WO2002011511A1 - Nouveau polypeptide, modulateur negatif 11.66 de la proteine d'activation de la gtpase, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, modulateur negatif 11.66 de la proteine d'activation de la gtpase, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002011511A1
WO2002011511A1 PCT/CN2001/001008 CN0101008W WO0211511A1 WO 2002011511 A1 WO2002011511 A1 WO 2002011511A1 CN 0101008 W CN0101008 W CN 0101008W WO 0211511 A1 WO0211511 A1 WO 0211511A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
protein
gtpase
negative regulator
Prior art date
Application number
PCT/CN2001/001008
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU93636/01A priority Critical patent/AU9363601A/en
Publication of WO2002011511A1 publication Critical patent/WO2002011511A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4703—Inhibitors; Suppressors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a negative regulator of GTPase 11.66, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • the tyrosine protein kinase of the receptor After binding in vivo, the tyrosine protein kinase of the receptor itself is activated, the kinase rephosphorylates the tyrosine residue of the target protein, and then affects gene expression through a series of phosphorylation cascades.
  • the characteristic of this pathway is that it does not need to pass the G protein, but the signal transmembrane transduction through the activation of the receptor's own tyrosine protein kinase. (Beijing Normal University 'Cell Biology 1998, p. 426)
  • the IRA1 gene is a negative regulator of the cyclic AMP pathway in yeast with tyrosine protein kinase activity.
  • the protein decoded by IRA2 has 3079 amino acids, which is 45% similar to the IRA1 protein.
  • a region in which IRA1 protein is homologous to a GTPase-activating protein having tyrosine protein kinase activity is also present in IRA2 protein.
  • the allele of the IRA2 gene is glc4. I A2 gene disruption will lead to increased heat shock sensitivity and nitrogen starvation, progeny defects, and inhibition of the lethality of the cdc25 mutation.
  • IRA1 and IRA2 break mutations show that IRA1 and IRA2 negatively regulate the cyclic AMP pathway with tyrosine protein kinase activity.
  • the expression of the IRA2 sequence is very similar to the protein that activates GTPase in the complementary role of sensitivity to heat shock.
  • IRA protein can negatively regulate the activity of a protein that activates GTPase with tyrosine protein kinase activity. (Mol Cell Biol 1990 Aug; 10 (8): 4303-13)
  • the breakage or deletion of the IRA2 gene will cause its abnormal expression, leading to increased sensitivity to heat shock and nitrogen starvation, or generation of progeny defects.
  • the present invention is named as a protein negative regulator 11.66 which activates GTPase.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector comprising a polynucleotide encoding a protein negative regulator 11.66 of an activated GTPase.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a protein negative regulator 11.66 of an activated GTPase.
  • Another object of the present invention is to provide a method for producing a negative regulator 11.66 of a protein that activates GTPase.
  • Another object of the present invention is to provide an antibody against the protein negative regulator 11.66 of a polypeptide of the present invention that activates GTPase one by one.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the protein negative regulator 11.66 of the polypeptide of the present invention which activates GTPase one by one.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in the negative regulators of protein activation of GTPase 11.66.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 A sequence of positions 290-610; and (b) a sequence of positions 1-842 in SEQ ID NO: 1.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit protein negative regulators of activated GTPase 11.66 protein activity, which comprises using the polypeptide of the present invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of diseases or susceptibility to diseases associated with abnormal expression of the protein negative regulator 11, 66 protein that activates GTPase, comprising detecting the polypeptide or its encoding polynucleotide sequence in a biological sample. Mutates, or detects the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the invention also relates to polypeptides and / or polynucleotides of the invention in the preparation of a medicament for the treatment of cancer, developmental disease or immune disease or other diseases caused by abnormal expression of the negative regulator 11.66 of GTPase. use.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • “Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with the negative regulator 11.66 of a protein that activates GTPase, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds to a protein negative regulator 11.66 that activates a GTPase.
  • Antagonist refers to a biological activity or immunity that can block or regulate the negative regulator of the protein GTPase 11.66 when combined with the negative regulator of the GTPase protein 11.66 Chemically active molecules. Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that binds to the negative regulators of protein 11.66 that activate GTPase.
  • “Regulation” refers to a change in the function of the protein negative regulator 1 1. 66 that activates GTPase, including an increase or decrease in protein activity, a change in binding characteristics, and any of the protein negative regulator 1 1. 66 that activates GTPase. Changes in other biological, functional or immune properties.
  • Substantially pure ' 1 means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. 66.
  • Those skilled in the art can use standard protein purification techniques to purify the negative regulator of the protein that activates GTPase 11.66.
  • the substantially pure protein negative regulator of activated GTPase 11.66 produces a single main band on a non-reducing polyacrylamide gel.
  • Negative regulator of protein activating GTPase 11. 66 The purity of the polypeptide can be analyzed by amino acid sequence.
  • Complementary or “complementary” refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A» can be combined with the complementary sequence "G-AC-T”.
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands It has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Sou thern blotting or Nor t hern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Perfect identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
  • the MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244).
  • the C lus ter method checks the distance between all pairs
  • the groups of sequences are arranged into clusters.
  • the clusters are then allocated in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of residues X 100
  • the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by Clus ter method or by methods known in the art such as Jotun He in Percentage of identity between them (He in J., (1990) Me thods in emzumo logy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the antigenic determinant of protein negative regulator 11.66 of activated GTPase.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, It is also possible that such a polynucleotide or polypeptide is part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated protein negative regulator of activated GTPase 11.66 refers to the protein negative regulator of activated GTPase 11.66 that is substantially free of other proteins, lipids, carbohydrates, or other substance. Those skilled in the art can purify negative protein regulators of activated GTPase using standard protein purification techniques 11.66. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Negative regulators of protein activating GTPase 11. The purity of 66 peptides can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide-negative regulator 11.66 of GTPase activation, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of the protein negative regulator 11.66 of GTPase activation.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the protein negative regulator 11.66 of the activated GTPase of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic codon; or ( ⁇ ) such that one or more of the amino acid residues is substituted by another group to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes SEQ ID NO: 1 Nucleotide sequence.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence that is 842 bases in length and has an open reading frame of 290-610 that encodes 106 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with the negative regulator of GTPase-activated protein. It can be concluded that the negative regulator of GTPase-activated protein 1 1. 66 has the negative regulator of GTPase-activated protein. Similar functionality.
  • the polynucleotide of the present invention may be in the form of DNA or MA.
  • DNA forms include cDNA, genomic DM, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (there is at least 501 ⁇ 2, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, G.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2 .
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, preferably at least 100 nucleotides.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding the negative regulator 11.66 of a protein that activates GTPase.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence of the protein negative regulator 11.66 of the present invention encoding an activated GTPase can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDM of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDM library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Qiagene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Molecu lar Cloning, A Laboratory Manua, Coll Spring Harbor Labora tory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the transcript of the negative regulator 11.66 of activated GTP hi (4) Detecting the protein product of gene expression by immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2,000 nucleotides, and preferably within 1,000 nucleotides.
  • the probe used here is usually a MA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of the negative regulator 11.66 gene expression of the activated GTPase can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). .
  • a method (Sa iki, et al. Sc ience 1985; 230: 1350-1 354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • RACE-Rapid Amplification of cDNA Ends can be preferably used.
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / MA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger e t al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the protein negative regulator 11.66 of the activated GTPase, and the present invention by recombinant technology A method of inventing the polypeptide.
  • a polynucleotide sequence encoding a protein negative regulator 11.66 of an activated GTPase can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct recombinant expression vectors.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct an expression vector containing a DNA sequence encoding the negative regulator 11.66 of a protein that activates GTPase and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, and the like (Sambroook, et al. Mol ecul ar Cloning, a Labora tory Manua 1, cold Harbor Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide the synthesis of raRM. Representative examples of these promoters are: l ac or trp promoter of E.
  • Expression vector also includes a nucleus for translation initiation Glycosome binding sites and transcription terminators. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on the promoter to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • the polynucleotide encoding the protein negative regulator 11.66 of the activated GTPase or the recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a gene containing the polynucleotide or the recombinant vector.
  • Engineered host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S 2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes s melanoma cells Wait.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM may be harvested after exponential growth phase, with (: Treatment 1 2, steps well known in the art with alternative is MgC l 2.
  • transformation can also be performed by electroporation.
  • the following DM transfection methods can be selected: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipid Body packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce a recombinant protein negative regulator of activated GTPase 1 1. 66 (Sc ience, 1984; 224: 1431). 0 Generally, there are The following steps:
  • polynucleotide (or variant) of the protein negative regulator 1 1.66 encoding human activated GTPase of the present invention, or a suitable host transformed or transduced with a recombinant expression vector containing the polynucleotide cell;
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. When host cells grow to proper After inducing the cell density, the appropriate promoter (such as temperature conversion or chemical induction) is used to induce the selected promoter, and the cells are cultured for a period of time.
  • the appropriate promoter such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • Fig. 1 is a comparison diagram of gene chip expression profiles of the protein negative regulator of activated GTPase 11.66 and the protein negative regulator of activated GTPase of the present invention.
  • the upper graph is a graph of the expression profile of the protein negative regulator of activated GTPase 11. 66, and the lower graph is the graph of the expression profile of the protein negative regulator of activated GTPase.
  • Figure 2 is a polyacrylamide gel electrophoresis picture of the isolated protein negative regulator 11.66 of activated GTPase.
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Isolation of poly (A) mRNA from Quik mRNA I solat ion Ki t (product of Qiegene) 2ug poly (A) mRM through reverse transcription CDNA is formed.
  • the Smart 00 cDNA cloning kit purchased from Clontech
  • the bacteria formed a cDNA library.
  • the sequences at the 5 'and 3' ends of all clones were determined using Dye terminate cycle reaction ionization kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer).
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones lOhll was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • CDNA was synthesized using fetal brain total RNA as a template and ol i go-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Pr imerl 5'- GTAATCTTATACATAAAATTTAGG -3 '(SEQ ID NO: 3)
  • Pr imer2 5'- AAAATTAACTTTATTATTATTTAT -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
  • Pr imer 2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50 mmol / L KC1, 10 mmol / L Tris-CI, (pH 8.5.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP in a reaction volume of 50 ⁇ 1 , l Opmol primer, 1U Taq DNA polymerase (C 1 on t ech).
  • the reaction was performed on a PB 9600 DNA thermal cycler (Pe rki n-E 1 me r company) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min 0 Simultaneously set during RT-PCR (3 -act in is the positive control and the template blank is the negative control.
  • the amplification products were purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit. DNA sequence analysis results showed that PCR The DNA sequence of the product is exactly the same as the 1-842bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of the protein negative regulator 11.66 gene expression of activated GTPase:
  • RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 703 ⁇ 4 ethanol, dried and dissolved in water.
  • RNA in 20 mM 3- (N- Morpholino) propanesulfonic acid (H7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde was run on a 1.2% agarose gel. It was then transferred to a nitrocellulose membrane.
  • the DNA probe used was the 11.66 coding region sequence (290bp to 610bp) of the protein negative regulator of the activated GTPase by PCR amplification shown in FIG. 1.
  • 32P-labeled probes (approximately 2 x 10 6 cpm / ml) were hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H 2 P0 4 (pH7.4)-5 x SSC- 5 x Denhardt's solution and 2G ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0.11 ⁇ 2 SDS at 55 ° C for 30 minutes. Then, it was performed with Phosphor Imager Analysis and quantification Example 4: In Vitro Expression, Isolation and Purification of Recombinant Activated GTPase Protein Negative Regulator 11.66
  • Priraer3 5,-CCCCATATGATGCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
  • the pBS-1093W1 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-1093hll plasmid, primers Primer-3 and Primer-4, and j was 10 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on an LB plate containing kanamycin (final concentration 30 ⁇ 8 / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-1093hll) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host strain BL21 (pET-1093hll) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to the final concentration. L. Continue incubation for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidines (6His-Tag). The purified protein negative regulator of GTPase activation was 11.66.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Needle-to-sample hybridization has the strongest specificity and is retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 853 ⁇ 4 or there are more than 15 consecutive bases, the primary probe should not be used in general;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • pre-hybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).
  • Gene microarray or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
  • a total of 400G polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification. The spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic instrument. After elution, the DM was fixed on the glass slide to prepare chips. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP 5-Amino-propargyl-2'-deoxyuridine 5--triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label niRNA of human mixed tissues, and the fluorescent reagent Cy5dUTP (5- Amino- propargyl- 2'- deoxyuridine 5 '-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the specific tissue (or stimulated cell line) mMA of the body, and purified the probe to prepare a probe.
  • Cy3dUTP 5-Amino-propargyl-2'-deoxyuridine 5--triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to
  • the probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (lx SSC, 0.2% SDS) at room temperature and scanned with ScanArray 3000.
  • the instrument purchased from General Scanning Company, USA
  • the scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line, thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar formation fc Growth factor stimulation, 1013HT, scar into fc to stimulate with growth factor, 1G13HC, bladder cancer construct cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardiac cancer. Draw a graph based on these 18 Cy3 / Cy5 ratios. (figure 1) . It can be seen from the figure that the expression profile of the protein negative regulator of activated GTPase 11.66 and the protein negative regulator of activated GTPase are very similar. Industrial applicability
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infection and immunity. Sexually transmitted diseases.
  • the present invention discloses a new polypeptide, a protein negative regulator 11.66 that activates GTPase, a polynucleotide encoding the polypeptide, and a method for producing the polypeptide by DNA recombination technology.
  • the invention also discloses a method for using the polypeptide to treat a variety of diseases, such as malignant tumors, blood diseases, developmental disorders, HIV infection, immune diseases, and various inflammations.
  • the invention also discloses an antagonist against the polypeptide and its therapeutic effect.
  • the present invention also discloses the use of a polynucleotide encoding the novel protein negative regulator 11.66 of activated GTPase.
  • the IRA2 protein has the role of a negative regulator of the cyclic AMP pathway of tyrosine protein kinase activity, and the IRA2 protein has the homologous region of the GTPase-activated protein of tyrosine protein kinase activity. The breakage or deletion of the IRA2 gene will cause its abnormal expression, leading to increased sensitivity to heat shock and nitrogen starvation or generation of progeny defects.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of the protein negative regulator IRA2 protein of human activated GTPase, both of which have similar biological functions.
  • the polypeptide of the present invention also acts on a receptor signaling pathway having tyrosine protein kinase activity in vivo, and is a negative regulator. Its abnormal expression is usually associated with some related substance metabolic disorders, protein dysfunction, and tumors of related tissues. The occurrence of other pathological processes is closely related and produces related diseases.
  • the abnormal expression of the negative regulator 11.66 of the GTPase-activated protein of the present invention will produce various diseases, especially various tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases. Illnesses include, but are not limited to:
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Neurofibromas, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma embryonic development Disorders: congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing syndrome Sexual retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, uterus Neckitis, various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • the abnormal expression of the protein negative regulator 11.66 of the activated GTPase of the present invention will also produce certain hereditary, hematological diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) protein negative regulators of activated GTPase 11.66.
  • Agonists increase the negative regulators of the protein that activate GTPase 11.66 stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing a protein negative regulator of activated GTPase 11.66 can be cultured together with a labeled protein negative regulator of activated GTPase 11.66 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of protein negative regulators that activate GTPase 11.66 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of the protein negative regulator 11.66 of activated GTPase can bind to the protein negative regulator 11.66 of activated GTPase and eliminate its function, or inhibit the production of the polypeptide, or with the active site of the polypeptide Binding prevents the polypeptide from functioning biologically.
  • the protein negative regulator of activated GTPase 11.66 can be added to the bioanalytical assay, and by measuring the compound, the protein negative regulator of activated GTPase 11.66 and its receptors interact with each other. Effect to determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to the protein negative regulator 11.66 of activated GTPase can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the negative regulator of the protein that activates GTPase 11.66 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the present invention also provides an antibody against the protein negative regulator 11.66 epitope that activates GTPase. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by inactivating GTPase protein negative regulator 11.66 by direct injection It can be obtained by various methods (such as rabbit, mouse, rat, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Techniques for preparing monoclonal antibodies that activate the negative regulator of protein GTPase 11.66 include, but are not limited to, hybridoma technology (Kohler and ilste in. Nature, 1975,
  • Antibodies against protein negative regulators of activated GTPase 11.66 can be used in immunohistochemical techniques to detect protein negative regulators of activated GTPase in biopsy specimens 11.66.
  • Monoclonal antibodies that bind to the protein negative regulator 11.66 of activated GTPase can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • protein negative regulators that activate GTPase 11.66 High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill the negative regulator of the protein that activates GTPase 11 66 positive cells.
  • the antibody of the present invention can be used to treat or prevent diseases related to the negative regulator 11.66 of the protein that activates GTPase.
  • Administration of appropriate doses of antibodies can stimulate or block the production or activity of the negative regulator 11.66 of GTPase.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of the negative regulator of protein 1.66 of the activated GTPase.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the level of protein negative regulator 11.66 of activated GTPase detected in the test can be used to explain the importance of protein negative regulator 11.66 of activated GTPase in various diseases and the protein used to diagnose activated GTPase Diseases with negative regulator 11.66.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • 66 of activated GTPase can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of the negative regulator 1 1.
  • 66 of the activated GTPase Recombinant gene therapy vectors (such as viral vectors) can be designed to express the mutant negative regulator of activated GTPase protein 11.66 to inhibit endogenous sexually activated GTPase protein negative regulator 11.66 activity.
  • a mutated protein negative regulator of activated GTPase 11.66 may be a shortened protein negative regulator of activated GTPase that lacks a signaling domain, 11.66, although it can bind to downstream substrates But lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of the negative regulator 11.66 of GTPase.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding a protein negative regulator 11.66 of an activated GTPase into a cell.
  • 66 of activated GTPase can be found in the literature (Sambrook, etal.).
  • a recombinant polynucleotide encoding the negative regulator 11.66 of a protein that activates GTPase can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • 66 mRNA oligonucleotides (including antisense MA and DNA) and ribozymes are also within the scope of the invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA and DNA and ribozymes can be obtained by any RNA or DNA synthesis technology. For example, solid-phase phosphate amide chemical synthesis of oligonucleotides has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • 66 of the activated GTPase can be used for the diagnosis of diseases related to the negative regulator 1 1.
  • Polynucleotides encoding a protein negative regulator 1 1.66 of activated GTPase can be used to detect the expression of protein negative regulator 11.66 of activated GTPase or the protein negative regulator of activated GTPase 11. 66 abnormal expression.
  • the DNA sequence encoding the protein negative regulator 11.66 of activated GTPase can be used to hybridize biopsy specimens to determine the expression of protein negative regulator 11.66 of activated GTPase.
  • Hybridization techniques include Sou thern blotting, Nor thern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and gene diagnosis. . Performed with the protein negative regulator 11.66 specific primers that activate GTPase RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the transcription product of protein negative regulator 11.66 of activated GTPase.
  • RT-PCR RNA-polymerase chain reaction
  • Negative Regulators of GTPase 11.66 Mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type GTPase 11.66 DM sequences. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckus i ck, Mendel i an
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals, and the mutation is not observed in any normal individual-then the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for staining Structural changes in the body, such as deletions or translocations that are visible from the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceutical or biological products, which prompts permission for administration on the human body by government agencies that manufacture, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • GTPase-activating protein negative regulators 11.66 are administered in amounts effective to treat and / or prevent specific indications.
  • the amount and dosage range of 66 will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Communicable Diseases (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biophysics (AREA)
  • AIDS & HIV (AREA)
  • Oncology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, un modulateur négatif 11.66 de la protéine d'activation de la GTPase, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de troubles du développement, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant le modulateur négatif 11.66 de la protéine d'activation de la GTPase.
PCT/CN2001/001008 2000-06-21 2001-06-19 Nouveau polypeptide, modulateur negatif 11.66 de la proteine d'activation de la gtpase, et polynucleotide codant ce polypeptide WO2002011511A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU93636/01A AU9363601A (en) 2000-06-21 2001-06-19 A novel polypeptide-the activating gtpase negative regulator 11.66 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116684A CN1329024A (zh) 2000-06-21 2000-06-21 一种新的多肽——活化gtp酶的蛋白负调控子11.66和编码这种多肽的多核苷酸
CN00116684.0 2000-06-21

Publications (1)

Publication Number Publication Date
WO2002011511A1 true WO2002011511A1 (fr) 2002-02-14

Family

ID=4586086

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001008 WO2002011511A1 (fr) 2000-06-21 2001-06-19 Nouveau polypeptide, modulateur negatif 11.66 de la proteine d'activation de la gtpase, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1329024A (fr)
AU (1) AU9363601A (fr)
WO (1) WO2002011511A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000008139A1 (fr) * 1998-08-07 2000-02-17 Human Genome Sciences, Inc. Facteur de necrose tumorale gamma
WO2000010602A1 (fr) * 1998-08-18 2000-03-02 Yale University Modeles animaux avec elimination de genes lats et leurs utilisations
WO2000015817A2 (fr) * 1998-09-17 2000-03-23 Pioneer Hi-Bred International, Inc. Genes de type stomatine et utilisation de ces genes dans des plantes

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000008139A1 (fr) * 1998-08-07 2000-02-17 Human Genome Sciences, Inc. Facteur de necrose tumorale gamma
WO2000010602A1 (fr) * 1998-08-18 2000-03-02 Yale University Modeles animaux avec elimination de genes lats et leurs utilisations
WO2000015817A2 (fr) * 1998-09-17 2000-03-23 Pioneer Hi-Bred International, Inc. Genes de type stomatine et utilisation de ces genes dans des plantes

Also Published As

Publication number Publication date
AU9363601A (en) 2002-02-18
CN1329024A (zh) 2002-01-02

Similar Documents

Publication Publication Date Title
WO2002014510A1 (fr) Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2002011511A1 (fr) Nouveau polypeptide, modulateur negatif 11.66 de la proteine d'activation de la gtpase, et polynucleotide codant ce polypeptide
WO2001068688A1 (fr) Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2002006470A1 (fr) Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001075036A2 (fr) Nouveau polypeptide, immunophiline humaine 14, et polynucleotide codant pour ce polypeptide
WO2002012297A1 (fr) Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide
WO2001094534A2 (fr) Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide
WO2002020581A1 (fr) Nouveau polypeptide, proteine 11.33 associee a l'arn polymerase ii, et polynucleotide codant ce polypeptide
WO2001070791A1 (fr) Nouveau polypeptide, facteur humain lie a nf-e2, et polynucleotide codant pour ce polypeptide
WO2002014365A1 (fr) Nouvelle proteine 12 activatrice du polypeptide-ras gtp et le polynucleotide codant pour ladite proteine
WO2002012486A1 (fr) Nouveau polypeptide, recepteur humain de la serine kinase 10.34, et polynucleotide codant ce polypeptide
WO2002020580A1 (fr) Nouveau polypeptide, proteine humaine 15 tnfr/ngfr contenant un domaine de cytochrome c, et polynucleotide codant ce polypeptide
WO2001074997A2 (fr) Nouveau polypeptide, proteine humaine de reception cannabinoide 11, et polynucleotide codant pour ce polypeptide
WO2001092327A1 (fr) Nouveau polypeptide, proteine 111 associee au centrosome nek-2, et polynucleotide codant ce polypeptide
WO2001070983A1 (fr) Nouveau polypeptide, proteine antigene prostatique specifique membranaire 9, et polynucleotide codant pour ce polypeptide
WO2001074887A1 (fr) Nouveau polypeptide, proteine humaine 9 humsiah, et polynucleotide codant pour ce polypeptide
WO2001075015A2 (fr) Nouveau polypeptide, fat24, et polynucleotide codant pour ce polypeptide
WO2001079491A1 (fr) Nouveau polypeptide, canal ionique humain 12 pour le chlore, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP