WO2002020578A1 - Nouveau polypeptide, aspartate transferase mitochondriale humaine 37.29, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, aspartate transferase mitochondriale humaine 37.29, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002020578A1
WO2002020578A1 PCT/CN2001/001009 CN0101009W WO0220578A1 WO 2002020578 A1 WO2002020578 A1 WO 2002020578A1 CN 0101009 W CN0101009 W CN 0101009W WO 0220578 A1 WO0220578 A1 WO 0220578A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
aspartate aminotransferase
human mitochondrial
mitochondrial aspartate
Prior art date
Application number
PCT/CN2001/001009
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU2001295394A priority Critical patent/AU2001295394A1/en
Publication of WO2002020578A1 publication Critical patent/WO2002020578A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1096—Transferases (2.) transferring nitrogenous groups (2.6)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, namely human mitochondrial aspartate aminotransferase 37. 29, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique
  • the biochemical reaction is completed through the regulation of proteins in the body. Genes affect metabolism by controlling the synthesis of these proteins. Mutations in these genes can affect the structure and number of corresponding protein molecules, and change their physiological functions, leading to abnormal metabolism. Amino acids are components of proteins in the body. Abnormal amino acid metabolism can cause many serious diseases.
  • Enzymes involved in glutamate metabolism such as glutamate dehydrogenase, ornithine aminotransferase, glutaminase, aspartate aminotransferase, etc., are mainly found in the mitochondria.
  • Aspartate aminotransferase is an intracellular enzyme that plays a role in the metabolism of amino acids and sugars. The reaction catalyzed is the catalysis of aspartic acid and homoglutaric acid into oxaloacetate and glutamic acid:
  • L one aspar tate + 2-oxog lutara te oxa l oaceta te + L-g lutama te It is abundant in liver, skeletal muscle, brain, red blood cells and heart. When the tissue is destroyed, it is released into the blood. ⁇
  • bile duct obstruction cholangitis, choledocholithiasis, etc.
  • mononucleosis alcoholic hepatitis and cirrhosis
  • liver abscess metabolic or primary liver cancer
  • myocardial infarction myopathy
  • muscle nutrition Disorders dermatomyositis
  • rhabdomyolysis ischemic liver injury or hypoxic injury
  • ischemic liver injury or hypoxic injury can be found in aspartate aminotransferase levels.
  • the present invention is named human mitochondrial aspartate aminotransferase 37. 29.
  • the human mitochondrial aspartate aminotransferase 37. 29 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, it has been necessary to identify more proteins in the field.
  • the human mitochondrial aspartate aminotransferase 37. 29 protein which is mostly involved in these processes, especially identifies the amino acid sequence of this protein. Isolation of the new human mitochondrial aspartate aminotransferase 37. 29 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of a diagnostic and / or therapeutic agent for disease 1 and it is therefore important to isolate its coding DM. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human mitochondrial aspartate aminotransferase 37. 29.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human mitochondrial aspartate aminotransferase 37. 29.
  • Another object of the present invention is to provide a method for producing human mitochondrial aspartate aminotransferase 37. 29.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human mitochondrial aspartate aminotransferase 37. 29.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human mitochondrial aspartate aminotransferase 37.29.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to human mitochondrial aspartate aminotransferase 37. 29 abnormality.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the present invention also relates to an isolated polynucleotide, which comprises a nucleotide sequence or a variant thereof selected from the group-.
  • sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 A sequence of positions 276-1295; and (b) a sequence of positions 1-1644 in SEQ ID NO: 1.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human mitochondrial aspartate aminotransferase 37. 29 protein, which comprises using the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human mitochondrial aspartate aminotransferase 37. 29 protein, comprising detecting mutations in the polypeptide or a sequence encoding the polynucleotide in a biological sample. Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for the treatment of cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human mitochondrial aspartate aminotransferase 37. 29 .
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • “Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human mitochondrial aspartate aminotransferase 37.29, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human mitochondrial aspartate aminotransferase 37. 29.
  • Antagonist refers to a biological or immunological activity that can block or regulate human mitochondrial aspartate aminotransferase 37. 29 when combined with human mitochondrial aspartate aminotransferase 37. 29 Molecule.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human mitochondrial aspartate aminotransferase 37. 29.
  • Regular refers to changes in the function of human mitochondrial aspartate aminotransferase 37. 29, including an increase or decrease in protein activity, changes in binding characteristics, and any other biological properties of human mitochondrial aspartate aminotransferase 37. 29 , Functional or immune properties.
  • Substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human mitochondrial aspartate aminotransferase 37 using standard protein purification techniques. 29. Basically pure human mitochondrial aspartate aminotransferase 37. 29 can produce a single main band on a non-reducing polyacrylamide gel. Human mitochondrial aspartate aminotransferase 37. 29 The purity of the polypeptide can be analyzed by amino acid sequence .
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Perfect identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
  • the MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: sequence A and sequence.
  • the number of matching residues between B and X 100
  • the number of spacer residues in number sequence B can also be determined by Clus ter method or using methods known in the art such as Jotun Hein.
  • the percent identity between nucleic acid sequences He in J., (1990) Methods in emzumo logy 183: 625 -645) 0 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (') 2 and? , which can specifically bind to human mitochondrial aspartate aminotransferase 37. 29 epitope.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, It is also possible that such a polynucleotide or polypeptide is part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human mitochondrial aspartate aminotransferase 37. 29 means human mitochondrial aspartate aminotransferase 37. 29 is substantially free of other proteins, lipids, carbohydrates or other substances naturally associated with it. Those skilled in the art can purify human mitochondrial aspartate aminotransferase 37. 29 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human mitochondrial aspartate aminotransferase 37. 29 The purity of the polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human mitochondrial aspartate aminotransferase 37. 29, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives, and analogs of human mitochondrial aspartate aminotransferase 37. 29.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human mitochondrial aspartate aminotransferase 37. 29 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or
  • polypeptide sequences (such as leader sequences or secretory sequences or sequences used to purify this polypeptide or protein sequences) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes SEQ ID NO: 1 Nucleotide sequence.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1644 bases in length and its open reading frame 276-1295 encodes 339 amino acids.
  • this polypeptide has a similar expression profile to mitochondrial aspartate aminotransferase, and it can be inferred that the human mitochondrial aspartate aminotransferase 37. 29 has similar functions to mitochondrial aspartate aminotransferase.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, preferably at least 100 nucleotides or more.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human mitochondrial aspartate aminotransferase 37. 29.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human mitochondrial aspartate aminotransferase 37. 29 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA library is also a common method (Sambrook, et al.,
  • genes of the present invention can be sistered from these cDM libraries by conventional methods. These methods include (but are not limited to): (1) DM-DNA or DNA-RM hybridization; (2) the presence or absence of marker gene functions; (3) determination of the transcript of human mitochondrial aspartate aminotransferase 37. 29 Level; (4) detecting protein products of gene expression by immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of the human mitochondrial aspartate aminotransferase 37. 29 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Amplification of DNA / RNA by PCR (Saiki, et al. Science
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human mitochondrial ⁇ aspartate transgene 37.29 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
  • the polynucleotide sequence encoding the human mitochondrial and asparaginase 37.29 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human mitochondrion and aspartate transgene 37.29 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide the synthesis of raRNA. Representative examples of these promoters are: the lac or trp promoter of E.
  • Expression vector also includes a nucleus for translation initiation Glycosome binding sites and transcription terminators. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs. They act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human mitochondrial aspartate aminotransferase 37. 29 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetic engineering containing the polynucleotide or the recombinant vector.
  • Host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS, or Bowes s melanoma cells, etc. .
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the 01 12 method, the steps used are well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human mitochondrial aspartate aminotransferase 37. 29 (Scence, 1984; 224: 1431). Generally speaking, there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. When host cells grow to proper After inducing the cell density, the appropriate promoter (such as temperature conversion or chemical induction) is used to induce the selected promoter, and the cells are cultured for a period of time.
  • the appropriate promoter such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • the physical, chemical, and other properties can be used to separate and purify the recombinant protein by various separation methods. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • FIG. 1 is a comparison diagram of gene chip expression profiles of mitochondrial aspartate aminotransferase 37. 29 and mitochondrial aspartate aminotransferase of the present invention.
  • the upper graph is a graph of the expression profile of human mitochondrial aspartate aminotransferase 37. 29, and the lower graph is the graph of the expression profile of mitochondrial aspartate aminotransferase 37. 29.
  • Figure 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of the isolated human mitochondrial aspartate aminotransferase 37. 29. 37kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRM was isolated from total RNA using Quik raRNA I solute ion Ki t (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed CDNA is formed. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 ⁇ fragment was inserted into the multicloning site of the pBSK (+) vector (Clontech), and transformed into DH5 ⁇ to form a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 1011 ⁇ 409 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the 1014a09 clone contains a full-length CDM of 1644bp (as shown by Seq ID N0: l), and has a 1019bp open reading frame (0RF) from 276bp to 1295bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • This clone pBS-1014a09 and encoded the protein named human mitochondrial aspartate aminotransferase 37. 29.
  • Example 2 Cloning of a gene encoding human mitochondrial aspartate aminotransferase 37. 29 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Pr imerl 5'- CAAGAAGAAACTATTGCTTCTTTG -3 '(SEQ ID NO: 3)
  • Pr imer2 5'- ATTAAAATATGTTTATTAATGTGC -3 '(SEQ ID NO: 4)
  • Pr iraerl is a forward sequence starting at the lbp at the 5 'end of SEQ ID NO: 1;
  • Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l of KC1, 10 mmol / L Tris-CI, (pH 8.5.5), 1.5 mmol / L MgCl 2) 200 ⁇ mol / L in a reaction volume of 50 ⁇ 1 L dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min 0 ⁇ -act in was set as positive during RT-PCR Controls and template blanks are negative controls.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit. DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l-1644bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human mitochondrial aspartate aminotransferase 37. 29 gene expression:
  • RNA extraction in one step [Anal. Biochera 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA in 20 mM 3- (N- Morpholino) propanesulfonic acid (H7.0)-5mM sodium acetate-ImM EDTA-2.2M formaldehyde on a 1.2% agarose gel. It was then transferred to a nitrocellulose membrane. Preparation cc- 32 P dATP with 32 P- DNA probe labeled by the random primer method.
  • the DNA probe used was the PCR amplified human mitochondrial aspartate aminotransferase 37.29 coding sequence (276bp to 1295bp) shown in FIG. 1.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5xSSC-5xDenhardt, s solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0.1 ° /. SDS at 55 ° C for 30min. Then Analysis and quantification using Phosphor Imager.
  • Example 4 In vitro expression, isolation and purification of recombinant human mitochondrial aspartate aminotransferase 37.29
  • Primer 3 5'-CCCCATATGATGTCATTACAGAATCAACTCAAG-3 '(Seq ID No: 5)
  • Primer4 5' -CATGGATCCTCATTGACTCATTCCCTTATTTTC-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Endonuclease site.
  • the PCR reaction was performed using pBS-1014a09 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 contains 10 pg of pBS-1014a09 plasmid, primers Primer-3 and Primer-4, and 1 J is 10 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into E. coli DH5CX using the calcium chloride method. After being cultured on LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1) overnight, positive clones were selected by colony PCR method and sequenced. A positive clone (pET-1014a09) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. The host strain BL21 (pET-1014a09) was at 37 in LB liquid medium containing kanamycin (final concentration 30 g / ml). C.
  • polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunocherai s try, 1969; 6: 43. Rabbits were immunized with 1 ⁇ 2 g of the hemocyanin-polypeptide complex plus complete Freund's adjuvant, and 15 days later the hemocyanin-polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Seph ar 0 S e4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. 29 ⁇ It was confirmed by immunoprecipitation that the purified antibody could specifically bind to human mitochondrial aspartate aminotransferase 37. 29.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. First, the selection of the probe
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After the bag was sealed, 68. C. Water shake for 2 hours.
  • prehybridization solution lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, refer to the literature DeRi si, JL, Lyer, V.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between the points is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) by one-step method, and the mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen).
  • Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Pharaacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino- propargyl- 2'-deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification.
  • Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5'-tr iphate coupled
  • the probes from the above two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line, thymus, normal.
  • Industrial applicability is fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line,
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Amino acids are components of proteins in the body. Abnormal amino acid metabolism can cause many serious diseases.
  • Aspartate aminotransferase is an intracellular aminotransferase that plays a role in the metabolism of amino acids and sugars. Abnormal expression in the body can affect the metabolism of proteins and carbohydrates, leading to the occurrence of related diseases.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human aspartate aminotransferase protein, and both have similar biological functions.
  • the polypeptide of the present invention is an intracellular transaminase in the body, and plays a role in the metabolism of amino acids and sugars. Its abnormal expression can affect the metabolism of proteins and carbohydrates, leading to the occurrence of related diseases, including but not limited to:
  • Protein peptide hormone dysfunction can cause the following diseases:
  • Insulin and glucagon diabetes, hypoglycemia, etc .;
  • hypothalamus and pituitary hormones Giant disease, dwarfism, acromegaly, Cortisol syndrome (Cushing's syndrome), primary hyperaldosteronism, secondary chronic adrenal insufficiency, hyperthyroidism Hypothyroidism (stingle disease, juvenile hypothyroidism, adult hypothyroidism), male / female infertility, menstrual disorders (functional uterine bleeding, amenorrhea, polycystic ovary syndrome, premenstrual tension syndrome, Menopause syndrome), sexual development disorder, diabetes insipidus, inappropriate antidiuretic hormone secretion syndrome, abnormal lactation
  • parathyroid hormone hyperparathyroidism, hypoparathyroidism, etc .
  • Gastrointestinal hormones peptic ulcer, chronic indigestion, chronic gastritis, etc .;
  • Arrhythmia shock, insanity, epilepsy, chorea, hepatic encephalopathy (norepinephrine, ⁇ -aminobutyric acid, serotonin, glutamine), motion sickness, type I allergic disease (net Measles, hay fever, allergic rhinitis, skin allergies), peptic ulcer (histamine), hypercholesterolemia (taurine), tumors (polyamines), etc .;
  • Hyperinsulinemia can promote lipid synthesis and stimulate arterial intimal smooth muscle cell proliferation (causing vascular lumen narrowing); hypoinsulinemia can reduce lipid clearance and vascular lysosomal lipase activity and accelerate arteries Occurrence and development of atherosclerosis. Coupled with an increase in the content of glycosylated hemoglobin, tissue hypoxia can be aggravated, so glucose metabolism disorders can lead to atherosclerosis of large and medium blood vessels and microvessels in the whole system. 2. Hyperglycemia can cause changes in aqueous osmotic pressure and promote eyeballs.
  • the glucose in the crystal is converted into sorbitol, which leads to the accumulation of sorbitol in the crystal, etc. 3.
  • Disturbance of glucose metabolism and the microvascular disease caused by it can lead to neurodegeneration, which is mainly mutation of peripheral nerve axis and demyelination. Reduced; 4.
  • Disturbance of glucose metabolism leads to poor nutritional status throughout the body, low immunity, and prone to various infections;
  • Cardio-cerebral vessels angina pectoris, myocardial infarction, arrhythmia, coronary heart disease, metabolic cardiomyopathy, heart failure, cardiogenic shock (aorta, coronary arteries, cardiac microvessels), transient ischemic attack, cerebral infarction, Lacunar infarction, cerebral hemorrhage (intracerebral artery), etc .;
  • Renal blood vessels renal artery stenosis, renal artery embolism and thrombosis, arteriolar renal sclerosis (benign, malignant), acute / chronic renal failure, etc .;
  • Peripheral blood vessels of the limb occlusive arteriosclerosis (lower extremity arteries), malnutrition skin ulcers (small skin arteries), etc .;
  • Ophthalmic diseases Metabolic cataract, refractive error, iridocyclitis, ocular motor paralysis, retinopathy (simple, proliferative), iris redness, neovascular glaucoma, etc. 3.
  • Nervous system diseases Peripheral neuropathy (symmetrical distal polyneuropathy, majority mononeuropathy, autonomic neuropathy), myelopathy, hypertonic coma, hypoglycemic encephalopathy, dementia, paralysis, etc .;
  • the polypeptide of the present invention and the antagonist, agonist and inhibitor of the polypeptide can be directly used for the treatment of various diseases, such as diseases related to protein metabolism disorders, diseases related to glucose metabolism disorders, and the like.
  • the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human mitochondrial aspartate aminotransferase 37. 29.
  • Agonists increase human mitochondrial aspartate aminotransferase 37. 29 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing human mitochondrial aspartate aminotransferase 37. 29 can be cultured with a labeled human mitochondrial aspartate transaminase 37. 29 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human mitochondrial aspartate aminotransferase 37. 29 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of human mitochondrial aspartate aminotransferase 37. 29 can bind to human mitochondrial aspartate aminotransferase 37. 29 and eliminate its function, or inhibit the production of the polypeptide, or combine with the active site of the polypeptide to make The polypeptide cannot perform biological functions.
  • human mitochondrial aspartate aminotransferase 37. 29 can be added to the bioanalytical assay, and the interaction between human mitochondrial aspartate aminotransferase 37. 29 and its receptors can be determined by measuring the compounds Influence to determine if a compound is an antagonist.
  • Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Polypeptide molecules capable of binding to human mitochondrial aspartate aminotransferase 37. 29 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the human mitochondrial aspartate aminotransferase 37. 29 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human mitochondrial aspartate aminotransferase 37. 29 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by direct injection of human mitochondrial aspartate aminotransferase 37. 29 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to human mitochondrial aspartate aminotransferase 37. 29 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), three tumor technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morr i son et
  • the antibody against human mitochondrial aspartate aminotransferase 37. 29 can be used in immunohistochemical techniques to detect human mitochondrial aspartate aminotransferase 37. 29 in biopsy specimens.
  • Monoclonal antibodies that bind to human mitochondrial aspartate aminotransferase 37. 29 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human mitochondrial aspartate aminotransferase 37. 29 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human mitochondrial aspartate aminotransferase 37. 29 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human mitochondrial aspartate aminotransferase 37. 29.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human mitochondrial aspartate aminotransferase 37. 29.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human mitochondrial aspartate aminotransferase 37. 29.
  • These tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human mitochondrial aspartate aminotransferase 37. 29 detected in the test can be used to explain the importance of human mitochondrial aspartate aminotransferase 37. 29 in various diseases and to diagnose human mitochondrial aspartate aminotransferase 37. 29 diseases at work.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human mitochondrial aspartate aminotransferase 37. 29 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human mitochondrial aspartate aminotransferase 37. 29.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human mitochondrial aspartate aminotransferase 37. 29 to inhibit endogenous human mitochondrial aspartate aminotransferase 37. 29 activity.
  • a variant human mitochondrial aspartate aminotransferase 37. 29 may be a shortened human mitochondrial aspartate aminotransferase lacking a signaling domain
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human mitochondrial aspartate aminotransferase 37. 29.
  • Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human mitochondrial aspartate aminotransferase 37. 29 into a cell.
  • a recombinant polynucleotide encoding human mitochondrial aspartate aminotransferase 37. 29 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human mitochondrial aspartate aminotransferase 37. 29 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA and DNA and ribozymes can be obtained by any RM or DNA synthesis technology. For example, solid-phase phosphoramidite synthesis of oligonucleotides has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human mitochondrial aspartate aminotransferase 37. 29 can be used for the diagnosis of diseases related to human mitochondrial aspartate aminotransferase 37. 29.
  • the polynucleotide encoding human mitochondrial aspartate aminotransferase 37. 29 can be used to detect the expression of human mitochondrial aspartate aminotransferase 37. 29 or the abnormal expression of human mitochondrial aspartate aminotransferase 37. 29 in a disease state .
  • the DM sequence encoding human mitochondrial aspartate aminotransferase 37. 29 can be used to hybridize biopsy specimens to determine the expression status of human mitochondrial aspartate aminotransferase 37. 29.
  • Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array (Mi croar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues .
  • 29 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human mitochondrial aspartate aminotransferase 37. 29 transcription products.
  • Detection of human mitochondrial aspartate aminotransferase 37. 29 mutations can also be used to diagnose human mitochondrial aspartate aminotransferase 37. 29-related diseases.
  • Human mitochondrial aspartate aminotransferase 37. 29 mutant forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human mitochondrial aspartate aminotransferase 37. 29 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • Only few chromosome markers based on actual sequence data (repeat polymorphisms) are available For marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a group of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNAj 0
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckus i ck, Mendel i an
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceuticals or biological products, which instructions reflect production, use Or a government agency that sells it allows it to be administered to humans.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human mitochondrial aspartate aminotransferase 37. 29 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human mitochondrial aspartate aminotransferase 37. 29 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • General Engineering & Computer Science (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une aspartate transférase mitochondriale humaine 37.29, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de maladies associées aux troubles du métabolisme des protéines et de maladies associées aux troubles de métabolisme des sucres. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant l'aspartate transférase mitochondriale humaine 37.29.
PCT/CN2001/001009 2000-06-21 2001-06-19 Nouveau polypeptide, aspartate transferase mitochondriale humaine 37.29, et polynucleotide codant ce polypeptide WO2002020578A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001295394A AU2001295394A1 (en) 2000-06-21 2001-06-19 A novel polypeptide-homo mitochondria aspartate aminotransferase 37.29 and polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116626.3 2000-06-21
CN 00116626 CN1329156A (zh) 2000-06-21 2000-06-21 一种新的多肽——人线粒体天冬氨酸转氨酶37.29和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002020578A1 true WO2002020578A1 (fr) 2002-03-14

Family

ID=4586028

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001009 WO2002020578A1 (fr) 2000-06-21 2001-06-19 Nouveau polypeptide, aspartate transferase mitochondriale humaine 37.29, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1329156A (fr)
AU (1) AU2001295394A1 (fr)
WO (1) WO2002020578A1 (fr)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
PAN GUANGLIANG ET AL.: "Research on asparate transaminase reaction and preparation of L-phenylalanine in BSTR and PFR reactors", JOURNAL OF NANJING UNIVERSITY OF CHEMICAL TECHNOLOGY, vol. 18, no. SUP., December 1996 (1996-12-01), pages 21 - 24 *
WANG ZIWEI ET AL.: "The study of proteolytic assaying AST isoenzymes in serum", JOURNAL OF CHINESE MEDICINE EXAMINATION, vol. 17, no. 3, May 1994 (1994-05-01), pages 154 - 157 *

Also Published As

Publication number Publication date
CN1329156A (zh) 2002-01-02
AU2001295394A1 (en) 2002-03-22

Similar Documents

Publication Publication Date Title
WO2002020578A1 (fr) Nouveau polypeptide, aspartate transferase mitochondriale humaine 37.29, et polynucleotide codant ce polypeptide
WO2002026796A1 (fr) Nouveau polypeptide, recepteur humain 14.3 d'hormone de croissance, et polynucleotide codant ce polypeptide
WO2001068689A1 (fr) Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide
WO2002006489A1 (fr) Nouveau polypeptide, sous-unite humaine de cytochrome c oxydase 8.91, et polynucleotide codant ce polypeptide
WO2001070964A1 (fr) Nouveau polypeptide, proteine humaine de transport de glucose 18, et polynucleotide codant pour ce polypeptide
WO2001094406A1 (fr) Nouveau polypeptide, dihydropyridine-acide dicarboxylique deshydrogenase 21, et polynucleotide codant ce polypeptide
WO2001066707A1 (fr) Nouveau polypeptide, serine protease humaine atp-dependante 11, et polynucleotide codant pour ce polypeptide
WO2002040523A1 (fr) Nouveau polypeptide, glutaryl-coa deshydrogenase humaine 15.51, et polynucleotide codant ce polypeptide
WO2002020592A1 (fr) Nouveau polypeptide, facteur humain 8.8 d'initiation de traduction mitochondriale, et polynucleotide codant ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001090348A1 (fr) Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide
WO2001075125A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 31, et polynucleotide codant pour ce polypeptide
WO2002026953A1 (fr) Nouveau polypeptide, atpase h + (ion d'hydrogene) vacuolaire humaine 36.08, et polynucleotide codant ce polypeptide
WO2001092315A1 (fr) Nouveau polypeptide, proteine humaine d'epissage 10.56, et polynucleotide codant ce polypeptide
WO2001075085A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide
WO2001098488A1 (fr) Nouveau polypeptide, sous-unite 24 de flavoproteine humaine, et polynucleotide codant ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001073045A1 (fr) Nouveau polypeptide, quinine reductase humaine 10, et polynucleotide codant pour ce polypeptide
WO2002012458A1 (fr) Nouveau polypeptide, desintegrine-metalloprotease humaine 11.11, et polynucleotide codant ce polypeptide
WO2001075010A2 (fr) Nouveau polypeptide, proteine humaine de transduction nucleaire 25 contenant un domaine structurel atp/gtp, et polynucleotide codant pour ce polypeptide
WO2001073066A1 (fr) Nouveau polypeptide, serine hydrolase atp-dependante humaine 10.1, et polynucleotide codant pour ce polypeptide
WO2001064868A1 (fr) Nouveau polypeptide, recepteur humain de cytokine 12, et polynucleotide codant pour ce polypeptide
WO2001070994A1 (fr) Nouveau polypeptide, dihydropyridine dicarboxylate deshydrogenase humaine 18, et polynucleotide codant pour ce polypeptide
WO2001072810A1 (fr) Nouveau polypeptide, proteine humaine 12 de la famille des amidases, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: JP