WO2002020783A1 - Nouveau polypeptide, proteine humaine 13.2 de reparation du mesappariement de bases, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, proteine humaine 13.2 de reparation du mesappariement de bases, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2002020783A1 WO2002020783A1 PCT/CN2001/000896 CN0100896W WO0220783A1 WO 2002020783 A1 WO2002020783 A1 WO 2002020783A1 CN 0100896 W CN0100896 W CN 0100896W WO 0220783 A1 WO0220783 A1 WO 0220783A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- mismatch repair
- base mismatch
- repair protein
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide ⁇ base mismatch repair protein 13.2, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. Controlled Back
- MMR mismatch repair gene
- the main function of MSH6 is to repair base mismatches (Am J Hum Genet 1999 Nov; 65 (5): 1291-8).
- the mutation of MSH6 is related to the occurrence of colorectal cancer sooner or later (J Med Genet 1999 Sep; 36 (9): 678-82). Mutations in MSH6 can cause familial colorectal cancer with advanced onset in the body, a disease that does not match the standard of the classic "hereditary nonpolyposis colorectal cancer” (Cancer Res 1999 Oct 15; 59 (20) : 5068-74).
- chemotherapeutic drugs such as cisplatin and vincristine
- Hmsh6 is underexpressed (Int J Cancer 1999 Mar 1; 80 (5): 744-50).
- the hMSH6 gene consists of 10 exons and is located at positions 15-16 of the short arm of the second human chromosome.
- hMSH6 protein and hMSH2 protein form a complex. There is no interaction between them (Proc Nat 1 AcadSci U S A 1996 Nov 26; 93). This complex binds to DM where base mismatch occurs, and then exerts its repairing effect.
- MutS congeners are now detectable in almost all tissues. They play a key role in maintaining the fidelity of mitotic inheritance and the fidelity of meiotic separation. MutS consortia play a role as molecular switches in the process of genome amplification.
- the expression of human MSH5 (human MSH, hMSH) during spermatogenesis suggests that it plays an important role in meiosis (Cancer Res 1999 Feb 15; 59 (4): 816-22).
- the human base mismatch repair protein 13.2 protein regulates cell division and embryo development It plays an important role in other important functions of the body, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there has been a need in the art to identify more human base mismatch repair proteins I 3 ⁇ 2 proteins involved in these processes, especially to identify this. Amino acid sequence of several proteins.
- New human base mismatch repair protein 13.2 The isolation of the protein-coding gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is very important. Object of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human base mismatch repair protein 13.2.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human base mismatch repair protein 13.2.
- Another object of the present invention is to provide a method for producing a human base mismatch repair protein 13.2.
- Another object of the present invention is to provide a human base mismatch repair protein directed to the polypeptide of the present invention
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human base mismatch repair protein 13.2.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to the abnormality of human base mismatch repair protein 13.2. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human base mismatch repair protein 13.2 protein activity, which comprises utilizing the polypeptide of the present invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a human base mismatch repair protein 13.2 protein, which comprises detecting mutations in the polypeptide or a sequence encoding the polynucleotide in a biological sample. Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human base mismatch repair protein 13. 2 .
- FIG. 1 is a comparison diagram of the gene chip expression profile of human base mismatch repair protein 13.2 and similar proteins of the present invention: human MSH6.
- the upper graph is a graph of the expression profile of human base mismatch repair protein 13. 2 and the lower graph is a graph of a similar protein: human MSH6.
- 1-bladder mucosa 2-PMA + Ecv304 cell line, 3-LPS + Ecv 3 (M cell line thymus, 4-normal fibroblasts 10 2 4NC, 5- Fibroblas t, growth factor stimulation, 1024NT, 6- Scar-fc growth factor stimulation, 1013HT, 7-scar-fc stimulation without growth factor stimulation, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cells Strain, 13-fetal skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human base mismatch repair protein 13.2.
- 1 3 kDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with a human base mismatch repair protein 13.2, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind a human base mismatch repair protein 1 3.2.
- Antagonist refers to a biological activity or immunity that can block or regulate human base mismatch repair protein 1 3.2 when combined with human base mismatch repair protein 1 3.2. Academic molecules. Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human base mismatch repair protein 1 3.2.
- Regular refers to a change in the function of human base mismatch repair protein 1 3.2, including an increase or decrease in protein activity, a change in binding characteristics, and any other organism of human base mismatch repair protein 1 3.2. Changes in nature, function, or immunity.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated Quality.
- Those skilled in the art can use standard protein purification techniques purified human nucleotide mismatch repair protein 13.2.
- Substantially pure human base mismatch repair protein 13.2 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of the human base mismatch repair protein 13. 2 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method checks the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the number of residues in sequence ⁇ -the number of spacer residues in sequence ⁇ -the number of spacer residues X in sequence S can also be determined by the Clus ter method or using methods known in the art such as Jotun Hein. J., (1990) Methods in enzymology 183: 625-645) relations
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution such as negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having uncharged head groups are Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand means PT / CN01 / 00896 A nucleic acid strand complementary to the "sense strand”.
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the epitope of human base mismatch repair protein 13.2.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human base mismatch repair protein 13.2 means human base mismatch repair protein 13.2 is substantially free of other proteins, lipids, carbohydrates, or other substances that are naturally associated with it. Those skilled in the art can use standard protein purification techniques to purify human base mismatch repair proteins 13.2. Essentially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. Human base mismatch repair protein 13.2 The purity of the peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human base mismatch repair protein 13.2, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
- the invention also includes fragments, derivatives and analogs of human base mismatch repair protein 13.2.
- fragments, derivatives and analogs of human base mismatch repair protein 13.2 As used in the present invention, the terms “fragment”, “derivative” and “analog” refer to substantially maintaining the present invention Human base mismatch repair protein 13. 2 Polypeptides with the same biological function or activity.
- a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ ) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 782 bases, and its open reading frame 231-593 encodes 120 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile to a similar protein: human MSH6, and it can be deduced that the human base mismatch repair protein 13.2 has similar functions to human MSH6.
- the polynucleotide of the present invention may be in the form of DM or RNA.
- DNA forms include cDM, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DM can be coded or non-coded.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is a polynucleotide A replacement form, which may be a substitution, deletion or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes.
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- stringent conditions refers to: (1) hybridization and wash under lower ionic strength and higher temperature, such as 0. 2 xSSC, 0.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human base mismatch repair protein 13.2.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human base mismatch repair protein 13.2 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- the genes of the present invention can be screened from these CDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RM hybridization; ( 2 ) the appearance or loss of marker gene function; (3) determination of the transcript of human base mismatch repair protein 13.2 Level; (4) by immunological techniques or measuring organisms To detect gene expression of protein products. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein products of the 13.2 gene expression of human base mismatch repair protein can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- a method for amplifying DM / RNA by PCR is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human base mismatch repair protein 13.2 coding sequence, and the recombinant technology to produce the Said method of polypeptide.
- a polynucleotide sequence encoding a human base mismatch repair protein 13.2. can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- vectors usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
- promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a human base mismatch repair protein 13.2 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetic engineering containing the polynucleotide or the recombinant vector.
- Host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, M g Cl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, Or conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.
- polynucleotide sequence of the present invention can be used to express or produce recombinant human base mismatch repair protein 13. 2 (Science, 1984; 224: 1431). Generally, the following steps are followed:
- polynucleotide (or variant) of the present invention encoding human human base mismatch repair protein 13.2, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- the main function of human MSH6 in the human body is to repair base mismatches.
- Abnormal expression of human MSH6 can cause various tumors and is related to tumor resistance.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of human MSH6 protein, and both have similar biological functions.
- the polypeptide of the present invention has the function of correcting mismatched bases in the body and preventing malignant transformation of cells.
- Abnormal expression of the polypeptide can cause malignant transformation of cells, which in turn leads to the occurrence of various tumor diseases. These diseases include but are not limited to:
- Digestive system tumors salivary gland tumors, esophageal cancer, esophageal leiomyosarcoma, primary small cell carcinoma of the esophagus, gastric cancer, gastric malignant lymphoma, colorectal cancer, colon cancer, intestinal malignant lymphoma, primary liver cancer, hepatoblastoma , Primary gallbladder cancer, pancreatic cancer
- Hematological and Lymphatic Tumors Acute Leukemia, Chronic Myeloid Leukemia, Chronic Lymphocytic Leukemia Hematopathy, malignant lymphoma (such as lymphatic reticulum, malignant lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, etc.), malignant histiocytosis
- Nervous system tumors astrocytoma, ependymoma, medulloblastoma, meningiomas, glioblastoma, acoustic neuroma, angiogenic tumor, pituitary adenoma, craniopharyngioma
- osteoid osteoma osteochondroma, chondroma, osteoblastoma, chondroblastoma, etc.
- malignant bone tumors such as giant cell tumor of bone, osteosarcoma, chondrosarcoma, Ewing's sarcoma, myeloma urinary Reproductive system tumors: Benign tumors such as renal cortical tubular adenoma, eosinophil adenoma, juxtaglomerular cell tumor, polycystic kidney tumor, seminoma, teratoma, testicular stromal tumor, endometrium Interstitial tumors, hydatidiform moles, ovarian tumors, breast fibromas, malignant tumors such as cell carcinoma, renal sarcomatoid carcinoma, papillary renal cell carcinoma, nephroblastoma, prostate cancer, testicular tumor chorionic carcinoma, epididymal cancer, child Cervical cancer, endometrial cancer,
- Soft tissue tumors fibroma, fibrosarcoma, fibromatosis, lipoma, liposarcoma, leiomyoma, leiomyosarcoma, rhabdomyosarcoma, rhabdomyosarcoma, synovial tissue tumor, hemangioma, intramuscular hemangioma, blood vessels Globuloma, hemangioendothelial sarcoma, lymphangioma, lymphangiomyoma, lymphatic endothelial sarcoma, histiocytoma, malignant fibrous histiocytoma, soft tissue acinar sarcoma, clear cell sarcoma, myxoma, extraosseous Ewing's sarcoma, Soft tissue osteosarcoma, soft tissue chondrosarcoma, mesothelioma, epithelioid sarcoma, schwannomas, neurofibromas, malignant
- Skin malignancies dermal Mike cell tumor, Kaposi sarcoma, melanoma
- MSH consortia The main function of MSH consortia is to repair base mismatches. They play a key role in maintaining the fidelity of mitotic inheritance and the fidelity of meiotic separation. Its abnormal expression can cause various chromosomal diseases and lead to various congenital developmental abnormalities.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of human MSH6 protein, and both have similar biological functions.
- the polypeptide of the present invention has the function of correcting mismatched bases in the body, preventing genes and chromosomal abnormalities, and has abnormal expression Can lead to the occurrence of various chromosomal diseases, and in turn cause various congenital developmental abnormalities. These diseases include, but are not limited to:
- Transverse absentia congenital short limbs no arms, no forearms, no hands, no fingers, no legs, no toes Absence of longitudinal limbs: Absence of radial or ulnar side of the upper limb, absence of the tibial or fibula of the lower limb, seal-like hand or foot deformity
- Limb differentiation disorder Absence of a certain muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multi-finger (toe) deformity, and multi-finger (toe) deformity, horseshoe varus
- Atrial septal defect ventricular septal defect
- abnormal separation of arterial trunk such as aorta and pulmonary artery dislocation, aortic or pulmonary artery stenosis, pulmonary artery stenosis, open duct
- polypeptide of the present invention and its antagonists, agonists and inhibitors can be directly used in the treatment of various diseases, especially various tumors, various congenital malformations and the like.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human base mismatch repair protein 13.2.
- Agonists enhance human base mismatch repair protein 13.2 stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human base mismatch repair protein 13.2 can be cultured together with labeled human base mismatch repair protein 13.2 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human base mismatch repair protein 13.2 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of human base mismatch repair protein 13.2 can be repaired with human base mismatch 00896 Protein 13.2 binds and eliminates its function, or inhibits the production of the polypeptide, or binds to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- human base mismatch repair protein 13.2 When screening compounds as antagonists, human base mismatch repair protein 13.2 can be added to the bioanalytical assay, and the interaction between human base mismatch repair protein 13.2 and its receptor can be determined by determining the compound Influence to determine if a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. With the ones base mismatch repair protein I 3. 2 polypeptide molecule can be various possible combinations of amino acid random peptide library bound to a solid phase composition is obtained by screening. When screening, generally 13.2 molecules of human base mismatch repair protein should be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the human base mismatch repair protein 13.2 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced using human base mismatch repair protein 13.2 by direct injection of immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant, etc.
- Techniques for preparing monoclonal antibodies against human base mismatch repair protein 13.2 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cells Hybridoma technology, EBV-hybridoma technology, etc.
- Inlay antibodies that combine human constant regions and non-human variable regions can be produced using existing technologies (Morrison et al., PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human base mismatch repair protein 13.
- Antibodies against human base mismatch repair protein 13.2 can be used in immunohistochemical techniques to detect human base mismatch repair protein 13.2 in biopsy specimens.
- Monoclonal antibodies that bind to human base mismatch repair protein 13.2 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins against a specific bead site in the body.
- High affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human base mismatch repair protein 13. 2 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to human base mismatch repair protein 13. 2 Sick. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human base mismatch repair protein 13.2.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting human base mismatch repair protein 13.2.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human base mismatch repair protein 13.2 detected in the test can be used to explain the importance of human base mismatch repair protein 13. 2 in various diseases and to diagnose human base mismatch repair protein 13. 2 Diseases at work.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding human base mismatch repair protein 13.2 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human base mismatch repair protein 13.2. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human base mismatch repair protein 13.2 to inhibit endogenous human base mismatch repair protein 13.2 activity.
- a variant human base mismatch repair protein 13.2 may be a shortened human base mismatch repair protein 13.2 that lacks a signaling domain, although it can bind to downstream substrates, but lacks Signaling activity.
- the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human base mismatch repair protein 13.2.
- Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding human base mismatch repair protein 13.2. Into cells.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human base mismatch repair protein 13.2 can be found in the existing literature (Sambrook, et al.).
- the recombinant polynucleotide encoding human base mismatch repair protein 13.2. Can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RM and DNA
- ribozymes that inhibit human base mismatch repair protein 13.2 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
- Antisense RM, DNA, and ribozymes can be obtained using any existing RM or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
- RNA 'molecule can be obtained by in vitro or in vivo transcription of a DM sequence encoding the RNA. This DNA sequence has been integrated into the vector's RNA T N01 / 00896 Downstream of the polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human base mismatch repair protein 13.2 can be used for the diagnosis of diseases related to human base mismatch repair protein 13.2.
- the polynucleotide encoding human base mismatch repair protein 13. 2 can be used to detect the expression of human base mismatch repair protein 13. 2 or the abnormal expression of human base mismatch repair protein 13. 2 in a disease state.
- the DM sequence encoding human base mismatch repair protein 13.2 can be used to hybridize biopsy specimens to determine the expression status of human base mismatch repair protein 13.2.
- Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These technical methods are all mature technologies that are publicly available, and related kits are commercially available.
- a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DM chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human base mismatch repair protein 13.2 specific primers for RM-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the human base mismatch repair protein 13. 2 transcription products.
- Human base mismatch repair protein 13.2 gene mutations can also be used to diagnose human base mismatch repair protein 1 3.2 related diseases.
- Human base mismatch repair protein 13.2 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human base mismatch repair protein 13.2 DM sequences. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with markers for flow sorting, and pre-selection of hybridization, to construct chromosome-specific cDM library.
- Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human base mismatch repair protein 13.2 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of human base mismatch repair protein 13.2 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Separation Quik mRNA Isolat ion Ki t (Qiegene Co.) total RNA from poly (A) mRNA 0 2ug poly (A) mRNA is formed by reverse transcription cDNA. Use Smart cDM Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multicloning site of pBSK (+) vector (Clontech), and transformed into DH5a. The bacteria formed a CDM library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elraer
- the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDM sequence of one clone 0625H05 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- Primerl 5'- CAGCGTGGTCTCCGACAGAGCGGC-3, (SEQ ID NO: 3)
- Primer2 5'- TATCGTGACGCGCGCTTTATTGTT -3 '(SEQ ID NO: 4)
- Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Amplification reaction conditions 50 mmol / L C1, 10 mmol / L Tri s-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, lOpmol primer, 1U Taq DM polymerase (Clontech).
- the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min.
- ⁇ -act in was used as a positive control and template blank was used as a negative control at the time of PCR.
- Amplification products were purified using QIAGEN kit and TA The cloning kit was ligated to a pCR vector (Invitrogen). DM sequence analysis results showed that the DM sequence of the PCR product was exactly the same as the 1-782bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human base mismatch repair protein 13.2 gene expression Total RNA extraction in one step [Anal.
- This method includes acid guanidinium thiocyanate-chloroform Extraction: The tissue is homogenized with 4M guanidinium isothiocyanate-25raM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol are added. (49: 1), mixed and centrifuged. Aspirate the aqueous layer, add isopropyl alcohol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. Wash the obtained RM precipitate with 70% ethanol, dry and dissolve in water.
- RNA containing 2 0mM 3- (N- morpholino) propanesulfonic acid (PH7 0.) -.
- 2M subjected to electrophoresis on a 1.2% agarose formaldehyde gel ImM EDTA-2 - 5mM sodium acetate And then transferred to a nitrocellulose membrane.
- a labeled DNA probe was prepared by a random primer method using cc- 32 P dATP. The DNA probe used was the human base mismatch repair protein I amplified by PCR shown in FIG. 1 3. 2 coding sequence (231 bp to 593bp).
- the 32P- labeled probes (about 2 ⁇ 10 6 cpm / ml) and transferred to nitrocellulose membrane in RNA Solution at 42 ° C overnight hybridization, the solution containing 50% formamide (pH7. 4) -5 x SSC -5 x Denhardt's solution, and 20 ( ⁇ g / ml salmon sperm -25mM KH 2 P0 4 DNA. After hybridization, The filter was washed in 1 X SSC-0.1 ° /. SDS for 30 min at 55 ° C. Then, analysis and quantification were performed using Phosphor Imager.
- Example 4 Recombinant human base mismatch repair protein 13.2 in vitro expression , Isolation and purification According to the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:
- Pr imer 3 5'-CCCCATATGATGGGAAGTCATTGTGGCCATAAT-3 '(Seq ID No: 5)
- Primer4 5'-CCCAAGCTTTCATCCCCAGCCAGAGCCCAGGGC-3' (Seq ID No: 6)
- the 5 'ends of these two primers contain Ndel and Hindlll digestion sites, respectively Points, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
- the restriction sites of Mel and Hindlll correspond to the expression vector plasmid P ET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
- PCR was performed using the pBS-0625H05 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0625 ⁇ 05 plasmid, Primer 3 and Primer 4 were 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and Hindlll were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into coliform bacteria DH5a by the calcium chloride method, and cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were selected by colony PCR method and sequenced. Positive clone with correct sequence (PET-0625H05) was recombined by calcium chloride method
- the plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen).
- the host bacteria BL21 (pET-0625H05) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1mmol / L, and continued Incubate for 5 hours.
- the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation.
- the supernatant was collected by centrifugation, and chromatography was performed using an His.
- Bind Quick Cartridge product of Novagen
- 6His-Tag 6 histidines
- a peptide synthesizer (product of PE company) was used to synthesize the following human base mismatch repair protein 13. 2 specific peptides:
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit sera.
- the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
- the immunoprecipitation method proved that the purified antibody could specifically bind to human base mismatch repair protein 13.2.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention using a filter hybridization method.
- Filter membrane hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods, etc., all of which fix the polynucleotide sample to be tested on the filter The membranes were hybridized using essentially the same procedure.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- GC content is 30% -70%, if it exceeds, non-specific hybridization increases
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so as to be used in the following experimental steps
- the film was washed with high-strength conditions and strength conditions, respectively.
- the sample film was placed in a plastic bag pre-hybridization solution was added 3 -10mg (10xDenhardt's; 6xSSC, 0. lmg / ml CT DNA ( calf thymus DNA)). After sealing the bag, shake at 68 ° C for 2 hours.
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs as target DNA, including the present invention Polynucleotide. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DM on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRM was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Ol igotex raRNA Midi Kit (purchased from QiaGen).
- Reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amershara Phamacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargy) 2'-deoxyuridine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Araersham Phamacia Biotech Company, was used to label mRM of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification.
- Reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5'-triphate coupled to Cy3 f
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth Factor stimulation, 1024NT, scar-to-fc growth factor stimulation, 1013HT, scar-to-fc growth factor stimulation, 1 G13HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen , Prostate cancer, jejunum adenocarcinoma, cardia cancer. Based on these 17 Cy3 / Cy5 ratios, a bar graph is drawn (Figure 1). It can be seen from the figure that the human base mismatch repair protein 13.2 and similar proteins according to the present invention: the expression profile of human MSH6 is very similar
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2001289510A AU2001289510A1 (en) | 2000-06-07 | 2001-06-04 | Novel polypeptide--- the human base mismatch repair protein 13.2 and polynucleotide encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00116379.5 | 2000-06-07 | ||
CN 00116379 CN1326986A (zh) | 2000-06-07 | 2000-06-07 | 一种新的多肽——人碱基错配修复蛋白13.2和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2002020783A1 true WO2002020783A1 (fr) | 2002-03-14 |
Family
ID=4585783
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000896 WO2002020783A1 (fr) | 2000-06-07 | 2001-06-04 | Nouveau polypeptide, proteine humaine 13.2 de reparation du mesappariement de bases, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1326986A (zh) |
AU (1) | AU2001289510A1 (zh) |
WO (1) | WO2002020783A1 (zh) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997001634A2 (en) * | 1995-06-27 | 1997-01-16 | Istituto Di Ricerche Di Biologia Molecolare P. Angeletti S.P.A. | Polypeptide for repairing genetic information, nucleotidic sequence which codes for it and process for the preparation thereof (guanine thymine binding protein - gtbp) |
DE19909878A1 (de) * | 1999-03-06 | 2000-09-07 | Univ Dresden Tech | Neue Sequenzvarianten des menschlichen MSH6-Mismatch Repair Gens und ihre Verwendung |
-
2000
- 2000-06-07 CN CN 00116379 patent/CN1326986A/zh active Pending
-
2001
- 2001-06-04 AU AU2001289510A patent/AU2001289510A1/en not_active Abandoned
- 2001-06-04 WO PCT/CN2001/000896 patent/WO2002020783A1/zh active Application Filing
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997001634A2 (en) * | 1995-06-27 | 1997-01-16 | Istituto Di Ricerche Di Biologia Molecolare P. Angeletti S.P.A. | Polypeptide for repairing genetic information, nucleotidic sequence which codes for it and process for the preparation thereof (guanine thymine binding protein - gtbp) |
DE19909878A1 (de) * | 1999-03-06 | 2000-09-07 | Univ Dresden Tech | Neue Sequenzvarianten des menschlichen MSH6-Mismatch Repair Gens und ihre Verwendung |
Also Published As
Publication number | Publication date |
---|---|
AU2001289510A1 (en) | 2002-03-22 |
CN1326986A (zh) | 2001-12-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002006477A1 (en) | A novel polypeptide-homo topoisomerase 12.1 and polynucleotide encoding said polypeptide | |
WO2002026812A1 (fr) | Nouveau polypeptide, proteine de type humain 16.17 de liaison a la repetition adn cgg, et polynucleotide codant ce polypeptide | |
WO2002020783A1 (fr) | Nouveau polypeptide, proteine humaine 13.2 de reparation du mesappariement de bases, et polynucleotide codant ce polypeptide | |
WO2002014510A1 (fr) | Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide | |
WO2001092319A1 (en) | A NOVEL POLYPEPTIDE-HOMO TNF α RECEPTOR 19.68 AND POLYNUCLEOTIDE ENCODING SAID POLYPEPTIDE | |
WO2001090177A1 (fr) | Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide | |
WO2001092515A1 (fr) | Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide | |
WO2002006335A1 (fr) | Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide | |
WO2002040525A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 18.92, et polynucleotide codant ce polypeptide | |
WO2002048355A1 (fr) | Nouveau polypeptide, proteine garp humaine 12.98, et polynucleotide codant ce polypeptide | |
WO2001090352A1 (fr) | Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide | |
WO2002020584A1 (fr) | Nouveau polypeptide, proteine humaine de reparation de l'adn 10.23, et polynucleotide codant ce polypeptide | |
WO2001070956A1 (fr) | Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2002006470A1 (fr) | Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide | |
WO2002012318A1 (fr) | Nouveau polypeptide, glycosyl phosphatidylinositol polysaccharide f11.22, et polynucleotide codant ce polypeptide | |
WO2002012488A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 8.8, et polynucleotide codant ce polypeptide | |
WO2002012320A1 (fr) | Nouveau polypeptide, proteine humaine 12 liee a tnfr/ngfr contenant un domaine de cytochrome c, et polynucleotide codant ce polypeptide | |
WO2001090133A1 (fr) | Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide | |
WO2001090172A1 (fr) | Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide | |
WO2001090131A1 (fr) | Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide | |
WO2001090379A1 (fr) | Nouveau polypeptide, nucleoproteine basophile humaine 22.55, et polynucleotide codant ce polypeptide | |
WO2001090173A1 (fr) | Nouveau polypeptide, chaperonine humaine cpn60 10, et polynucleotide codant pour ce polypeptide | |
WO2002026814A1 (fr) | Nouveau polypeptide, proteine humaine 8.8 contenant quatre sequences repetees de polypeptides, et polynucleotide codant ce polypeptide | |
WO2002032948A1 (fr) | Nouveau polypeptide, proteine humaine de grande taille 10.12, et polynucleotide codant ce polypeptide | |
WO2001094532A2 (fr) | Nouveau polypeptide, proteine ribosomale l39 9, et polynucleotide codant ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |