WO2002020580A1 - Nouveau polypeptide, proteine humaine 15 tnfr/ngfr contenant un domaine de cytochrome c, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine 15 tnfr/ngfr contenant un domaine de cytochrome c, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002020580A1
WO2002020580A1 PCT/CN2001/001013 CN0101013W WO0220580A1 WO 2002020580 A1 WO2002020580 A1 WO 2002020580A1 CN 0101013 W CN0101013 W CN 0101013W WO 0220580 A1 WO0220580 A1 WO 0220580A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
domain
tnfr
protein
Prior art date
Application number
PCT/CN2001/001013
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU2001293639A priority Critical patent/AU2001293639A1/en
Publication of WO2002020580A1 publication Critical patent/WO2002020580A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70578—NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human TNFR / NGFR protein 15 containing a cytochrome C domain, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • Hydrophilic signal molecules include neurotransmitters, growth factors, cytokines, local chemical transmitters, and most hormones. They cannot pass through the plasma membrane and can only bind to receptors on the cell surface to form ligand-receptor complexes for signaling. divert. According to the mechanism of signal transduction and the types of receptor proteins, cell surface receptors can be divided into three types: (1) ion channel-coupled receptors; (2) ligase surface receptors; (3) with G proteins Coupling receptor.
  • nerve growth factor receptor proteins there are a large number of growth factor receptor proteins in the body, and these growth factor receptor proteins combine with various signal factors to correctly regulate various physiological responses in the body.
  • the nerve growth factor receptor and tumor necrosis factor receptor constitute an independent nerve growth factor receptor and tumor necrosis factor receptor (TNFR / NGFR) superfamily [Mallet S., Barclay AN, 1991, Immunol Today, 15: 220-223].
  • Nerve growth factor receptor proteins may regulate the signal response of nerve cells to nerve growth factors in the body to coordinate the metabolism of the nervous system and exert normal physiological functions; and tumor necrosis factor receptors in the body and its related signal factors such as The combination of tumor necrosis factor can effectively cause tumor cell response, promote tumor cell destruction, and inhibit infinite proliferation of tumor cells.
  • i-like proteins will lead to abnormal growth and development of the nervous system, abnormal proliferation of tissue cells and abnormal expression of proteins, which will cause various related diseases, such as various malignant tumors and cancers, and various nerves. Systemic disorders, various development disorders, etc.
  • cysteine-rich domain consisting of 110-160 amino acid residues.
  • This domain contains the following conserved consensus sequence fragments: CX (4, 6)-[FYH] -X (5, 10) -CX (0, 2) -CX (2, 3) -CX (7, 11) -CX (4, 6)-[DNEQSKP]-X (2)-C.
  • This domain can be divided into four different patterns.
  • the heme group is tightly bound to two conserved cysteine residues through a thioether bond.
  • the binding site contains a consensus sequence: C-CPWHF-CPWR-C-H-CFYW; the histidine in the sequence is one of the two central ligands of the heme iron.
  • This conserved sequence is an important structural region where the protein binds to iron ions to form a specific structure to complete the process of electron transfer and energy conversion. Mutations in this central region are likely to be the direct cause of the abnormal function of the protein, causing the protein to fail to complete various energy conversion processes normally, thereby causing various related diseases.
  • the novel human cytochrome C domain-containing TNFR / NGFR protein of the present invention also contains N-terminally conserved amino acid sequence fragments of the nerve growth factor receptor and tumor necrosis factor receptor superfamily and a conserved cytochrome C-conserved sequence fragment. Therefore, it is a new member of the human nerve growth factor receptor and tumor necrosis factor receptor superfamily, and has similar biological functions as other members of the family. It has similar biological functions in vivo with various malignant tumors and cancers, and various nerves. Systemic disorders, related to various developmental disorders.
  • the human cytochrome C domain-containing TNFR / NGFR protein 15 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. There has been a need to identify more human cytochrome C domain-containing TNFR / NGFR protein 15 proteins involved in these processes, and in particular the amino acid sequence of this protein.
  • the newcomer's cytochrome C domain-containing TNFR / NGFR protein 15 protein encoding gene isolation also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human cytochrome C domain-containing TNFR / NGFR protein 15.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a human cytochrome C domain-containing TNFR / NGFR protein 15.
  • Another object of the present invention is to provide a method for producing a human cytochrome C domain-containing TNFR / NGFR protein 15.
  • Another object of the present invention is to provide an antibody directed against a human cytochrome C domain-containing TNFR / NGFR protein 15 of the polypeptide of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the TNFR / NGFR protein 15 containing a cytochrome c domain of a polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human cytochrome C domain-containing TNFR / NGFR protein 15.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1 340-1 to 744 in SEQ ID NO: 1; and (b) a sequence having 1 in SEQ ID NO: 1 -21 35-bit sequences.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human cytochrome C domain-containing TNFR / NGFR protein 15 protein activity, which comprises utilizing a polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of a human cytochrome C domain-containing TNFR / NGFR protein 15 protein, which comprises detecting the polypeptide in a biological sample or It encodes a mutation in a polynucleotide sequence or detects the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the preparation of polypeptides and / or polynucleotides of the present invention for treating cancer, developmental or immune diseases, or other diseases caused by abnormal expression of human cytochrome C domain-containing TNFR / NGFR protein 15. Use of medicine.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when bound to a human cytochrome C domain-containing TNFR / NGFR protein 15, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to a human cytochrome C domain-containing TNFR / NGFR protein 15.
  • An "antagonist” or “inhibitor” refers to an organism that can block or regulate human cytochrome C domain-containing TNFR / NGFR protein 15 when combined with human cytochrome C domain-containing TNFR / NGFR protein 15.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human cytochrome C domain-containing TNFR / NGFR protein 15.
  • Regulation refers to changes in the function of human cytochrome C domain-containing TNFR / NGFR protein 15, including increased or decreased protein activity, changes in binding properties, and human cytochrome C domain-containing TNFR / NGFR protein 1 5 for any other biological, functional or immune change.
  • Substantially pure ' 1 means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human cytochrome C domain-containing TNFR using standard protein purification techniques.
  • / NGFR protein 15. Essentially pure human cytochrome C domain-containing TNFR / NGFR protein 15 produces a single main band on a non-reducing polyacrylamide gel. Human cytochrome C domain-containing TNFR / NGFR The purity of the protein 15 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad is on Wis.). The MEGALIGN program can compare two or more sequences (Higgins, DG and PM Sharp (1988) Gene 73: 237-244) according to different methods, such as the Cluster method. The distance between them arranges each group of sequences into clusters. Then the clusters are allocated in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of residues matching between sequence A and sequence ⁇ 1 00
  • the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the C l us ter method or using Methods known in the art, such as Jo tun He in, determine the percent identity between nucleic acid sequences (He in J., (1990) Me thods in emzumo l ogy 1 83: 625-645), "similarity" refers to the amino acid sequence Degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to human cytochrome C domain-containing TNFR / NGFR protein 15 epitopes.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human cytochrome C domain-containing TNFR / NGFR protein 15 refers to human cytochrome C domain-containing TNFR / NGFR protein 15 which is substantially free of other proteins and lipids naturally associated with it. , Sugar or other substances.
  • Those skilled in the art can use standard protein purification techniques to purify Human cytochrome C domain-containing TNFR / NGFR protein15.
  • Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel.
  • the purity of human cytochrome C domain-containing TNFR / NGFR protein 15 polypeptide can be analyzed by amino acid sequence analysis.
  • the present invention provides a new polypeptide, a human TNFR / NGFR protein 15 containing a cytochrome C domain, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptides of the invention may be glycosylated, or they may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives, and analogs of human TNFR / NGFR protein 15 containing a cytochrome C domain.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human cytochrome C domain-containing TNFR / NGFR protein 15 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) such a species in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 21 35 bases, and its open reading frame 1 340-1744 encodes 1 34 amino acids.
  • this polypeptide has a similar expression profile to the human cytochrome C domain-containing TNFR / NGFR protein. It can be inferred that the human cytochrome C domain-containing TNFR / NGFR protein 15 has human cells. The TNFR / NGFR protein of the pigment C domain functions similarly.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate human TNFR / NGFR proteins encoding cytochrome C domains
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human cytochrome C domain-containing TNFR / NGFR protein 15 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Qiagene).
  • the construction of cDM libraries is also a common method (Sarabrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) the determination of human TNFR / NGFR protein 15 containing cytochrome C domains The level of transcripts; (4) Detecting protein products expressed by genes by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human cytochrome C domain-containing TNFR / NGFR protein 15 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait.
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait.
  • a method of applying the PCR technique to amplify DM / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human cytochrome C domain-containing TNFR / NGFR protein 15 coding sequence, and produced by recombinant technology A method of a polypeptide according to the invention.
  • a polynucleotide sequence encoding a human cytochrome C domain-containing TNFR / NGFR protein 15 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing DM sequences encoding human cytochrome C domain-containing TNFR / NGFR protein 15 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, e. T. A. Mol. Molecular Cloning, a Labora tory Manua, Cold Labor Harbor tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide the synthesis of raRNA. Representative examples of these promoters are: the l ac or trp promoter of E.
  • coli the PL promoter of lambda phage
  • eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, and the early and late SV40 promoters Promoters, retroviral LTRs, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • Expression vectors also include ribosome binding sites and transcription terminators for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
  • Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancer of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancer and adenovirus enhancer on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture. And green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture.
  • GFP green fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human cytochrome C domain-containing TNFR / NGFR protein 15 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a polynucleotide containing the polynucleotide or the recombinant vector.
  • Genetically engineered host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes s melanoma cells, etc. .
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM may be in exponential growth phase were harvested after the treatment with (Method 12, using the procedure well known in the art.
  • Alternative is MgC l 2.
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human cytochrome C domain-containing TNFR / NGFR protein 15 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic bacteria, Ultrasonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion-exchange liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic bacteria, Ultrasonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion-exchange liquid chromatography (HPLC) and various other
  • Figure 1 is a comparison of gene chip expression profiles of human cytochrome C domain-containing TNFR / NGFR protein 15 and human cytochrome C domain-containing TNFR / NGFR protein.
  • the upper graph is a graph of the human cytochrome C domain-containing TNFR / NGFR protein 15 and the lower graph is the graph of the human cytochrome C domain-containing TNFR / NGFR protein.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human TNFR / NGFR protein 15 containing cytochrome C domain. 15kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
  • Example 1 Cloning of human cytochrome C domain-containing TNFR / NGFR protein 15
  • the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0060 ⁇ 2 was new DNA. Insert a cDNA fragment into the clone by synthesizing a series of primers Segments are measured in both directions. The results showed that, 0060 ⁇ 2 length cDNA clone is contained 2135bp (eg Seq IDN0: 1 shown), from 13 4 0bp a 405bp to 1744bp open reading frame (ORF), encoding a novel protein (e.g. Seq ID NO: 2).
  • a novel protein e.g. Seq ID NO: 2
  • Example 2 Cloning of a gene encoding human cytochrome C domain-containing TNFR / NGFR protein 15 by RT-PCR method Using fetal brain cell total RNA as a template and oligo-dT as a primer for reverse transcription reaction to synthesize cDNA. After purification of the kit, PCR amplification was performed with the following primers:
  • Primer 1 5'- ATACTGTCTTTGGTGAGGCATTGC -3 '(SEQ ID NO: 3)
  • Primer2 5'- CCCCTAAGCTTCGTCTTCTCGCAG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l / L KC1, 10mraol / L Tris-Cl, (pH8.5), 1.5mraol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol in a reaction volume of 50 ⁇ 1 Primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72. C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2135bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human cytochrome C domain-containing TNFR / NGFR protein 15 gene expression:
  • Jf20Mg RNA was electrophoresed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • the DNA probe used is the human cytochrome C domain-containing TNFR / NGFR protein 15 coding region sequence (1340bp to 1744bp) amplified by PCR as shown in FIG. 1.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ral) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25raM KH 2 P0 4 (pH7.4) -5 x SSC-5 x Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filters were placed in 1 x SSC-0.1% SDS at 55. C for 30 min. Phosphor Imager was then used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human cytochrome C domain-containing TNFR / NGFR protein 15 Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers was designed The sequence is as follows:
  • Primer3 5'-CATGCTAGCATGGGATTACAGGCACGAGCCACT-3 '(Seq ID No: 5)
  • Priraer4 5,-CATGGATCCTTATGTTCTTAAAGATGAAGCTCT-3, (Seq ID No: 6)
  • the 5' ends of these two primers contain Nhel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the target gene are followed, respectively.
  • the Nhel and BamHI restriction sites correspond to the selectivity on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. s 69865.3). Endonuclease site.
  • the PCR reaction was performed using the pBS-0060 ⁇ 2 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0060f 12 plasmid, primers? 1 ⁇ 1116: 1: -3 and? 1 ⁇ 1116; 1: -4 points and another!] Is 10 [1101, Advantage polymerase Mi (Clontech) 1 ⁇ 1.
  • Cycle parameters 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
  • Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5CC using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 ⁇ g / ml), positive clones were selected by colony PCR method and sequenced. A positive clone ( ⁇ ET-0060II) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host bacteria BL21 ( ⁇ -0060 ⁇ 2) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L. Continue incubation for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidine (6His-Tag). The purified human cytochrome C domain-containing TNFR / NGFR protein 15 was purified.
  • a peptide synthesizer (product of PE) was used to synthesize the following human cytochrome C domain-containing TNFR / NGFR protein 15-specific peptides:
  • NH2-Met-Gly-Leu-Gln-Ala-Arg-Ala-Thr-Ala-Pro-Gly-Gln-Vai-Ile-Tyr- C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method Acid sequence or a homologous polynucleotide sequence thereof.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention as hybridization probes should follow the following principles and several aspects to be considered: 1.
  • the preferred range of probe size is 18-50 nucleotides;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements for homology comparison of the regions, if the homology with the non-target molecular region is greater than 851 ⁇ 2 or there are more than 15 consecutive bases, the primary selection probe should generally not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance from the point is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Ol igotex raRNA Midi Ki t (purchased from Qi aGen).
  • the fluorescent reagent Cy3dUTP (5-Amino- propargyl_2'-deoxyur idine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissues, and the fluorescent reagent Cy5dUTP (5- Amino- propargyl — 2 '— deoxyuridine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • Cy3dUTP 5-Amino- propargyl_2'-deoxyur idine 5'-triphat
  • the probes from the above two tissues were hybridized with the chip in UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • UniHyb TM Hybridization Solution purchasedd from TeleChem
  • lx SSC 0.2% SDS
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line, thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar formation fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1 G13HC, bladder cancer plant cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma Cardiac cancer. Draw a graph based on these 18 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the human cytochrome C domain-containing TNFR / NGFR protein 15 and the human cytochrome C domain-containing TNFR / NGFR protein expression profile are very similar. Industrial applicability
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Nerve growth factor receptor and tumor necrosis factor receptor constitute a separate superfamily of nerve growth factor receptor and tumor necrosis factor receptor (TNFR / NGFR) [Ma l let S., Barclay AN, 1991 , Immuno l Today, 15: 220-223].
  • Nerve growth factor receptor proteins may regulate the signal response of nerve cells to nerve growth factors in the body to coordinate the metabolism of the nervous system and exert normal physiological functions; while tumor necrosis factor receptors and their related signal factors in the body For example, the combination of tumor necrosis factor can effectively cause tumor cell response, promote tumor cell destruction, and inhibit infinite proliferation of tumor cells.
  • the specific TNFR / NGFR family is rich in cysteine-rich domains as the central region of the active conformation of the receptor protein, and plays an important regulatory role in the normal function of the protein. Abnormal expression of such proteins will lead to the Abnormal growth and development, as well as abnormal proliferation of tissue cells and abnormal expression of proteins, cause a variety of related diseases, such as: various malignant tumors and cancers, various nervous system disorders, and various development disorders.
  • the abnormal expression of the human cytochrome C domain-containing TNFR / NGFR protein of the present invention will produce various diseases, especially various tumors, various nervous system disorders, various development disorders, etc. These diseases include but not limited to:
  • tumors gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, colon cancer , Malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, Tumors of the thymus and nasal sinuses, nasopharyngeal carcinoma, laryngeal carcinoma, tracheal tumors, pleural mesothelioma, fibroids, fibrosarcoma, lipoma, liposarcoma, leiomyoma, etc.
  • transient ischemic attack glioblastoma, meningiomas, neurofibromas, pituitary adenomas, intracranial granulose, Alzheimer's disease, Parkinson's disease, chorea, depression, Amnesia, Huntington's disease, epilepsy, migraine, dementia, multiple sclerosis, myasthenia gravis, spinal muscular atrophy, muscular pseudohypertrophy, Duchenne muscular dystrophy, tonic muscular dystrophy, myotonic , Bradykinesia, dystonia, neurofibromatosis, nodular sclerosis, cerebral triangione neuroangioma disease, ataxia capillary dilatation, schizophrenia, depression, paranoia, anxiety, obsessive-compulsive Symptoms, Phobia, Nerve Decay, Acute Myelitis, Spinal Compression, Trigeminal Neuralgia, Facial Paralysis, Bulbum Paralysis, Sciatica, Guillain-Barre Syndrome, Neural
  • These diseases include, but are not limited to, the following, such as: cleft palate, facial cleft lip, cervical sac, cervical fistula, lack of limbs, limb differentiation disorders, obstruction or stenosis of the digestive tract, ileal diverticulum, umbilical fistula, congenital umbilical Hernia, congenital aganglion-free giant colon, laryngotracheal stenosis or atresia, tracheoesophageal fistula, hyaline membrane disease, congenital pulmonary cyst, atelectasis, polycystic kidney, ectopic kidney, horse telluride, double ureter, umbilical Urinary fistula, crypto, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, abnormal separation of arterial trunk, aortic
  • Bone dysplasia Bone dysplasia, Langer-Giedion syndrome, funnel chest, gonad hypoplasia, congenital adrenal hyperplasia, upper urethra, short stature syndrome such as Conrad i syndrome and Danbo l tC los s syndrome, congenital Abnormal lens position, congenital palpebral fissure, retinal dysplasia, congenital optic nerve atrophy, congenital sensorineural hearing loss, cracked hand and foot, teratosis, Wi lli ams syndrome, A lag il le syndrome, Baywet Syndrome and so on.
  • stature syndrome such as Conrad i syndrome and Danbo l tC los s syndrome
  • congenital Abnormal lens position congenital palpebral fissure
  • retinal dysplasia congenital optic nerve atrophy
  • congenital sensorineural hearing loss congenital sensorineural hearing loss
  • cracked hand and foot teratosis
  • Wi lli ams syndrome A
  • Abnormal expression of the human cytochrome C domain-containing TNFR / NGFR protein 15 of the present invention will also cause certain hereditary, hematological and immune system diseases.
  • the present invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human cytochrome C domain-containing TNFR / NGFR protein 15.
  • Agonists increase human cytochrome C domain-containing TNFR / NGFR protein 15 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing human cytochrome C domain-containing TNFR / NGFR protein 15 and a labeled human cytochrome C domain-containing TNFR / NGFR protein 15 can be cultured in the presence of a drug. . The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human cytochrome C domain-containing TNFR / NGFR protein 15 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of human cytochrome C domain-containing TNFR / NGFR protein 15 can bind to human cytochrome C domain-containing TNFR / NGFR protein 15 and eliminate its function, or inhibit the production of the polypeptide, or with the polypeptide The active site binding prevents the polypeptide from performing biological functions.
  • human cytochrome C domain-containing TNFR / NGFR protein 15 can be added to a bioanalytical assay, and the compounds can be used to determine human cytochrome C domain-containing TNFR / NGFR protein 15 and its effects. The effects of interactions between humans to determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human cytochrome C domain-containing TNFR / NGFR protein 15 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, human TNFR / NGFR protein 15 molecules containing cytochrome C domains should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human cytochrome C domain-containing TNFR / NGFR protein 15 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by direct injection of human cytochrome C domain-containing TNFR / NGFR protein15 Obtained by immunizing animals (such as rabbits, mice, rats, etc.).
  • immunizing animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing human cytochrome C domain-containing TNFR / NGFR protein 15 monoclonal antibodies include, but are not limited to, hybridoma technology (Koh ler and Milstei n. Nature, 1975, 256: 495-497), three tumors Technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morr is on etal, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human TNFR / NGFR protein 1 5 containing cytochrome C domain.
  • Antibodies against human cytochrome C domain-containing TNFR / NGFR protein 15 can be used in immunohistochemical techniques to detect human cytochrome C domain-containing TNFR / NGFR protein 15 in biopsy specimens.
  • Monoclonal antibodies that bind to human cytochrome C domain-containing TNFR / NGFR protein 15 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human cytochrome C domain-containing TNFR / NGFR protein 15 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human TNFR containing cytochrome C domain / NGFR protein 15 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human cytochrome C domain-containing TNFR / NGFR protein 15.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human TNFR / NGFR protein 15 containing a cytochrome C domain.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting human cytochrome C domain-containing TNFR / NGFR protein 15 levels.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the levels of human cytochrome C domain-containing TNFR / NGFR protein 15 detected in the test can be used to explain the importance of human cytochrome C domain-containing TNFR / NGFR protein 15 in various diseases and for diagnosis Diseases in which human cytochrome C domain-containing TNFR / NGFR protein 15 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human cytochrome C domain-containing TNFR / NGFR protein 15 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human cytochrome C domain-containing TNFR / NGFR protein 15.
  • Reorganization Gene therapy vectors (such as viral vectors) can be designed to express mutated human cytochrome C domain-containing TNFR / NGFR protein 15 to inhibit endogenous human cytochrome C domain-containing TNFR / NGFR protein 15 active.
  • a variant human cytochrome C domain-containing TNFR / NGFR protein 1 5 may be a shortened human cytochrome C domain-containing TNFR / NGFR protein 15 without a signaling domain, although it may be related to downstream
  • the substrate binds but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human cytochrome C domain-containing TNFR / NGFR protein 15.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc.
  • a recombinant viral vector carrying a polynucleotide encoding a human cytochrome C domain-containing TNFR / NGFR protein 15 can be found in existing literature (Sambrook, etal.).
  • a recombinant polynucleotide encoding human cytochrome C domain-containing TNFR / NGFR protein 15 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human TNFR / NGFR protein 15 mRM containing cytochrome C domains are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically breaks down specific NAs. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphothioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human cytochrome C domain-containing TNFR / NGFR protein 15 can be used for the diagnosis of diseases related to human cytochrome C domain-containing TNFR / NGFR protein 15.
  • the polynucleotide encoding human cytochrome C domain-containing TNFR / NGFR protein 15 can be used to detect the expression of human cytochrome C domain-containing TNFR / NGFR protein 15 or human cytochrome C domain-containing disease states Abnormal Expression of TNFR / NGFR Protein 15.
  • a DNA sequence encoding human cytochrome C domain-containing TNFR / NGFR protein 15 can be used to hybridize biopsy specimens to determine the expression of human cytochrome C domain-containing TNFR / NGFR protein 15.
  • Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These technologies and methods are all mature technologies that are publicly available. Commercially available. Part or all of the polynucleotides of the present invention can be immobilized on a microarray as probes
  • MA chip also called “gene chip”
  • Human cytochrome C domain-containing TNFR / NGFR protein 15 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human cytochrome C domain-containing TNFR / NGFR protein 15 transcripts .
  • Human cytochrome C domain-containing TNFR / NGFR protein 15 mutant forms include point mutations, translocations, deletions, recombinations, and others compared to normal wild-type human cytochrome C domain-containing TNFR / NGFR protein 15 DM sequences Any exceptions etc. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine if genes and genes have been mapped to chromosomal regions Relationship between diseases.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase Figure resolution and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human cytochrome C domain-containing TNFR / NGFR protein 15 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human cytochrome C domain-containing TNFR / NGFR protein 15 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Toxicology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine 15 TNFR/NGFR contenant un domaine de cytochrome c, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine humaine 15 TNFR/NGFR contenant un domaine de cytochrome c.
PCT/CN2001/001013 2000-06-21 2001-06-19 Nouveau polypeptide, proteine humaine 15 tnfr/ngfr contenant un domaine de cytochrome c, et polynucleotide codant ce polypeptide WO2002020580A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001293639A AU2001293639A1 (en) 2000-06-21 2001-06-19 A novel polypeptide-human tnfr/ngfr protein 15 that contains cytochrome c structural domain and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116674.3 2000-06-21
CN00116674A CN1329086A (zh) 2000-06-21 2000-06-21 一种新的多肽——人含细胞色素c结构域的tnfr/ngfr蛋白15和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002020580A1 true WO2002020580A1 (fr) 2002-03-14

Family

ID=4586076

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001013 WO2002020580A1 (fr) 2000-06-21 2001-06-19 Nouveau polypeptide, proteine humaine 15 tnfr/ngfr contenant un domaine de cytochrome c, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1329086A (fr)
AU (1) AU2001293639A1 (fr)
WO (1) WO2002020580A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999066039A1 (fr) * 1998-06-12 1999-12-23 Astrazeneca Ab Proteine du type du recepteur du facteur de necrose tumorale et comportant un domaine d'apoptose
WO2000023572A1 (fr) * 1998-10-20 2000-04-27 Human Genome Sciences, Inc. Gene 12 lie au recepteur de tnf (tnfr)
WO2000034294A2 (fr) * 1998-12-11 2000-06-15 Bristol-Myers Squibb Company Homologue recepteur du facteur de necrose tumorale (trh1)

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999066039A1 (fr) * 1998-06-12 1999-12-23 Astrazeneca Ab Proteine du type du recepteur du facteur de necrose tumorale et comportant un domaine d'apoptose
WO2000023572A1 (fr) * 1998-10-20 2000-04-27 Human Genome Sciences, Inc. Gene 12 lie au recepteur de tnf (tnfr)
WO2000034294A2 (fr) * 1998-12-11 2000-06-15 Bristol-Myers Squibb Company Homologue recepteur du facteur de necrose tumorale (trh1)

Also Published As

Publication number Publication date
CN1329086A (zh) 2002-01-02
AU2001293639A1 (en) 2002-03-22

Similar Documents

Publication Publication Date Title
WO2002020580A1 (fr) Nouveau polypeptide, proteine humaine 15 tnfr/ngfr contenant un domaine de cytochrome c, et polynucleotide codant ce polypeptide
WO2001068684A1 (fr) Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide
WO2001092319A1 (fr) NOUVEAU POLYPEPTIDE, RECEPTEUR HUMAIN 19.68 DE L'INTERFERON α, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2002048355A1 (fr) Nouveau polypeptide, proteine garp humaine 12.98, et polynucleotide codant ce polypeptide
WO2002012320A1 (fr) Nouveau polypeptide, proteine humaine 12 liee a tnfr/ngfr contenant un domaine de cytochrome c, et polynucleotide codant ce polypeptide
WO2001066730A1 (fr) Nouveau polypeptide, proteine humaine rs3 12, et polynucleotide codant pour ce polypeptide
WO2002040525A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 18.92, et polynucleotide codant ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001064744A1 (fr) Nouveau polypeptide, facteur de croissance du fibroblaste 14, et polynucleotide codant pour ce polypeptide
WO2002002614A1 (fr) Nouveau polypeptide, proteine humaine 14 contenant un domaine de cytochrome c tnfr/ngfr, et polynucleotide codant ce polypeptide
WO2001092518A1 (fr) Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide
WO2001081420A1 (fr) Nouveau polypeptide, laminine 19, et polynucleotide codant pour ce polypeptide
WO2002026790A1 (fr) Nouveau polypeptide, proteine tnfr/ngfr humaine 9.02 contenant un domaine des cytochromes c, et polynucleotide codant ce polypeptide
WO2002020589A1 (fr) Nouveau polypeptide, proteine humaine associee aux tumeurs de la retine 19.91, et polynucleotide codant ce polypeptide
WO2001070786A1 (fr) Nouveau polypeptide, proteine humaine tnfr/ngfr 9 contenant un domaine structurel des cytochromes c, et polynucleotide codant pour ce polypeptide
WO2002011511A1 (fr) Nouveau polypeptide, modulateur negatif 11.66 de la proteine d'activation de la gtpase, et polynucleotide codant ce polypeptide
WO2002020595A1 (fr) Nouveau polypeptide, proteine a doigt de zinc humaine 18.04, et polynucleotide codant ce polypeptide
WO2002000825A2 (fr) Nouveau polypeptide, antigene stromal proteique nucleaire 110.34, et polynucleotide codant ce polypeptide
WO2001074994A2 (fr) Nouveau polypeptide, proteine tnfr/nger 13 contenant un domaine de cytochrome c, et polynucleotide codant pour ce polypeptide
WO2001070791A1 (fr) Nouveau polypeptide, facteur humain lie a nf-e2, et polynucleotide codant pour ce polypeptide
WO2002048357A1 (fr) Nouveau polypeptide, sous-unite du compose c0p9 humaine 37.62, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP