038604A1 (fr) 2000-11-10 2001-11-09 Nouveau polypeptide, proteine associee a la racine ciliaire 45.98, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1352041A (fr)
AU (1) AU2002221473A1 (fr)
WO (1) WO2002038604A1 (fr)

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
FINGERT, J.H. ET AL.: "Characterization and comparison of the human and mouse GLC1A glaucome genes", GENOME RES., vol. 8, no. 4, 1998, pages 377 - 384 *
TAGUCHI, M. ET AL.: "Molecular cloning and expression profile of rat myocilin", MOL. GENET. METAB., vol. 70, no. 1, 2000, pages 75 - 80 *
TANIGUCHI, F. ET AL.: "Molecular cloning of the bovine MYOC and induction of its expression in trabecular meshwork cells", INVEST. OPHTHALMOL. VIS. SCI., vol. 41, no. 8, 2000, pages 2070 - 2075 *

Also Published As

Publication number Publication date
AU2002221473A1 (en) 2002-05-21
CN1352041A (zh) 2002-06-05

Similar Documents

Publication Publication Date Title
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2002004505A1 (fr) Nouveau polypeptide, semaphorine humaine 9, et polynucleotide codant ce polypeptide
WO2002020795A1 (fr) Nouveau polypeptide, hexokinase proteine 9.68, et polynucleotide codant ce polypeptide
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2002038604A1 (fr) Nouveau polypeptide, proteine associee a la racine ciliaire 45.98, et polynucleotide codant ce polypeptide
WO2002004633A1 (fr) Nouveau polypeptide, proteine humaine de fasciculation et d'extension 12.87, et polynucleotide codant ce polypeptide
WO2002020606A1 (fr) Nouveau polypeptide, la proteine humaine 38.39 liee aux defauts d'audition, et polynucleotide codant pour elle
WO2002012311A1 (fr) Nouveau polypeptide, proteine humaine 16.61 de fasciculation et d'extension, et polynucleotide codant ce polypeptide
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2002038603A1 (fr) Nouveau polypeptide, grande proteine humaine 1225-13.87, et polynucleotide codant ce polypeptide
WO2001075085A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide
WO2001046437A1 (fr) Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide
WO2002012491A1 (fr) Nouveau polypeptide, proteine humaine notch 24.64, et polynucleotide codant ce polypeptide
WO2002006333A1 (fr) Nouveau polypeptide, proteine vn1-18 du recepteur de la pheromone, et polynucleotide codant ce polypeptide
WO2001070956A1 (fr) Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2002042453A1 (fr) Nouveau polypeptide, appele grosse proteine humaine 0767-19.36 et polynucleotide codant ce polypeptide
WO2001094399A1 (fr) Nouveau polypeptide, proteine humaine 11.66 associee au synaptosome, et polynucleotide codant pour ce polypeptide
WO2002040526A1 (fr) Nouveau polypeptide, proteine 18.70 exprimee de maniere specifique dans le cerveau chez l'homme, et polynucleotide codant ledit polypeptide
WO2002026797A1 (fr) Nouveau polypeptide, deshydrogenase humaine 29.15, et polynucleotide codant ce polypeptide
WO2002026970A1 (fr) Nouveau polypeptide, molecule d'adhesion neuronale humaine 11.44, et polynucleotide codant ce polypeptide
WO2001048199A1 (fr) Nouveau polypeptide, proteine ribosomale s10 14, et polynucleotide codant pour ce polypeptide
WO2001055372A1 (fr) Nouveau polypeptide, proteine humaine tnfr/ngfr 10, et polynucleotide codant pour ce polypeptide
WO2001081384A1 (fr) Nouveau polypeptide, laminine 16, et polynucleotide codant pour ce polypeptide
WO2001047990A1 (fr) Nouveau polypeptide, proteine ribosomale l2 11, et polynucleotide codant pour ce polypeptide
WO2001047984A1 (fr) Nouveau polypeptide, proteine 10 de la famille des amidases, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP