WO2002026797A1 - Nouveau polypeptide, deshydrogenase humaine 29.15, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, deshydrogenase humaine 29.15, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002026797A1
WO2002026797A1 PCT/CN2001/001251 CN0101251W WO0226797A1 WO 2002026797 A1 WO2002026797 A1 WO 2002026797A1 CN 0101251 W CN0101251 W CN 0101251W WO 0226797 A1 WO0226797 A1 WO 0226797A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human dehydrogenase
sequence
seq
Prior art date
Application number
PCT/CN2001/001251
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2002221426A priority Critical patent/AU2002221426A1/en
Publication of WO2002026797A1 publication Critical patent/WO2002026797A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human dehydrogenase 29.15, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • Trans-retinol is a precursor of other retinoids.
  • Trans-retinal is trans-retinoic acid or 9-cis-retinoic acid.
  • trans-retinoic acid or 9-cis-retinoic acid is used as a hormone to influence important biochemical processes such as differentiation through and gated ligand transcription factors.
  • Retinal is potentially toxic, so it does not accumulate in high concentrations in most tissues.
  • the function of the visual system is based on retinal, which is present at high concentrations of approximately 3 mM in the outer fragments of photoreceptor cells.
  • 11-cis-retinaldehyde activates rhodopsin, initiates phototransduction, and the product of photoisomerization, trans-retinal, enters a series of reactions to produce the "11-cis" structure And related visual pigments;
  • the regeneration reaction begins with the MDPH-dependent reduction of trans-retinal, which is catalyzed by trans-retinol dehydrogenase (RDH), which plays an important role in the physiological aspects of the photoreceptor, catalyzing
  • RDH trans-retinol dehydrogenase
  • the visual cycle of rod cells plays an important role in quenching photosensitized rhodopsin in the last step of phototransduction. In this way, the phototransduction and regeneration reactions form a visual cycle process.
  • SDRl short chain dehydrogenase / reductase
  • Its expression product is similar to 11-cis-retinol dehydrogenase, with an isoelectric point of 9.07, consisting of 302 amino acids, and a molecular weight of approximately 33520 Da l. It has all the functional domains of the SDR superfamily, including the invariant functional domain YXXXK (amino acids 188-192, where X is any amino acid), the catalytic center Ser-175, the highly conserved Ser before Lys-192, the highly conserved nucleic acid Binding region TGXXXGXG (amino acids 44-51) and so on. Its RTEK at positions 71-74 is related to the specificity of the enzyme for NADPH.
  • the protein binds to a nucleic acid with a typical Rossmann fold, and the N-terminus extends outward to facilitate binding to the substrate.
  • This enzyme may also be involved in the metabolism of retinol outside the photoreceptor.
  • Human retSDR1 is distributed in the cones of the placenta, lungs, liver, kidneys, pancreas and retina (not present in the rod), but not in the brain [J Bi ol Chem, Vol.
  • the novel polypeptide of the present invention has 38% homology and 55% similarity with the known human dehydrogenase retSDR1 constituent components at the protein level, and has similar structural characteristics with it, which is considered to be a
  • a new component of human dehydrogenase retSDRl, named human dehydrogenase 29.15, has similar biological functions as known proteins, and plays an important role in visual circulation such as light transduction. If the expression is abnormal, it will cause Brown lipid accumulation causes diseases such as visual impairment. In addition, it also plays a role in the diagnosis and treatment of related diseases.
  • human dehydrogenase 29.15 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so it has been necessary to identify more involved in these The process of human dehydrogenase 29. 15 protein, especially the amino acid sequence of this protein is identified.
  • the isolation of new human dehydrogenase 29. 15 protein-coding genes also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostics and / or therapeutics for the disease, so it is important to isolate its code for DM.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human dehydrogenase 29.15.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human dehydrogenase 29.15.
  • Another object of the present invention is to provide a method for producing human dehydrogenase 29.15.
  • Another object of the present invention is to provide an antibody against the polypeptide-human dehydrogenase 29. 15 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide-human dehydrogenase 29. 15 of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human dehydrogenase 29.15. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the The polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from: (a) a sequence having positions 132-929 in SEQ ID NO: 1; and (b) a sequence having 1-2436 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening for compounds that mimic, activate, antagonize or inhibit human dehydrogenase 29.15 protein activity, which comprises utilizing a polypeptide of the present invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human dehydrogenase 29.15 protein, comprising detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for the treatment of cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human dehydrogenase 29.15.
  • FIG. 1 is a comparison diagram of amino acid sequence homology between the human dehydrogenase 29. 15 and human dehydrogenase of the present invention.
  • the upper sequence is human dehydrogenase 29. 15 and the lower sequence is human dehydrogenase.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 1 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human dehydrogenase 29.15. 29. 15kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genome or a synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human dehydrogenase 29.15, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human dehydrogenase 29.15.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human dehydrogenase 29.15 when combined with human dehydrogenase 29.15.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human dehydrogenase 29.15.
  • Regular refers to a change in the function of human dehydrogenase 29.15, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of human dehydrogenase 29.15 Change of nature.
  • “Substantially pure '” means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human dehydrogenase 29. 15 using standard protein purification techniques. Basic The pure human dehydrogenase 29. 15 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human dehydrogenase 29. 15 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This type of inhibition of hybridization can be achieved by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency to detect substantially homologous sequences or hybridization probes can compete and inhibit completely homologous sequences from the target sequence Bonding under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction. .
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method checks the distance between all pairs by Each group of sequences is arranged into clusters. Each cluster is then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzymology 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the "sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl 'group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b ') 2 and F V, which specifically binds to human antigens 29.15 dehydrogenase determinant.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it exists in a living thing, but the same polynucleotide or polypeptide is separated if it is separated from some or all of the substances that coexist in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human dehydrogenase 29. 15 means that human dehydrogenase 29. 15 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human dehydrogenase 29. 15 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human dehydrogenase 29. 15 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide-human dehydrogenase 29.15, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human dehydrogenase 29.15.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human dehydrogenase 29.15 of the present invention.
  • a fragment, derivative or analog of a polypeptide of the invention may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be encoded by a genetic codon; Or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted with another group to include a substituent; or ( ⁇ ⁇ ) such a type in which the mature polypeptide and another compound (such as A compound that prolongs the half-life of a polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence (such as a leader sequence or a secretion sequence or a polypeptide used to purify the polypeptide) formed by fusing additional amino acid sequences into a mature polypeptide Sequence or protease sequence).
  • a polypeptide sequence such as a leader sequence or a secretion sequence or a polypeptide used to purify the polypeptid
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2436 bases in length and its open reading frame 132-929 encodes 265 amino acids.
  • this polypeptide has 38% homology with human dehydrogenase, and it can be deduced that the human dehydrogenase 29. 15 has a similar structure and function to human dehydrogenase.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DM, or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DM can be coded or non-coded.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to a sequence described above 50% less, preferably 70% identity).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human dehydrogenase 29.15.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human dehydrogenase 29. 15 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • raRNA extraction There are many mature techniques for raRNA extraction, and kits are also commercially available (Qiagene).
  • construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Labora tory Manua, Cold Spruing Harbor Labora tory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of human dehydrogenase 29. 15 transcripts; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 3G nucleotides, more preferably At least 50 Nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein products expressed by the human dehydrogenase 29. 15 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method for amplifying DM / RNA by PCR is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using human dehydrogenase 29.15 coding sequence, and a recombinant technology to produce a polypeptide of the present invention method.
  • a polynucleotide sequence encoding human dehydrogenase 29. 15 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
  • DM sequence can be operably linked to an appropriate promoter in an expression vector to guide the synthesis of raRM.
  • promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human dehydrogenase 29. 15 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human dehydrogenase 29. 15 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Trans-retinol is a precursor of other retinoids.
  • Trans-retinal is trans-retinoic acid or 9-cis-retinoic acid.
  • trans-retinoic acid or 9-cis-retinoic acid is used as a hormone to influence important biochemical processes such as differentiation through and gated ligand transcription factors.
  • Retinal is potentially toxic, so it does not accumulate in high concentrations in most tissues.
  • the function of the visual system is based on retinal, which is present at high concentrations of approximately 3 mM in the outer fragments of photoreceptor cells.
  • 11-cis-retinaldehyde activates rhodopsin, initiates phototransduction, and the product of photoisomerization, trans-retinal, enters a series of reactions to produce the "11-cis" structure And related visual pigments;
  • the regeneration reaction begins with the NADPH-dependent reduction of trans-retinal, which is catalyzed by trans-retinol dehydrogenase (RDH), which plays an important role in the physiological aspects of photoreceptors, catalyzing
  • RDH trans-retinol dehydrogenase
  • the visual cycle of rod cells plays an important role in quenching photosensitized rhodopsin in the last step of phototransduction. In this way, the phototransduction and regeneration reactions form a visual cycle process.
  • the human dehydrogenase retSDRl cloned by Fransoi se Haeseleer and others in 1998 is a new member of the short-chain dehydrogenase / reductase (SDR) superfamily.
  • the protein has a functional domain that binds to nucleic acids.
  • the enzyme may also be involved in photosensitivity. Retinol Metabolism Outside the Organ.
  • novel polypeptide and the constituents of the present invention have 38% homology and 55% similarity at the protein level, and have similar structural characteristics, and thus are considered to be a new human dehydrogenase retSDR1 Constituents, named peptides, have similar biological functions to known proteins, and play an important role in visual circulation such as light transduction. If the expression is abnormal, it will lead to brown lipid accumulation and cause visual disturbance. And other diseases. In addition, it also plays a role in the diagnosis and treatment of related diseases.
  • the polypeptide of the present invention and the known human dehydrogenase retSDR1 are human dehydrogenases, and contain a characteristic sequence of a short-chain dehydrogenase / reductase (SDR). Both have similar biological functions. It catalyzes the dehydrogenation of trans-retinol in the body and participates in the regeneration of trans-retinol. Trans-retinol is a precursor of other retinoids, and vitamin A and its metabolites are many important physiological processes The active substance is not necessary for visual function.
  • the abnormal expression of the polypeptide of the present invention is usually closely related to visual impairment, vitamin A deficiency, and causes related diseases.
  • human dehydrogenase 29. 15 of the present invention will produce various diseases, especially night blindness and vitamin A deficiency diseases, and these diseases include, but are not limited to:
  • Vitamin A deficiency weakened dark adaptation and night blindness, xerophthalmia and corneal softening, skin follicle keratosis, visceral lesions
  • polypeptide of the present invention as well as its antagonists, agonists and inhibitors, can be directly used in the treatment of diseases, for example, it can treat various diseases, especially night blindness, vitamin A deficiency and the like.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human dehydrogenase 29. 15.
  • Agonists enhance human dehydrogenases 29. 15 Stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing human dehydrogenase 29. 15 can be cultured with labeled human dehydrogenase 29. 15 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human dehydrogenase 29. 15 include antibodies, compounds, receptor deletions and analogs that have been screened. Antagonists of human dehydrogenase 29. 15 can bind to human dehydrogenase 29. 15 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
  • human dehydrogenase 29. 15 can be added to the bioanalytical assay to determine whether the compound is a compound by measuring the effect of the compound on the interaction between human dehydrogenase 29. 15 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human dehydrogenase 29. 15 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human dehydrogenase 29. 15 molecule should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human dehydrogenase 29. 15 epitopes.
  • These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries Paragraph.
  • Polyclonal antibodies can be produced by direct injection of human dehydrogenase 29.15 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies against human dehydrogenase 29.15 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridization. Tumor technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). And existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against human dehydrogenase 29.15.
  • Anti-human dehydrogenase 29.15 antibodies can be used in immunohistochemical techniques to detect human dehydrogenase 29.15 in biopsy specimens.
  • Monoclonal antibodies that bind to human dehydrogenase 29.15 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human dehydrogenase 29.15 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human dehydrogenase 29.15 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human dehydrogenase 29.15.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human dehydrogenase 29.15.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human dehydrogenase 29.15.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human dehydrogenase 29.15 detected in the test can be used to explain the importance of human dehydrogenase 29.15 in various diseases and to diagnose diseases in which human dehydrogenase 29.15 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human dehydrogenase 29.15 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human dehydrogenase 29.15.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human dehydrogenase 29.15 to inhibit endogenous human dehydrogenase 29.15 activity.
  • a variant human dehydrogenase 29.15 may be a shortened human dehydrogenase 29.15 that lacks a signaling domain, although The downstream substrate binds but lacks signaling activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human dehydrogenase 29.15.
  • Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human dehydrogenase 29. 15 into a cell.
  • Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human dehydrogenase 29.15 can be found in existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human dehydrogenase 29.15 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RM and DNA
  • ribozymes that inhibit human dehydrogenase 29.15 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target MA and performs endonucleation.
  • Antisense RM, DM, and ribozymes can be obtained by any existing RM or DM synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM. This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding human dehydrogenase 29. 15 can be used for the diagnosis of diseases related to human dehydrogenase 29. 15.
  • the polynucleotide encoding human dehydrogenase 29. 15 can be used to detect the expression of human dehydrogenase 29. 15 or the abnormal expression of human dehydrogenase 29. 15 in a disease state.
  • a DNA sequence encoding human dehydrogenase 29. 15 can be used to hybridize biopsy specimens to determine the expression of human dehydrogenase 29. 15.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These technical methods are all mature technologies that are publicly available, and related kits are commercially available.
  • a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a micro array or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue.
  • Human dehydrogenase 29. 15 specific primers can be used to perform RM-polymerase chain reaction (RT-PCR) in vitro amplification to detect the transcribed product of human dehydrogenase 29. 15.
  • Detection of mutations in the human dehydrogenase 29. 15 gene can also be used to diagnose human dehydrogenase 29. 15-related diseases.
  • Human dehydrogenase 29. 15 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human dehydrogenase 29. 15 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated. The sequences of the invention are also valuable for chromosome identification.
  • This sequence will specifically target a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for labeling chromosome positions.
  • an important first step is to locate these DM sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human dehydrogenase 29. 15 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human dehydrogenase 29. 15 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Human fetal brain total MA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Separation Quik raRNA Isolat ion Ki t (Qiegene Co.) total RNA from poly (A) mRNA 0 2ug poly (A) mRNA is formed by reverse transcription cDNA. A Smart cDNA cloning kit (purchased from Clontech) was used to orient the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5a, and the bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 25 05el2 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the sequence of the human dehydrogenase 29. 15 of the present invention and the protein sequence encoded by the dehydrogenase 29. 15 of the present invention were analyzed using the Blas t program (Bas ic (local al ignment search tool) [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], homology search was performed in databases such as Genbank, Switzerland, and so on.
  • the gene with the highest homology with the human dehydrogenase 29.15 of the present invention is a known human dehydrogenase, and the accession number of the encoded protein in Genbank is AF061743.
  • the protein homology results are shown in FIG. The two are highly homologous, with an identity of 38% and a similarity of 55%.
  • Example 3 Cloning of a gene encoding human dehydrogenase 29.15 by RT-PCR
  • the total RM of fetal brain cells was used as a template, and ol igo-dT was used as a primer for reverse transcription reaction to synthesize cDM. After purification by Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imer2 5'- CATAGGCCGAGGCGGCCGACATGT -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 mmol / L KCl, 10 mmol / L Tri s-HCl pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ ⁇ dNTP, 1 Opmol primer, 1U Taq in a reaction volume of 50 ⁇ 1 DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min 0 During RT-PCR, ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-2436bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human dehydrogenase 29.15 gene expression
  • RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) Centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) and an RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM KH 2 P0 4 (pH7. 4) -5 ⁇ SSC-5 x Denhardt's solution and 20 (g / ml salmon sperm DM. After hybridization, the filter was placed at 1 ⁇ SSC- Wash in 0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human dehydrogenase 29.15
  • Primer3 5'-CCCCATATGATGTCTTTCAACCTGCAATCATCA-3 '(Seq ID No: 5)
  • Priraer4 5' -CATGGATCCTTAGAGCTTCTTCTTTTGGTCACA-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BaniHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the target gene are followed, respectively.
  • the restriction sites of Mel and BamHI correspond to the selection on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3). Sex endonuclease site.
  • PCR reaction was performed using the pBS-2505el2 plasmid containing the full-length target gene as a template.
  • PCR reaction conditions were: 1 in a total volume of 50 ⁇ plasmid pBS-2505el2 containing 10pg, primers Pr imer-3 and Primer- 4 are lOpmol, Advantage polymerase Mix (Clontech Products) 1 ⁇ 1.
  • Cycle parameters 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles.
  • Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into coliform bacteria DH5a by the calcium chloride method, and cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were selected by colony PCR method and sequenced.
  • a positive clone with correct sequence (PET-2505el2) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • NH2-Met-Ser-Phe-Asn-Leu-Gln-Ser-Ser-Lys-Lys-Leu-Phe-I le-Phe-Leu-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex.
  • Rabbits were immunized with 4 mg of the above-mentioned jk cyanoprotein complex plus complete Freund's adjuvant, and 15 days later, hemocyanin polypeptide complex plus incomplete Adjuvant boosts immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody could specifically bind to human dehydrogenase 29.15.
  • Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method Acid sequence or a homologous polynucleotide sequence thereof.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • the primary probe is compared with the region of its source sequence (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complementary regions, respectively. If the homology with the non-target molecular region is greater than 85% or there is If more than 15 consecutive bases are identical, the primary probe should generally not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the sample membrane was placed in a plastic bag, and 3-lOmg prehybridization solution (10xDenhardt-s; 6xSSC, 0.1mg / ml CT DM (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • 3-lOmg prehybridization solution (10xDenhardt-s; 6xSSC, 0.1mg / ml CT DM (calf thymus DNA)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une déshydrogénase humaine 29.15, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de la cécité et de l'avitaminose A. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la déshydrogénase humaine 29.15.
PCT/CN2001/001251 2000-08-23 2001-08-20 Nouveau polypeptide, deshydrogenase humaine 29.15, et polynucleotide codant ce polypeptide WO2002026797A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002221426A AU2002221426A1 (en) 2000-08-23 2001-08-20 A novel polypeptide -human dehydrogenase 29.15 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00119711.8 2000-08-23
CN00119711A CN1339590A (zh) 2000-08-23 2000-08-23 一种新的多肽——人脱氢酶29.15和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002026797A1 true WO2002026797A1 (fr) 2002-04-04

Family

ID=4587948

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001251 WO2002026797A1 (fr) 2000-08-23 2001-08-20 Nouveau polypeptide, deshydrogenase humaine 29.15, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1339590A (fr)
AU (1) AU2002221426A1 (fr)
WO (1) WO2002026797A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5965372A (en) * 1995-08-24 1999-10-12 Baker Medical Research Institute Genetic sequences encoding glucocorticoid dehydrogenases and uses thereof
WO2000004135A2 (fr) * 1998-07-16 2000-01-27 Incyte Pharmaceuticals, Inc. Molecules apparentees a l'alcool-deshydrogenase chaine courte de type humain, scrm-1 et scrm-2

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5965372A (en) * 1995-08-24 1999-10-12 Baker Medical Research Institute Genetic sequences encoding glucocorticoid dehydrogenases and uses thereof
WO2000004135A2 (fr) * 1998-07-16 2000-01-27 Incyte Pharmaceuticals, Inc. Molecules apparentees a l'alcool-deshydrogenase chaine courte de type humain, scrm-1 et scrm-2

Also Published As

Publication number Publication date
AU2002221426A1 (en) 2002-04-08
CN1339590A (zh) 2002-03-13

Similar Documents

Publication Publication Date Title
WO2002051867A1 (fr) Nouveau facteur 8.8 polypeptidique liberant de la corticotrophine et polynucleotide codant ledit polypeptide
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001083780A1 (fr) Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide
WO2002026797A1 (fr) Nouveau polypeptide, deshydrogenase humaine 29.15, et polynucleotide codant ce polypeptide
WO2001047983A1 (fr) Nouveau polypeptide, facteur de liberation de la corticotrophine 13, et polynucleotide codant pour ce polypeptide
WO2002026809A1 (fr) Nouveau polypeptide, proteine transmembranaire 35.31 possedant un domaine permettant la duplication de facteurs de croissance epidermique, et polynucleotide codant ce polypeptide
WO2001046240A1 (fr) Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide
WO2001038540A1 (fr) Nouveau polypeptide, la methionyl arnt synthetase humaine de 29 kda, et polynucleotide codant pour ledit polypeptide
WO2002026798A1 (fr) Nouveau polypeptide, acide phosphatidique phosphatase 29.81, et polynucleotide codant ce polypeptide
WO2002020606A1 (fr) Nouveau polypeptide, la proteine humaine 38.39 liee aux defauts d'audition, et polynucleotide codant pour elle
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2001049724A1 (fr) Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide
WO2001072986A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 10, et polynucleotide codant pour ce polypeptide
WO2001046437A1 (fr) Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide
WO2001070785A1 (fr) Nouveau polypeptide, serine proteinase humaine atp-dependante 13, et polynucleotide codant pour ce polypeptide
WO2001068686A1 (fr) Nouveau polypeptide, phosphomannose isomerase 16, et polynucleotide codant pour ce polypeptide
WO2002038605A1 (fr) Nouveau polypeptide, recepteur olfactif 27.61, et polynucleotide codant ce polypeptide
WO2001048004A1 (fr) Nouveau polypeptide, proteine de liaison de l'heparine 10, et polynucleotide codant pour ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001075085A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide
WO2001062783A1 (fr) Nouveau polypeptide, compose de clivage 69, et polynucleotide codant pour ce polypeptide
WO2001075125A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 31, et polynucleotide codant pour ce polypeptide
WO2001098488A1 (fr) Nouveau polypeptide, sous-unite 24 de flavoproteine humaine, et polynucleotide codant ce polypeptide
WO2001048001A1 (fr) Nouveau polypeptide, quinone-proteine reductase 7, et polynucleotide codant pour ce polypeptide
WO2001049860A1 (fr) Nouveau polypeptide, helicase 9, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP