WO2002020607A1 - Nouveau polypeptide, proteine associee a la biphenyl hydrolase humaine (bph-rp) 16.06, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine associee a la biphenyl hydrolase humaine (bph-rp) 16.06, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002020607A1
WO2002020607A1 PCT/CN2001/000908 CN0100908W WO0220607A1 WO 2002020607 A1 WO2002020607 A1 WO 2002020607A1 CN 0100908 W CN0100908 W CN 0100908W WO 0220607 A1 WO0220607 A1 WO 0220607A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
bph
polynucleotide
human
related protein
Prior art date
Application number
PCT/CN2001/000908
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2001289516A priority Critical patent/AU2001289516A1/en
Publication of WO2002020607A1 publication Critical patent/WO2002020607A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human biphenyl hydrolase-related protein (Bph-rp) 16.06, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • Hydrolases contain a serine residue in their active site.
  • This protein family is composed of many different members, including serine proteases, esterases, and lipases, which can catalyze various substrates and perform distinct biological functions. Although these members are significantly different, closely related proteins belonging to the serine-dependent hydrolase superfamily can be classified into several subfamilies based on substrate specificity or amino acid sequence similarity.
  • the common function of the biphenyl hydrolase-related protein subfamily is to degrade aromatic complexes, including the biphenyl derivatives phenol, toluene, and xylene (Derewenda, ZS, and Derewenda, U. (1991) Biochem. Cel l Biol. 69, 842-851) cosmic
  • Bph-rp Human biphenyl hydrolase-related protein
  • Bph-rp Human biphenyl hydrolase-related protein
  • the amino acid sequence of Bph-rp contains a glycine-X-serine-X-glycine characteristic sequence template.
  • the active serine residue is a catalytic residue and is involved in the degradation of aromatic complexes by hydrolytic enzymes.
  • the template is characterized by serine hydrolase. It is generally similar to several prokaryotic hydrolases involved in the degradation of aromatic complexes.
  • the human biphenyl hydrolase-related protein (Bph-rp) 16.06 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. There is a continuing need in the art to identify more human biphenylhydrolase-related protein (Bph-rp) 16.06 proteins involved in these processes, and in particular to identify the amino acid sequence of this protein. New human biphenyl hydrolase-related protein (Bph-rp) 16. 06
  • the isolation of the protein-coding gene also provides a basis for the study to determine the role of the protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human biphenylhydrolase-related protein (Bph- r p) 16.06.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human biphenyl hydrolase: "related protein (Bph-rp) 16.06.
  • Another object of the present invention is to provide a method for producing human biphenylhydrolase-related protein (Bph-rp) 16.06.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human biphenyl hydrolase-related protein (Bph-rp) 16.06.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human biphenylhydrolase-related protein (Bph-rp) 16.06.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormality of human biphenylhydrolase-related protein (Bph-rp) 16.06. Summary of invention
  • the invention relates to an isolated polypeptide, which is of human origin, and which comprises: SEQ ID No. 2 Amino acid sequence of a polypeptide, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 307-747 in SEQ ID NO: 1; and (b) a sequence having 1-1175 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human biphenylhydrolase-associated protein (Bph-rp) 16.06 protein activity, which comprises utilizing a polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or disease susceptibility related to the abnormal expression of human biphenylhydrolase-related protein (Bph-rp) 16.06 protein, which comprises detecting the polypeptide in the biological sample or its encoding multinucleus Mutations in the nucleotide sequence, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • Bph-rp human biphenylhydrolase-related protein
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to polypeptides and / or polynucleotides of the present invention prepared for use in the treatment of cancer, developmental or immune diseases, or other diseases due to abnormal expression of human biphenyl hydrolase-related protein (Bph-rp) 16.06. Use of drugs that cause disease.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human biphenylhydrolase-related protein (Bph-rp) 16.06 and human biphenylhydrolase-related protein (Bph-rp) of the present invention.
  • the picture above shows human biphenyl hydrolase-related protein (Bph- rp) 16.06 is a graph of the expression profile.
  • the figure below is a graph of the expression profile of human biphenylhydrolase-related protein (Bph-rp).
  • 1-bladder mucosa 2-PMA + Ecv304 cell line, 3- LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5-Fibroblas t, growth factor stimulation, 1024NT, 6- scar into fc growth factor Stimulation, 1013HT, 7-scar into fc without stimulation with growth factors, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetus Skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
  • FIG. 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human biphenyl hydrolase-related protein (Bph-rp) 16.06.
  • 16kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • Antagonist means that when combined with human biphenylhydrolase-related protein (Bph-rp) 16.06, a A molecule that can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human biphenylhydrolase-related protein (Bph-rp) 16.06.
  • Antagonist refers to a type that can block or regulate human biphenylhydrolase-related protein (Bph-rp) when combined with human biphenylhydrolase-related protein (Bph-rp) 16.06. ) 16. Biologically or immunologically active molecules of 16.06. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human biphenylhydrolase-related protein (Bph-rp) 16.06.
  • Regular refers to changes in the function of human biphenylhydrolase-related protein (Bph-rp) 16.06, including increased or decreased protein activity, changes in binding characteristics, and human biphenylhydrolase-related protein (Bph -rp) 16.06. any other biological, functional or immune change.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human biphenylhydrolase-related protein (Bph-rp) 16.06 using standard protein purification techniques.
  • Substantially pure human biphenyl hydrolase-related protein (Bph-rp) 16.06 produces a single main band on a non-reducing polyacrylamide gel.
  • Human biphenyl hydrolase-related protein (Bph-rp) 16. 06 The purity of the polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method checks each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
  • sequence identity percentage between the sequences A and B is calculated by the following formula ⁇ number may be measured as Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) methods in enzyraology 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution such as negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having uncharged head groups are Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (') 2 and? 7. It can specifically bind to the epitope of human biphenylhydrolase-related protein (Bph-rp) 16.06.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human biphenylhydrolase-related protein (Bph-rp) 16.06” refers to human biphenylhydrolase-related protein (Bph-rp) 16.06, which is substantially free of naturally associated proteins Other proteins, Lipids, sugars or other substances.
  • Those skilled in the art can purify human biphenylhydrolase-related protein (Bph-rp) 16.06 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human biphenyl hydrolase-related protein (Bph-rp) 16. 06 The purity of the polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide-human biphenylhydrolase-related protein (Bph-rp) 16.06, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptides of the invention may be glycosylated, or they may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of human biphenylhydrolase-related protein (Bph-rp) 16.06.
  • fragment refers to substantially maintaining the same biological function or activity of the human biphenylhydrolase-related protein (Bph-rp) 16.06 of the present invention Of peptides.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by the genetic code; or ( ⁇ ) such that one or more of the amino acid residues is substituted with other groups to include a substituent; or (in) such One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1175 bases in length and its open reading frames 307-747 encode 146 amino acids.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be encoded Chain or non-coding chain.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add a denaturant during hybridization, such as 50% ( ⁇ / ⁇ ) formamide, 0.1% calf serum / 0.1% Ficol l, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human biphenylhydrolase-related protein (Bph-rp) 16.06.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human biphenylhydrolase-related protein (Bph-rp) 16.06 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) Hybridization of genomic or cDNA libraries with probes to detect homologous multinucleates Nucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleotide fragments with common structural characteristics.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene). It is also a common method to construct a CDM library (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
  • CDM library Standard, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989.
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RM hybridization; (2) the presence or absence of marker gene functions; (3) determination of human biphenylhydrolase-related protein (Bph-rp) 16 The level of transcript of 06; (4) Detection of the protein product of gene expression by immunological techniques or determination of biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the human biphenylhydrolase-related protein (Bph-rp) 16. 06 gene expression protein product can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay Method (ELISA) and so on.
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay Method (ELISA) and so on.
  • a method (Sa iki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RM is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • Polynucleotide sequences of the gene of the present invention obtained as described above, or various DNA fragments can be used It is determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell using the vector of the present invention or directly using human biphenyl hydrolase-associated protein (Bph-rp) 16.06 coding sequence, and A method for producing a polypeptide according to the present invention by recombinant techniques.
  • a vector comprising the polynucleotide of the present invention, and a host cell using the vector of the present invention or directly using human biphenyl hydrolase-associated protein (Bph-rp) 16.06 coding sequence, and A method for producing a polypeptide according to the present invention by recombinant techniques.
  • Bph-rp human biphenyl hydrolase-associated protein
  • a polynucleotide sequence encoding a human biphenylhydrolase-related protein (Bph-rp) 16.06 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct recombinant expression vectors.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • DM sequences encoding human biphenylhydrolase-related protein (Bph-rp) 16.06 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DM synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manua 1, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pairs of the SV40 enhancer on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide for selection
  • selectable marker genes to provide for selection
  • the phenotypic traits of transformed host cells such as dihydrofolate reductase, neomycin resistance and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E. coli.
  • GFP green fluorescent protein
  • a polynucleotide encoding human biphenylhydrolase-related protein (Bph-rp) 16.06 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute the polynucleotide or the like.
  • Genetically engineered host cells for recombinant vectors refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS, or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (1 2 method used in the step are well known in the art. Alternatively, it is a MgCl 2.
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging Wait.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human biphenylhydrolase-related protein (Bph-rp) 16. 06 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
  • polynucleotide or variant encoding human human biphenylhydrolase-related protein (Bph-rp) 16.06 of the present invention, or a recombinant expression vector containing the polynucleotide for transformation or transduction A suitable host cell;
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include But not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic lysis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography , High performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic lysis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography , High performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Serine hydrolase is a functional hydrolase that contains a serine residue in its active site.
  • the protein family is composed of many different members, including serine proteases, esterases, and lipases, which can catalyze various substrates and perform distinct biological functions.
  • Human biphenyl hydrolase-related protein (Bph-rp) is a new human serine hydrolase whose main function is to degrade aromatic complexes, including biphenyl derivatives, phenol, xylene, and xylene. It is well known that aromatic compounds are closely related to the synthesis of many physiologically active substances such as cholesterol, aromatic amino acids, and Vi tK and Vi tE in the body.
  • the main function of human biphenyl hydrolase-related protein (Bph-rp) in the body is to degrade aromatic complexes.
  • Abnormal expression of human biphenyl hydrolase-related protein (Bph-rp) can affect the metabolism of aromatic complexes, which in turn affects the metabolism of related physiologically active substances, leading to related diseases. occur.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human-human biphenylhydrolase-related protein (Bph-rp), and both have similar biological functions.
  • the abnormal expression of the polypeptide of the present invention in vivo can affect the metabolism of aromatic compounds, and then affect the metabolism of related physiologically active substances, leading to the occurrence of related diseases, including but not limited to:
  • Hypercholesterolemia and various hyperlipoproteinemias (hyperlipoproteinemia II, III, IV, V), etc .;
  • Cardio-cerebral vessels angina pectoris, myocardial infarction, arrhythmia, coronary heart disease, metabolic cardiomyopathy, heart failure, cardiogenic shock (aorta, coronary arteries, cardiac microvasculature), transient ischemic attack, cerebral infarction, Lacunar infarction, cerebral hemorrhage (intracerebral artery), etc .;
  • Renal blood vessels renal artery stenosis, renal artery embolism and thrombosis, arteriolar renal sclerosis (benign, malignant), acute / chronic renal failure, etc .;
  • Fatty deposition diseases fatty liver, steatosis cardiomyopathy, steatosis nephropathy, etc .;
  • Vi tA night blindness, dry eye, bone retardation
  • Vi tE infertility, abortion, anemia, muscle wasting, neurodegeneration
  • Vi tK coagulation factors II, VII, IX, X deficiency
  • Vi tD3 child rickets, adult osteomalacia, kidney stones), etc .
  • steatosis fat malabsorption of fat-soluble vitamins
  • gallbladder cholesterol stones
  • biliary cirrhosis etc.
  • Glucocorticoid cortisol: high / low blood sugar, muscle wasting, osteoporosis, delayed wound healing, infection, concentric obesity, water poisoning (headache, convulsions, coma), mental disorders, etc .;
  • Mineralocorticoid aldosterone: edema, hypertension, high / low blood sodium (headache, convulsions, coma), high / low blood potassium (muscle paralysis, arrhythmia, renal failure, paralytic intestinal obstruction, drowsiness, Coma) etc;
  • Sex hormones (testosterone, progesterone, estrogen): abnormal sexual development, abortion, 'breast cancer, etc .; 3. other metabolic disorders:
  • Aromatic amino acids (mental disorders, coma), epinephrine / norepinephrine (arrhythmia, hypertension, shock), thyroxine (hyperthyroidism, hypothyroidism), etc .;
  • polypeptides of the present invention and the antagonists, agonists and inhibitors of the polypeptides can be directly used in the treatment of a variety of diseases, such as disorders of cholesterol metabolism disorders, disorders of aromatic amino acid metabolism disorders, epinephrine / norepinephrine, thyroid Disorders of metabolic disorders.
  • the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human biphenyl hydrolase-related protein (Bph-rp) 16.06.
  • Agonists increase human biphenylhydrolase-related protein (Bph-rp) 16. 06 stimulates biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing human biphenylhydrolase-related protein (Bph-rp) 16.06 can be labeled with a labeled human biphenylhydrolase-related protein (Bph-rp) in the presence of a drug. 16. 06 Cultivate together. The ability of the drug to increase or suppress this interaction is then measured.
  • Antagonists of human biphenylhydrolase-related protein include antibodies, compounds, receptor deletions, and the like that were screened out.
  • Antagonist of human biphenylhydrolase-related protein (Bph-rp) 16.06 can bind to human biphenylhydrolase-related protein (Bph-rp) 16.06 and eliminate its function, or inhibit the production of the polypeptide Or, in combination with the active site of the polypeptide, the polypeptide cannot perform biological functions.
  • human biphenyl hydrolase-related protein (Bph-rp) 16. 06 can be added to the bioanalytical assay, and the human biphenyl hydrolase-related protein (Bph- rp) 16.06 and the effect of its interactions to determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human biphenylhydrolase-related protein (Bph-rp) 16.06 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human biphenylhydrolase-related protein (Bph-rp) 16.06 molecules should be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the present invention also provides an antibody against a human biphenylhydrolase-related protein (Bph-rp) 16.06 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • polyclonal antibodies can be obtained by direct injection of human biphenylhydrolase-related protein (Bph-rp) 16.06 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance immunity
  • the reaction includes, but is not limited to, Freund's adjuvant and the like.
  • Techniques for preparing monoclonal antibodies against human biphenylhydrolase-related protein (Bph-rp) 16.06 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), three tumors Technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies U.S. Pat No. 4946778, can also be used to produce single-chain antibodies against human biphenylhydrolase-related protein (Bph-rp) 16.06.
  • Antibodies against human biphenyl hydrolase-related protein (Bph-rp) 16. 06 can be used in immunohistochemistry to detect human biphenyl hydrolase-related protein (Bph-rp) 16. 06 in biopsy specimens.
  • Monoclonal antibodies that bind to human biphenylhydrolase-related protein (Bph-rp) 16.06 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body. Such as human biphenyl hydrolase-related protein (Bph-rp) 16. 06 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human biphenylhydrolase-related protein ( Bph-rp) 16. 06 positive cells.
  • a thiol cross-linking agent such as SPDP
  • the antibodies in the present invention can be used to treat or prevent diseases related to human biphenylhydrolase-related protein (Bph-rp) 16.06.
  • Administration of appropriate doses of antibodies can stimulate or block the production or activity of human biphenylhydrolase-related protein (Bph-rp) 16.06.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human biphenylhydrolase-related protein (Bph-rp) 16.06. These tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human biphenylhydrolase-related protein (Bph-rp) 16.06 detected in the test can be used to explain the importance of human biphenylhydrolase-related protein (Bph-rp) 16.06 in various diseases and for Diagnose diseases where human biphenylhydrolase-related protein (Bph-rp) 16.06 works.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human biphenylhydrolase-related protein (Bph-rp) 16.06 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human biphenylhydrolase-related protein (Bph-rp) 16.06.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human biphenylhydrolase-related protein (Bph-rp) 16.06 to inhibit endogenous human biphenylhydrolase-related protein (Bph-rp ) 16.06 activity.
  • a mutated human biphenylhydrolase-related protein (Bph-rp) 16.06 may be a shortened human biphenylhydrolase-related protein (Bph-rp) 16.06, which is missing from the signaling domain.
  • the downstream substrate binds but lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human biphenylhydrolase-related protein (Bph-rp) 16.06.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, parvovirus, etc.
  • a polynucleotide encoding human biphenylhydrolase-related protein (Bph-rp) 16.06 can be used to transfer a polynucleotide encoding human biphenylhydrolase-related protein (Bph-rp) 16.06 to in the cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human biphenylhydrolase-related protein (Bph-rp) 16.06 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human biphenylhydrolase-related protein (Bph-rp) 16.06 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense A and DM
  • ribozymes that inhibit human biphenylhydrolase-related protein (Bph-rp) 16.06 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RM, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis methods has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence is integrated Downstream of the RNA polymerase promoter to the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human biphenylhydrolase-related protein (Bph-rp) 16.06 can be used for diagnosis of diseases related to human biphenylhydrolase-related protein (Bph-rp) 16.06.
  • Polynucleotides encoding human biphenylhydrolase-related protein (Bph-rp) 16.06 can be used to detect the expression of human biphenylhydrolase-related protein (Bph-rp) 16.06 or humans in disease states Abnormal expression of biphenyl hydrolase-related protein (Bph-rp) 16.06.
  • a DNA sequence encoding human biphenylhydrolase-related protein (Bph-rp) 16.06 can be used to hybridize biopsy specimens to determine the expression of human biphenylhydrolase-related protein (Bph-rp) 16.06.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • RNA-polymerase chain reaction in vitro amplification can also detect human biphenylhydrolase-related protein (Bph-rp) 16.
  • 06's transcript production detects human biphenylhydrolase-related protein (Bph-rp) 16. Mutations in the 06 gene can also be used to diagnose human biphenylhydrolase-related protein (Bph-rp) 16.06-related diseases.
  • Human biphenylhydrolase-related protein (Bph-rp) 16.06 mutations include point mutations and translocations compared to normal wild-type human biphenylhydrolase-related protein (Bph-rp) 16.06 DNA sequences , Deletions, reorganizations, and any other abnormalities.
  • Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • sublocalization can be achieved by a similar method using a set of fragments from a specific chromosome or a large number of genomic clones.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human biphenylhydrolase-related protein (Bph-rp) 16.06 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human biphenylhydrolase-related protein (Bph-rp) 16.06 administered to a patient will depend on many factors, such as the mode of administration, The condition of the therapist and the judgment of the diagnostician. Examples
  • Total RM of human fetal brain was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) raRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Smart cDNA cloning kit (purchased from Clontech ⁇ cDNA fragment was inserted into the multi-cloning site of pBSK (+) vector (Clontech)) to transform DH5 a to form a cDNA library.
  • Dye terminate cycle react ion sequencing ki t Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequences were compared with existing public DNA sequence databases (Genebank). By comparison, the cDNA sequence of one of the clones 0609E07 was found to be new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragment of the clone in both directions.
  • CDNA was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification using Q i agene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- GAATACCATAAGGGTTTTATGAAA -3 '(SEQ ID NO: 3)
  • Primer2 5'- ACTGCACCCAGCTAATTTTTTGTA -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 mmol / L KC1, 10 mmol / L Tri s-HCl, pH 8.5, 1.5 mfflol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, lOpmol primers, 1U Taq DNA polymerase (Clontech). Reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30 sec; 72 ° C 2min. 0 ⁇ -act in Positive control and template blank are negative controls.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen).
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1175bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human biphenylhydrolase-related protein (B P h-rp) 16. 06 gene expression
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RM was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7. 4) -5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ral salmon sperm DM. After hybridization, the filter was washed in lx SSC-0. 1% SDS at 55 ° C for 30 minutes. Then, Analysis and quantification using Phosphor Imager. 'Example 4 Recombinant human biphenylhydrolase-related protein (Bph-rp) 16. 06 in vitro expression, isolation and purification
  • Pr imer3 5'-CCCCATATGATGGAGGCCAGCATGCCATTTCAT-3 '(Seq ID No: 5)
  • Pr imer4 5' -CATGGATCCTCAATTTTGAAAGGGGAAGAAAGA-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively Points, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • the pBS-0609E07 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • PCR reaction conditions are: total volume 50 ⁇ 1
  • the pBS-0609E07 plasmid contained 10 pg
  • the primers Primer-3 and Primer-4 contained 1 Opmol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively.
  • Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into the colibacillus DH5 cx by the calcium chloride method. After being cultured on LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1) overnight, positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0609E07) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host strain BL21 (pET-0609E07) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1IM 0 1 / L, continue to culture for 5 hours. Centrifuge to collect bacterial cells, decompose by ultrasound, collect the supernatant by centrifugation, and use an affinity chromatography column His s. Bind Quick Cartridge that can bind 6 histidines (6His-Tag). (Product of Novagen) was chromatographed to obtain purified human biphenyl hydrolase-related protein (Bph-rp) 16. 06.
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once. Using 15 ⁇
  • a g / ml bovine serum albumin peptide complex-coated titer plate was used for ELISA to determine the antibody titer in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the polypeptide bound to cyanogen bromide-activated S e pharose4B column, by affinity chromatography from total IgG isolated anti-polypeptide antibody.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human biphenylhydrolase-related protein (Bph-rp) 16.06.
  • Bph-rp human biphenylhydrolase-related protein
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to Identifying whether it contains the polynucleotide sequence of the present invention and detecting a homologous polynucleotide sequence, further The probe is used to detect whether the expression of the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof in cells of normal tissues or pathological tissues is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt) ⁇
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • Step ⁇ 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1,000 g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1x10 8 cells / ml). Use a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 7 cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or at 37 ° C. C gently shake overnight.
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; finding and screening for tissue specificity New genes, especially those related to diseases such as tumors; Diagnosis of diseases, such as hereditary diseases.
  • the specific method steps have been reported in the literature. For example, see DeRis i, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And Helle, RA, Schema, M., Chai, A., Shalom, D.,
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the DNA was fixed on the glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) using a one-step method, and raRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • Fluorescent reagent Cy3dUTP (5_Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino-propargyl -2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • fluorescent reagent Cy5dUTP (5- Amino-propargyl -2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent
  • the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1 Q24NC, Fibroblas t, growth factor stimulation, 1024NT, scar-like fc growth Factor stimulation, 1013HT, scar into fc without stimulation with growth factor, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer .

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Wood Science & Technology (AREA)
  • Public Health (AREA)
  • Genetics & Genomics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine associée à la biphényl hydrolase humaine (Bph-rp) 16.06, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des troubles du métabolisme du cholestérol, des troubles du métabolisme des acides aminés aromatiques et des troubles du métabolisme de l'adrénaline/noradrénaline et de la thyroxine. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine associée à la biphényl hydrolase humaine (Bph-rp) 16.06.
PCT/CN2001/000908 2000-06-07 2001-06-04 Nouveau polypeptide, proteine associee a la biphenyl hydrolase humaine (bph-rp) 16.06, et polynucleotide codant ce polypeptide WO2002020607A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001289516A AU2001289516A1 (en) 2000-06-07 2001-06-04 A new polypeptide-human biphenyl hydrolase-related protein (bph-rp)16.06 and thepolynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116386.8 2000-06-07
CN00116386A CN1327065A (zh) 2000-06-07 2000-06-07 一种新的多肽——人联苯水解酶－相关蛋白(Bph－rp)16.06和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002020607A1 true WO2002020607A1 (fr) 2002-03-14

Family

ID=4585790

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000908 WO2002020607A1 (fr) 2000-06-07 2001-06-04 Nouveau polypeptide, proteine associee a la biphenyl hydrolase humaine (bph-rp) 16.06, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1327065A (fr)
AU (1) AU2001289516A1 (fr)
WO (1) WO2002020607A1 (fr)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
FURUNO N. ET AL.: "Complete nucleotide sequence of the human RCC1 gene involved in coupling between DNA replication and mitosis", GENOMICS, vol. 11, no. 2, 1991, pages 459 - 461 *
PUENTE X.S. ET AL.: "Cloning and expression analysis of a novel human serine hydrolase with sequence similarity to prokaryotic enzymes involved in the degradation of aromatic compounds", J. BIOL. CHEM., vol. 270, no. 21, 1995, pages 12926 - 12932 *

Also Published As

Publication number Publication date
CN1327065A (zh) 2001-12-19
AU2001289516A1 (en) 2002-03-22

Similar Documents

Publication Publication Date Title
WO2001074879A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s3-12, et polynucleotide codant pour ce polypeptide
WO2002020607A1 (fr) Nouveau polypeptide, proteine associee a la biphenyl hydrolase humaine (bph-rp) 16.06, et polynucleotide codant ce polypeptide
WO2002002613A1 (fr) Nouveau polypeptide, proteine humaine de liaison 38.72 au sterol de type oxygene, et polynucleotide codant ce polypeptide
WO2001083743A1 (fr) Polypeptide sous-unite 11 d'adducine alpha de globule rouge humain et polynucleotide codant pour ce polypeptide
WO2002026809A1 (fr) Nouveau polypeptide, proteine transmembranaire 35.31 possedant un domaine permettant la duplication de facteurs de croissance epidermique, et polynucleotide codant ce polypeptide
WO2001048221A1 (fr) Nouveau polypeptide, colipase 12, et polynucleotide codant pour ce polypeptide
WO2002012314A1 (fr) Nouveau polypeptide, proteine-1 humaine associee a la dihydropyrimidinase (drp-1) 9.68, et polynucleotide codant ce polypeptide
WO2001071003A1 (fr) Nouveau polypeptide, serine protease humaine 8, et polynucleotide codant pour ce polypeptide
WO2001090348A1 (fr) Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide
WO2002012297A1 (fr) Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide
WO2001085923A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 9.2, et polynucleotide codant pour ce polypeptide
WO2001094371A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001070785A1 (fr) Nouveau polypeptide, serine proteinase humaine atp-dependante 13, et polynucleotide codant pour ce polypeptide
WO2002020591A1 (fr) Nouveau polypeptide, recepteur du complement 12, et polynucleotide codant ce polypeptide
WO2001072986A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 10, et polynucleotide codant pour ce polypeptide
WO2001075038A2 (fr) Nouveau polypeptide, serine hydrolase humaine 9 atp-dependante, et polynucleotide codant pour ce polypeptide
WO2001075005A2 (fr) Nouveau polypeptide, sous-unite c de l'atpase pompe a protons vacuolaire (v-atpase) 12, et polynucleotide codant pour ce polypeptide
WO2002020575A1 (fr) Nouveau polypeptide, proteine humaine 10 associee aux maladies auto-immunes, et polynucleotide codant ce polypeptide
WO2001096524A2 (fr) Nouveau polypeptide, recepteur humain sigma 10.67, et polynucleotide codant ce polypeptide
WO2002020785A1 (fr) Nouveau polypeptide, proteine humaine 11 associee au syndrome de parkinson, et polynucleotide codant ce polypeptide
WO2001079508A1 (fr) Nouveau polypeptide, proteine porteuse mitochondriale humaine 18, et polynucleotide codant pour ce polypeptide
WO2001092287A1 (fr) Nouveau polypeptide, phosphatase acide 14, et polynucleotide codant ce polypeptide
WO2002006473A1 (fr) Nouveau polypeptide, proteine humaine 10.01 associee au recepteur d'oestrogene, et polynucleotide codant ce polypeptide
WO2001094407A1 (fr) Nouveau polypeptide, enzyme de conjugaison de l'ubiquitine humaine 10.01, et polynucleotide codant ce polypeptide
WO2001092318A1 (fr) Nouveau polypeptide, proteine kringle 14, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP