WO2002020785A1 - Nouveau polypeptide, proteine humaine 11 associee au syndrome de parkinson, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, proteine humaine 11 associee au syndrome de parkinson, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2002020785A1 WO2002020785A1 PCT/CN2001/000904 CN0100904W WO0220785A1 WO 2002020785 A1 WO2002020785 A1 WO 2002020785A1 CN 0100904 W CN0100904 W CN 0100904W WO 0220785 A1 WO0220785 A1 WO 0220785A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- syndrome
- related protein
- human parkinson
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human Parkinson's syndrome-related protein 11, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides.
- this protein is very similar to the N-terminus of ubiquitin protein, in which conserved lysine residues are necessary for polyubiquitin chain formation; the rest of the parkin protein sequence is rich in cysteine, and The C-terminus of the protein sequence also contains a RING zinc finger protein motif: Cys-X2-Cys-X9-Cys-Xl-Hi s-X2- [Cys-X4-Cys] -X4-Cys-X2-Cys 0 It is considered that this protein is a member of the zinc finger protein RING protein family and has similar biological functions as other members of the zinc finger protein family [Tohru Ki tada, Shui chi Asakawa et a l., 1998, Nature, 392 : 605-608].
- parkin plays an important regulatory role in the development of the nervous system of the organism, and it involves the study of the pathogenesis of various neurodegenerative diseases.
- the C-terminus of this protein contains a highly conserved RING structure motif of the zinc finger protein RING protein family.
- This protein shares similar biological functions with other members of the zinc finger protein family. It is involved in regulating the differentiation, growth, and development of various related tissue cells in the body, and its mutation or abnormal expression will cause abnormal development and growth of related tissues, and then cause various related diseases.
- the protein is usually closely related to the development of various nervous system development and metabolic disorders, immune system diseases and related tissue tumors and cancers in vivo. It can also be used to diagnose and treat various diseases mentioned above.
- the human Parkinson's syndrome-related protein 11 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so the identification of more participants has been required
- These processes of the human Parkinson's syndrome-related protein 11 protein in particular, identify the amino acid sequence of this protein. Isolation of the new Parkinson's syndrome-related protein 11 protein-encoding gene also provides the basis for research to determine its role in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human Parkinson's syndrome-related protein 11.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human Parkinson's syndrome related protein 11.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human Parkinson's syndrome related protein 11.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human Parkinson's syndrome-related protein 11. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 216-518 in SEQ ID NO: 1; and (b) a sequence having 1-1252 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human Parkinson's syndrome-related protein 11 protein, which comprises using the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of a human Parkinson's syndrome-related protein 11 protein, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human Parkinson's syndrome-related protein 11.
- FIG. 1 is a comparison diagram of gene chip expression profiles of the inventor's Parkinson's syndrome-related protein 11 and human parkinson's syndrome-related protein.
- the upper graph is a graph of the expression profile of human Parkinson's syndrome-related protein 11, and the lower graph is the graph of the expression profile of human Parkinson's syndrome-related protein.
- 1-bladder mucosa 2-PMA + Ecv304 cell line, 3-LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5-Fibroblas t, growth factor stimulation, 1024NT, 6- scar fc growth factor Stimulation, 1013HT, 7-scar scar into fc without stimulation with growth factors, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetus Skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human Parkinson's syndrome-related protein 11.
- l lkDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- Antagonist refers to a protein that, when combined with human Parkinson's syndrome-associated protein 11 Molecules whose white matter changes to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human Parkinson's syndrome-related protein 11.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human Parkinson's syndrome-related protein 11 when combined with human Parkinson's syndrome-related protein 11.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human Parkinson's syndrome related protein 11.
- Regular refers to a change in the function of human Parkinson's syndrome-related protein 11, including an increase or decrease in protein activity, a change in binding properties, and any other biological properties, functions, or immunity of human Parkinson's syndrome-related protein 11. Change of nature.
- Substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human Parkinson's syndrome related proteins 11 using standard protein purification techniques.
- Substantially pure human Parkinson's syndrome-related protein 11 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of the human Parkinson's syndrome related protein 11 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to target sequences under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences based on different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues matching sequence ⁇
- the number of residues in the sequence-the number of sequence residues (the number of spacer residues in sequence 3-the number of spacer residues in sequence 3 can also be determined by Clus ter method or using methods well known in the art) such as Jotun Hein J., (1990) Methods in enzymology 183: 625-645) 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution such as negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having uncharged head groups are Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ,) 2 and? 7. It can specifically bind to the epitope of human Parkinson's syndrome-related protein 11.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human Parkinson's syndrome-related protein 11 means that human Parkinson's syndrome-related protein 11 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human Parkinson's syndrome related proteins using standard protein purification techniques. 11. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human Parkinson's syndrome related protein 11 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a novel polypeptide-human Parkinson's syndrome-related protein 11, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
- the invention also includes fragments, derivatives and analogs of human Parkinson's syndrome related protein 11.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human Parkinson's syndrome-related protein 11 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ⁇ ) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence). As set forth herein, such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1252 bases and its open reading frame 216-518 encodes 100 amino acids.
- this peptide has a similar expression profile to that of human Parkinson's syndrome-related protein, and it can be deduced that the human Parkinson's syndrome-related protein 11 has similar functions to human Parkinson's syndrome-related protein.
- the polynucleotide of the present invention may be in the form of DM or RNA.
- DM forms include cDNA, genomic DM, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- degenerate variants in the present invention It refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences
- the hybridization occurs only when the identity between them is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 and Active.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human Parkinson's syndrome-related protein 11.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human Parkinson's syndrome-related protein 11 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) Isolation of double-stranded DNA from genomic DNA Sequence; 2) chemically synthesize a DNA sequence to obtain a double-stranded DM of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDM of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RM hybridization; (2) the presence or loss of marker gene function; (3) determination of the level of transcripts of human Parkinson's syndrome-related protein 11; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used alone or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used herein is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of human Parkinson's syndrome-associated protein 11 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- a method (Sa iki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RM is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DM / RM fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. To obtain the full-length CDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones before they can be spliced. Long cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human Parkinson's syndrome related protein 11 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
- a polynucleotide sequence encoding human Parkinson's syndrome-related protein 11 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually incorporate a replication origin, a promoter, a marker gene, and translational regulatory elements.
- Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human Parkinson's syndrome-related protein 11 and appropriate transcription / translation regulatory elements. These methods include in vitro recombination DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human Parkinson's syndrome-related protein 11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CHO, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (1 2 method used in the step are well known in the art. Alternatively, it is a MgCl 2.
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging Wait.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human Parkinson's syndrome-related protein 11 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention and the antagonists, agonists and inhibitors of the polypeptides can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and Immune diseases, etc.
- Parkinson's syndrome is a common neurodegenerative disease with complex clinical features. Studies have found that mutations or deletions of the q25. 2-q27 locus on the sixth human chromosome are the main causes of autosomal recessive juvenile Parkinson's syndrome. Mutations or abnormal expression of the protein encoded by this site will lead to the development of juvenile Parkinson's syndrome. It can be seen that the protein encoded by this site plays an important regulatory role in the development and growth of related nervous systems in vivo.
- Human Parkinson's syndrome-related protein (Parkin's protein) is a new protein associated with the development of Parkinson's syndrome. This protein is expressed in various human tissues, including brain, heart, testis, and skeletal muscle.
- the protein In the brain, the protein is expressed in a variety of regions, including in the brain substantia nigra. Mutations or deletions in the exon will cause Parkinson's syndrome.
- the C-terminus of this protein contains a highly conserved RING structure motif of the zinc finger protein RING protein family. This protein shares similar biological functions with other members of the zinc finger protein family. It is involved in regulating the differentiation, growth, and development of various related tissue cells in the body, and its mutation or abnormal expression will cause abnormal development and growth of related tissues, and then cause various related diseases.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of human Parkinson's syndrome-related protein (Parkin), and both have similar biological functions.
- the polypeptide of the present invention is involved in regulating the differentiation, growth, and development of various related tissue cells in vivo, and its mutation or abnormal expression will cause abnormal development and growth of related tissues, and then cause various related disorders, including but not limited to:
- Frontal lobe dementia, personality changes (frontal frontal), strabismus, inability to write (back middle frontal gyrus), motor aphasia (back lower frontal gyrus), loss of smell (bottom of frontal lobe), limb paralysis, Convulsions (central gyrus), etc .;
- Parietal lobe sensory disturbance (central posterior gyrus), dyslexia (left corner gyrus), body image disorder (right parietal lobe), etc .;
- Temporal lobe Hookback attack (anterior temporal lobe), sensory / amnestic aphasia (left temporal lobe), hearing impairment (rear superior temporal gyrus), etc.
- Occipital lobe hemianopia, hallucinations, visual disagreement, etc.
- V. Limbic system emotional symptoms, memory loss, disturbance of consciousness, hallucinations, etc.
- various congenital heart diseases atrial deficiency, ventricular deficiency
- male sexual development disorders and the like
- the polypeptide of the present invention and antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of various diseases, For example, cerebral cortical dysfunction diseases, extrapyramidal dysfunction diseases, cerebellar dysfunction diseases, various congenital heart diseases, and male sexual development disorders.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human Parkinson's syndrome related protein 11.
- Agonists enhance human Parkinson's syndrome-related protein 11 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or a membrane preparation expressing human Parkinson's syndrome-related protein 11 can be cultured with labeled human Parkinson's syndrome-related protein 11 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human Parkinson's syndrome-related protein 11 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human Parkinson's syndrome-related protein 11 can bind to human parkinson's syndrome-related protein 11 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
- human Parkinson's syndrome-related protein 11 When screening compounds as antagonists, human Parkinson's syndrome-related protein 11 can be added to a bioanalytical assay, and the compounds can be identified by measuring the effect of the compound on the interaction between human Parkinson's syndrome-related protein 11 and its receptor. Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human Parkinson's syndrome-related protein 11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the 11 molecules of human Parkinson's syndrome-related protein should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the present invention also provides antibodies against human Parkinson's syndrome-related protein 11 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human Parkinson's syndrome-related protein 11 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
- Techniques for preparing monoclonal antibodies to human Parkinson's syndrome-related protein 11 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma Technology, EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morr i son et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human Parkinson's syndrome-related protein 11.
- Antibodies against human Parkinson's syndrome-related protein 11 can be used in immunohistochemistry to detect human Parkinson's syndrome-related protein 11 in biopsy specimens.
- Monoclonal antibodies that bind to human Parkinson's syndrome-related protein 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human Parkinson's syndrome-related protein 11 High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human Parkinson's syndrome-related protein 11 positive Cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to human Parkinson's syndrome-related protein 11.
- Administration of appropriate doses of antibodies can stimulate or block the production or activity of human Parkinson's syndrome related protein 11.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human Parkinson's syndrome related protein 11.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human Parkinson's syndrome-related protein 11 detected in the test can be used to explain the importance of human Parkinson's syndrome-related protein 11 in various diseases and to play a role in the diagnosis of human Parkinson's syndrome-related protein 11. disease.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- human Parkinson's syndrome-related protein 11 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human Parkinson's syndrome-related protein 11.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human Parkinson's syndrome-related protein 11 to inhibit endogenous human Parkinson's syndrome-related protein 11 activity.
- a mutated human Parkinson's syndrome-related protein 11 may be a shortened human Parkinson's syndrome-associated protein 11 that lacks a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity.
- the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human Parkinson's syndrome-related protein 11.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. are available for transferring a polynucleotide encoding human Parkinson's syndrome-related protein 11 into cells.
- Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human Parkinson's syndrome-related protein 11 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human Parkinson's syndrome-related protein 11 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human Parkinson's syndrome related protein 11 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DNA synthesis technology. For example, solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides has been widely used.
- Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM. This DM sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human Parkinson's syndrome-related protein 11 can be used for the diagnosis of diseases related to human Parkinson's syndrome-related protein 11.
- the polynucleotide encoding human Parkinson's syndrome-related protein 11 can be used to detect the expression of human Parkinson's syndrome-related protein 11 or the abnormal expression of human Parkinson's syndrome-related protein 11 in the disease state.
- the DM sequence encoding human Parkinson's syndrome-related protein 11 can be used to hybridize biopsy specimens to determine the expression of human Parkinson's syndrome-related protein 11.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available.
- Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DM chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- a DM chip also known as a "gene chip”
- Human Parkinson's syndrome-related protein 11 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human Parkinson's syndrome-related protein 11 transcription products.
- Human Parkinson's syndrome-associated protein 11 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human Parkinson's syndrome-associated protein 11 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern Blotting and Wes tern blotting can indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition contains a safe and effective amount of the polypeptide or antagonist and does not affect Pharmaceutically effective carriers and excipients. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human Parkinson's syndrome related protein 11 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of human Parkinson's syndrome-related protein 11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Smart cDNA cloning kit (purchased from Clontech 1) was inserted into the multi-cloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ to form a cDNA library.
- Dye terminate cycle react ion sequencing ki t Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequences were compared with existing public DNA sequence databases (Genebank). By comparison, it was found that the cDNA sequence of one of the clones 06 4 5A11 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragment of the clone in both directions.
- the G645A11 clone contained a full-length cDM of 1252bp ( As shown in Seq ID N0: l), there is a 302bp open reading frame (0RF) from the 2nd 16bp to 518bp, which encodes a new protein (as shown in Seq ID NO: 2).
- this clone pBS -0645A11 the encoded protein is named human Parkinson's syndrome related protein 11.
- Example 2 The gene encoding human Parkinson's syndrome-related protein 11 was cloned by RT-PCR. The total RNA from fetal brain cells was used as a template, and oligo-dT was used as a primer for reverse transcription reaction to synthesize cDNA. , Using the following primers for PCR amplification:
- Pr imer 1 5, — CACCAACTAAAACTGTGGGTTTCA—3, (SEQ ID NO: 3)
- Pr imer2 5'- TAAAGAAAGTCAGATGTATTAGAA -3 '(SEQ ID NO: 4)
- Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Amplification reaction conditions A reaction volume of 50 ⁇ l contains 50 ⁇ l / L KCl, 10 mmol / L Tris-HCl, pH 8. 5, 1. 5 mmol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, lOpmol primer, 1U of Taq DNA polymerase (product of Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
- ⁇ -act in was used as a positive control and template blank was used as a negative control.
- the amplified products were purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen). DM sequence The analysis results showed that the DNA sequence of the PCR product was exactly the same as l-1252bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of the expression of human Parkinson's syndrome related protein 11 gene Total A [Anal. Biochem 1987, 162, 156-159] 0 This method involves acid guanidinium thiocyanate phenol-chloroform extraction.
- Example 4 In vitro expression, isolation and purification of recombinant human Parkinson's syndrome-related protein 11 Based on the sequence of the coding region shown in SEQ ID NO: 1 and FIG. 1, a pair of specific amplification primers were designed.
- Pr imer 3 5'-CATGGATCCATGGGATCTGTTAGCATCAGTTCC-3 '(Seq ID No: 5)
- Pr imer4 5'-CCCCTCGAGTTAAAGCACCAAATGTGCGCCTGC-3' (Seq ID No: 6)
- the 5 'ends of these two primers contain Xhol and Xhol digestion respectively Site, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
- the Xhol and Xhol restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
- the PCR reaction was performed using the pBS-0645A11 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 contains 10 pg of pBS-0645All plasmid, primer Primer-3 and Primer-4 points; j is l Opmol, Advantage polymerase Mix
- Cycle parameters 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
- Xhol and Xhol were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into Ca. bacillus DH5 ⁇ by the calcium chloride method.
- the LB plate with a final concentration of 3 was cultured overnight, and the positive clones were selected by colony PCR method and sequenced.
- the positive clones with the correct sequence (pET-0645A11) were selected to transform the recombinant plasmid into the large intestine by the calcium chloride method BL21 (DE3) plySs (product of Novagen).
- the host bacteria BL21 (pET-0645A11) was cultured at 37 ° C to the logarithmic growth phase. Add IPTG to a final concentration of 1 ol / L, and continue to culture for 5 hours. Centrifuge to collect bacteria, sonicate the bacteria, centrifuge to collect the supernatant, and use an affinity layer capable of binding to 6 histidines (6His-Tag). Analytical column Hi s. Bind Quick Cartridge
- NH2-Met-Gly-Ser-Val-Ser-I le-Ser-Ser-Thr-Leu-Leu-Leu-Glu-Ala-Met- C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemis try, 1969; 6: 43. Rabbits were immunized with 4 mg of the above-mentioned jfe cyanin polypeptide complex and complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex and incomplete Freund's adjuvant were used to boost immunity once.
- the titer of antibody in rabbit serum was determined by ELISA using a titer plate coated with 15 ⁇ ⁇ / ⁇ 1 bovine serum albumin polypeptide complex.
- Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose.
- the peptide was bound to a desert cyanide-activated Seph arOS e4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation proves that purified antibodies can specifically interact with human Parkinson's syndrome Guanin 11 binds.
- Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- the selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- GC content is 30 ° /. -703 ⁇ 4, beyond which non-specific hybridization increases;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used; 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- the sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (1 OxDenhardt's; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
- 3-1 Omg pre-hybridization solution (1 OxDenhardt's; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)
- Hybridization Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake in a 42 C water bath overnight. Wash film:
- probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
- Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. , M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDMs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in an ultraviolet cross-linker. After elution, the slides were fixed to fix the DM on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen).
- J Cy3dUTP (5-Amino-propargy 1-2 '-deoxyur idine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino- propargyl-2'-deoxyuridine 5'-tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech The company) labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare the probe.
- Cy5dUTP (5-Amino- propargyl-2'-deoxyuridine 5'-tr iphate coupled to Cy
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodicovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar-like fc growth factor stimulation 1013HT, scar into fc not stimulated with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardia cancer. Based on these 17 Cy3 / Cy5 ratios, a histogram is drawn (Figure 1). It can be seen from the figure that the expression profiles of human Parkinson's syndrome-related protein 11 and human Parkinson's syndrome-related protein according to the present invention are very similar.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2001289514A AU2001289514A1 (en) | 2000-06-07 | 2001-06-04 | Novel polypeptide---a human parkinson's disease related protein 11 and polynucleotide encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00116368 CN1326980A (zh) | 2000-06-07 | 2000-06-07 | 一种新的多肽——人帕金森综合症相关蛋白11和编码这种多肽的多核苷酸 |
CN00116368.X | 2000-06-07 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2002020785A1 true WO2002020785A1 (fr) | 2002-03-14 |
Family
ID=4585772
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000904 WO2002020785A1 (fr) | 2000-06-07 | 2001-06-04 | Nouveau polypeptide, proteine humaine 11 associee au syndrome de parkinson, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1326980A (fr) |
AU (1) | AU2001289514A1 (fr) |
WO (1) | WO2002020785A1 (fr) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999060019A1 (fr) * | 1998-05-20 | 1999-11-25 | Smithkline Beecham Corporation | GENE EDG3sb HUMAIN |
-
2000
- 2000-06-07 CN CN 00116368 patent/CN1326980A/zh active Pending
-
2001
- 2001-06-04 AU AU2001289514A patent/AU2001289514A1/en not_active Abandoned
- 2001-06-04 WO PCT/CN2001/000904 patent/WO2002020785A1/fr active Application Filing
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999060019A1 (fr) * | 1998-05-20 | 1999-11-25 | Smithkline Beecham Corporation | GENE EDG3sb HUMAIN |
Also Published As
Publication number | Publication date |
---|---|
AU2001289514A1 (en) | 2002-03-22 |
CN1326980A (zh) | 2001-12-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001090176A1 (fr) | Nouveau polypeptide, keratine humaine 45.87, et polynucleotide codant ce polypeptide | |
WO2002020785A1 (fr) | Nouveau polypeptide, proteine humaine 11 associee au syndrome de parkinson, et polynucleotide codant ce polypeptide | |
WO2001094406A1 (fr) | Nouveau polypeptide, dihydropyridine-acide dicarboxylique deshydrogenase 21, et polynucleotide codant ce polypeptide | |
WO2001092515A1 (fr) | Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide | |
WO2002012315A1 (fr) | Nouveau polypeptide, proteine mid1 10.56 du gene de type « ring finger », et polynucleotide codant ce polypeptide | |
WO2001092518A1 (fr) | Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide | |
WO2002012314A1 (fr) | Nouveau polypeptide, proteine-1 humaine associee a la dihydropyrimidinase (drp-1) 9.68, et polynucleotide codant ce polypeptide | |
WO2001090177A1 (fr) | Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide | |
WO2002012297A1 (fr) | Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide | |
WO2001090348A1 (fr) | Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide | |
WO2001090352A1 (fr) | Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide | |
WO2001092315A1 (fr) | Nouveau polypeptide, proteine humaine d'epissage 10.56, et polynucleotide codant ce polypeptide | |
WO2002004501A1 (fr) | Nouveau polypeptide, $g(b)-glucosaccharase humaine 11.88, et polynucleotide codant ce polypeptide | |
WO2001090133A1 (fr) | Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide | |
WO2001079434A2 (fr) | Nouveau polypeptide, signal peptidase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001075125A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 31, et polynucleotide codant pour ce polypeptide | |
WO2002020575A1 (fr) | Nouveau polypeptide, proteine humaine 10 associee aux maladies auto-immunes, et polynucleotide codant ce polypeptide | |
WO2001096524A2 (fr) | Nouveau polypeptide, recepteur humain sigma 10.67, et polynucleotide codant ce polypeptide | |
WO2002026971A1 (fr) | Nouveau polypeptide, facteur de transcription humain lcr-f112.1, et polynucleotide codant ce polypeptide | |
WO2001094534A2 (fr) | Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide | |
WO2001092324A1 (fr) | Nouveau polypeptide, nucleoproteine humaine 10.78 basophile, et polynucleotide codant ce polypeptide | |
WO2001090131A1 (fr) | Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide | |
WO2002002768A1 (fr) | Nouveau polypeptide, recepteur peptidique natriuretique humain 9, et polynucleotide codant ce polypeptide | |
WO2001090379A1 (fr) | Nouveau polypeptide, nucleoproteine basophile humaine 22.55, et polynucleotide codant ce polypeptide | |
WO2001094533A2 (fr) | Nouveau polypeptide, proteine humaine 13 de regulation de la proteine phosphorylase, et polynucleotide codant ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |