WO2002020591A1 - Nouveau polypeptide, recepteur du complement 12, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, recepteur du complement 12, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2002020591A1 WO2002020591A1 PCT/CN2001/000929 CN0100929W WO0220591A1 WO 2002020591 A1 WO2002020591 A1 WO 2002020591A1 CN 0100929 W CN0100929 W CN 0100929W WO 0220591 A1 WO0220591 A1 WO 0220591A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- complement receptor
- sequence
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70596—Molecules with a "CD"-designation not provided for elsewhere
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide-complement receptor 12, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. Background technique
- E-CR Erythrocyte complement receptor
- UC C3b / C4b immune tolerance complex
- UC human factor I-transduced cleavage Factor
- the E-CR1 system is an important person that provides safety protection for the IC cycle.
- E-CR belongs to complement receptor type I (CR1) (Fearon, D. T. et al., 1980 J. Exp. Med. 152: 20).
- the CR1 molecule is one of the regulators of C activation (RCA).
- RCA regulators are a group of C3b and C4b binding proteins that regulate RCA in their own tissues and circulation.
- Human CR1 is expressed in most peripheral blood cells, with almost more than 85% of the total circulating CR1 in red blood cells (Siegel, Let al., 1981 Lancet 2: 556).
- Human CR1 is a single-chain glycoprotein. According to the molecular weight, human CR1 protein can be divided into four allotypes, mainly A or F. Correspondingly, CR1 transcripts are divided into four types from 1.3KD to 1.5KD.
- CR1-A extracellular polypeptides consist of 30 repeat units, each repeat unit contains 59-76 amino acids, called short consensus repeats SCRs (Klickstein, LB et al., 1987 J. Exp. Med. 165 : 1095) (Hourcade, D. et al., 1988J. Exp. Med. L68: 1255). Of all the repeating units, every 7 repeating units have the highest homology, so these 7 repeating units are further defined as long homologous repeats (LHRs).
- LHRs long homologous repeats
- the CR1-A type contains 4 LHRs, and the first two SCRs in most three N-terminal LHRs are specific binding sites for the ligand.
- SCRsl and SCRs2 mainly specifically combine C4b, SCRs8 and SCRs9, SCRsl5 and SCsR16 mainly specifically combine C3b (lickstein, L.B. et al., 1988 J. Exp. Med. 168: 1699).
- Orangutan E-CR1 has 98.8% homology with human 220, OOOMr CR1. It may be another splicing form of human E-CR1 precursor mRNA.
- the 8 SCRs encoded by the orangutan E-CR1 gene are followed by a 24 amino acid hydrophobic region, followed by a stop code. The presence of this stop code in the C-terminal hydrophobic region indicates that the protein may be unstable, although these 24 amino acid sequences provide sufficient hydrophobic regions for complete membrane adhesion. (lein, P. et al., 1985 Biochira. Biophys. Acta. 815: 468)
- Orangutan E-CR1 head 6.5 SCRs are closest to human head 6.5 SCRs (Hourcade, D. etal., 1990 J. Biol. Chem. 265: 974).
- the complement receptor 12 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so there is always a need in the art to identify more complements that participate in these processes.
- Receptor 12 protein especially the amino acid sequence of this protein is identified. Isolation of the gene encoding the new complement receptor 12 protein also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a method for producing complement receptor 12.
- Another object of the present invention is to provide antibodies against the polypeptide-complement receptor 12 of the present invention.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide-complement receptor 12 of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of complement receptor 12.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 409-747 in SEQ ID NO: 1; and (b) a sequence having 1-1294 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit complement receptor 12 protein activity, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of complement receptor 12 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a mutation in a biological sample.
- the amount or biological activity of a polypeptide of the invention comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a mutation in a biological sample.
- the present invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of complement receptor 12.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when bound to complement receptor 12, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind the complement receptor 12.
- Antagonist refers to a molecule that, when bound to complement receptor 12, can block or modulate the biological or immunological activity of complement receptor 12.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind complement receptor 12.
- Regulation refers to a change in the function of complement receptor 12, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of complement receptor 12.
- Substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify complement receptor 12 using standard protein purification techniques. Substantially pure Complement receptor 12 can generate a single main band on a non-reducing polyacrylamide gel. The purity of complement receptor 12 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Sou thern blot or Nor thern blot, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences be combined with each other as a specific or selective interaction.
- Percent identity means the sequence is the same or similar in the comparison of two or more amino acid or nucleic acid sequences Percentage.
- the percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.).
- the MEGALIGN program can compare two or more sequences based on different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0
- the Clus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
- the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the epitope of complement receptor 12.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if natural Material, the original environment is the natural environment).
- natural Material the original environment is the natural environment.
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated complement receptor 12 means that complement receptor 12 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify complement receptor 12 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the complement receptor 12 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide-complement receptor 12, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of complement receptor 12.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the complement receptor 12 of the present invention.
- the fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length nucleotide sequence of 1294 bases, and its open reading frame of 409-747 encodes 112 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile as the complement receptor, and it can be inferred that the complement receptor 12 has a similar function as the complement receptor.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding Code chain.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
- These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50 ° /. (V / v) formamide, 0.1 ° /. Calf serum / 0.1 ° /.
- hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding complement receptor 12.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- polynucleotide sequence encoding the complement receptor 12 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) Isolation of double-stranded DNA from genomic DNA Sequence; 2) chemically synthesize a DNA sequence to obtain double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Various methods have been developed for mRNA extraction, and kits are also commercially available (Qiagene;).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of complement receptor 12 transcripts; (4) passing Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2,000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of complement receptor 12 gene expression can be detected using immunological techniques such as
- a method using PCR technology to amplify DNA / RM (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention.
- the RACE method RACE-rapid cDNA end rapid amplification method
- the primers for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a complement receptor 12 coding sequence, and the production of the present invention by recombinant technology Said method of polypeptide.
- a polynucleotide sequence encoding the complement receptor 12 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers and adenoviral enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- the polynucleotide encoding the complement receptor 12 or the recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- Bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- polynucleotide sequence of the present invention can be used to express or produce recombinant complement receptors 12 (Scence, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- Fig. 1 is a comparison diagram of gene chip expression profiles of complement receptor 12 and complement receptor of the present invention. Pictured above is the complement receptor
- Figure 12 shows a graph of the complement of the complement receptor.
- 1-bladder mucosa 2-PMA + Ecv304 cell line, 3-LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1 024NC, 5-Fibroblas t, growth factor stimulation, 1024NT, 6- scar into fc growth factor stimulation, 1013HT, 7- scar into fc without growth factor stimulation, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetal skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated complement receptor 12. 12kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik raRNA I solat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- the Smart cDNA cloning kit purchased from Clontech) was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ to form a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0749 g 07 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
- Pr iraerl 5,-GTCTATAAATATGATAAGCAAGTG -3, (SEQ ID NO: 3)
- Pr imer 2 5'- CTGAATTGAATGTCTTTAATTTCA -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Pr imer2 is the 3′-end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions 50 mmol / L KC1, 10 crypto ol / L Tris-Cl, (pH8.5), 1.5 mmol / L MgCl 2) 200 ⁇ mol / L dNTP, lOpmol in a reaction volume of 50 ⁇ 1 Primer, 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
- ⁇ -actin was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit. DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1294bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of complement receptor 12 gene expression:
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- Primer3 5 '-CATGCTAGCATGTCATCACAGTGCCTAGAAACT-3' (Seq ID No: 5)
- Primer4 5'-CATGGATCCTTAAAAAAAGGAAGAAAAAGAAAG-3 '(Seq ID No: 6)
- the 5' ends of these two primers contain Nhel and BamHI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively.
- Nhel and BamHI restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
- the PCR reaction was performed using the pBS-0749 g 07 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1, containing 10 pg of pBS-0749g07 plasmid, primers? 1 ⁇ 0161 "-3 and ⁇ : 1: 111161: -4 min! Also for 1 ( ⁇ 11101, Advantage polymerase Mix (Clontech) Product) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E.
- a peptide synthesizer (product of PE company) was used to synthesize the following complement receptor 12-specific peptides:
- NH2-Met-Ser-Ser-Gln-Cys-Leu-Glu-Thr-Arg-Thr-Val-I le-Tyr-Arg-Ser-C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For the method, see: Avraraeas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin-polypeptide complex with complete Freund's adjuvant. After 15 days, the rabbits were immunized with hemocyanin-polypeptide complex and incomplete Freund's adjuvant once.
- a titer plate coated with a 15 ⁇ g / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum.
- Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit serum.
- the peptide was bound to a Sepharos B column activated by cyanogen bromide, and the anti-peptide antibody was separated from the total IgG by affinity chromatography.
- the immunoprecipitation method demonstrated that the purified antibody specifically binds to complement receptor 12.
- Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the invention; the second type of probes are partially related to the invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The region is compared for homology. If the homology with the non-target molecule region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 which belongs to the first class of probes, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (right) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- Two NC membranes are required for each probe, so that it can be used in subsequent experiments.
- the film is washed with high-strength conditions and strength conditions, respectively.
- probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
- Example 7 DNA Mi croarray
- Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature, for example, see the literature DeR i s i, J. L., Lyer, V. & Brown, P. 0.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian Company, USA). The distance between points is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen), and separated by reverse transcription.
- Photo reagent Cy3dUTP (5-Amino-propargyl-2'_deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino-propargy 2 2 ' -deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification.
- Photo reagent Cy3dUTP (5-Amino-propargyl-2'_deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amers
- the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar into fc growth factor stimulation 1013HT, scar into fc without stimulation with growth factor, 1013HC, bladder Cystocarcinoma cells EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell lines, placenta, spleen, prostate cancer, jejunal adenocarcinoma, cardia cancer. Draw a chart based on these 17 Cy3 / Cy5 ratios. (figure 1 ). It can be seen from the figure that the complement receptor 12 and complement receptor expression profiles according to the present invention are very similar.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Toxicology (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2001295371A AU2001295371A1 (en) | 2000-06-12 | 2001-06-11 | A novel polypeptide-homo complement receptor 12 and polynucleotide encoding saidpolypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00116438 CN1327991A (zh) | 2000-06-12 | 2000-06-12 | 一种新的多肽——补体受体12和编码这种多肽的多核苷酸 |
CN00116438.4 | 2000-06-12 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2002020591A1 true WO2002020591A1 (fr) | 2002-03-14 |
Family
ID=4585842
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000929 WO2002020591A1 (fr) | 2000-06-12 | 2001-06-11 | Nouveau polypeptide, recepteur du complement 12, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1327991A (fr) |
AU (1) | AU2001295371A1 (fr) |
WO (1) | WO2002020591A1 (fr) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114703146B (zh) * | 2022-01-19 | 2023-03-10 | 山西农业大学 | 一种杂交瘤细胞株及其应用 |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPH0867636A (ja) * | 1994-08-30 | 1996-03-12 | Yamanouchi Pharmaceut Co Ltd | 播種性血管内凝固症候群(dic)の予防治療薬 |
WO1997011601A1 (fr) * | 1995-09-28 | 1997-04-03 | The Johns Hopkins University School Of Medicine | Procede pour empecher le rejet de xenogreffes par les receveurs de transplants |
WO1997031944A1 (fr) * | 1996-03-02 | 1997-09-04 | Adprotech Plc | Fragments de recepteur du complement de type 1 et leurs utilisations |
WO1998045430A1 (fr) * | 1997-04-05 | 1998-10-15 | Mathilda And Terence Kennedy Institute Of Rheumatology | Modulation de l'immunite a l'aide de polypeptides apparentes au cr1 |
-
2000
- 2000-06-12 CN CN 00116438 patent/CN1327991A/zh active Pending
-
2001
- 2001-06-11 WO PCT/CN2001/000929 patent/WO2002020591A1/fr unknown
- 2001-06-11 AU AU2001295371A patent/AU2001295371A1/en not_active Abandoned
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPH0867636A (ja) * | 1994-08-30 | 1996-03-12 | Yamanouchi Pharmaceut Co Ltd | 播種性血管内凝固症候群(dic)の予防治療薬 |
WO1997011601A1 (fr) * | 1995-09-28 | 1997-04-03 | The Johns Hopkins University School Of Medicine | Procede pour empecher le rejet de xenogreffes par les receveurs de transplants |
WO1997031944A1 (fr) * | 1996-03-02 | 1997-09-04 | Adprotech Plc | Fragments de recepteur du complement de type 1 et leurs utilisations |
WO1998045430A1 (fr) * | 1997-04-05 | 1998-10-15 | Mathilda And Terence Kennedy Institute Of Rheumatology | Modulation de l'immunite a l'aide de polypeptides apparentes au cr1 |
Also Published As
Publication number | Publication date |
---|---|
CN1327991A (zh) | 2001-12-26 |
AU2001295371A1 (en) | 2002-03-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002020591A1 (fr) | Nouveau polypeptide, recepteur du complement 12, et polynucleotide codant ce polypeptide | |
WO2002012314A1 (fr) | Nouveau polypeptide, proteine-1 humaine associee a la dihydropyrimidinase (drp-1) 9.68, et polynucleotide codant ce polypeptide | |
WO2001090348A1 (fr) | Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide | |
WO2001092315A1 (fr) | Nouveau polypeptide, proteine humaine d'epissage 10.56, et polynucleotide codant ce polypeptide | |
WO2001074865A1 (fr) | Nouveau polypeptide, proteine a doigt de zinc 10, et polynucleotide codant pour ce polypeptide | |
WO2001075117A1 (fr) | Nouveau polypeptide, tyrosinase humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2002012297A1 (fr) | Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide | |
WO2001081594A1 (fr) | Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide | |
WO2001066584A1 (fr) | Nouveau polypeptide, proteine humaine pax 9, et polynucleotide codant pour ce polypeptide | |
WO2001092518A1 (fr) | Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide | |
WO2001072986A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 10, et polynucleotide codant pour ce polypeptide | |
WO2001079432A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide | |
WO2002012315A1 (fr) | Nouveau polypeptide, proteine mid1 10.56 du gene de type « ring finger », et polynucleotide codant ce polypeptide | |
WO2002020575A1 (fr) | Nouveau polypeptide, proteine humaine 10 associee aux maladies auto-immunes, et polynucleotide codant ce polypeptide | |
WO2001094596A1 (fr) | Nouveau polypeptide, recepteur humain 21.23 de purine, et polynucleotide codant ce polypeptide | |
WO2002006473A1 (fr) | Nouveau polypeptide, proteine humaine 10.01 associee au recepteur d'oestrogene, et polynucleotide codant ce polypeptide | |
WO2002020779A1 (fr) | Nouveau polypeptide, proteine humaine plp 40.15, et polynucleotide codant ce polypeptide | |
WO2001070792A1 (fr) | Nouveau polypeptide, tyrosinase humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2002006332A1 (fr) | Nouveau polypeptide, proteine humaine de liaison de fk506, et polynucleotide codant ce polypeptide | |
WO2001073041A1 (fr) | Nouveau polypeptide, adn ligase humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001066728A1 (fr) | Nouveau polypeptide, proteine humaine 11 du gene de reparation de mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001087968A1 (fr) | Proteine s4-36 ribosomale, polypeptide humain, et polynucleotide la codant | |
WO2002026971A1 (fr) | Nouveau polypeptide, facteur de transcription humain lcr-f112.1, et polynucleotide codant ce polypeptide | |
WO2001047969A1 (fr) | Nouveau polypeptide, proteine de translocation nucleaire i10, et polynucleotide codant pour ce polypeptide | |
WO2001083682A2 (fr) | Nouveau polypeptide, proteine pax humaine 11.6, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
NENP | Non-entry into the national phase |
Ref country code: JP |