WO2002038603A1 - Nouveau polypeptide, grande proteine humaine 1225-13.87, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, grande proteine humaine 1225-13.87, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002038603A1
WO2002038603A1 PCT/CN2001/001542 CN0101542W WO0238603A1 WO 2002038603 A1 WO2002038603 A1 WO 2002038603A1 CN 0101542 W CN0101542 W CN 0101542W WO 0238603 A1 WO0238603 A1 WO 0238603A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human large
large protein
sequence
Prior art date
Application number
PCT/CN2001/001542
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2002221472A priority Critical patent/AU2002221472A1/en
Publication of WO2002038603A1 publication Critical patent/WO2002038603A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human large protein 1225-13.87, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
  • cDNA sequences contain similar domains. These genes are expressed in 10 human tissues and 8 brain regions (tonsils, corpus callosum, cerebellum, caudate nucleus, hippocampus, and thalamic nuclei, respectively). Thalamus, substantia nigra), spinal cord, fetal brain and fetal liver (Takahiro Nagase, Ken-ichi Ishikawa et al., 1999, DNA Research., 6, 63-70). Analysis of genes encoding large proteins has led us to discover that they play an important role in mammals (Nomura, N., Miuajima, n., 1994, DNA Res., 1, 27-35).
  • the human protein of the present invention and human large protein 1225 have 87% identity and 93% similarity at the protein level. Based on the above points, the new gene of the present invention is considered to be a human large protein gene, and it is inferred that it is similar to 1225, is a member of the human large protein family, and has similar biological functions. If mutation occurs, it will affect the normal movement of cells, destroy cell morphology, and cause a series of diseases. In addition, it also plays a role in the diagnosis and treatment of related diseases.
  • human large protein 1225-13.87 protein regulates cell division and embryonic development. It plays an important role in important functions of the body, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there has been a need in the art to identify more human large proteins 1225-1 3.87 proteins involved in these processes, especially the amino acids of this protein. sequence.
  • the new human protein 1225-1 3.87 The isolation of the protein-coding gene also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding D. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human large protein 1225-1.87.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human large protein 1225-13.87.
  • Another object of the present invention is to provide a method for producing human large protein 1225-1.87.
  • Another object of the present invention is to provide antibodies against the polypeptide of the present invention, human large protein 1225-1 3. 87.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human large protein 1225-1 3.87.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human large protein 1225-1 3.87. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 A sequence of positions 191-844; and (b) a sequence of positions 1-2413 in SEQ ID NO: 1.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human large protein 1225-13.87 protein activity, which comprises using the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human large protein 1225-13.87 protein, comprising detecting mutations in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human large protein 1225-13.87.
  • Figure 1 is a comparison of the amino acid sequence homology of human large protein 1225-13.87 and human large protein 1225 of the present invention.
  • the upper sequence is human large protein 1225-13. 87, and the lower sequence is human large protein 1225.
  • Identical amino acids are represented by single character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human large protein 1225-13.87.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human large protein 1225-1 3.87, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human large protein 1225-1 3.87.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human large protein 1225-1 3.87 when combined with human large protein 1225-1 3.87.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human large proteins 1225-1 3.87.
  • Regular refers to changes in the function of human large protein 1225-1 3.87, including the increase or decrease in protein activity, changes in binding characteristics, and any other biological properties, functions, or immunity of human large protein 1225-1 3.87 Change of nature.
  • substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can purify human large proteins 1225-1 3.87 using standard protein purification techniques. Basically pure human large protein 1225-13. 87 can produce a single main band on a non-reducing polyacrylamide gel. Human large protein 1225-1 3. 87 The purity of the peptide can be analyzed by amino acid sequence.
  • Complementary refers to base pairing by allowing base salt concentration and temperature Polynucleotides bind naturally.
  • sequence can be combined with the complementary sequence "GACT”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art, such as Jotun He in (Hein J., (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which are specific sexually binds to human epitopes of 1225-13. 87 epitopes.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human large protein 1225-13. 87 refers to human large protein 1225-1 3. 87 which is substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human large protein 1225-1 3.87 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human large protein 1225-13. 87 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human large protein 1225-13.87, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives, and analogs of human large protein 1225-1.87.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human large proteins 1225-1 3.87 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by other groups to include a substituent; or (III) such One, where the mature polypeptide is with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol) Fusion; or (IV) a polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify the polypeptide or a protease sequence) in which an additional amino acid sequence is fused into a mature polypeptide.
  • a polypeptide sequence such as a leader sequence or a secreted sequence or a sequence used to purify the polypeptide or a prote
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 241 3 bases, and its open reading frames 191-844 encode 217 amino acids. According to the amino acid sequence homology comparison, it was found that this peptide has 87% homology with human large protein 1225. It can be inferred that human large protein 1225-1 3. 87 has a similar structure and function to human large protein 1225.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i col l, 42 'C, etc .; or D) Hybridization occurs only when the identity between the two sequences is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human large proteins 1225-13.87.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding human large protein 1225-13.87 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the D fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA. Kits are also commercially available (Qiagene), and constructing cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of transcripts of human large protein 1225-13.87; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein products of human large protein 1225- 13.87 gene expression.
  • a method using PCR technology to amplify DM / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human large protein 1225-13.87 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology .
  • a polynucleotide sequence encoding human large protein 1225-13.87 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • DNA sequences encoding human large proteins 1225-13.87 and appropriate transcription / translation regulatory elements can be used to construct expression vectors containing DNA sequences encoding human large proteins 1225-13.87 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: E.
  • coli lac or trp promoter Lambda phage PL promoter
  • eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and The late SV40 promoter, retroviral LTRs, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
  • Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human large protein 1225-13.87 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human large protein 1225-13.87 (Sc ience, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various Conventional medium. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Human large protein is expressed in 10 tissues and 8 brain regions in the human body, the spinal cord, fetal brain, and fetal liver. It affects signal transmission / communication between cells, cell structure / movement, and nucleic acid control. It plays an important role in the pathways of nervous system signaling and protein metabolism, and its abnormal expression can cause disorders in nervous system signaling and protein metabolism, and then cause related diseases.
  • the polypeptide of the present invention and the known human 1225 protein are human large protein 1225, which contains characteristic sequences of the protein family, and both have similar biological functions.
  • the polypeptide of the present invention affects the transmission / exchange of signals between cells, cell structure / movement, and control of nucleic acids in the human body. It plays an important role in the nervous system signal transmission and protein metabolism, and its abnormal expression can cause disorders in the nervous system and protein metabolism, and then cause related diseases. These diseases include, but are not limited to:
  • Frontal lobe dementia, personality changes (frontal frontal), strabismus, inability to write (back middle frontal gyrus), motor aphasia (back frontal subfrontal gyrus), loss of smell (bottom of frontal lobe), limb paralysis, Convulsions (central gyrus), etc .;
  • Parietal lobe sensory disturbance (central posterior gyrus), dyslexia (left corner gyrus), body image disorder (right parietal lobe), etc .;
  • Temporal lobe Hookback attack (anterior temporal lobe), sensory / amnestic aphasia (left temporal lobe), hearing impairment (rear superior temporal gyrus), etc.
  • Occipital lobe hemianopia, hallucinations, visual disagreement, etc.
  • Peripheral nervous system includes: 12 pairs of brain nerves, 31 pairs of spinal nerves, and autonomic nerves (sympathetic and parasympathetic).
  • the dysfunction can cause related diseases or / and clinical symptoms. These diseases or / and clinical symptoms include, but are not limited to:
  • Loss of olfactory taste olfactory nerve
  • visual impairment and / or visual field defect ophthalmoplegia
  • diplopia changes in pupil size / reflexes (eye movement nerve, pulley nerve, abductor nerve), facial sensory disorders, masticatory muscles Paralysis, neuroparalytic keratitis (triple nerves), facial paralysis (facial nerves), deafness, tinnitus, vertigo, balance disorders, nystagmus (auditory nerves), hoarseness, difficulty swallowing, pharyngeal reflexes disappeared (glossopharyngeal nerve, vagus nerve) Shoulder drooping, neck / shrug fatigue (collateral nerve), lingual muscle paralysis (sublingual nerve), etc .;
  • Paresthesia Inhibitory paresthesia (lack of sensation, hypoparesis), irritating paresthesia (allergy, paresthesia, pain), etc .;
  • Dyskinesias Central paralysis (monoplegia, hemiplegia, paraplegia), peripheral paralysis, etc. 3. Autonomic (sympathetic and parasympathetic) functional disorders:
  • Cardio-cerebral vascular system
  • arrhythmias such as early atrial, early ventricular, sinus tachycardia, supraventricular tachycardia, atrial tachycardia, atrial flutter, atrial fibrillation, sinus bradycardia, sinus arrest, sick sinus syndrome, indoor conduction block, etc .;
  • Pulmonary edema respiratory muscle paralysis, respiratory failure, bronchial asthma, etc .
  • Gastrointestinal neurosis Hydatid disease, psychogenic vomiting, neurogenic belching, anorexia nervosa, irritable bowel syndrome, etc .;
  • dysmenorrhea dysmenorrhea, glaucoma, visual impairment and ischemic necrosis of multiple organs, such as renal necrosis (renal failure), liver necrosis, intestinal necrosis, etc .;
  • Protein peptide hormone dysfunction can cause the following diseases:
  • Insulin and glucagon diabetes, hypoglycemia, etc .;
  • Hypothalamus and pituitary hormones giant disease, dwarfism, acromegaly, cortisol syndrome (Cushing's syndrome), primary aldosteronism, secondary chronic adrenal insufficiency, hyperthyroidism Hypothyroidism (stingle disease, juvenile hypothyroidism, adult hypothyroidism), male / female infertility, menstrual disorders (functional uterine bleeding, amenorrhea, polycystic ovary syndrome, premenstrual tension syndrome, Menopause syndrome), sexual development disorder, diabetes insipidus, inappropriate antidiuretic hormone secretion syndrome, abnormal lactation, etc .;
  • parathyroid hormone hyperparathyroidism, hypoparathyroidism, etc .
  • Gastrointestinal hormones peptic ulcer, chronic indigestion, chronic gastritis, etc .;
  • Arrhythmia shock, insanity, epilepsy, chorea, hepatic encephalopathy (norepinephrine, Y-aminobutyric acid, serotonin, glutamine), motion sickness, type I allergic disease (net Measles, hay fever, allergic rhinitis, skin allergies), peptic ulcer (histamine), hypercholesterolemia (taurine), tumors (polyamines), etc .;
  • the polypeptide of the present invention and the antagonist, agonist and inhibitor of the polypeptide can be directly used in the treatment of various diseases, such as dementia, facial paralysis, arrhythmia, bronchial asthma, peptic ulcer, diabetes, periodic paralysis, etc. .
  • the invention also provides screening compounds to identify increasing (agonist) or repressing (antagonist) human large proteins.
  • 1225-13.87 method of medicament.
  • Agonists enhance human large protein 1225-13.87 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human large protein 1225-13.87 can be cultured together with labeled human large protein 1225-13.87 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human large protein 1225-13.87 include antibodies, compounds, receptor deletions and analogs that have been screened. Antagonists of human large protein 1225-13.87 can bind to human large protein 1225-13.87 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human large protein 1225-13.87 When screening compounds as antagonists, human large protein 1225-13.87 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human large protein 1225-13.87 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Polypeptide molecules capable of binding to human large protein 1225-13.87 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the 1225-13.87 molecules of human large protein should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the human large protein 1225-13.87 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • polyclonal antibodies can be obtained by direct injection of human large protein 1225-13.87 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to human large protein 1225-13.87 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridization Tumor technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). And already The single-chain antibody production technology (US Pat No. 4946778) can also be used to produce single-chain antibodies against human large proteins 1225- 13.87.
  • Antibodies to human large protein 1225-13.87 can be used in immunohistochemistry to detect human large protein 1225-13.87 in biopsy specimens.
  • Monoclonal antibodies that bind to human large protein 1225-13.87 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • immunotoxins such as human large protein 1225-13.87 monoclonal antibodies with high affinity can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and toxins are bound to the antibody through disulfide exchange.
  • This hybrid antibody can be used to kill human large protein 1225-13.87 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human large protein 1225-13.87.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human large protein 1225-13.87.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human large protein 1225-13.87.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the levels of human large protein 1225-13.87 detected in the test can be used to explain the importance of human large protein 1225-13.87 in various diseases and to diagnose diseases where human large protein 1225-13.87 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human large proteins 1225-13.87 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human large protein 1225-13.87.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human large protein 1225-13.87 to inhibit endogenous human large protein 1225-13.87 activity.
  • a mutated human large protein 1225-13.87 may be a shortened human large protein 1225-13.87 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human large protein 1225-13.87.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer polynucleotides encoding human large proteins 1225-13.87 into cells.
  • Methods for constructing recombinant viral vectors carrying polynucleotides encoding human large proteins 1225-13.87 can be found in existing literature (Sambrook, et al.).
  • recombinantly encodes human large protein 1225-13.87 The polynucleotide can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body etc.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human large protein 1225-13.87 are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of the D sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human large protein 1225-13.87 can be used for the diagnosis of diseases related to human large protein 1225-13.87.
  • the polynucleotide encoding human large protein 1225-13.87 can be used to detect the expression of human large protein 1225-13.87 or the abnormal expression of human large protein 1225-13.87 in a disease state.
  • the D sequence encoding human large protein 1225-13.87 can be used to hybridize biopsy specimens to determine the expression of human large protein 1225-13.87.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are all mature and open technologies, and related kits are available from commercial sources.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a D chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human big protein 1225-13.87 specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human big protein 1225-13.87 transcripts.
  • Detection of human large protein 1225-13.87 mutations can also be used to diagnose human large protein 1225-13.87 related diseases.
  • the forms of human large protein 1225-13.87 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild type human large protein 1225-13.87 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Only few chromosome markers based on actual sequence data (repeat polymorphisms) are available For marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these D sequences on a chromosome.
  • the PCR primers (preferably 15-35bp) are prepared based on the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition contains a safe and effective amount of a polypeptide or an antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceuticals or biological products, which instructions reflect production, use Or a government agency that sells it allows it to be administered to humans.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human large protein 1225-13.87 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human large protein 1225-13.87 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA was reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragments into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public D sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 3325G07 was a new DM.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • the sequence of the human large protein 1225-13.87 of the present invention and the protein sequence encoded by the same are applied to the Blast program (Basic local alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], Homology search in databases such as Genbank and Swissport.
  • the gene with the highest homology to the human large protein 1225-13.87 of the present invention is a known human large protein 1225.
  • the encoded protein is The access number for Genbank is AB033051.
  • the protein homology results are shown in Figure 1. The two are highly homologous, with 87% identity; 93% similarity.
  • Example 3 Cloning of a gene encoding human large protein 1225-13.87 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- GTCTAACGTGGCACCTTCCTGGAT -3 '(SEQ ID NO: 3)
  • Primer2 5'- CATAGGCCGAGGCGGCCGACATGT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l / LKCl, 10 mmol / L Tris-HCl pH8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ ol / L dNTP, lOpmol primer, 1U Taq DNA in a 50 ⁇ 1 reaction volume Polymerase (C 1 on t ech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perk i nE 1 mer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l-2413bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human large protein 1225-13.87 gene expression
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. The aqueous phase was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain an R precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 minutes. Then, use Phosphor Imager performs analysis and quantification.
  • Example 5 Recombinant human large protein 1225-13. 87 in vitro expression, isolation and purification According to the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:
  • Pr imer3 5 '-CATGCTAGCATGATGGAGAACCTAATAAGGGGA-3' (Seq ID No: 5)
  • Pr imer4 5'-CATGGATCCTCAGATGTTTGGTAGAGTTTTCAA-3 '(Seq ID No: 6)
  • Nhel and BamHI digestion sites correspond to the expression vector plasmid pET-28b (+) (Novagen Corporation product, Ca t. No. 69865. 3) Selective endonuclease site.
  • PCR was performed using the PBS-3325G07 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of pBS-3325G07 plasmid was contained in a total volume of 50 ⁇ 1, and Primer-3 and Primer-4 primers were 1 Opmol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60. C 30s, 68. C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E.
  • the host bacteria BL21 (pET-3325G07) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L, Continue incubation for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The affinity chromatography column His s. Bind Quick Cart r idge (product of Novagen) was used to bind 6 histidines (6His-Tag). Chromatography was performed to obtain purified human protein 1225-13.87.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human large protein 1225-13.
  • 87 specific peptides NH2-Met-Met-G 1 u-Asn-Leu-1 1 e-Arg-G 1 yA r gA s nP r oP r oG 1 n-Ty rG 1 n-OH (SEQ ID NO: 7).
  • the polypeptide was coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences Compare its homology with its complementary region. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une grande protéine humaine 1225-13.87, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment la démence, les paralysies faciales, les arythmies, l'asthme, les ulcères digestifs, le diabète et les paralysies périodiques. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la grande protéine humaine 1225-13.87.
PCT/CN2001/001542 2000-11-10 2001-11-09 Nouveau polypeptide, grande proteine humaine 1225-13.87, et polynucleotide codant ce polypeptide WO2002038603A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002221472A AU2002221472A1 (en) 2000-11-10 2001-11-09 A novel peptide---human large protein 1225-13.87 and the polynucleotide coding this novel peptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00127371.X 2000-11-10
CN 00127371 CN1352168A (zh) 2000-11-10 2000-11-10 一种新的多肽——人大蛋白1225－13.87和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002038603A1 true WO2002038603A1 (fr) 2002-05-16

Family

ID=4592387

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001542 WO2002038603A1 (fr) 2000-11-10 2001-11-09 Nouveau polypeptide, grande proteine humaine 1225-13.87, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1352168A (fr)
AU (1) AU2002221472A1 (fr)
WO (1) WO2002038603A1 (fr)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 4 November 1996 (1996-11-04), APPERSON, M.L. ET AL., retrieved from GI:1657757 accession no. NCBI Database accession no. (U66707.1) *

Also Published As

Publication number Publication date
CN1352168A (zh) 2002-06-05
AU2002221472A1 (en) 2002-05-21

Similar Documents

Publication Publication Date Title
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2002004505A1 (fr) Nouveau polypeptide, semaphorine humaine 9, et polynucleotide codant ce polypeptide
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2002038603A1 (fr) Nouveau polypeptide, grande proteine humaine 1225-13.87, et polynucleotide codant ce polypeptide
WO2002002617A1 (fr) Nouveau polypeptide, sous-unite beta 10 d'adductine humaine, et polynucleotide codant ce polypeptide
WO2001038521A1 (fr) Nouveau polypeptide, proteine humaine 42 de liaison au calcium, et polynucleotide codant pour ce polypeptide
WO2002012304A1 (fr) Nouveau polypeptide, proteine murine du potentiel de recepteur transitoire 2 (trp2 ) 12, et polynucleotide codant ce polypeptide
WO2002012457A1 (fr) Nouveau polypeptide, proteine phosphatase humaine 13.31, et polynucleotide codant ce polypeptide
WO2002042453A1 (fr) Nouveau polypeptide, appele grosse proteine humaine 0767-19.36 et polynucleotide codant ce polypeptide
WO2002038604A1 (fr) Nouveau polypeptide, proteine associee a la racine ciliaire 45.98, et polynucleotide codant ce polypeptide
WO2001094399A1 (fr) Nouveau polypeptide, proteine humaine 11.66 associee au synaptosome, et polynucleotide codant pour ce polypeptide
WO2002012491A1 (fr) Nouveau polypeptide, proteine humaine notch 24.64, et polynucleotide codant ce polypeptide
WO2001064733A1 (fr) Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2002012311A1 (fr) Nouveau polypeptide, proteine humaine 16.61 de fasciculation et d'extension, et polynucleotide codant ce polypeptide
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2001046439A1 (fr) Nouveau polypeptide, proteine dnaj humaine 39, et polynucleotide codant pour ce polypeptide
WO2001055372A1 (fr) Nouveau polypeptide, proteine humaine tnfr/ngfr 10, et polynucleotide codant pour ce polypeptide
WO2001075085A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide
WO2002004633A1 (fr) Nouveau polypeptide, proteine humaine de fasciculation et d'extension 12.87, et polynucleotide codant ce polypeptide
WO2002040526A1 (fr) Nouveau polypeptide, proteine 18.70 exprimee de maniere specifique dans le cerveau chez l'homme, et polynucleotide codant ledit polypeptide
WO2002006474A1 (fr) Nouveau polypeptide, proteine humaine ehd 12.1, et polynucleotide codant ce polypeptide
WO2002011513A1 (fr) Nouveau polypeptide, proteine humaine ehd 9.57, et polynucleotide codant ce polypeptide
WO2001048199A1 (fr) Nouveau polypeptide, proteine ribosomale s10 14, et polynucleotide codant pour ce polypeptide
WO2001047997A1 (fr) Nouveau polypeptide, stathmine 8, et polynucleotide codant pour ce polypeptide
WO2001081384A1 (fr) Nouveau polypeptide, laminine 16, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP