WO2002004505A1 - Nouveau polypeptide, semaphorine humaine 9, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, semaphorine humaine 9, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002004505A1
WO2002004505A1 PCT/CN2001/000995 CN0100995W WO0204505A1 WO 2002004505 A1 WO2002004505 A1 WO 2002004505A1 CN 0100995 W CN0100995 W CN 0100995W WO 0204505 A1 WO0204505 A1 WO 0204505A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
protein
polynucleotide
human
semaphor
Prior art date
Application number
PCT/CN2001/000995
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU95388/01A priority Critical patent/AU9538801A/en
Publication of WO2002004505A1 publication Critical patent/WO2002004505A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4703—Inhibitors; Suppressors

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human semaphorin protein 9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • semaphorin gene family proteins serve as growth cone guidance signals.
  • Biologists have recently discovered five new members of the semaphorin protein family, which are semaphorinA-E.
  • the semaphorin gene is differentially expressed in the mesoderm and neuroectoderm before or during the axon of the murine embryo's path. Studies have shown that a variety of molecules in members of the semaphorin protein family can provide specific local signals for areas that cannot reach the growth cone.
  • Semaphorin protein family can be divided into at least 4 subfamilies.
  • Subfamily I includes non-vertebrate semal proteins, which are 60% identical to the semaphorin domain
  • subfamily II includes the Drosophila semall gene (the protein of which is 34% identical and 60% similar to G-Semal at the protein level), and the The protein may be a secreted protein.
  • Subfamily III consists of brain failure proteins. Its homologues in humans and murines are semalll and semD, and two murine related genes, seraA and semD.
  • Subfamily IV includes the SemB and SemC proteins of the murine. So far, all semaphorin proteins contain 12 conserved cysteine residues and a possible N-glycosylation site.
  • Semaphorin protein may be recognized by specific neurons as repulsive signals, and may also be involved in the differentiation of other organs and tissues.
  • the polypeptide of the present inventor has 97% identity and 98% similarity with the semaphorin protein at the protein level, and has similar structural characteristics, and both belong to the semaphorin protein family and are named semaphor in 9, and it is speculated that it has similar biological functions.
  • human semaphor in 9 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes.
  • Human semaphor in protein 9 protein especially the amino acid sequence of this protein.
  • the isolation of the newcomer semaphor in protein 9 gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding for DM. Disclosure of invention
  • An object of the present invention is to provide an isolated novel polypeptide-human semaphor in protein 9 and another object thereof is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human semaphor in protein 9.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human semaphor in protein 9.
  • Another object of the present invention is to provide a method for producing human semaphor in protein 9.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human semaphor in protein 9.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of human semaphor in protein 9 against the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of human semaphor in protein 9.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 A sequence of positions 1028-1276; and (b) a sequence of positions 1-1594 in SEQ ID NO: 1.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human seraaphor in protein 9 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human semaphor in protein 9 protein, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human semaphor in protein 9.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to genomes or DNA or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the absence of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. Missed.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human semaphor in protein 9, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human semaphor in protein 9.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human semaphor in protein 9 when combined with human semaphor in protein 9.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human semaphor in protein 9.
  • Regular refers to a change in the function of human semaphor in protein 9, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human semaphor in protein 9.
  • Substantially pure 1 'means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human semaphor in protein 9 using standard protein purification techniques. Essentially pure Human semaphor in protein 9 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human semaphor in protein 9 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • Number of residues matching between sequence A and sequence X 100 Number of residues in sequence A-number of spacer residues in sequence A-number of spacer residues in sequence B Methods such as Jotun He in determine the percent identity between nucleic acid sequences (He in J., (1990) Methods in emzurao logy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and F V , which can specifically bind to the epitope of human semaphor in protein 9.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it exists in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human semaphor in protein 9 means that human semaphor in protein 9 is essentially free of other proteins, lipids, sugars, or other substances that are naturally associated with it. Those skilled in the art can purify human semaphor in protein 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human semaphor in protein 9 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human semaphorin protein 9, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human semaphor in protein 9.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human semaphor in protein 9 of the present invention.
  • a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
  • such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1594 bases in length and its open reading frame 1028-1276 encodes 82 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide is 97% homologous to the human semaphor in protein. Sex, it can be deduced that the human semaphor in protein 9 has a similar structure and function of human semaphor in protein
  • the polynucleotide of the present invention may be in the form of MA or RNA.
  • DM forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) L ° / ⁇ Hybridization with a denaturant, such as 50 ° v / v) formamide, 0.1% calf serum / 0.1 ° /.
  • hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human semaphor in protein 9.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human semaphor in protein 9 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Q i agene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecuraar Cloning, A Labora tory Manua, Cold Harbor Harbora Tory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of human semaphor in protein 9 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human semaphor in protein 9 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Selected and synthesized by conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • Polynucleotide sequences of the gene of the present invention obtained as described above, or various DNA fragments can be used The standard method is determined by dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human semaphorin 9 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
  • a polynucleotide sequence encoding a human semaphorin protein 9 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors as are well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing DM sequences encoding human semaphorin protein 9 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
  • Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selecting transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture, and And green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • selectable marker genes to provide phenotypic traits for selecting transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture, and And green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human semaphor in protein 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • Drosophila S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant human semaphor in protein 9 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
  • FIG. 1 is a comparison diagram of amino acid sequence homology between the inventor's semaphor in protein 9 and the human semaphor in protein.
  • the upper sequence is human semaphor in protein 9 and the lower sequence is human semaphor in protein.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • FIG. 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human semaphor in protein 9 isolated.
  • 9kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 1110f 03 was new DNA.
  • the inserted cDNA fragment contained in this clone was determined in both directions by synthesizing a series of primers.
  • the results showed that the full-length cDNA contained in the 1110f 03 clone was 1594bp (as shown in Seq ID NO: 1), and there was a 249bp open reading frame (0RF) from 1028bp to 1276bp, encoding a new protein (such as Seq ID NO: 2).
  • This clone pBS-1110f 03 and encoded the protein as human semaphor in protein 9.
  • Example 2 Homologous search of cDNA clones
  • the sequence of the human semaphorin protein 9 of the present invention and the protein sequence encoded by the same are used by the Blas t program (Basiclocal Alignment search tool) [Altschul, SF et al.
  • Example 3 Cloning of a gene encoding human semaphorin protein 9 by RT-PCR
  • CDNA was synthesized using fetal brain cell total RNA as a template and oligo-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Primerl 5'- GCTTGGCTGGCTCAGGCCAGATCA —3, (SEQ ID NO: 3)
  • Primer2 5,-TTGAGACAAGAAGAAGTTTTTCAC -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l of KC1, 10 mmol / L in a 50 ⁇ l reaction volume
  • Tris-Cl (pH 8.5), 1.5 mmol / L MgCl 2) 200 mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1594 bp shown in SEQ ID NO: 1.
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25raM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • Pr imer3 5'-CCCCATATGATGCGAACCACCAAGGAGTTCCCA-3 '(Seq ID No: 5)
  • Pr imer4 5'-CATGGATCCTTAGTACATTCTTTTACTACACAT-3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and BamHI digestion sites, respectively Points, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • the pBS-1110f 03 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-1110f 03 plasmid, Primer-3 and Primer-4 primers were 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 rain, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid P ET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 M g / ml), positive clones were selected by colony PCR method and sequenced. A positive clone (PET-1110f03) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host bacteria BL21 (pET-1110f 03) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L , Continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. Chromatography was performed using an affinity chromatography column His s. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag). The purified target protein human semaphor in protein 9 was obtained.
  • the following peptides specific for human semaphorin protein 9 were synthesized using a peptide synthesizer (product of PE company): -I le-C00 H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Rabbits were immunized with 4 mg of the hemocyanin polymorphic complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with 15 ⁇ g / ml bovine serum albumin polypeptide complex was used as an ELISA to determine the antibody titer in rabbit serum.
  • Total protein A-Septiarose was isolated from antibody-positive rabbit serum IgG.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human semaphor in protein 9.
  • Example 7 Use of a polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this example is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps to hybridize the fixed polynucleotide sample to the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher intensity membrane washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention;
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the spot imprint method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements Region for homology comparison, if the homology with non-target molecular region is greater than 85% or more than 15 Two consecutive bases are completely the same, the primary probe should generally not be used;
  • Probe l which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • the polypeptide of the present invention, as well as its antagonists, agonists and inhibitors, can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Semaphor in gene family proteins serve as growth cone guidance signals. Studies have shown that a variety of molecules in members of the semaphor in protein family can provide specific local signals for areas that cannot reach the growth cone. Semaphor in protein may be recognized by specific neurons as repulsive signals, and may also participate in the differentiation of other organs and tissues. In vivo, abnormal expression of Semaphor in protein can affect the development of the nervous system, cause the occurrence of neurological malformations or / and functional defects, and lead to the occurrence of related diseases.
  • the polypeptide of the present invention and human Semaphor in protein are human semaphor in proteins, which contain characteristic sequences of the Semaphor in protein family. Both have similar biological functions.
  • the polypeptide functions as a growth cone guiding signal in the body and affects nerves. Systematic development and differentiation, whose abnormal expression can lead to the occurrence of neurological malformations and / or functional defects, which in turn leads to the occurrence of related diseases, including but not limited to: Common malformations of the nervous system:
  • Neural tube defects no cerebral malformations, spina bifida, spinal meningocele, hydrocephalous meningocele), hydrocephalus in / outside the brain, etc.
  • Functional defects of the nervous system include the brain, cerebellum, peripheral nervous system, etc. Functional dysfunction, causing related disorders
  • Frontal lobe dementia, personality changes (frontal frontal), strabismus, inability to write (back middle frontal gyrus), motor aphasia (back lower frontal gyrus), loss of smell (bottom of frontal lobe), limb paralysis, twitch
  • Parietal lobe sensory disturbance (central gyrus), dyslexia (left corner gyrus), body image disorder (right side)
  • Temporal lobe Hookback attack (anterior temporal lobe), sensory / amnestic aphasia (left temporal lobe), hearing impairment (rear superior temporal gyrus), etc.
  • Occipital lobe hemianopia, hallucinations, visual disagreement, etc.
  • V. Limbic system emotional symptoms, memory loss, disturbance of consciousness, hallucinations, etc.
  • the peripheral nervous system includes: 12 pairs of brain nerves, 31 pairs of spinal nerves, autonomic nerves (sympathetic and parasympathetic), Its dysfunction can lead to the occurrence of related diseases or clinical symptoms, including but not limited to:
  • olfactory nerve Loss of olfactory taste (olfactory nerve), visual impairment and / or visual field defect (optic nerve), ophthalmoplegia, diplopia, changes in pupil size / reflexes (eye movement nerve, pulley nerve, abductor nerve), facial sensory disorders, masticatory muscles Paralysis, neuroparalytic keratitis (trigeminal nerve), facial paralysis (facial nerve), deafness, tinnitus, vertigo, balance disorders, nystagmus (auditory nerve), hoarseness, dysphagia, loss of pharyngeal reflex (glossopharyngeal nerve, vagus nerve), shoulder Sagging, turning neck / shrugs, fatigue (collateral nerve), paralysis of the tongue muscle (sublingual nerve), etc .; 2. Spinal nerve dysfunction:
  • Paresthesia Inhibitory paresthesia (lack of sensation, hypoparesis), irritating paresthesia (allergy, paresthesia, pain), etc .;
  • Dyskinesias Central paralysis (monoplegia, hemiplegia, paraplegia), peripheral paralysis, etc. 3. Autonomic (sympathetic and parasympathetic) functional disorders:
  • Cardio-cerebral vascular system
  • arrhythmias such as atrial early, ventricular early, sinus tachycardia, supraventricular tachycardia, ventricular tachycardia, atrial flutter, atrial fibrillation, sinus bradycardia, sinus arrest, sick sinus syndrome, indoor conduction block, etc .;
  • CAD angina pectoris, myocardial infarction, cardiovascular neurosis, acute heart failure, chronic heart failure, HBP, neurogenic orthostatic hypotension, syncope, cerebrovascular accident, hypotension shock, etc .;
  • Pulmonary edema respiratory muscle paralysis, respiratory failure, bronchial asthma, etc .
  • Nausea vomiting, flatulence, gastrointestinal pain, biliary pain, renal colic, gastrointestinal obstruction, urinary tract obstruction, acute obstructive cholangitis, acute pancreatitis, chronic pancreatitis, etc .;
  • Reflux esophagitis chronic gastritis, peptic ulcer, non-ulcer dyspepsia, neurodiarrhea, etc.
  • gastrointestinal neurosis globus, psychogenic vomiting, nervous gas, anorexia nervosa, irritable bowel Syndrome, etc.
  • Muscle motor system
  • dysmenorrhea dysmenorrhea, glaucoma, visual impairment and ischemic necrosis of multiple organs, such as renal necrosis (renal failure), liver necrosis, intestinal necrosis, etc .;
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used for the treatment of various diseases, such as neurological malformations and neurological dysfunction diseases.
  • the invention also provides screening compounds to identify increasing (agonist) or repressing (antagonist) people
  • Method for the preparation of semaphor in protein 9. Agonists enhance human semaphor in protein 9 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing human semaphor in protein 9 can be cultured with labeled human semaphor in protein 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human semaphor in protein 9 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human semaphor in protein 9 can bind to human semaphor in protein 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human semaphor in protein 9 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human semaphor in protein 9 and its receptor.
  • Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human semaphor in protein 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the human semaphor in 9 molecule should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human semaphor in protein 9 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human semaphor in protein 9 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to human semaphor in protein 9 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta cells Hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that combine human constant regions with non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0
  • Existing techniques for producing single-chain antibodies can also be used to produce single chain antibodies against human semaphorin protein 9.
  • Antibodies against human semaphorin 9 can be used in immunohistochemical techniques to detect human semaphorin 9 in biopsy specimens.
  • Monoclonal antibodies that bind to human semaphorin 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human semaphorin protein 9 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human semaphorin 9 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human semaphorin 9.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human semaphorin 9.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human semaphorin 9 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the levels of human semaphorin 9 detected in the test can be used to explain the importance of human semaphorin 9 in various diseases and to diagnose diseases in which human semaphorin 9 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
  • human semaphorin protein 9 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human semaphorin protein 9.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human semaphorin 9 to inhibit endogenous human semaphorin 9 activity.
  • a variant human semaphorin protein 9 may be a shortened human semaphorin protein 9 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human semaphorin protein 9.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human semaphorin protein 9 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding human semaphorin protein 9 can be found in existing literature. (Sambrook, et al.).
  • a recombinant polynucleotide encoding human semaphor in protein 9 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DM
  • ribozymes that inhibit human semaphor in protein 9 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA and ribozymes can be obtained using any of the existing RNA or DNA synthesis techniques, such as solid-phase phosphoramidation synthesis of oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence is integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding human semaphor in protein 9 can be used for the diagnosis of diseases related to human semaphor in protein 9.
  • a polynucleotide encoding human semaphor in protein 9 can be used to detect the expression of human semaphor in protein 9 or the abnormal expression of human semaphor in protein 9 in a disease state.
  • a DNA sequence encoding human semaphorin protein 9 can be used to hybridize biopsy specimens to determine the expression of human semaphorin protein 9.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissue.
  • Human semaphor in protein 9 specific primers can also be used to detect human semaphor in protein 9 transcripts by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
  • RT-PCR RNA-polymerase chain reaction
  • Detection of mutations in the human semaphor in protein 9 gene can also be used to diagnose human semaphor in protein 9-related diseases.
  • Human semaphor in 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human semaphor in 9 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, the mutation may affect the expression of the protein, so the Nor thern blotting and Western blotting can be used to indirectly determine whether there is a mutation in the gene.
  • sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • Only few chromosome markers based on actual sequence data (repeat polymorphisms) are available For marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian
  • the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceuticals or biological products, which instructions reflect production, use, or sales Of the government's regulatory agency permits its administration on humans.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human semaphor in protein 9 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human seraaphor in protein 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une sémaphorine humaine 9, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de malformations du système nerveux et de maladies liées au dysfonctionnement du système nerveux. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la sémaphorine humaine 9.
PCT/CN2001/000995 2000-06-19 2001-06-18 Nouveau polypeptide, semaphorine humaine 9, et polynucleotide codant ce polypeptide WO2002004505A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU95388/01A AU9538801A (en) 2000-06-19 2001-06-18 A novel polypeptide - human semaphorin protein 9 and a polynucleotide encoding the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116602.6 2000-06-19
CN 00116602 CN1329060A (zh) 2000-06-19 2000-06-19 一种新的多肽——人semaphorin蛋白9和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002004505A1 true WO2002004505A1 (fr) 2002-01-17

Family

ID=4586006

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000995 WO2002004505A1 (fr) 2000-06-19 2001-06-18 Nouveau polypeptide, semaphorine humaine 9, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1329060A (fr)
AU (1) AU9538801A (fr)
WO (1) WO2002004505A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004166690A (ja) * 2002-11-01 2004-06-17 Arita Junichi 抗酸化作用を有する亜鉛含有物

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101754433B1 (ko) * 2009-05-08 2017-07-05 백시넥스 인코포레이티드 항-ｃｄ100 항체 및 이의 사용 방법
CN110105452A (zh) 2011-10-11 2019-08-09 瓦西尼斯公司 臂板蛋白-4d结合分子用于调节血脑屏障渗透性的用途

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0933425A1 (fr) * 1998-01-30 1999-08-04 Smithkline Beecham Plc Polypeptides et polynucléotides de la familie du semaphorin
WO1999045114A2 (fr) * 1998-03-03 1999-09-10 Zymogenetics, Inc. Semaphorine humaine zsmf-7
WO2000031252A1 (fr) * 1998-11-26 2000-06-02 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Semaphorine humaine 6a-1(sema6a-1), gene implique dans des mecanismes de developpement et de regeneration neuronaux pendant l'apoptose, et son utilisation en tant que cible potentielle de medicaments

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0933425A1 (fr) * 1998-01-30 1999-08-04 Smithkline Beecham Plc Polypeptides et polynucléotides de la familie du semaphorin
WO1999045114A2 (fr) * 1998-03-03 1999-09-10 Zymogenetics, Inc. Semaphorine humaine zsmf-7
WO2000031252A1 (fr) * 1998-11-26 2000-06-02 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Semaphorine humaine 6a-1(sema6a-1), gene implique dans des mecanismes de developpement et de regeneration neuronaux pendant l'apoptose, et son utilisation en tant que cible potentielle de medicaments

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004166690A (ja) * 2002-11-01 2004-06-17 Arita Junichi 抗酸化作用を有する亜鉛含有物

Also Published As

Publication number Publication date
AU9538801A (en) 2002-01-21
CN1329060A (zh) 2002-01-02

Similar Documents

Publication Publication Date Title
WO2002051867A1 (fr) Nouveau facteur 8.8 polypeptidique liberant de la corticotrophine et polynucleotide codant ledit polypeptide
WO2002004505A1 (fr) Nouveau polypeptide, semaphorine humaine 9, et polynucleotide codant ce polypeptide
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2002002617A1 (fr) Nouveau polypeptide, sous-unite beta 10 d'adductine humaine, et polynucleotide codant ce polypeptide
WO2002038604A1 (fr) Nouveau polypeptide, proteine associee a la racine ciliaire 45.98, et polynucleotide codant ce polypeptide
WO2002004633A1 (fr) Nouveau polypeptide, proteine humaine de fasciculation et d'extension 12.87, et polynucleotide codant ce polypeptide
WO2002012311A1 (fr) Nouveau polypeptide, proteine humaine 16.61 de fasciculation et d'extension, et polynucleotide codant ce polypeptide
WO2001074876A1 (fr) Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide
WO2002012491A1 (fr) Nouveau polypeptide, proteine humaine notch 24.64, et polynucleotide codant ce polypeptide
WO2002020606A1 (fr) Nouveau polypeptide, la proteine humaine 38.39 liee aux defauts d'audition, et polynucleotide codant pour elle
WO2002006333A1 (fr) Nouveau polypeptide, proteine vn1-18 du recepteur de la pheromone, et polynucleotide codant ce polypeptide
WO2001075085A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide
WO2001055417A1 (fr) Nouveau polypeptide, proteine a f-box 65, et polynucleotide codant pour ce polypeptide
WO2001070956A1 (fr) Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001072793A1 (fr) Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide
WO2001049734A1 (fr) Nouveau polypeptide, proteine plp 10, et polynucleotide codant pour ce polypeptide
WO2001055372A1 (fr) Nouveau polypeptide, proteine humaine tnfr/ngfr 10, et polynucleotide codant pour ce polypeptide
WO2002038603A1 (fr) Nouveau polypeptide, grande proteine humaine 1225-13.87, et polynucleotide codant ce polypeptide
WO2001094399A1 (fr) Nouveau polypeptide, proteine humaine 11.66 associee au synaptosome, et polynucleotide codant pour ce polypeptide
WO2002040526A1 (fr) Nouveau polypeptide, proteine 18.70 exprimee de maniere specifique dans le cerveau chez l'homme, et polynucleotide codant ledit polypeptide
WO2002042453A1 (fr) Nouveau polypeptide, appele grosse proteine humaine 0767-19.36 et polynucleotide codant ce polypeptide
WO2001081389A1 (fr) Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier d'une proteine ribosomale l19, et polynucleotide codant pour ce polypeptide
WO2001081593A1 (fr) Nouveau polypeptide, proteine humaine 20 contenant un domaine a structure de boite de paires appariees, et polynucleotide codant pour ce polypeptide
WO2001079436A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 10, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP