WO2002004633A1 - Nouveau polypeptide, proteine humaine de fasciculation et d'extension 12.87, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, proteine humaine de fasciculation et d'extension 12.87, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2002004633A1 WO2002004633A1 PCT/CN2001/001023 CN0101023W WO0204633A1 WO 2002004633 A1 WO2002004633 A1 WO 2002004633A1 CN 0101023 W CN0101023 W CN 0101023W WO 0204633 A1 WO0204633 A1 WO 0204633A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- human
- protein
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human bundle and elongation protein 12.87, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
- axons In the nervous system, axons often pass through different extracellular environments to reach their destination. Most axons grow along other axons, and the concentration of different axons in the nerve bundle is likely to play an important role in the tissues of the nervous system. Analysis of mutants of nematode dyskinesia revealed a set of genes that, when mutated, affect the growth of axons in the nerve fiber bundles, but axons in the matrix without surrounding nerve fibers are not affected.
- unc-34, unc-71, unc76 mutations in this group of proteins can cause two types of defects: many axons in the dorsal / abdominal nerve fiber bundles cannot stretch to normal lengths; in addition, Many axons also fail to stay in the nerve fiber bundles that should normally be present.
- the two possible functions of mic-76 are: first, the unc-76 protein may play an important role in the formation and / or maintenance of nerve fiber bundles through interaction with cell surface adhesion proteins, axon membranes, and cytoskeleton; Second, the unc-76 protein may transmit signals from the cell surface to the inside of the cell to regulate the axon extension and adhesion. [Proc. Natl. Acad. Sci. USA Vol. 94, pp. 3414-3419, April 1997]
- FEZl human unc-76 human FEZl protein
- FEZl (bundling and elongation protein ⁇ -1). It consists of 393 amino acid residues. It has a high content of arginine / glutamic acid, its N-terminus is highly acidified, and some sites contain amphoteric helixes.
- FEZ1 has no signal sequence and no transmembrane region. This property implies that it exists inside the cell.
- FEZ1 is highly expressed in both adult mouse brain and mouse embryo. FEZ1 can interact with the N-terminal variable region of the PKCZ zeta subunit, and can also interact weakly with P ⁇ . This shows that FEZ1 is one of the substrates of PKC.
- FEZ1 plays a key role in axon guidance in mammals through PKC zeta interactions.
- Gene chip analysis revealed that in the bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblast , Growth factor stimulation, 1024NT, scar into fc growth factor stimulation, 1013HT, scar into fc stimulation without growth factor stimulation, 1013HC, bladder cancer plant cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, Spleen, forefront In adenocarcinoma, jejunum adenocarcinoma, and cardia cancer, the expression profile of the polypeptide of the present invention is very similar to the expression profile of the human FEZ1 protein, so the functions of the two may be similar.
- the present invention is named human bundling and elongin 12.87.
- the human bunching and elongating protein 12.87 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art Human bunching and elongating proteins 12.87 proteins involved in these processes, in particular the amino acid sequence of this protein is identified.
- Newcomer bundling and elongation protein 12. 87 The isolation of protein-coding genes also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human bunching and elongating protein 12.87.
- Another object of the present invention is to provide a method for producing human bundles and elongins 12.87.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of one-to-one bundling and elongation protein 12.87 of the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human bundling and elongin 12.87.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 295-648 in SEQ ID NO: 1; and (b) a sequence having 1-2251 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human bundling and elongation protein activity, including the use of a polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human bunching and elongation 12.87 protein, comprising detecting mutations in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human bundling and elongation protein 12.87.
- Nucleic acid sequence means an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and 'may also refer to a genome or a synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, which The amino acid substituted in the amino acid has a structural or chemical property similar to that of the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with human bundling and elongation protein 12.87, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human bunching and elongating proteins 12.87.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human bundling and elongin 12.87 when combined with human bundling and elongin 12.87.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human bunching and elongating proteins 12.87.
- Regular refers to changes in the function of human bundling and elongin 12.87, including an increase or decrease in protein activity, changes in binding characteristics, and any other biological properties and functions of human bundling and elongation 12.87 Or changes in immune properties.
- Substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can use standard protein purification techniques to purify human bundling and elongating proteins 12.87 Basically pure human bundles and elongins 12.87 can produce a single main band on a non-reducing polyacrylamide gel. Human bundles and elongins 12.87 The purity of the polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and suppress Binding of a homologous sequence to a target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
- the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by Cluster's method or by methods known in the art such as Jotun He in. The percentage identity between nucleic acid sequences (He in J., (1990) Methods in emzumo logy 183: (625-645) 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to human bundling and elongating protein 12.87 epitopes.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of matter from its original environment (for example, Natural environment).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated human bundling and elongating protein 12.87 refers to human bundling and elongating protein 12.87 that is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated.
- Those skilled in the art can purify human bundling and elongation proteins using standard protein purification techniques 12.87.
- Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel.
- Human Bundles and Elongins 12. The purity of more than 87 can be analyzed by amino acid sequence.
- the present invention provides a novel polypeptide one-to-one bundling and elongation protein 12.87, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
- the invention also includes fragments, derivatives and analogs of human bunching and elongating protein 12.87.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human bundle and elongin 12.87 of the present invention.
- the fragments, organisms or the like of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify this polypeptide or protease sequence)
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2251 bases and its open reading frame of 295-648 encodes 17 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile with human FEZ1 protein, and it can be inferred that the human bundle and elongation protein 12.87 have similar functions to human FEZ1 protein.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50 ° / »(v / v) formamide, 0.1% calf serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) only in two sequences Crosses occur only when the identity between them is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide is identical to the mature polypeptide shown in SEQ ID NO: 2 Biological function and activity.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human bunching and elongating proteins 12.87.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human bunching and elongating protein 12.87 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sambrook, et al., Moleculiar Cloning, A Labora tory Manua l, Cod Spring Harbor Labora tory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of human bundled and elongated transcript levels of 12.87 (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2,000 nucleotides, and preferably within 1,000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of the human bundle and elongation 12.87 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- a method of amplifying DNA / RNA by PCR (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention.
- the RACE method RACE-rapid amplification of cDNA ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human bunching and elongation 12.87 coding sequence, and a recombinant technology to produce the polypeptide of the present invention. method.
- a polynucleotide sequence encoding human bunching and elongating protein 12.87 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human bunching and elongation protein 12.87 and suitable transcription / translation regulatory elements. These methods include in vitro recombinant DM technology, synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome junction for translation initiation Binding site and transcription terminator, etc. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
- Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on the promoter to enhance gene transcription.
- Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a human bunching and elongating protein 12.87 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (Method 12, using the procedure well known in the art.
- Alternative is MgC l 2.
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human bundling and elongating protein 12.87 (Scence, 1 984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. When the host cell has grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and The cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- FIG. 1 is a comparison diagram of gene chip expression profiles of the inventor bundled and extended protein 12.87 and human FEZ1 protein.
- the upper graph is a graph of the expression profile of human bunching and elongating protein 12.87, and the lower graph is the graph of the expression profile of human FEZ1 protein.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human bunching and elongating protein 12.87. 13kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
- RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Qu ik mRNA Iso lat ion Ki t
- the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the CDM sequence of one of the clones 0876gl2 was a new DM.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results showed that the 0876gl2 clone contained a full-length cDNA of 2251 bp (as shown in Seq ID N0: 1), and a 353 bp open reading frame (0RF) from 295 bp to 648 bp, encoding a new protein (such as Seq ID NO : Shown in 2).
- CDNA was synthesized using fetal brain total RM as a template and ol igo-dT as a primer for reverse transcription reaction.
- PCR amplification was performed with the following primers:
- Pr imerl 5,-ACTTGAGTATCTAAAGTTCTCTAT -3, (SEQ ID NO: 3)
- Pr imer 2 5'- ACGGAGTCTCACTCTGTCGCCCAA -3 '(SEQ ID NO: 4)
- Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 ⁇ l / L C1, 1 Oramol / L Tri s-CI, (pH 8.5.5), 1.5 mmol / L MgCl 2) 200 ⁇ mol / L in 50 ⁇ 1 reaction volume dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
- RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l_2251bp shown in SEQ ID NO: 1.
- Example 3 Northern Blot Analysis of Human Bundle and Extendin 12.87 Gene Expression:
- RNA extraction in one step [Ana l. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC- 5 x Denhardt, s solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC- 0.1% SDS at 55 ° C for 30 minutes. Then, Analysis and quantification using Phosphor Imager.
- Example 4 In vitro expression, isolation and purification of recombinant human bundling and elongation protein 12.87
- Primer3 5'-CCCCATATGATGGGATTATGTGTGGCTTTATTA-3 '(Seq ID No: 5)
- Primer4 5' -CATGGATCCTCATGAGGTCAGGAGTTCGAGAGC-3 '(Seq ID No: 6)
- the 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively.
- the coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively.
- the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
- PCR was performed using the pBS-0876gl2 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS- 0876gl2 plasmid, primers Pi'imer-3 and Pr imer-4, and! J is lOpmol, Advantage polymerase Mix
- Cycle parameters 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
- Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into Ca. bacillus DH5 ⁇ by the calcium chloride method.
- the LB plate with a final concentration of 3 was cultured overnight, and the positive clones were selected by colony PCR method and sequenced.
- the positive clones with the correct sequence (pET-0876gl2) were selected to transform the recombinant plasmid into the large intestine by the calcium chloride method BL21 (DE3) plySs (Novagen).
- the host strain BL21 (pET-0876gl2) was cultured at 37 ° C in logarithmic LB liquid medium containing kanamycin (final concentration 30 ⁇ g / ml). During the growth period, add IPTG to a final concentration of 1 ol / L, and continue to culture for 5 hours. Centrifuge to collect bacteria, sonicate, and collect the supernatant by centrifugation. And Columns His. Bind Quick Cartridge
- a peptide synthesizer (product of PE company) was used to synthesize the following human bundle and elongin-specific 12.87 peptides: NH2- Met- Gly- Leu- Cys- Vab Ala- Leu- Leu- Thr- lie- Phe- Ser- lie- Ser- Thr- COOH (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method Acid sequence or a homologous polynucleotide sequence thereof.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragment selected from the polynucleotide SEQ ID NO: 1 of the present invention for use as a hybridization probe shall be Following the following principles and several aspects to consider:
- the preferred range of probe size is 18-50 nucleotides
- GC content is 30% -70 ° /. If it exceeds, non-specific hybridization increases;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that it can be used in the following experimental steps
- the film was washed with high-strength conditions and strength conditions, respectively.
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared after the collection solutions of the first peak are combined.
- X-ray autoradiography -70 ° C
- X-ray autoradiography press time depends on the radioactivity of the hybrid spot
- Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. Chai, A., Sha lom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and the samples were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between the points is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic instrument. After elution, the DM was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) by one-step method, and the mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen).
- Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5--triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino-propargyl- 2 '-deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled mRM, a specific tissue (or stimulated cell line) of the body, and purified the probe to prepare a probe.
- Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5--triphate coupled to Cy3 f l
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line, thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar formation fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, Cardiac cancer. Draw a graph based on these 18 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profile of human bundle and elongation protein 12.87 and human FEZ1 according to the present invention are very similar. Industrial applicability
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
- Human FEZ1 protein has two functions: first, it plays an important role in the formation and / or maintenance of nerve fiber bundles through interaction with cell surface adhesion proteins, axon membranes, and cytoskeleton; etc. The cell surface is passed inside the cell to regulate the axon extension and adhesion. Abnormal expression of human FEZ1 protein in vivo can affect the formation and / or maintenance of nerve fiber bundles, and then lead to the occurrence of related diseases.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human FEZ1 protein, and both have similar biological functions.
- the polypeptide of the present invention has an important role in the formation and / or maintenance of nerve fiber bundles in the body, and its abnormal expression can lead to the development of neurological malformations and / or dysfunctional diseases. These diseases include but are not limited to: Malformations: Neural tube defects (no cerebral malformations, spina bifida, spinal meningocele, hydrocephalous meningocele), clinical symptoms related to cerebral cortical dysfunction such as hydrocephalus in / outside the brain: 1.
- Frontal lobe dementia Personality changes (frontal frontal), strabismus, inability to write (back middle frontal gyrus), motor aphasia (back lower frontal gyrus), loss of smell (bottom of frontal lobe), limb paralysis, convulsions (central frontal gyrus), etc. ;
- Parietal lobe sensory disturbance (central posterior gyrus), dyslexia (left corner gyrus), body image disorder (right parietal lobe), etc .;
- Temporal lobe Hookback attack (anterior temporal lobe), sensory / amnestic aphasia (left temporal lobe), hearing impairment (rear superior temporal gyrus), etc.
- Occipital lobe hemianopia, hallucinations, visual disagreement, etc.
- V. Limbic system emotional symptoms, memory loss, disturbance of consciousness, hallucinations, etc .; disorders related to peripheral nervous system dysfunction
- Peripheral nervous system includes: 12 pairs of brain nerves, 31 pairs of spinal nerves, and autonomic nerves (sympathetic and parasympathetic). Its functional disorders can lead to the occurrence of related diseases or / and clinical symptoms. These diseases or / and clinical symptoms include, but are not limited to:
- olfactory nerve Loss of olfactory taste (olfactory nerve), visual impairment and / or visual field defect (optic nerve), ophthalmoplegia, diplopia, changes in pupil size / reflexes (eye movement nerve, pulley nerve, abductor nerve), facial sensory disorders, masticatory muscles Paralysis, neuroparalytic keratitis (trigeminal nerve), facial paralysis (facial nerve), deafness, tinnitus, vertigo, balance disorder, nystagmus (auditory nerve), hoarseness, swallowing Difficulties, disappearance of pharyngeal reflex (glossopharyngeal nerve, vagus nerve), drooping shoulders, neck / shrug fatigue (collateral nerve), paralysis of tongue muscle (hypoglossal nerve), etc .; 2. Spinal nerve dysfunction:
- Paresthesia Inhibitory paresthesia (lack of sensation, hypoparesis), irritating paresthesia (allergy, paresthesia, pain), etc .;
- Dyskinesias Central paralysis (monoplegia, hemiplegia, paraplegia), peripheral paralysis, etc. 3. Autonomic (sympathetic and parasympathetic) functional disorders:
- Cardio-cerebral vascular system
- arrhythmias such as early atrial, early ventricular, sinus tachycardia, supraventricular tachycardia, ventricular tachycardia, atrial flutter, atrial fibrillation, sinus bradycardia, sinus arrest,
- Sinus syndrome indoor conduction block, etc .
- CAD cardiac pain, myocardial infarction, cardiovascular neurosis, acute heart failure, chronic heart failure, HBP, neurogenic orthostatic hypotension, syncope, cerebrovascular accident, hypotension shock, etc .;
- Pulmonary edema respiratory muscle paralysis, respiratory failure, bronchial asthma, etc .
- Reflux esophagitis chronic gastritis, peptic ulcer, non-ulcer dyspepsia, neurodiarrhea, etc.
- gastrointestinal neurosis globus, psychogenic vomiting, nervous gas, anorexia nervosa, irritable bowel Syndrome, etc.
- Diabetes hypoglycemia, lipidemia, hyperlipoproteinemia, obesity, pheochromocytoma, etc .;
- the polypeptide of the present invention and the antagonist, agonist and inhibitor of the polypeptide can be directly used for the treatment of various diseases, such as developmental disorders of the nervous system and / or dysfunctional diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human bundling and elongation protein 12.87.
- Agonists enhance human bundling and elongation.
- 12.87 Stimulates biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human bundling and elongation protein 12.87 can be cultured together with labeled human bundling and elongation protein 12.87 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human bundling and elongin 12.87 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human bunching and elongin 12.87 can bind to human bunching and elongin 12.87 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.
- human bundles and elongin 12.87 can be added to bioanalytical assays by determining the effect of compounds on the interaction between human bundles and elongin 12.87 and their receptors Determine if the compound is an antagonist.
- Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
- Polypeptide molecules capable of binding to human bundles and elongins 12.87 can be obtained by screening random peptide libraries composed of various possible combinations of amino acids bound to the solid phase. When screening, human bundles and elongin 12.87 molecules should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against human bunching and elongating protein 12.87 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- polyclonal antibodies can be obtained by human bunching and elongating protein 12.87 direct injection in immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on.
- Techniques for preparing monoclonal antibodies to human bundle and elongation protein 12.87 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta -Cell hybridoma technology, EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pa t No. 4946778) can also be used to produce single chain antibodies against human bunching and elongating protein 12.87. Antibodies against human bundling and elongin 12.87 can be used in immunohistochemistry to detect human bundling and elongin 12.87 in biopsy specimens.
- Monoclonal antibodies that bind to human bunching and elongating protein 12.87 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body. Such as human bundling and elongating proteins 12.87 High-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human bunching and elongating protein 12.87 cell.
- a thiol cross-linking agent such as SPDP
- the antibodies of the present invention can be used to treat or prevent diseases associated with human bundling and elongation protein 12.87. Administration of appropriate doses of the antibody can stimulate or block the production or activity of human bundling and elongation protein 12.87.
- the invention also relates to a diagnostic test method for the quantitative and localized detection of 12.87 levels of human bundling and elongin.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the levels of human bundling and elongin 12.87 detected in the test can be used to explain the importance of human bundling and elongin 12.87 in various diseases and to diagnose diseases where human bundling and elongin 12.87 play a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human bundling and elongating protein 12.87 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormalities in cell proliferation, development, or metabolism caused by the lack of expression or abnormal / inactive expression of human bunching and elongation 12.87.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human bunching and elongating protein 12.87 to inhibit endogenous human bunching and elongating protein 12.87 activity.
- a mutated human bundling and elongating protein 12.87 may be a shortened human bundling and elongating protein 12.87 lacking a signaling functional domain.
- the recombinant gene therapy vector can be used for treating diseases caused by human bundles and elongation protein 12.87 expression or activity abnormalities.
- Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer a polynucleotide encoding the human east and elongation protein 12.87 into cells.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human bunching and elongating protein 12.87 can be found in the literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human bunching and elongating protein 12.87 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- Oligonucleotides including antisense MA and DNA
- ribozymes that inhibit human bunching and elongation 12.87 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes a specific MA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human bunching and elongating protein 12.87 can be used for diagnosis of diseases related to human bunching and elongating protein 12.87.
- the polynucleotide encoding human bunching and elongating protein 12.87 can be used to detect the expression of human bunching and elongating protein 12.87 or abnormal expression of human bunching and elongating protein 12.87 in a disease state.
- the DNA sequence encoding human bunching and elongation protein 12.87 can be used to hybridize biopsy specimens to determine the expression status of human bunching and elongation protein 12.87.
- Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human bunching and elongation 12.87 specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human bunching and elongation 12.87 transcripts.
- RT-PCR RNA-polymerase chain reaction
- Human bunching and elongation 12.87 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human bunching and elongation 12.87 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- Only few chromosome markers based on actual sequence data (repeat polymorphisms) are available For marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Wetch Medi Library). Linkage analysis can then be used to determine the relationship between genes and diseases that are mapped to chromosomal regions.
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceuticals or biological products, which instructions reflect production, use Or a government agency that sells it allows it to be administered to humans.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human bundling and elongin 12. 87 is administered in an amount effective to treat and / or prevent a particular indication.
- the amount and range of human bundling and elongin 12.87 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU95396/01A AU9539601A (en) | 2000-06-21 | 2001-06-19 | A novel polypeptide, a human fascicular and elongation protein 12.87 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00116641.7 | 2000-06-21 | ||
CN 00116641 CN1329074A (zh) | 2000-06-21 | 2000-06-21 | 一种新的多肽——人成束和延伸蛋白12.87和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2002004633A1 true WO2002004633A1 (fr) | 2002-01-17 |
Family
ID=4586043
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/001023 WO2002004633A1 (fr) | 2000-06-21 | 2001-06-19 | Nouveau polypeptide, proteine humaine de fasciculation et d'extension 12.87, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1329074A (fr) |
AU (1) | AU9539601A (fr) |
WO (1) | WO2002004633A1 (fr) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2010044365A1 (fr) | 2008-10-17 | 2010-04-22 | 国立大学法人東京海洋大学 | Trousse de réactifs pour une mesure de fraîcheur |
-
2000
- 2000-06-21 CN CN 00116641 patent/CN1329074A/zh active Pending
-
2001
- 2001-06-19 AU AU95396/01A patent/AU9539601A/en not_active Abandoned
- 2001-06-19 WO PCT/CN2001/001023 patent/WO2002004633A1/fr active Application Filing
Non-Patent Citations (5)
Title |
---|
DATABASE GENBANK [online] 28 January 2000 (2000-01-28), Database accession no. AC007216 * |
DATABASE GENBANK [online] 3 February 2000 (2000-02-03), Database accession no. AC004741 * |
DATABASE GENBANK [online] 31 May 1998 (1998-05-31), Database accession no. AC004778 * |
DATABASE GENBANK [online] 5 December 1998 (1998-12-05), Database accession no. AC006139 * |
DATABASE GENBANK [online] 6 June 1998 (1998-06-06), Database accession no. AC002090 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2010044365A1 (fr) | 2008-10-17 | 2010-04-22 | 国立大学法人東京海洋大学 | Trousse de réactifs pour une mesure de fraîcheur |
Also Published As
Publication number | Publication date |
---|---|
CN1329074A (zh) | 2002-01-02 |
AU9539601A (en) | 2002-01-21 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002020795A1 (fr) | Nouveau polypeptide, hexokinase proteine 9.68, et polynucleotide codant ce polypeptide | |
WO2002004633A1 (fr) | Nouveau polypeptide, proteine humaine de fasciculation et d'extension 12.87, et polynucleotide codant ce polypeptide | |
WO2002004505A1 (fr) | Nouveau polypeptide, semaphorine humaine 9, et polynucleotide codant ce polypeptide | |
WO2002012311A1 (fr) | Nouveau polypeptide, proteine humaine 16.61 de fasciculation et d'extension, et polynucleotide codant ce polypeptide | |
WO2002012491A1 (fr) | Nouveau polypeptide, proteine humaine notch 24.64, et polynucleotide codant ce polypeptide | |
WO2002012297A1 (fr) | Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide | |
WO2002012320A1 (fr) | Nouveau polypeptide, proteine humaine 12 liee a tnfr/ngfr contenant un domaine de cytochrome c, et polynucleotide codant ce polypeptide | |
WO2001070956A1 (fr) | Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2002012457A1 (fr) | Nouveau polypeptide, proteine phosphatase humaine 13.31, et polynucleotide codant ce polypeptide | |
WO2001094399A1 (fr) | Nouveau polypeptide, proteine humaine 11.66 associee au synaptosome, et polynucleotide codant pour ce polypeptide | |
WO2001092315A1 (fr) | Nouveau polypeptide, proteine humaine d'epissage 10.56, et polynucleotide codant ce polypeptide | |
WO2002048356A1 (fr) | Nouveau polypeptide, proteine humaine formee de cytochromes 45, et polynucleotide codant ce polypeptide | |
WO2001074876A1 (fr) | Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2002026970A1 (fr) | Nouveau polypeptide, molecule d'adhesion neuronale humaine 11.44, et polynucleotide codant ce polypeptide | |
WO2002020590A1 (fr) | Nouveau polypeptide, sucre phosphotransferase phosphoenolpyruvate-dependante 33, et polynucleotide codant ce polypeptide | |
WO2002020779A1 (fr) | Nouveau polypeptide, proteine humaine plp 40.15, et polynucleotide codant ce polypeptide | |
WO2002000835A2 (fr) | Nouveau polypeptide, proteine de transcription humaine 23, et polynucleotide codant ce polypeptide | |
WO2002012319A1 (fr) | Nouveau polypeptide, pompe sodium-potassium humaine 14.85, et polynucleotide codant ce polypeptide | |
WO2002012321A1 (fr) | Nouveau polypeptide, nrd invertase humaine 10.01, et polynucleotide codant ce polypeptide | |
WO2002011511A1 (fr) | Nouveau polypeptide, modulateur negatif 11.66 de la proteine d'activation de la gtpase, et polynucleotide codant ce polypeptide | |
WO2002038604A1 (fr) | Nouveau polypeptide, proteine associee a la racine ciliaire 45.98, et polynucleotide codant ce polypeptide | |
WO2001092287A1 (fr) | Nouveau polypeptide, phosphatase acide 14, et polynucleotide codant ce polypeptide | |
WO2002048357A1 (fr) | Nouveau polypeptide, sous-unite du compose c0p9 humaine 37.62, et polynucleotide codant ce polypeptide | |
WO2002020580A1 (fr) | Nouveau polypeptide, proteine humaine 15 tnfr/ngfr contenant un domaine de cytochrome c, et polynucleotide codant ce polypeptide | |
WO2001087916A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s5-13, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |