WO2002004493A2 - Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof - Google Patents
Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof Download PDFInfo
- Publication number
- WO2002004493A2 WO2002004493A2 PCT/US2001/021241 US0121241W WO0204493A2 WO 2002004493 A2 WO2002004493 A2 WO 2002004493A2 US 0121241 W US0121241 W US 0121241W WO 0204493 A2 WO0204493 A2 WO 0204493A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- contiguous nucleotides
- polynucleotide
- expression cassette
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/53—DNA (RNA) vaccination
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
- C12N2740/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16211—Human Immunodeficiency Virus, HIV concerning HIV gagpol
- C12N2740/16222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16311—Human Immunodeficiency Virus, HIV concerning HIV regulatory proteins
- C12N2740/16322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Definitions
- TECHNICAL FIELD Polynucleotides encoding antigenic Type C HTV polypeptides (e.g., Gag, pol, vif, vpr, tat, rev, vpu, env, and net) are described, as are uses of these polynucleotides and polypeptide products in immunogenic compositions. Also described are polynucleotide sequences from South African variants of HTV Type C.
- ADDS Acquired immune deficiency syndrome
- HTV Human Immunodeficiency Virus
- Gag gene products include, but are not limited to, Gag-polymerase and Gag-protease.
- Env gene products include, but are not limited to, monomeric gpl20 polypeptides, oligomeric gpl40 polypeptides and gpl60 polypeptides.
- Virol. 72(2): 1497-1503, 1998) described an increased immune response elicited by DNA vaccination employing a synthetic gpl20 sequence with modified codon usage.
- Schneider, et al., (J Virol. 71(7):4892-4903, 1997) discuss inactivation of inhibitory (or instability) elements (INS) located within the coding sequences of the Gag and Gag-protease coding sequences.
- INS inhibitory (or instability) elements located within the coding sequences of the Gag and Gag-protease coding sequences.
- the Gag proteins of HIV-1 are necessary for the assembly of virus-like particles.
- HIV-1 Gag proteins are involved in many stages of the life cycle of the virus including, assembly, virion maturation after particle release, and early post-entry steps in virus replication. The roles of HIV-1 Gag proteins are numerous and complex (Freed, E.O., Virology 251:1-15, 1998). Wolf, et al., (PCT International Application, WO 96/30523, published 3 October
- novel Type C HIV sequences for example, 8_5_TV1_C.ZA, 8_2_TV1_C.ZA and 12-5_1_TV2_C.ZA, polypeptides encoded by these novel sequences, and synthetic expression cassettes generated from these and other Type C HTV sequences.
- the present invention relates synthetic expression cassettes encoding HTV Type C polypeptides, including Env, Gag, Pol, Prot, Vpr, Vpu, Vif, Nef, Tat, Rev and/or fragments thereof.
- the present invention also relates to improved expression of HTV Type C polypeptides and production of virus-like particles.
- HIN polypeptides e.g., Gag-, pol-, protease (prot)-, reverse transcriptase, integrase, R ⁇ AseH, Tat, Rev, ⁇ ef, Npr, Npu, Nif and/or Env- containing polypeptides
- HIN polypeptides e.g., Gag-, pol-, protease (prot)-, reverse transcriptase, integrase, R ⁇ AseH, Tat, Rev, ⁇ ef, Npr, Npu, Nif and/or Env- containing polypeptides
- an expression cassette typically include an HIN- polypeptide encoding sequence inserted into an expression vector backbone.
- an expression cassette comprises a polynucleotide sequence encoding one or more Po/-containing polypeptides, wherein the polynucleotide sequence comprises a sequence having at least about 85%, preferably about 90%, more preferably about 95%, and more preferably about 98% sequence (and any integers between these values) identity to the sequences taught in the present specification.
- polynucleotide sequences encoding Pol- containing polypeptides include, but are not limited to, those shown in SEQ ID NO: 30, SEQ LO NO:31; SEQ ID NO:32; SEQ ID NO:62; SEQ ID NO:103; SEQ ID NO:58; SEQ ID NO:60; SEQ ID NO:64; SEQ ID NO:66; SEQ ID NO:68; SEQ ID NO:70; SEQ ID NO:76; and SEQ ID NO:78.
- the polynucleotides encoding the HTV polypeptides of the present invention may also include sequences encoding additional polypeptides.
- Such additional polynucleotides encoding polypeptides may include, for example, coding sequences for other viral proteins (e.g., hepatitis B or C or other HTV proteins, such as, polynucleotide sequences encoding an HTV Gag polypeptide, polynucleotide sequences encoding an HTV Env polypeptide and/or polynucleotides encoding one or more of vif, vpr, tat, rev, vpu and nef); cytokines or other transgenes.
- the sequence encoding the HTV Pol polypeptide(s) can be modified by deletions of coding regions corresponding to reverse transcriptase and integrase. Such deletions in the polymerase polypeptide can also be made such that the polynucleotide sequence preserves T-helper cell and CTL epitopes. Other antigens of interest may be inserted into the polymerase as well.
- an expression cassette comprises a polynucleotide sequence encoding a polypeptide including an HIN G g-containing polypeptide, wherein the polynucleotide sequence encoding the Gag polypeptide comprises a sequence having at least about 85%o, preferably about 90%, more preferably about 95%, and most preferably about 98% sequence identity to the sequences taught in the present specification.
- the polynucleotide sequences encoding G ⁇ g-containing polypeptides include, but are not limited to, the following polynucleotides: nucleotides 844-903 of Figure 1 (a Gag major homology region) (SEQ TD ⁇ O:l); nucleotides 841-900 of Figure 2 (a Gag major homology region) (SEQ ID NO:2); Figure 24 (SEQ ID NO:53, a Gag major homology region); the sequence presented as Figure 1 (SEQ ID NO:3); the sequence presented as Figure 22 (SEQ TD NO:51); the sequence presented as Figure 70 (SEQ ID NO:99); and the sequence presented as Figure 2 (SEQ TD NO:4).
- the polynucleotides encoding the G ⁇ g-containing polypeptides of the present invention may also include sequences encoding additional polypeptides.
- an expression cassette comprises a polynucleotide sequence encoding a polypeptide including an HIN Env-containing polypeptide, wherein the polynucleotide sequence encoding the Env polypeptide comprises a sequence having at least about 85% ⁇ , preferably about 90%>, more preferably about 95%, and most preferably about 98% sequence identity to the sequences taught in the present specification.
- polynucleotide sequences encoding E/zv-containing polypeptides include, but are not limited to, the following polynucleotides: nucleotides 1213-1353 of Figure 3 (S ⁇ Q ID ⁇ O:5) (encoding an ⁇ nv common region); the sequence presented as Figure 17 (S ⁇ Q ID NO:46) (encoding a 97 nucleotide long ⁇ nv common region); S ⁇ Q ID NO:47 (encoding a 144 nucleotide long ⁇ nv common region); nucleotides 82-1512 of Figure 3 (S ⁇ Q TD NO:6) (encoding a g ⁇ l20 polypeptide); nucleotides 82-2025 of Figure 3 (S ⁇ Q ID NO:7) (encoding a gpl40 polypeptide); nucleotides 82-2547 of Figure 3 (S ⁇ Q TD NO:8) (encoding a gpl60 polypeptide); S ⁇ Q TD NO:49 (encoding a g ⁇
- 8__2_TV1_C.ZA signal sequence nucleotides 1 to 2049 of Figure 100 (SEQ TD NO:131) (encoding a gpl40 polypeptide with TPA1 signal sequence); nucleotides 7 to 1607 of Figure 98 (SEQ ID NO:126) (encoding a gpl60 polypeptide with wild type 8_2_TV1_C.ZA signal sequence); nucleotides 7 to 2064 of SEQ TD NO:132 (encoding a gpl40 polypeptide with modified wild-type 8_2_TV1_C.ZA leader sequence); and nucleotides 7 to 2064 of SEQ TD NO:133 (encoding a gpl40 polypeptide with wild-type 8_2_TN1_C.ZA leader sequence).
- the Env-encoding sequences will contain further modifications, for instance mutation of the cleavage site to prevent the cleavage of a gp 140 polypeptide into a g ⁇ l20 polypeptide and a g ⁇ 41 polypeptide (SEQ TD ⁇ O:121 and SEQ LD NO: 124) or deletion of variable regions VI and/or V2 (SEQ ID NO: 119; SEQ TD NO: 120; SEQ TD NO:121; SEQ TD NO:122; SEQ ID NO:123; and SEQ TD NO:124).
- an expression cassette comprises a polynucleotide sequence encoding a polypeptide including an HIN Ne/ ⁇ containing polypeptide, wherein the polynucleotide sequence encoding the Ne/polypeptide comprises a sequence having at least about 85%, preferably about 90%o, more preferably about 95%>, and most preferably about 98%o sequence identity to the sequences taught in the present specification.
- the polynucleotide sequences encoding Ne -containing polypeptides include, but are not limited to, the following polynucleotides: the sequence presented in Figure 26 (SEQ TD ⁇ O:55); the sequence presented in Figure 72 (SEQ ID NO: 101); the sequence presented in Figure 28 (SEQ TD NO:57); the sequence presented in Figure 67 (SEQ ID NO:96); the sequence presented in Figure 103 (SEQ ID NO:134); and the sequence presented in Figure 104 (SEQ TD NO: 135).
- an expression cassette comprises a polynucleotide sequence encoding a polypeptide including an HTV i-ev-containing polypeptide, wherein the polynucleotide sequence encoding the Rev polypeptide comprises a sequence having at least about 85%, preferably about 90%, more preferably about 95%, and most preferably about 98%o sequence identity to the sequences taught in the present specification.
- polynucleotide sequences encoding itev-containing polypeptides include, but are not limited to, the following polynucleotides: the sequence presented in Figure 43 (SEQ ID NO:72); the sequence presented in Figure 76 (SEQ ID NO: 105); the sequence presented in Figure 45 (SEQ ID NO:74); the sequence presented in Figure 78 (SEQ ID NO: 107); and the sequence presented in Figure 62 (SEQ TD NO:91).
- an expression cassette comprises a polynucleotide sequence encoding a polypeptide including an HIV T ⁇ t-containing polypeptide, wherein the polynucleotide sequence encoding the Tat polypeptide comprises a sequence having at least about 85%., preferably about 90%>, more preferably about 95%>, and most preferably about 98%o sequence identity to the sequences taught in the present specification.
- polynucleotide sequences encoding T ⁇ t-containing polypeptides include, but are not limited to, the following polynucleotides: the sequence presented in Figure 51 (SEQ TD NO:80); the sequence presented in Figure 80 (SEQ ID NO: 109); the sequence presented in Figure 52 (SEQ ID NO:81); the sequence presented in Figure 54 (SEQ TD NO:83); and the sequence presented in Figure 82 (SEQ TD NO: 111).
- an expression cassette comprises a polynucleotide sequence encoding a polypeptide including an HIV ⁇ containing polypeptide, wherein the polynucleotide sequence encoding the Fz/polypeptide comprises a sequence having at least about 85%, preferably about 90%>, more preferably about 95%, and most preferably about 98% sequence identity to the sequences taught in the present specification.
- the polynucleotide sequences encoding z / ⁇ -containing polypeptides include, but are not limited to, the following polynucleotides: the sequence presented in Figure 56 (SEQ TD NO:85); and the sequence presented in Figure 84 (SEQ LD NO: 113).
- an expression cassette comprises a polynucleotide sequence encoding a polypeptide including an HIV pr-containing polypeptide, wherein the polynucleotide sequence encoding the Vpr polypeptide comprises a sequence having at least about 85%, preferably about 90%), more preferably about 95%>, and most preferably about 98% sequence identity to the sequences taught in the present specification.
- the polynucleotide sequences encoding pr-containing polypeptides include, but are not limited to, the following polynucleotides: the sequence presented in Figure 58 (SEQ ID NO:87); and the sequence presented in Figure 86 (SEQ ID NO:l 15).
- an expression cassette comprises a polynucleotide sequence encoding a polypeptide including an HIV ⁇ w-containing polypeptide, wherein the polynucleotide sequence encoding the Vpu polypeptide comprises a sequence having at least about 85%, preferably about 90%, more preferably about 95%, and most preferably about 98% sequence identity to the sequences taught in the present specification.
- the polynucleotide sequences encoding J ⁇ pw-containing polypeptides include, but are not limited to, the following polynucleotides: the sequence presented in Figure 60 (SEQ TD NO:89); and the sequence presented in Figure 88 (SEQ ID NO:l 17).
- Exemplary polynucleotide sequences encoding Gag- containing polypeptides include, but are not limited to, the following polynucleotides: nucleotides 844-903 of Figure 1 (SEQ ID NO:l) (a Gag major homology region); nucleotides 841-900 of Figure 2 (SEQ TD NO:2) (a Gag major homology region); the sequence presented as Figure 1 (SEQ ID NO:3); the sequence presented as Figure 2 (SEQ ID NO:4); the sequence presented as Figure 22 (SEQ TD NO:51); the sequence presented as Figure 70 (SEQ ID NO:99); and the sequence presented as Figure 24 (SEQ ID NO:53) (a Gag major homology region).
- Exemplary polynucleotide sequences encoding E7?v-containing polypeptides include, but are not limited to, the following polynucleotides: nucleotides 1213-1353 of Figure 3 (S ⁇ Q ID NO:5) (encoding an ⁇ nv common region); the sequence presented as Figure 17 (S ⁇ Q TD NO:46) (encoding a 97 nucleotide long ⁇ nv common region); S ⁇ Q ID NO:47 (encoding a 144 nucleotide long ⁇ nv common region); nucleotides 82-1512 of Figure 3 (S ⁇ Q ID NO:6) (encoding a gpl20 polypeptide); nucleotides 82-2025 of Figure 3 (S ⁇ Q ID NO:7) (encoding a gpl40 polypeptide); nucleotides 82-2547 of Figure 3 (S ⁇ Q ID NO:8) (encoding a gpl60 polypeptide); S ⁇ Q ID NO:49 (encoding a gpl60
- Exemplary purified polynucleotides encoding additional HIV polynucleotides include: Pol-encoding polynucleotides (e.g., SEQ TD NO:30, SEQ TD NO:31; SEQ TD NO:32; SEQ ID NO:62; SEQ TD NO:103; SEQ ID NO:58; SEQ ID NO:60; SEQ TD NO:64; SEQ ID NO:66; SEQ TD NO:68; SEQ ID NO:70; SEQ ID NO:76; and SEQ ID NO:78); Nef- encoding polynucleotides (e.g., SEQ ID NO:55; SEQ TD NO:101; SEQ ID NO:57; SEQ ID NO:96); Rev-encoding polynucleotides (e.g., SEQ ID NO:72; SEQ ID NO: 105; SEQ ID NO:74); SEQ TD NO:107; SEQ ID NO:91); Tat-encoding polynucleotides
- the present invention relates to native HTV polypeptide- encoding sequences obtained from novel Type C strains; fragments of these native sequences; expression cassettes containing these wild-type sequences; and uses of these sequences, fragments and expression cassettes. Exemplary full length sequences are shown in SEQ ID NO:33 and SEQ ID NO: 45.
- Exemplary fragments coding for various HTV gene products include: the sequence presented in Figure 19 (SEQ ID NO:48) (an Env-encoding sequence); the sequence presented in Figure 69 (SEQ ID NO:98) (an Env-encoding sequence); the sequence presented in Figure 21 (SEQ ED NO:50) (a gpl60 polypeptide); the sequence presented in Figure 23 (SEQ ID NO:52) (a Gag polypeptide); the sequence presented in Figure 71 (SEQ TD NO: 100) (a Gag polypeptide); the sequence presented in Figure 25 (SEQ ID NO:54) (a Gag polypeptide); the sequence presented in Figure 27 (SEQ TD NO:56) (a Nef polypeptide); the sequence presented in Figure 73 (SEQ TD NO: 102) (a Nef polypeptide); the sequence presented in Figure 30 (SEQ ID NO:59) (a pl5RNAseH polypeptide); the sequence presented in Figure 32 (SEQ TD NO:61) (a p31Integrase
- the native and synthetic polynucleotide sequences encoding the HEV polypeptides of the present invention typically have at least about 85%>, preferably about 90%, more preferably about 95%>, and most preferably about 98%> sequence identity to the sequences taught herein. Further, in certain embodiments, the polynucleotide sequences encoding the HTV polypeptides of the invention will exhibit 100%) sequence identity to the sequences taught herein.
- polynucleotides of the present invention can be produced by recombinant techniques, synthetic techniques, or combinations thereof.
- the present invention further includes recombinant expression systems for use in selected host cells, wherein the recombinant expression systems employ one or more of the polynucleotides and expression cassettes of the present invention.
- the polynucleotide sequences are operably linked to control elements compatible with expression in the selected host cell.
- control elements include, but are not limited to, the following: transcription promoters, transcription enhancer elements, transcription termination signals, polyadenylation sequences, sequences for optimization of initiation of translation, and translation termination sequences.
- Exemplary transcription promoters include, but are not limited to those derived from CMV, CMV+intron A, SV40, RS V, HIV-Ltr, MMLV-ltr, and metallothionein.
- the invention includes cells comprising one or more of the expression cassettes of the present invention where the polynucleotide sequences are operably linked to control elements compatible with expression in the selected cell.
- such cells are mammalian cells.
- Exemplary mammalian cells include, but are not limited to, BHK, VERO, HT1080, 293, RD, COS-7, and CHO cells.
- insects e.g., Trichoplusia ni (Tn5) and Sf9
- bacteria e.g., Bacillus subtilis
- yeast e.g., Bacillus subtilis
- antigen presenting cells e.g., macrophage, monocytes, dendritic cells, B-cells, T-cells, stem cells, and progenitor cells thereof
- primary cells e.g., immortalized cells, tumor-derived cells.
- the present invention includes compositions for generating an immunological response, where the composition typically comprises at least one of the expression cassettes of the present invention and may, for example, contain combinations of expression cassettes (such as one or more expression cassettes carrying a Pol-polypeptide- encoding polynucleotide, one or more expression cassettes carrying a Gag-polypeptide- encoding polynucleotide, one or more expression cassettes carrying accessory polypeptide- encoding polynucleotides (e.g., native or synthetic vpu, vpr, nef, vif, tat, rev), and/or one or more expression cassettes carrying an Env-polypeptide-encoding polynucleotide).
- expression cassettes such as one or more expression cassettes carrying a Pol-polypeptide- encoding polynucleotide, one or more expression cassettes carrying a Gag-polypeptide- encoding polynucleotide, one or more expression cassette
- compositions may further contain an adjuvant or adjuvants.
- the compositions may also contain one or more Type C HEV polypeptides.
- the Type C HTV polypetpides may correspond to the polypeptides encoded by the expression cassette(s) in the composition, or may be different from those encoded by the expression cassettes.
- An example of the polynucleotide in the expression cassette encoding the same polypeptide as is being provided in the composition is as follows: the polynucleotide in the expression cassette encodes the Gag-polypeptide of Figure 1 (SEQ ED NO:3), and the polypeptide (SEQ ED NO: 17) is the polypeptide encoded by the sequence shown in Figure 1.
- polynucleotide in the expression cassette encoding a different polypeptide as is being provided in the composition is as follows: an expression cassette having a polynucleotide encoding a Gag- polymerase polypeptide, and the polypeptide provided in the composition may be a Gag and/or Gag-protease polypeptide.
- compositions containing both expression cassettes (or polynucleotides of the present invention) and polypeptides various expression cassettes of the present invention can be mixed and/or matched with various Type C HIV polypeptides described herein.
- the present invention includes methods of immunization of a subject.
- any of the above described compositions are into the subject under conditions that are compatible with expression of the expression cassette(s) in the subject.
- the expression cassettes (or polynucleotides of the present invention) can be introduced using a gene delivery vector.
- the gene delivery vector can, for example, be a non- viral vector or a viral vector.
- Exemplary viral vectors include, but are not limited to Sindbis-virus derived vectors, retroviral vectors, and lentiviral vectors.
- Compositions useful for generating an immunological response can also be delivered using a particulate carrier.
- compositions can be coated on, for example, gold or tungsten particles and the coated particles delivered to the subject using, for example, a gene gun.
- the compositions can also be formulated as liposomes.
- the subject is a mammal and can, for example, be a human.
- the invention includes methods of generating an immune response in a subject. Any of the expression cassettes described herein can be expressed in a suitable cell to provide for the expression of the Type C HTV polypeptides encoded by the polynucleotides of the present invention. The polypeptide(s) are then isolated (e.g., substantially purified) and administered to the subject in an amount sufficient to elicit an immune response.
- the methods comprise administration of one or more of the expression cassettes or polynucleotides of the present invention, using any of the gene delivery techniques described herein.
- the methods comprise co- administration of one or more of the expression cassettes or polynucleotides of the present invention and one or more polypeptides, wherein the polypeptides can be expressed from these polynucleotides or can be other subtype C HTV polypeptides.
- the methods comprise co-administration of multiple expression cassettes or polynucleotides of the present invention.
- the methods comprise co- administration of multiple polypeptides, for example polypeptides expressed from the polynucleotides of the present invention and/or other subtype C HIV polypeptides.
- the invention further includes methods of generating an immune response in a subject, where cells of a subject are fransfected with any of the above-described expression cassettes or polynucleotides of the present invention, under conditions that permit the expression of a selected polynucleotide and production of a polypeptide of interest (e.g., encoded by any expression cassette of the present invention).
- a polypeptide of interest e.g., encoded by any expression cassette of the present invention.
- Transfection of the cells may be performed ex vivo and the fransfected cells are reintroduced into the subject. Alternately, or in addition, the cells may be fransfected in vivo in the subject.
- the immune response may be humoral and/or cell-mediated (cellular).
- this method may also include administration of an Type C HEV polypeptides before, concurrently with, and/or after introduction of the expression cassette into the subject.
- Figure 1 shows the nucleotide sequence of a polynucleotide encoding a synthetic Gag polypeptide.
- the nucleotide sequence shown was obtained by modifying type C strain AF110965 and include further modifications of INS.
- Figure 2 shows the nucleotide sequence of a polynucleotide encoding a synthetic Gag polypeptide.
- the nucleotide sequence shown was obtained by modifying type C strain AF110967 and include further modifications of INS.
- Figure 3 shows the nucleotide sequence of a polynucleotide encoding a synthetic Env polypeptide.
- the nucleotide sequence depicts g ⁇ l60 (including a signal peptide) and was obtained by modifying type C strain AFl 10968.
- the arrows indicate the positions of various regions of the polynucleotide, including the sequence encoding a signal peptide (nucleotides 1-81) (SEQ ID NO: 18), a gpl20 polypeptide (nucleotides 82-1512) (SEQ ID NO:6), a gp41 polypeptide (nucleotides 1513-2547) (SEQ ED NO: 10), a gpl40 polypeptide (nucleotides 82-2025) (SEQ ED NO:7) and a gpl60 polypeptide (nucleotides 82- 2547) (SEQ ED NO: 8).
- Figure 4 shows the nucleotide sequence of a polynucleotide encoding a synthetic Env polypeptide.
- the nucleotide sequence depicts gpl60 (including a signal peptide) and was obtained by modifying type C strain AF110975.
- the arrows indicate the positions of various regions of the polynucleotide, including the sequence encoding a signal peptide (nucleotides 1-72) (SEQ TD NO: 19), a g ⁇ l20 polypeptide (nucleotides 73- 1509) (SEQ ID NO:12), a gp41 polypeptide (nucleotides 1510-2565) (SEQ ID NO: 16), a gpl40 polypeptide (nucleotides 73-2022) (SEQ D NO: 13), and a gpl60 polypeptide (nucleotides 73-2565) (SEQ ID NO:14).
- the codons encoding the signal peptide are modified (as described herein) from the native HIV-1 signal sequence.
- Figure 5 shows the location of some remaining INS in synthetic Gag sequences derived from AF110965. The changes made to these sequences are boxed in the Figures.
- the top line depicts a codon modified sequence of Gag polypeptides from the indicated strains (SEQ TD NO:20).
- the nucleotide(s) appearing below the line in the boxed region(s) depicts changes made to remove further INS and correspond to the sequence depicted in Figure 1 (SEQ ID NO:3).
- Figure 6 shows the location of some remaining INS in synthetic Gag sequences derived from AF110967. The changes made to these sequences are boxed in the Figures.
- the top line depicts a modified sequence of Gag polypeptides from the indicated strains (SEQ ED NO:21).
- the nucleotide(s) appearing below the line in the boxed region(s) depicts changes made to remove further INS and correspond to the sequence depicted in Figure 2 (SEQ ID NO:4).
- Figure 7 is a schematic depicting the selected domains in the Pol region of HIV.
- Figure 8 depicts the nucleotide sequence of the synthetic construct designated PR975(+). "(+)” indicates that the reverse transcriptase is functional. This construct includes sequence from p2 (nucleotides 16 to 54 of SEQ ID NO:30); p7
- nucleotides 55 to 219 of SEQ TD NO:30 pl/p6 (nucleotides 220-375 of SEQ TD NO:30); prot (nucleotides 376 to 672 of SEQ ED NO:30), reverse transcriptase (nucleotides 673 to 2352 of SEQ ID NO:30); and 6 amino acids of integrase shown in Figure 7 (nucleotides 2353 to 2370 of SEQ ID NO:30).
- the construct contains a multiple cloning site (MCS, nucleotides 2425 to 2463 of SEQ TD NO:30) for insertion of a transgene and a YMDD epitope cassette (nucleotides 2371 to 2424 of SEQ ID NO:30).
- Figure 9 depicts the nucleotide sequence of the synthetic construct designated PR975YM. As illustrated in Figure 7,. the RT region includes a mutation in the catalytic center (mut. cat. center). "YM" refers to constructs in which the nucleotides encode the amino acids AP instead of YMDD in this region. Reverse transcriptase is not functional in this construct.
- This construct includes sequence from the p2 (nucleotides 16 to 54 of SEQ ID NO:31); p7 (nucleotides 55 to 219 of SEQ ID NO:31); pl/p6 (nucleotides 220 to 375 of SEQ TD NO:31); prot (nucleotides 376 to 672 of SEQ ED NO:31); and reverse transcriptase (nucleotides 673 to 2346 of SEQ ID NO:31) shown in Figure 7, although the reverse transcriptase protein is not functional.
- the construct contains a multiple cloning site (MCS, nucleotides 2419 to 2457 of SEQ ID NO:31) for insertion of a transgene and a YMDD epitope cassette (nucleotides 2365 to 2418 of SEQ ID NO:31).
- MCS multiple cloning site
- YMDD epitope cassette nucleotides 2365 to 2418 of SEQ ID NO:31
- Figure 10 depicts the nucleotide sequence of the synthetic construct designated PR975YMWM.
- YM refers to constructs in which the nucleotides encode the amino acids AP instead of YMDD in this region.
- M refers to constructs in which the nucleotides encode amino acids PI instead of WMGY in this region.
- This construct includes sequence from the p2 (nucleotides 16 to 54 of SEQ ID NO:32); p7 (nucleotides 55 to 219 of SEQ TD NO:32); pl/ ⁇ 6 (nucleotides 220 to 375 of SEQ TD NO:32); prot (nucleotides 376 to 672 of SEQ ID NO:32); and reverse transcriptase (nucleotides 673 to 2340 of SEQ TD NO:32) shown in Figure 7, although the reverse transcriptase protein is not functional.
- the construct contains a multiple cloning site (MCS, nucleotides 2413 to 2451 of SEQ TD NO:32) for insertion of a transgene and a YMDD epitope cassette (nucleotides 2359 to 2412 of SEQ ED NO:32).
- MCS multiple cloning site
- YMDD epitope cassette nucleotides 2359 to 2412 of SEQ ED NO:32
- Figure 11 depicts the nucleotide sequence of 8_5_TV1_C.ZA. Various regions are shown in Table A.
- Figure 12 depicts the wild type nucleotide sequence of AF 110975
- Figure 13 depicts the wild type nucleotide sequence of AF110975 Pol from pi through the first 6 amino acids of the integrase protein.
- Figure 14 depicts the nucleotide sequence of a cassette encoding Ilel78 through Serine 191 of reverse transcriptase.
- Figure 15 shows amino acid sequence which includes an epitope in the region of the catalytic center of the reverse transcriptase protein.
- Figure 16 depicts the nucleotide sequence of 12-5_1_TV2_C.ZA.
- Figure 17 depicts the nucleotide sequence of a synthetic Env- encoding polynucleotide derived from 8_5_TV1_C.ZA. The sequence corresponds to a short (97 base pair) common region.
- Figure 18 depicts the nucleotide sequence of a synthetic Env- encoding polynucleotide derived from 8_5_TV1_C.ZA. The sequence corresponds to a common region in Env.
- Figure 19 depicts the wild-type nucleotide sequence of 8_5_TV1_C.ZA Env.
- Figure 20 depicts the nucleotide sequence of a synthetic Env gpl60- encoding polynucleotide derived from 8_5_TV1_C.ZA.
- Figure 21 depicts the wild-type nucleotide sequence of 8_5_TV1_C.ZA Env gpl60.
- Figure 22 depicts the nucleotide sequence of a synthetic Gag- encoding polynucleotide derived from 8_5_T V 1_C .Z A.
- Figure 23 depicts the wild-type nucleotide sequence of 8_5_TV1_C.ZA Gag.
- Figure 24 depicts the nucleotide sequence of a synthetic Gag- encoding polynucleotide (major homology region) derived from 8_5_TV1_C.ZA.
- Figure 25 depicts the wild-type nucleotide sequence of
- Figure 26 depicts the nucleotide sequence of a synthetic Nef- encoding polynucleotide derived from 8_5_TV1_C.ZA.
- Figure 27 depicts the wild-type nucleotide sequence of 8_5_TVl_C.ZANef.
- Figure 28 depicts the nucleotide sequence of a synthetic Nef- encoding polynucleotide derived from 8_5_TV1_C.ZA. The sequence includes a mutation at position 125 which results in a non-functional gene product.
- Figure 29 depicts the nucleotide sequence of a synthetic RNAseH- encoding polynucleotide derived from 8_5_TV1_C.ZA.
- RnaseH is a functional domain of the Pol gene, corresponding to pl5 (Table A).
- Figure 30 depicts the wild-type nucleotide sequence of 8_5_TV1_C.ZA RNAseH.
- Figure 31 depicts the nucleotide sequence of a synthetic integrase (Int)-encoding polynucleotide derived from 8_5_TV1_C.ZA. Int is a functional domain of the Pol gene, corresponding to p31 (Table A).
- Figure 32 depicts the wild-type nucleotide sequence of 8_5_TV1_C.ZA Int.
- Figure 33 depicts the nucleotide sequence of a synthetic Pol- encoding polynucleotide derived from 8_5_TV1_C.ZA.
- Figure 34 depicts the wild-type nucleotide sequence of
- Figure 35 depicts the nucleotide sequence of a synthetic protease (prot)-encoding polynucleotide derived from 8_5_TV1_C.ZA.
- Figure 36 depicts the wild-type nucleotide sequence of 8_5_TVl_C.ZA Prot.
- Figure 37 depicts the nucleotide sequence of a synthetic protease (prot)-encoding polynucleotide derived from 8_5_TV1_C.ZA containing a mutation in which results in inactivation of the protease.
- Figure 38 depicts the wild-type nucleotide sequence of 8_5_TV 1_C.ZA inactivated Prot.
- Figure 39 depicts the nucleotide sequence of a synthetic protease (prot)-encoding polynucleotide and a synthetic reverse transcriptase (RT)-encoding polynucleotide, both derived from 8_5_TV1_C.ZA.
- the Prot and RT sequences both contain a mutation which results in inactivation of the gene product.
- Figure 40 depicts the wild-type nucleotide sequence of
- Figure 41 depicts the nucleotide sequence of a synthetic protease (prot)-encoding polynucleotide and a synthetic reverse transcriptase (RT)-encoding polynucleotide, both derived from 8_5_TV1_C.ZA.
- Figure 42 depicts the wild-type nucleotide sequence of
- Figure 43 depicts the nucleotide sequence of a synthetic rev- encoding polynucleotide derived from 8_5_TV1_C.ZA. The synthetic sequence depicted corresponds to exon 1 of rev. Wild-type rev has two exons.
- Figure 44 depicts the wild-type nucleotide sequence of 8__5_TV1_C.ZA exon 1 of Rev.
- Figure 45 depicts the nucleotide sequence of a synthetic rev- encoding polynucleotide derived from 8_5_TN1_C.ZA. The synthetic sequence depicted corresponds to exon 2 of rev.
- Figure 46 depicts the wild-type nucleotide sequence of 8_5_TV1_C.ZA exon 2 of Rev.
- Figure 47 depicts the nucleotide sequence of a synthetic RT- encoding polynucleotide derived from 8_5_TN1_C.ZA.
- Figure 48 depicts the wild-type nucleotide sequence of 8_5_TV1_C.ZA RT.
- Figure 49 depicts the nucleotide sequence of a synthetic RT- encoding polynucleotide derived from 8_5_TN1_C.ZA.
- the synthetic polynucleotide includes a mutation in the RT coding sequence which renders the gene product inactive.
- Figure 50 depicts the wild-type nucleotide sequence of 8_5_TN1_C.ZA RT including a mutation which inactivates the RT gene product.
- Figure 51 depicts the nucleotide sequence of a synthetic Tat- encoding polynucleotide derived from 8_5_TN1_C.ZA. The synthetic sequence depicted corresponds to exon 1 of Tat and further includes a mutation that renders the Tat gene product non-functional. Wild-type Tat has two exons.
- Figure 52 depicts the nucleotide sequence of a synthetic Tat- encoding polynucleotide derived from 8_5_TN1_C.ZA. The synthetic sequence depicted corresponds to exon 1 of Tat.
- Figure 53 depicts the wild-type nucleotide sequence of 8_5_TV1_C.ZA exon 1 of Tat.
- Figure 54 depicts the nucleotide sequence of a synthetic Tat- encoding polynucleotide derived from 8_5_TN1_C.ZA. The synthetic sequence depicted corresponds to exon 2 of Tat.
- Figure 55 depicts the wild-type nucleotide sequence of 8 _5_TN1_C.ZA exon 2 of Tat.
- Figure 56 depicts the nucleotide sequence of a synthetic Vif- encoding polynucleotide derived from 8_5_TV1_C.ZA.
- Figure 57 depicts the wild-type nucleotide sequence of
- Figure 58 depicts the nucleotide sequence of a synthetic Vpr- encoding polynucleotide derived from 8_5_TN1_C.ZA.
- Figure 59 depicts the wild-type nucleotide sequence of 8_5_TVl_C.ZA Vpr.
- Figure 60 depicts the nucleotide sequence of a synthetic Vpu- encoding polynucleotide derived from 8_5_TN1_C.ZA.
- Figure 61 depicts the wild-type nucleotide sequence of 8_5_TVl_C.ZA Vpu.
- Figure 62 depicts the nucleotide sequence of a synthetic rev- encoding polynucleotide derived from 8_5_TN1_C.ZA. The synthetic sequence depicted corresponds to exons 1 and 2 of rev.
- Figure 63 depicts the wild-type nucleotide sequence of exons 1 and 2 of rev derived from 8_5_TV1_C.ZA.
- Figure 64 depicts the nucleotide sequence of a synthetic Tat- encoding polynucleotide derived from 8_5_TV1_C.ZA.
- the synthetic polynucleotide includes both exons 1 and 2 of Tat and further includes a mutation in exon 1 which renders the gene product non-functional.
- Figure 65 depicts the nucleotide sequence of a synthetic Tat- encoding polynucleotide derived from 8_5_TV1_C.ZA.
- the synthetic polynucleotide includes both exons 1 and 2 of Tat.
- Figure 66 depicts the wild-type nucleotide sequence of exons 1 and 2 of Tat derived from 8_5_TV1_C.ZA.
- Figure 67 depicts the nucleotide sequence of a synthetic Nef- encoding polynucleotide derived from 8_5_TV1_C.ZA. The sequence includes a mutation at position 125 which results in a non-functional gene product and a mutation that eliminates the myristoylation site of the Nef gene product.
- Figure 68 depicts the nucleotide sequence of a synthetic Env gpl60- encoding polynucleotide derived from 12-5_1_TV2_C.ZA.
- Figure 69 depicts the wild-type nucleotide sequence of Env gpl60 derived from 12-5_1_TV2_C.ZA.
- Figure 70 depicts the nucleotide sequence of a synthetic Gag- encoding polynucleotide derived from 12-5_1_TV2_C.ZA.
- Figure 71 depicts the wild-type nucleotide sequence of Gag derived from 12-5_1_TV2_C.ZA.
- Figure 72 depicts the nucleotide sequence of a synthetic Nef- encoding polynucleotide derived from 12-5_1_TV2_C.ZA.
- Figure 73 depicts the wild-type nucleotide sequence of Nef derived
- Figure 74 depicts the nucleotide sequence of a synthetic Pol- encoding polynucleotide derived from 12-5_1_TV2_C.ZA.
- Figure 75 depicts the wild-type nucleotide sequence of Pol derived
- Figure 76 depicts the nucleotide sequence of a synthetic Rev- encoding polynucleotide derived from exon 1 of Rev from 12-5_1_TN2_C.ZA.
- Figure 77 depicts the wild-type nucleotide sequence of exon 1 of Rev derived from 12-5_1_TV2_C.ZA.
- Figure 78 depicts the nucleotide sequence of a synthetic Rev- encoding polynucleotide derived from exon 2 of Rev from 12-5_1_TN2_C.ZA.
- Figure 79 depicts the wild-type nucleotide sequence of exon 2 of Rev derived from 12-5_1_TV2_C.ZA.
- Figure 80 depicts the nucleotide sequence of a synthetic Tat- encoding polynucleotide derived from exon 1 of Tat from 12-5_1_TV2_C.ZA.
- Figure 81 depicts the wild-type nucleotide sequence of exon 1 of Tat derived from 12-5_1_TV2_C.ZA.
- Figure 82 depicts the nucleotide sequence of a synthetic Tat- encoding polynucleotide derived from exon 2 of Tat from 12-5_1_TV2_C.ZA.
- Figure 83 depicts the wild-type nucleotide sequence of exon 2 of Tat derived from 12-5_1_TV2_C.ZA.
- Figure 84 depicts the nucleotide sequence of a synthetic Nif- encoding polynucleotide derived from 12-5_1_TN2_C.ZA.
- Figure 85 depicts the wild-type nucleotide sequence of Vif derived from 12-5_1_TN2_C.ZA.
- Figure 86 depicts the nucleotide sequence of a synthetic Vpr- encoding polynucleotide derived from 12-5_1_TV2_C.ZA.
- Figure 87 depicts the wild-type nucleotide sequence of Vpr derived from 12-5_1_TV2_C.ZA.
- Figure 88 depicts the nucleotide sequence of a synthetic Vpu- encoding polynucleotide derived from 12-5_1_TV2_C.ZA.
- Figure 89 depicts the wild-type nucleotide sequence of Vpu derived from 12-5_1_TV2_C.ZA.
- Figure 90 depicts the nucleotide sequence of a synthetic Env gpl20-encoding polynucleotide derived from 8_2_TN1_C.ZA. The N2 region is deleted. The sequence includes: an EcoRI restriction site (nucleotides 1 to 6); a codon modified signal peptide leader sequence (nucleotides 7 to 87); a gpl20 coding sequence (nucleotides 88 to 1464); a stop codon (nucleotides 1465 to 1467); an Xhol restriction site (nucleotides 1468 to 1473).
- Figure 91 depicts the nucleotide sequence of a synthetic Env gpl40-encoding polynucleotide derived from 8_2_TN1_C.ZA. The N2 region is deleted. The sequence includes: an EcoRI restriction site (nucleotides 1 to 6); a modified signal peptide leader sequence (nucleotides 7 to 87); a gpl40 coding sequence (nucleotides 88 to 1977); a stop codon (nucleotides 1978 to 1980); an Xhol restriction site (nucleotides 1981 to 1986).
- Figure 92 depicts the nucleotide sequence of a synthetic Env gpl40-encoding polynucleotide derived from 8_2_TV1_C.ZA.
- the V2 region is deleted and the sequence includes mutations in the cleavage site that prevent the cleavage of a gp 140 polypeptide into a gpl20 polypeptide and a gp41 polypeptide.
- the sequence includes: an EcoRI restriction site (nucleotides 1 to 6); a modified signal peptide leader sequence (nucleotides 7 to 87); gpl40 coding sequence (nucleotides 88 to 1977); a stop codon (nucleotides 1978 to 1980); an Xhol restriction site (nucleotides 1981 to 1986).
- Figure 93 depicts the nucleotide sequence of a synthetic Env gpl60-encoding polynucleotide derived from 8_2_TN1_C.ZA. The N1/N2 regions are deleted.
- the sequence includes: an EcoRI restriction site (nucleotides 1 to 6); a modified signal peptide leader sequence (nucleotides 7 to 87); gpl60 coding sequence (nucleotides 88 to 2388); a stop codon (nucleotides 2389 to 2391); an Xhol restriction site (nucleotides 2392 to 2397).
- Figure 94 depicts the nucleotide sequence of a synthetic Env gpl60-encoding polynucleotide derived from 8_2_TN1_C.ZA. The N2 region is deleted. The sequence includes: an EcoRI restriction site (nucleotides 1 to 6); a modified signal peptide leader sequence (nucleotides 7 to 87); a gpl60 coding sequence (nucleotides 88 to 2520); a stop codon (nucleotides 2521 to 2523); an Xhol restriction site (nucleotides 2524 to 2529).
- Figure 95 depicts the nucleotide sequence of a synthetic Env gpl60-encoding polynucleotide derived from 8_2_TV1_C.ZA.
- the V2 region is deleted and the cleavage site is mutated.
- the sequence includes: an EcoRI restriction site (nucleotides 1 to 6); a modified signal peptide leader sequence (nucleotides 7 to 87); a gpl60 coding sequence (nucleotides 88 to 2520); a stop codon (nucleotides 2521 to 2523); an Xhol restriction site (nucleotides 2524 to 2529).
- Figure 96 depicts the nucleotide sequence of a synthetic Env gpl60-encoding polynucleotide derived from 8_2_TV1_C.ZA.
- the nucleotide sequence includes a TPA1 leader sequence.
- the sequence includes: a Sail restriction site (nucleotides 1 to 6); a Kozak sequence (nucleotides 7 to 12); a TPA1 signal peptide leader sequence (nucleotides 13 to 87); a gpl60 coding sequence (nucleotides 88 to 2604); a stop codon (nucleotides 2605 to 2607); an Xhol restriction site (nucleotides 2608 to 2613).
- Figure 97 (SEQ ID NO: 126) depicts the nucleotide sequence of a synthetic Env g l60-encoding polynucleotide derived from 8_2_TV1_C.ZA.
- the sequence includes: an EcoRI restriction site (nucleotides 1 to 6); a modified signal peptide leader sequence (nucleotides 7 to 87); a gpl60 coding sequence (nucleotides 8 to 2607); a stop codon (nucleotides 2608 to 2610); an Xhol restriction site (nucleotides 2611 to 2616).
- Figure 98 depicts the nucleotide sequence of a synthetic Env gpl60-encoding polynucleotide derived from 8_2_TV1_C.ZA.
- the nucleotide sequence includes a wild type leader sequence.
- the sequence includes: an EcoRI restriction site (nucleotides 1 to 6); a native (unmodified) signal peptide leader sequence (nucleotides 7 to 87); a gpl60 coding sequence (nucleotides 88 to 2607); a stop codon (nucleotides 2608 to 2610); an Xhol restriction site (nucleotides 2611 to 2616).
- Figure 99 depicts the nucleotide sequence of wild type gpl60 derived from 8_2_TV1_C.ZA.
- Figure 100 depicts the nucleotide sequence of a synthetic Env gpl40-encoding polynucleotide derived from 8_2_TV1_C.ZA.
- the nucleotide sequence includes a TPA1 leader sequence (nucleotides 1-75); a gpl40 coding sequence (nucleotides 76 to 2049); a stop codon (nucleotides 2050 to 2052)
- Figure 101 depicts the nucleotide sequence of a synthetic gpl40- encoding polynucleotide derived from 8_2_TV1_C.ZA.
- the nucleotide sequence includes an EcoRI restriction site (nucleotides 1 to 6); a leader sequence modified from the TV1_C.ZA wild-type leader sequence (nucleotides 7 to 87); a gpl40 coding sequence (nucleotides 88 to 2064); a stop codon (nucleotides 2065 to 2067); a Xhol restriction site (nucleotides 2068 to 2073).
- Figure 102 depicts the nucleotide sequence of a synthetic gpl40- encoding polynucleotide derived from 8_2_TV1_C.ZA.
- the nucleotide sequence includes wild-type TV1_C.ZA unmodified leader sequence.
- the nucleotide sequence includes a restriction site (nucleotides 1 to 6); a wild type leader sequence (nucleotides 7 to 87); a gpl40 coding sequence (nucleotides 88 to 2064); a stop codon (nucleotides 2065 to 2067); a Xhol restriction site (nucleotides 2068-2073).
- Figure 103 depicts the nucleotide sequence of a synthetic Nef- encoding polynucleotide derived from 12-5_1_TN2_C.ZA. The sequence includes a mutation at position 125 which results in a non-functional gene product.
- Figure 104 depicts the nucleotide sequence of a synthetic Nef- encoding polynucleotide derived from 12-5_1 TV2_C.ZA. The synthetic polynucleotide includes a mutation that eliminates the myristoylation site of the Nef gene product.
- Figure 105 depicts an alignment of Env polypeptides from various HIV isolates.
- the regions between the arrows indicate regions (of TVl and TV2 clones) in the beta and/or bridging sheet region(s) that can be deleted and/or truncated.
- the "*" denotes N-linked glycosylation sites (of TVl and TV2 clones), one or more of which can be modified (e.g., deleted and/or mutated).
- Synthetic sequences refers to Type C HIV polypeptide-enco ⁇ g polynucleotides whose expression has been modified as described herein, for example, by codon substitution and inactivation of inhibitory sequences.
- Wild-type or “native” sequences refers to polypeptide encoding sequences that are essentially as they are found in nature, e.g., Gag, Pol, Nif, Npr, Tat, Rev, Npu, Env and/or ⁇ ef encoding sequences as found in Type C isolates, e.g., AF110965, AFl 10967, AF110968, AF110975, 8_5_ TN1_C.ZA, 8_2_TN1_C.ZA or 12-5_1_TV2_C.ZA.
- Table A The various regions of the HTV genome are shown in Table A, with numbering relative to 8_5_TV1_C.ZA (SEQ ID ⁇ O:33).
- the term “Pol” refers to one or more of the following polypeptides: polymerase (p6Pol); protease (prot); reverse transcriptase (p66RT or RT); RNAseH (pl5RNAseH); and/or integrase (p3 lint or Int).
- virus-like particle or “V P” refers to a nonreplicating, viral shell, derived from any of several viruses discussed further below.
- VLPs are generally composed of one or more viral proteins, such as, but not limited to those proteins referred to as capsid, coat, shell, surface and/or envelope proteins, or particle-forming polypeptides derived from these proteins.
- VLPs can form spontaneously upon recombinant expression of the protein in an appropriate expression system. Methods for producing particular VLPs are known in the art and discussed more fully below. The presence of VLPs following recombinant expression of viral proteins can be detected using conventional techniques known in the art, such as by electron microscopy, X-ray crystallography, and the like. See, e.g., Baker et al., Biophys. J. (1991) 60: 1445-1456; Hagensee et al., J. Virol.
- VLPs can be isolated by density gradient centrifugation and/or identified by characteristic density banding.
- cryoelectron microscopy can be performed on vitrified aqueous samples of the VLP preparation in question, and images recorded under appropriate exposure conditions.
- particle-forming polypeptide derived from a particular viral protein is meant a full-length or near full-length viral protein, as well as a fragment thereof, or a viral protein with internal deletions, which has the ability to form VLPs under conditions that favor VLP formation.
- the polypeptide may comprise the full-length sequence, fragments, truncated and partial sequences, as well as analogs and precursor forms of the reference molecule.
- the term therefore intends deletions, additions and substitutions to the sequence, so long as the polypeptide retains the ability to form a VLP.
- the term includes natural variations of the specified polypeptide since variations in coat proteins often occur between viral isolates.
- the term also includes deletions, additions and substitutions that do not naturally occur in the reference protein, so long as the protein retains the ability to form a VLP.
- Preferred substitutions are those which are conservative in nature, i.e., those substitutions that take place within a family of amino acids that are related in their side chains.
- amino acids are generally divided into four families: (1) acidic — aspartate and glutamate; (2) basic — lysine, arginine, histidine; (3) non-polar ⁇ alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar ⁇ glycine, asparagine, glutamine, cystine, serine threoniiie, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids.
- an “antigen” refers to a molecule containing one or more epitopes (either linear, conformational or both) that will stimulate a host's immune system to make a humoral and/or cellular antigen-specific response.
- the term is used interchangeably with the term "immunogen.”
- a B-cell epitope will include at least about 5 amino acids but can be as small as 3-4 amino acids.
- a T-cell epitope, such as a CTL epitope will include at least about 7-9 amino acids, and a helper T-cell epitope at least about 12-20 amino acids.
- an epitope will include between about 7 and 15 amino acids, such as, 9, 10, 12 or 15 amino acids.
- antigen denotes both subunit antigens, (i.e., antigens which are separate and discrete from a whole organism with which the antigen is associated in nature), as well as, killed, attenuated or inactivated bacteria, viruses, fungi, parasites or other microbes.
- Antibodies such as anti-idiotype antibodies, or fragments thereof, and synthetic peptide mimotopes, which can mimic an antigen or antigenic determinant, are also captured under the definition of antigen as used herein.
- an oligonucleotide or polynucleotide which expresses an antigen or antigenic determinant in vivo, such as in gene therapy and DNA immunization applications, is also included in the definition of antigen herein.
- antigens can be derived from any of several known viruses, bacteria, parasites and fungi, as described more fully below.
- the term also intends any of the various tumor antigens.
- an "antigen" refers to a protein which includes modifications, such as deletions, additions and substitutions (generally conservative in nature), to the native sequence, so long as the protein maintains the ability to elicit an immunological response, as defined herein. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the antigens.
- an "immunological response" to an antigen or composition is the development in a subject of a humoral and/or a cellular immune response to an antigen present in the composition of interest.
- a “humoral immune response” refers to an immune response mediated by antibody molecules
- a “cellular immune response” is one mediated by T-lymphocytes and/or other white blood cells.
- One important aspect of cellular immunity involves an antigen-specific response by cytolytic T-cells
- CTLs have specificity for peptide antigens that are presented in association with proteins encoded by the major histocompatibility complex (MHC) and expressed on the surfaces of cells. CTLs help induce and promote the destruction of intracellular microbes, or the lysis of cells infected with such microbes.
- MHC major histocompatibility complex
- Another aspect of cellular immunity involves an antigen-specific response by helper T-cells. Helper T-cells act to help stimulate the function, and focus the activity of, nonspecific effector cells against cells displaying peptide antigens in association with MHC molecules on their surface.
- a "cellular immune response” also refers to the production of cytokines, chemokines and other such molecules produced by activated T-cells and/or other white blood cells, including those derived from CD4+ and CD8+ T-cells.
- a composition or vaccine that elicits a cellular immune response may serve to sensitize a vertebrate subject by the presentation of antigen in association with MHC molecules at the cell surface.
- the cell-mediated immune response is directed at, or near, cells presenting antigen at their surface.
- antigen-specific T-lymphocytes can be generated to allow for the future protection of an immunized host.
- the ability of a particular antigen to stimulate a cell-mediated immunological response may be determined by a number of assays, such as by lymphoproliferation
- lymphocyte activation assays CTL cytotoxic cell assays, or by assaying for T-lymphocytes specific for the antigen in a sensitized subject.
- assays are well known in the art. See, e.g., Erickson et al, J Immunol. (1993) 151:4189-4199; Doe et al, Eur. J. Immunol. (1994) 24:2369-2376.
- Recent methods of measuring cell-mediated immune response include measurement of intracellular cytokines or cytokine secretion by T-cell populations, or by measurement of epitope specific T-cells (e.g., by the tetramer technique)(reviewed by McMichael, A.J., and O'Callaghan, C.A., J. Exp. Med. 187(9)1367-1371, 1998; Mcheyzer- Williams, M.G., et al, Immunol. Rev. 150:5-21, 1996; Lalvani, A., et al, J. Exp. Med. 186:859-865, 1997).
- an immunological response as used herein may be one which stimulates the production of CTLs, and/or the production or activation of helper T- cells.
- the antigen of interest may also elicit an antibody-mediated immune response.
- an immunological response may include one or more of the following effects: the production of antibodies by B- cells; and/or the activation of suppressor T-cells and/or ⁇ T-cells directed specifically to an antigen or antigens present in the composition or vaccine of interest.
- These responses may serve to neutralize infectivity, and/or mediate antibody-complement, or antibody dependent cell cytotoxicity (ADCC) to provide protection to an immunized host.
- ADCC antibody dependent cell cytotoxicity
- an "immunogenic composition” is a composition that comprises an antigenic molecule where administration of the composition to a subject results in the development in the subject of a humoral and/or a cellular immune response to the antigenic molecule of interest.
- the immunogenic composition can be introduced directly into a recipient subject, such as by injection, inhalation, oral, intranasal and mucosal (e.g., intra-rectally or intra- vaginally) administration.
- subunit vaccine is meant a vaccine composition which includes one or more selected antigens but not all antigens, derived from or homologous to, an antigen from a pathogen of interest such as from a virus, bacterium, parasite or fungus. Such a composition is substantially free of intact pathogen cells or pathogenic particles, or the lysate of such cells or particles.
- a “subunit vaccine” can be prepared from at least partially purified (preferably substantially purified) immunogenic polypeptides from the pathogen, or analogs thereof.
- the method of obtaining an antigen included in the subunit vaccine can thus include standard purification techniques, recombinant production, or synthetic production.
- substantially purified general refers to isolation of a substance (compound, polynucleotide, protein, polypeptide, polypeptide composition) such that the substance comprises the majority percent of the sample in which it resides.
- a substantially purified component comprises 50%o, preferably 80%-85%>, more preferably 90- 95% of the sample.
- Techniques for purifying polynucleotides and polypeptides of interest are well-known in the art and include, for example, ion-exchange chromatography, affinity chromatography and sedimentation according to density.
- a “coding sequence” or a sequence which "encodes” a selected polypeptide is a nucleic acid molecule which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vivo when placed under the control of appropriate regulatory sequences (or “control elements”).
- the boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus.
- a coding sequence can include, but is not limited to, cDNA from viral, procaryotic or eucaryotic mRNA, genomic DNA sequences from viral or procaryotic DNA, and even synthetic DNA sequences.
- a transcription termination sequence such as a stop codon may be located 3' to the coding sequence.
- Typical "control elements”, include, but are not limited to, transcription promoters, transcription enhancer elements, transcription termination signals, polyadenylation sequences (located 3' to the translation stop codon), sequences for optimization of initiation of translation (located 5' to the coding sequence), and translation termination sequences.
- a "polynucleotide coding sequence” or a sequence which "encodes" a selected polypeptide is a nucleic acid molecule which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vivo when placed under the control of appropriate regulatory sequences (or "control elements").
- coding sequence The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus.
- exemplary coding sequences are the modified viral polypeptide-coding sequences of the present invention.
- a transcription termination sequence may be located 3' to the coding sequence.
- control elements include, but are not limited to, transcription regulators, such as promoters, transcription enhancer elements, transcription termination signals, and polyadenylation sequences; and translation regulators, such as sequences for optimization of initiation of translation, e.g., Shine-Dalgarno (ribosome binding site) sequences, Kozak sequences (i.e., sequences for the optimization of translation, located, for example, 5' to the coding sequence), leader sequences, translation initiation codon (e.g., ATG), and translation termination sequences.
- transcription regulators such as promoters, transcription enhancer elements, transcription termination signals, and polyadenylation sequences
- translation regulators such as sequences for optimization of initiation of translation, e.g., Shine-Dalgarno (ribosome binding site) sequences, Kozak sequences (i.e., sequences for the optimization of translation, located, for example, 5' to the coding sequence), leader sequences, translation initiation codon (e.g., ATG),
- one or more translation regulation or initiation sequences are derived from wild-type translation initiation sequences, i.e., sequences that regulate translation of the coding region in their native state. Wild-type leader sequences that have been modified, using the methods described herein, also find use in the present invention.
- Promoters can include inducible promoters (where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), repressible promoters (where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), and constitutive promoters.
- a "nucleic acid" molecule can include, but is not limited to, procaryotic sequences, eucaryotic mRNA, cDNA from eucaryotic mRNA, genomic DNA sequences from eucaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences.
- the term also captures sequences that include any of the known base analogs of DNA and RNA.
- “Operably linked” refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function.
- a given promoter operably linked to a coding sequence is capable of effecting the expression of the coding sequence when the proper enzymes are present.
- the promoter need not be contiguous with the coding sequence, so long as it functions to direct the expression thereof.
- intervening untranslated yet transcribed sequences can be present between the promoter sequence and the coding sequence and the promoter sequence can still be considered “operably linked" to the coding sequence.
- Recombinant as used herein to describe a nucleic acid molecule means a polynucleotide of genomic, cDNA, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation: (1) is not associated with all or a portion of the polynucleotide with which it is associated in nature; and/or (2) is linked to a polynucleotide other than that to which it is linked in nature.
- the term "recombinant” as used with respect to a protein or polypeptide means a polypeptide produced by expression of a recombinant polynucleotide.
- Recombinant host cells “host cells,” “cells,” “cell lines,” “cell cultures,” and other such terms denoting procaryotic microorganisms or eucaryotic cell lines cultured as unicellular entities, are used interchangeably, and refer to cells which can be, or have been, used as recipients for recombinant vectors or other transfer DNA, and include the progeny of the original cell which has been fransfected. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement to the original parent, due to accidental or deliberate mutation.
- Progeny of the parental cell which are sufficiently similar to the parent to be characterized by the relevant property, such as the presence of a nucleotide sequence encoding a desired peptide, are included in the progeny intended by this definition, and are covered by the above terms.
- similarity means the exact amino acid to amino acid comparison of two or more polypeptides at the appropriate place, where amino acids are identical or possess similar chemical and/or physical properties such as charge or hydrophobicity. A so-termed “percent similarity” then can be determined between the compared polypeptide sequences.
- Techniques for determining nucleic acid and amino acid sequence identity also are well known in the art and include determining the nucleotide sequence of the mRNA for that gene (usually via a cDNA intermediate) and dete ⁇ nining the amino acid sequence encoded thereby, and comparing this to a second amino acid sequence.
- identity refers to an exact nucleotide to nucleotide or amino acid to amino acid correspondence of two polynucleotides or polypeptide sequences, respectively.
- Two or more polynucleotide sequences can be compared by determining their "percent identity.”
- Two or more amino acid sequences likewise can be compared by determining their "percent identity.”
- the percent identity of two sequences, whether nucleic acid or peptide sequences is generally described as the number of exact matches between two aligned sequences divided by the length of the shorter sequence and multiplied by 100.
- An approximate alignment for nucleic acid sequences is provided by the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981). This algorithm can be extended to use with peptide sequences using the scoring matrix developed by Dayhoff, Atlas of Protein Sequences and Structure, M.O. Dayhoff ed., 5 suppl.
- percent identity of a particular nucleotide sequence to a reference sequence can be determined using the homology algorithm of Smith and Waterman with a default scoring table and a gap penalty of six nucleotide positions.
- Another method of establishing percent identity in the context of the present invention is to use the MPSRCH package of programs copyrighted by the University of Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by InteUiGenetics, Inc. (Mountain View, CA). From this suite of packages, the Smith- Waterman algorithm can be employed where default parameters are used for the scoring table (for example, gap open penalty of 12, gap extension penalty of one, and a gap of six).
- the "Match” value reflects "sequence identity.”
- Other suitable programs for calculating the percent identity or similarity between sequences are generally known in the art, such as the alignment program BLAST, which can also be used with default parameters.
- a representative embodiment of the present invention would include an isolated polynucleotide having X contiguous nucleotides, wherein (i) the X contiguous nucleotides have at least about a selected level of percent identity relative to Y contiguous nucleotides of the sequences described herein, and (ii) for search purposes X equals Y, wherein Y is a selected reference polynucleotide of defined length.
- sequences of the present invention can include fragments of the sequences, for example, from about 15 nucleotides up to the number of nucleotides present in the full-length sequences described herein (e.g., see the Sequence Listing, Figures, and claims), including all integer values falling within the above-described range.
- fragments of the polynucleotide sequences of the present invention may be 30-60 nucleotides, 60-120 nucleotides, 120-240 nucleotides, 240-480 nucleotides, 480-1000 nucleotides, and all integer values therebetween.
- the synthetic expression cassettes (and purified polynucleotides) of the present invention include related polynucleotide sequences having about 80% to 100%), greater than 80-85%, preferably greater than 90-92%, more preferably greater than 95%, and most preferably greater than 98% up to 100% (including all integer values falling within these described ranges) sequence identity to the synthetic expression cassette (and purified polynucleotide) sequences disclosed herein (for example, to the claimed sequences or other sequences of the present invention) when the sequences of the present invention are used as the query sequence against, for example, a database of sequences.
- Two nucleic acid fragments are considered to "selectively hybridize" as described herein.
- the degree of sequence identity between two nucleic acid molecules affects the efficiency and strength of hybridization events between such molecules.
- a partially identical nucleic acid sequence will at least partially inhibit a completely identical sequence from hybridizing to a target molecule. Inhibition of hybridization of the completely identical sequence can be assessed using hybridization assays that are well known in the art (e.g., Southern blot, Northern blot, solution hybridization, or the like, see Sambrook, et al., supra or Ausubel et al., supra).
- Such assays can be conducted using varying degrees of selectivity, for example, using conditions varying from low to high stringency.
- the absence of non-specific binding can be assessed using a secondary probe that lacks even a partial degree of sequence identity (for example, a probe having less than about 30%> sequence identity with the target molecule), such that, in the absence of non-specific binding events, the secondary probe will not hybridize to the target.
- a partial degree of sequence identity for example, a probe having less than about 30%> sequence identity with the target molecule
- a nucleic acid probe When utilizing a hybridization-based detection system, a nucleic acid probe is chosen that is complementary to a target nucleic acid sequence, and then by selection of appropriate conditions the probe and the target sequence "selectively hybridize,” or bind, to each other to fonn a hybrid molecule.
- a nucleic acid molecule that is capable of hybridizing selectively to a target sequence under "moderately stringent” typically hybridizes under conditions that allow detection of a target nucleic acid sequence of at least about 10-14 nucleotides in length having at least approximately 70% sequence identity with the sequence of the selected nucleic acid probe.
- Stringent hybridization conditions typically allow detection of target nucleic acid sequences of at least about 10-14 nucleotides in length having a sequence identity of greater than about 90-95%) with the sequence of the selected nucleic acid probe.
- Hybridization conditions useful for probe/target hybridization where the probe and target have a specific degree of sequence identity can be determined as is known in the art (see, for example, Nucleic Acid Hybridization: A Practical Approach, editors B.D. Hames and S.J. Higgins, (1985) Oxford; Washington, DC; IRL Press).
- stringency conditions for hybridization it is well known in the art that numerous equivalent conditions can be employed to establish a particular stringency by varying, for example, the following factors: the length and nature of probe and target sequences, base composition of the various sequences, concentrations of salts and other hybridization solution components, the presence or absence of blocking agents in the hybridization solutions (e.g., formamide, dextran sulfate, and polyethylene glycol), hybridization reaction temperature and time parameters, as well as, varying wash conditions.
- the selection of a particular set of hybridization conditions is selected following standard methods in the art (see, for example, Sambrook, et al., supra or Ausubel et al, supra).
- a first polynucleotide is "derived from" second polynucleotide if it has the same or substantially the same basepair sequence as a region of the second polynucleotide, its cDNA, complements thereof, or if it displays sequence identity as described above.
- a first polypeptide is "derived from” a second polypeptide if it is (i) encoded by a first polynucleotide derived from a second polynucleotide, or (ii) displays sequence identity to the second polypeptides as described above.
- a viral polypeptide is "derived from" a particular polypeptide of a virus (viral polypeptide) if it is (i) encoded by an open reading frame of a polynucleotide of that virus (viral polynucleotide), or (ii) displays sequence identity to polypeptides of that virus as described above.
- Encoded by refers to a nucleic acid sequence which codes for a polypeptide sequence, wherein the polypeptide sequence or a portion thereof contains an amino acid sequence of at least 3 to 5 amino acids, more preferably at least 8 to 10 amino acids, and even more preferably at least 15 to 20 amino acids from a polypeptide encoded by the nucleic acid sequence. Also encompassed are polypeptide sequences which are immunologically identifiable with a polypeptide encoded by the sequence. Further, polyproteins can be constructed by fusing in-frame two or more polynucleotide sequences encoding polypeptide or peptide products.
- polycistronic coding sequences may be produced by placing two or more polynucleotide sequences encoding polypeptide products adjacent each other, typically under the control of one promoter, wherein each polypeptide coding sequence may be modified to include sequences for internal ribosome binding sites.
- Polynucleotide refers to a polynucleotide of interest or fragment thereof which is essentially free, e.g., contains less than about 50%, preferably less than about 70% > , and more preferably less than about 90%, of the protein with which the polynucleotide is naturally associated.
- Techniques for purifying polynucleotides of interest include, for example, disruption of the cell containing the polynucleotide with a chaotropic agent and separation of the polynucleotide(s) and proteins by ion-exchange chromatography, affinity chromatography and sedimentation according to density.
- nucleic acid immunization is meant the introduction of a nucleic acid molecule encoding one or more selected antigens into a host cell, for the in vivo expression of an antigen, antigens, an epitope, or epitopes.
- the nucleic acid molecule can be introduced directly into a recipient subject, such as by injection, inhalation, oral, intranasal and mucosal administration, or the like, or can be introduced ex vivo, into cells which have been removed from the host. In the latter case, the transformed cells are reintroduced into the subject where an immune response can be mounted against the antigen encoded by the nucleic acid molecule.
- Gene transfer or “gene delivery” refers to methods or systems for reliably inserting DNA of interest into a host cell. Such methods can result in transient expression of non- integrated transferred DNA, extrachromosomal replication and expression of transferred replicons (e.g., episomes), or integration of transferred genetic material into the genomic
- Gene delivery expression vectors include, but are not limited to, vectors derived from alphaviruses, pox viruses and vaccinia viruses. When used for immunization, such gene delivery expression vectors may be referred to as vaccines or vaccine vectors.
- T lymphocytes or “T cells” are non-antibody producing lymphocytes that constitute a part of the cell-mediated arm of the immune system. T cells arise from immature lymphocytes that migrate from the bone marrow to the thymus, where they undergo a maturation process under the direction of thymic hormones. Here, the mature lymphocytes rapidly divide increasing to very large numbers. The maturing T cells become immunocompetent based on their ability to recognize and bind a specific antigen. Activation of immunocompetent T cells is triggered when an antigen binds to the lymphocyte's surface receptors.
- transfection is used to refer to the uptake of foreign DNA by a cell.
- a cell has been "transfected” when exogenous DNA has been introduced inside the cell membrane.
- transfection techniques are generally known in the art. See, e.g., Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, a laboratory manual,
- a “vector” is capable of transferring gene sequences to target cells (e.g., viral vectors, non-viral vectors, particulate carriers, and liposomes).
- target cells e.g., viral vectors, non-viral vectors, particulate carriers, and liposomes.
- vector construct e.g., viral vectors, non-viral vectors, particulate carriers, and liposomes.
- expression vector e transfer vector
- the term includes cloning and expression vehicles, as well as viral vectors.
- suicide gene e.g., a drug-susceptibility gene
- HSV-tk herpes simplex virus
- cytochrome P450 Manome et al. (1996) Gene Therapy 3:513-520
- human deoxycytidine kinase Manome et al. (1996) Nature Medicine 2(5):567-573
- cytosine deaminase Dong et al. (1996) Human Gene Therapy 7:713-720.
- Cells which express these genes are rendered sensitive to the effects of the relatively nontoxic prodrugs ganciclovir (HSV-tk), cyclophosphamide (cytochrome P450 2B1), cytosine arabinoside (human deoxycytidine kinase) or 5- fluorocytosine (bacterial cytosine deaminase).
- HSV-tk relatively nontoxic prodrugs
- cytochrome P450 2B1 cytochrome P450 2B1
- cytosine arabinoside human deoxycytidine kinase
- 5- fluorocytosine bacterial cytosine deaminase
- a “specific binding agent” refers to a member of a specific binding pair of molecules wherein one of the molecules specifically binds to the second molecule through chemical and/or physical means.
- a specific binding agent is an antibody directed against a selected antigen.
- subject any member of the subphylum chordata, including, without limitation, humans and other primates, including non-human primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs; birds, including domestic, wild and game birds such as chickens, turkeys and other gallinaceous birds, ducks, geese, and the like.
- the term does not denote a particular age. Thus, both adult and newborn individuals are intended to be covered.
- the system described above is intended for use in any of the above vertebrate species, since the immune systems of all of these vertebrates operate similarly.
- pharmaceutically acceptable or “pharmacologically acceptable” is meant a material which is not biologically or otherwise undesirable, i.e., the material may be administered to an individual in a formulation or composition without causing any undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.
- physiological pH or a “pH in the physiological range” is meant a pH in the range of approximately 7.2 to 8.0 inclusive, more typically in the range of approximately 7.2 to 7.6 inclusive.
- treatment refers to any of (I) the prevention of infection or reinfection, as in a traditional vaccine, (ii) the reduction or elimination of symptoms, and (iii) the substantial or complete elimination of the pathogen in question. Treatment may be effected prophylactically (prior to infection) or therapeutically (following infection).
- co-administration is meant administration of more than one composition or molecule.
- co-administration includes concurrent administration or sequentially administration (in any order), via the same or different routes of administration.
- co-administration regimes include, co-administration of nucleic acid and polypeptide; co-administration of different nucleic acids (e.g., different expression cassettes as described herein and/or different gene delivery vectors); and co-administration of different polypeptides (e.g., different HIV polypeptides and/or different adjuvants).
- the term also encompasses multiple administrations of one of the co-administered molecules or compositions (e.g., multiple administrations of one or more of the expression cassettes described herein followed by one or more administrations of a polypeptide-containing composition).
- multiple administrations of one of the co-administered molecules or compositions e.g., multiple administrations of one or more of the expression cassettes described herein followed by one or more administrations of a polypeptide-containing composition.
- the time between each administration can be readily determined by one of skill in the art in view of the teachings herein.
- Lentiviral vector refers to a nucleic acid construct which carries, and within certain embodiments, is capable of directing the expression of a nucleic acid molecule of interest.
- the lentiviral vector include at least one transcriptional promoter/enhancer or locus defining element(s), or other elements which control gene expression by other means such as alternate splicing, nuclear RNA export, post- translational modification of messenger, or post-transcriptional modification of protein.
- Such vector constructs must also include a packaging signal, long terminal repeats (LTRS) or portion thereof, and positive and negative strand primer binding sites appropriate to the retrovirus used (if these are not already present in the refroviral vector).
- LTRS long terminal repeats
- the recombinant lentiviral vector may also include a signal which directs polyadenylation, selectable markers such as Neo, TK, hygromycin, phleomycin, histidinol, or DHFR, as well as one or more restriction sites and a translation termination sequence.
- selectable markers such as Neo, TK, hygromycin, phleomycin, histidinol, or DHFR
- such vectors typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second strand DNA synthesis, and a 3 'LTR or a portion thereof
- Lentiviral vector particle refers to a lentivirus which carries at least one gene of interest.
- the retrovirus may also contain a selectable marker.
- the recombinant lentivirus is capable of reverse transcribing its genetic material (RNA) into DNA and incorporating this genetic material into a host cell's DNA upon infection.
- Lentiviral vector particles may have a lentiviral envelope, a non-lentiviral envelope (e.g., an ampho or VSV-G envelope), or a chimeric envelope.
- Nucleic acid expression vector or “Expression cassette” refers to an assembly which is capable of directing the expression of a sequence or gene of interest.
- the nucleic acid expression vector includes a promoter which is operably linked to the sequences or gene(s) of interest. Other control elements may be present as well.
- Expression cassettes described herein may be contained within a plasmid construct.
- the plasmid construct may also include a bacterial origin of replication, one or more selectable markers, a signal which allows the plasmid construct to exist as single-stranded DNA (e.g., a Ml 3 origin of replication), a multiple cloning site, and a "mammalian" origin of replication (e.g., a SV40 or adenovirus origin of replication).
- a Ml 3 origin of replication e.g., a Ml 3 origin of replication
- a multiple cloning site e.g., a SV40 or adenovirus origin of replication
- “Packaging cell” refers to a cell which contains those elements necessary for production of infectious recombinant retrovirus which are lacking in a recombinant refroviral vector.
- such packaging cells typically contain one or more expression cassettes which are capable of expressing proteins which encode Gag, pol and env proteins.
- Producer cell or “vector producing cell” refers to a
- HEV genome and various polypeptide-encoding regions are shown in Table A.
- the nucleotide positions are given relative to 8_5_TV1_C.ZA (SEQ ID NO:33, Figure 11).
- HEV strains or variants e.g., isolates HTV IIIb , HIV SF2 , HJV-1 SF162 , HEV-1 SF170 , HTV LAV , HEV LAI , HIV MN , HEV- 1 CM235» HEV-1 US4 , other HIV-1 strains from diverse subtypes(e.g., subtypes, A through G, and O), HEV-2 strains and diverse subtypes (e.g., HIV-2 UC1 and HEV-2 UC2 ), and simian immunodeficiency virus (SIV).
- SIV simian immunodeficiency virus
- Table A Regions of the HIV Genome relative to 8_5_TV1_C.ZA
- Env polypeptide sequences can be similarly aligned.
- Figure 103 shows the alignment of Env polypeptide sequences from various strains, relative to SF-162.
- Env polypeptides e.g., g ⁇ l20, gpl40 and gpl60
- a "bridging sheet" comprised of 4 anti-parallel ⁇ -strands ( ⁇ -2, ⁇ -3, ⁇ -20 and ⁇ -21) that form a ⁇ -sheet. Extruding from one pair of the ⁇ -strands ( ⁇ -2 and ⁇ -3) are two loops, NI and N2.
- the ⁇ -2 sheet occurs at approximately amino acid residue 113 (Cys) to amino acid residue 117 (Thr) while ⁇ -3 occurs at approximately amino acid residue 192 (Ser) to amino acid residue 194 (He), relative to SF-162 (see, Figure 103).
- the "N1/N2 region” occurs at approximately amino acid positions 120 (Cys) to residue 189 (Cys), relative to SF-162.
- Extruding from the second pair of ⁇ -strands ( ⁇ -20 and ⁇ -21) is a "small-loop" structure, also referred to herein as "the bridging sheet small loop.”
- the locations of both the small loop and bridging sheet small loop can be determined relative to HXB-2 following the teachings herein and in WO/39303.
- Also shown by arrows in Figure 103A-C are approximate sites for deletions sequence from the beta sheet region.
- the "*" denotes ⁇ -glycosylation sites that can be mutated following the teachings of the present specification.
- One aspect of the present invention is the generation of HTV- 1 type C coding sequences, and related sequences, having improved expression relative to the corresponding wild-type sequences.
- SEQ ID NO:52 shows the wild-type sequence of Gag from 8_5_TV1_C.ZA
- SEQ TD NO:54 shows the wild-type sequence of the major homology region of Gag (nucleotides 1632-1694 of Table A) of the same strain.
- SEQ ED NO:100 shows the wild-type sequence of Gag of 12-5_1_TV2_C.ZA.
- Gag sequence obtained from other Type C HIN-1 variants may be manipulated in similar fashion following the teachings of the present specification.
- Such other variants include, but are not limited to, Gag protein encoding sequences obtained from the isolates of HIV-1 Type C, for example as described in ⁇ ovitsky et al., (1999), supra; Myers et al., infra; Virology, 3rd Edition (W.K. Joklik ed. 1988); Fundamental Virology, 2nd Edition (B. ⁇ . Fields and D.M. Knipe, eds. 1991); Virology, 3rd Edition (Fields, B ⁇ , DM Knipe, PM Howley, Editors, 1996, Lippincott-Raven, Philadelphia, PA and on the World Wide Web (Internet), for example at http ://hiv-web . Ian 1.
- the HIV-1 codon usage pattern was modified so that the resulting nucleic acid coding sequence was comparable to codon usage found in highly expressed human genes (Example 1).
- the HIV codon usage reflects a high content of the nucleotides A or T of the codon-triplet.
- the effect of the HEV-1 codon usage is a high AT content in the D ⁇ A sequence that results in a decreased translation ability and instability of the mR ⁇ A.
- highly expressed human codons prefer the nucleotides G or C.
- the Gag coding sequences were modified to be comparable to codon usage found in highly expressed human genes.
- inhibitory (or instability) elements located within the coding sequences of the Gag coding sequences.
- the RRE is a secondary RNA structure that interacts with the HIV encoded Rev-protein to overcome the expression down-regulating effects of the INS.
- the instability elements can be inactivated by introducing multiple point mutations that do not alter the reading frame of the encoded proteins.
- Subtype C Gag-encoding sequences having inactivated RRE sites are shown, for example, in Figures 1 (SEQ ED NO:3), 2 (SEQ ED NO:4), 5 (SEQ ID NO:20) and 6 (SEQ ID NO:26).
- other synthetic polynucleotides derived from other Subtype C strains can be modified to inactivate the RRE sites.
- Modification of the Gag polypeptide coding sequences results in improved expression relative to the wild-type coding sequences in a number of mammalian cell lines (as well as other types of cell lines, including, but not limited to, insect cells). Further, expression of the sequences results in production of virus-like particles (VLPs) by these cell lines (see below).
- VLPs virus-like particles
- the present invention also includes synthetic Env-encoding polynucleotides and modified Env proteins.
- Wild-type Env sequences are obtained from the AF110968 and AF110975 strains as well as novel strains 8_5_TV1_C.ZA (SEQ ID NO:33) and 12- 5_1_TV2_C.ZA (SEQ ID NO:45) of HIV-1, type C. (see, for example, Novitsky et al. (1999) J. Virol. 73(5):4427-4432, for molecular cloning of various subtype C clones from Botswana).
- Wild-type Env sequences of 8_5_TV1_C.ZA are shown, for example, in SEQ TD NO:48 (wild-type Env common region, nucleotides 7486-7629 as shown in Table A); and SEQ ID NO:50 (wild type gpl60, nucleotides 6244-8853 as shown in Table A). Wild-type Env gpl60 of 12-5_1_TV2_C.ZA is shown in SEQ ID NO:98.
- polynucleotides encoding fragments of Env gpl60 can be readily obtained from the larger, full-length sequences disclosed herein. It will also be readily apparent that other modifications can be made, for example deletion of regions such as the NI and/or N2 region; mutation of the cleavage site and the like (see, Example 1). Exemplary sequences of such modification as shown in SEQ ID NO: 119 through 127.
- Env sequences obtained from other Type C HIV-l variants may be manipulated in similar fashion following the teachings of the present specification.
- Such other variants include, but are not limited to, Env protein encoding sequences obtained from the isolates of HEV- 1 Type C, described above.
- the codon usage pattern for Env was modified as described above for Gag so that the resulting nucleic acid coding sequence was comparable to codon usage found in highly expressed human genes. Experiments performed in support of the present invention show that the synthetic Env sequences were capable of higher level of protein production relative to the native Env sequences.
- Env polypeptide coding sequences results in improved expression relative to the wild-type coding sequences in a number of mammalian cell lines (as well as other types of cell lines, including, but not limited to, insect cells). Similar Env polypeptide coding sequences can be obtained, modified and tested for improved expression from a variety of isolates, including those described above for Gag.
- Env include, but are not limited to, generating polynucleotides that encode Env polypeptides having mutations and/or deletions therein.
- the hypervariable regions, VI and/or V2 can be deleted as described herein.
- other modifications, for example to the bridging sheet region and/or to N- glycosylation sites within Env can also be performed following the teachings of the present specification, (see, Figure 103A-C and WO/39303). Various combinations of these modifications can be employed to generate synthetic expression cassettes as described herein.
- the present invention also includes expression cassettes which include synthetic Pol sequences.
- "Pol” includes, but is not limited to, the protein-encoding regions shown in Figure 7, for example polymerase, protease, reverse transcriptase and/or integrase- containing sequences.
- the regions shown in Figure 7 are described, for example, in Wan et et al (1996) Biochem. J. 316:569-573; Kohl et al. (1988) PNAS USA 85:4686-4690; Krausslich et al. (1988) J. Virol. 62:4393-4397; Coffin, "Retroviridae and their Replication” in Virology, ppl437-1500 (Raven, New York, 1990); Patel et. al. (1995) Biochemistry
- the synthetic expression cassettes exemplified herein include one or more of these regions and one or more changes to the resulting amino acid sequences.
- Wild type Pol sequences were obtained from the AFl 10975, 8_5_TV1_C.ZA and 12- 5_1_TN2_C.ZA strains of HIV-1, type C. (see, for example, ⁇ ovitsky et al. (1999) J. Virol. 73(5):4427-4432, for molecular cloning of various subtype C clones from Botswana).
- SEQ TD ⁇ O:34 shows the wild type sequence of AFl 10975 from the p2 through p7 region of Pol (see, Figure 7 and Table A).
- SEQ ID NO:35 shows the wild type sequence of AFl 10975 from pi through the first 6 amino acids of integrase (see, Figure 7 and Table A).
- SEQ TD NO:63 and SEQ ED NO: 104 show wild-type sequences of Pol from 8_5_TV1_C.ZA and 12- 5_1_ TN2_C.ZA, respectively (see, also, Table A).
- Type C HIN-1 variants may be manipulated in similar fashion following the teachings of the present specification.
- Such other variants include, but are not limited to, Pol protein encoding sequences obtained from the isolates of HEV- 1 Type C described herein.
- the codon usage pattern for Pol was modified as described above for Gag and Env so that the resulting nucleic acid coding sequence was comparable to codon usage found in highly expressed human genes.
- Table B shows the nucleotide positions of various regions found in the Pol constructs exemplified herein (e.g., SEQ ID NOs: 30-32).
- the expression constructs exemplified herein include sequence that encodes the first 6 amino acids of the integrase polypeptide. This 6 amino acid region is believed to provide a cleavage recognition site recognized by HEV protease (.see, e.g., McCornack et al. (1997) FEBS Letts 414:84-88).
- certain constructs exemplified herein include a multiple cloning site (MCS) for insertion of one or more transgenes, typically at the 3' end of the construct.
- MCS multiple cloning site
- a cassette encoding a catalytic center epitope derived from the catalytic center in RT is typically included 3' of the sequence encoding 6 amino acids of integrase.
- This cassette (SEQ ID NO:36) encodes Ilel78 through Serine 191 of RT (amino acids 3 through 16 of SEQ ID NO: 37) and was added to keep this well conserved region as a possible CTL epitope.
- the constructs contain an insertion mutations (position 225 of SEQ TD NOs:30 to 32) to preserve the reading frame, (see, e.g., Park et al. (1991) J. Virol. 65:5111).
- the catalytic center and/or primer grip region of RT are modified.
- the catalytic center and primer grip regions of RT are described, for example, in Patel et al. (1995) Biochem. 34:5351 and Palaniappan et al. (1997) J. Biol. Chem. 272(17): 11157.
- PR975YM SEQ ID NO:31
- wild type sequence encoding the amino acids YMDD at positions 183-185 of p66 RT, numbered relative to AFl 10975 are replaced with sequence encoding the amino acids "AP".
- PR975YMWM SEQ ID NO:32
- the same mutation in YMDD is made and, in addition, the primer grip region (amino acids WMGY, residues 229-232 of p66RT, numbered relative to AFl 10975) are replaced with sequence encoding the amino acids "PI.”
- the changes in codon usage are typically restricted to the regions up to the -1 frameshift and starting again at the end of the Gag reading frame; however, regions within the frameshift translation region can be modified as well.
- inhibitory (or instability) elements (INS) located within the coding sequences of the protease polypeptide coding sequence can be altered as well.
- the present invention also includes expression cassettes which include synthetic HIV Type C sequences derived HIV genes other than Gag, Env and Pol, including but not limited to, regions within Gag, Env, Pol, as well as, vif, vpr, tat, rev, vpu, and nef, for example from 8_5_TV1_C.ZA (SEQ TD NO:33) or 12-5_1_TV2_C.ZA (SEQ ID NO:45). Sequences obtained from other strains can be manipulated in similar fashion following the teachings of the present specification. As noted above, the codon usage pattern is modified as described above for Gag, Env and Pol so that the resulting nucleic acid coding sequence is comparable to codon usage found in highly expressed human genes.
- nucleic acid sequence can also be modified to introduce mutations into one or more regions of the gene, for instance to render the gene product non-functional and/or to eliminate the myristoylation site in Nef.
- Synthetic expression cassettes exemplified herein include SEQ ID NO:49 and SEQ ED
- Type C HEV polypeptide-encoding expression cassettes described herein may also contain one or more further sequences encoding, for example, one or more transgenes.
- HCV antigens e.g., El, E2; Houghton, M.., et al., U.S. Patent No. 5,714,596, issued February 3, 1998; Houghton, M.., et al., U.S. Patent No. 5,71
- HEV antigens e.g., derived from tat, rev, nef and/or env
- sequences encoding tumor antigens/epitopes e.g., derived from tat, rev, nef and/or env
- sequences may also be derived from non-viral sources, for instance, sequences encoding cytokines such interleukin-2 (IL-2), stem cell factor (SCF), interleukin 3 (IL-3), interleukin 6 (IL-6), interleukin 12 (IL- 12), G-CSF, granulocyte macrophage-colony stimulating factor (GM-CSF), interleukin-1 alpha (IL-1I), interleukin-11 (IL-11), MIP-1I, tumor necrosis factor (TNF), leukemia inhibitory factor (LIF), c-kit ligand, thrombopoietin (TPO) and flt3 ligand, commercially available from several vendors such as, for example, Genzyme (Framingham, MA),
- HIV polypeptide coding sequences can be obtained from other Type C HTV isolates, see, e.g., Myers et al. Los Alamos Database, Los Alamos National Laboratory, Los Alamos, New Mexico (1992); Myers et al, Human Retroviruses and Aids, 1997, Los Alamos, New Mexico: Los Alamos National Laboratory. Synthetic expression cassettes can be generated using such coding sequences as starting material by following the teachings of the present specification (e.g., see Example 1).
- the synthetic expression cassettes of the present invention include related polypeptide sequences having greater than 85%, preferably greater than 90%, more preferably greater than 95%, and most preferably greater than 98% sequence identity to the synthetic expression cassette sequences disclosed herein (for example, (SEQ ED NOs:30-32; SEQ ID NOs: 3, 4, 20, and 21 and SEQ ID NOs:5-17).
- FIG. 3 Various coding regions are indicated in Figures 3 and 4, for example in Figure 3 (AFl 10968), nucleotides 1-81 (SEQ ED NO:18); nucleotides 82-1512 (SEQ ED NO:6) encode a gpl20 polypeptide, nucleotides 1513 to 2547 (SEQ ID NO-.10) encode a gp41 polypeptide, nucleotides 82-2025 (SEQ ED NO:7) encode a gpl40 polypeptide and nucleotides 82-2547 (SEQ ED NO:8) encode a gpl60 polypeptide.
- nucleotides 1-6 are an EcoRI restriction site; nucleotides 7-87 a encode a wild-type (from 8_2_TN1_C.ZA) leader signal peptide; nucleotides 88 to 1563 encode a gpl20 polypeptide; nucleotides 88 to 2064 encode a gpl40 polypeptide; nucleotides 88 to 2607 encode a gpl60 polypeptide.
- Synthetic HIN-encoding sequences (expression cassettes) of the present invention can be cloned into a number of different expression vectors to evaluate levels of expression and, in the case of Gag, production of NLPs.
- the synthetic D ⁇ A fragments for HEV polypeptides can be cloned into eucaryotic expression vectors, including, a transient expression vector, CMV-promoter-based mammalian vectors, and a shuttle vector for use in baculovirus expression systems.
- Corresponding wild-type sequences can also be cloned into the same vectors.
- vectors can then be fransfected into a several different cell types, including a variety of mammalian cell lines (293, RD, COS-7, and CHO, cell lines available, for example, from the A.T.C.C).
- mammalian cell lines (293, RD, COS-7, and CHO, cell lines available, for example, from the A.T.C.C).
- the cell lines are then cultured under appropriate conditions and the levels of any appropriate polypeptide product can be evaluated in supernatants. (see, Table A and Example 2).
- p24 can be used to evaluate Gag expression
- gpl60, gpl40 or gpl20 can be used to evaluate Env expression
- p6pol can be used to evaluate Pol expression
- prot can be used to evaluate protease
- pi 5 for RNAseH p31 for Integrase
- prot can be used to evaluate protease
- pi 5 for RNAseH p31 for Integrase
- prot can be used to evaluate protease
- p31 for Integrase and other appropriate polypeptides for Vif, Vpr, Tat, Rev, Vpu and Nef.
- modified polypeptides can also be used, for example, other Env polypeptides include, but are not limited to, for example, native g ⁇ l60, oligomeric gpl40, monomeric gpl20 as well as modified and/or synthetic sequences of these polypeptides. The results of these assays demonstrate that
- Western Blot analysis can be used to show that cells containing the synthetic expression cassette produce the expected protein at higher per-cell concentrations than cells containing the native expression cassette.
- the HTV proteins can be seen in both cell lysates and supernatants. The levels of production are significantly higher in cell supernatants for cells fransfected with the synthetic expression cassettes of the present invention.
- Efficient expression of these HIV-containing polypeptides in mammalian cell lines provides the following benefits: the polypeptides are free of baculovirus contaminants; production by established methods approved by the FDA; increased purity; greater yields (relative to native coding sequences); and a novel method of producing the Subtype C HJN- containing polypeptides in CHO cells which is not feasible in the absence of the increased expression obtained using the constructs of the present invention.
- Exemplary Mammalian cell lines include, but are not limited to, BHK, NERO, HT1080, 293, 293T, RD, COS-7, CHO, Jurkat, HUT, SUPT, C8166, MOLT4/clone8, MT-2, MT-4, H9, PM1, CEM, and CEMX174, such cell lines are available, for example, from the A.T.C.C).
- a synthetic Gag expression cassette of the present invention will also exhibit high levels of expression and NLP production when transfected into insect cells. Synthetic expression cassettes described herein also demonstrate high levels of expression in insect cells. Further, in addition to a higher total protein yield, the final product from the synthetic polypeptides consistently contains lower amounts of contaminating baculovirus proteins than the final product from the native Type C sequences.
- synthetic expression cassettes of the present invention can also be introduced into yeast vectors which, in turn, can be transformed into and efficiently expressed by yeast cells (Saccharomyces cerevisea; using vectors as described in Rosenberg, S. and Tekamp-Olson, P., U.S. Patent No. RE35,749, issued, March 17, 1998).
- yeast cells Sacharomyces cerevisea; using vectors as described in Rosenberg, S. and Tekamp-Olson, P., U.S. Patent No. RE35,749, issued, March 17, 1998.
- the synthetic expression cassettes of the present invention can be incorporated into a variety of expression vectors using selected expression control elements. Appropriate vectors and control elements for any given cell type can be selected by one having ordinary skill in the art in view of the teachings of the present specification and information known in the art about expression vectors.
- a synthetic expression cassette can be inserted into a vector which includes control elements operably linked to the desired coding sequence, which allow for the expression of the gene in a selected cell-type.
- typical promoters for mammalian cell expression include the SV40 early promoter, a CMV promoter such as the CMV immediate early promoter (a CMN promoter can include intron A), RSN, HIV-Ltr, the mouse mammary tumor virus LTR promoter (MMLV-ltr), the adenovirus major late promoter (Ad MLP), and the herpes simplex virus promoter, among others.
- transcription termination and polyadenylation sequences will also be present, located 3' to the translation stop codon.
- a sequence for optimization of initiation of translation located 5' to the coding sequence, is also present.
- transcription terminator/polyadenylation signals include those derived from SV40, as described in Sambrook, et al., supra, as well as a bovine growth hormone terminator sequence.
- Introns, containing splice donor and acceptor sites, may also be designed into the constructs for use with the present invention (Chapman et al., Nuc. Acids Res. (1991) 19:3979-3986).
- Enhancer elements may also be used herein to increase expression levels of the mammalian constructs. Examples include the SV40 early gene enhancer, as described in Dijkema et al., EMBO J. (1985) 4:761, the enhancer/promoter derived from the long terminal repeat (LTR) of the Rous Sarcoma Virus, as described in Gorman et al., Proc. Natl. Acad.
- LTR long terminal repeat
- the desired synthetic polypeptide encoding sequences can be cloned into any number of commercially available vectors to generate expression of the polypeptide in an appropriate host system.
- These systems include, but are not limited to, the following: baculovirus expression ⁇ Reilly, P.R., et al, BACULOVIRUS EXPRESSION VECTORS: A LABORATORY MANUAL (1992); Beanies, et al, Biotechniques 11:378 (1991); Pharmingen; Clontech, Palo Alto, CA) ⁇ , vaccinia expression ⁇ Earl, P. L., et al, "Expression of proteins in mammalian cells using vaccinia" In Current Protocols in Molecular Biology (F. M.
- an expression vector containing coding sequences and expression control elements which allow expression of the coding regions in a suitable host.
- the control elements generally include a promoter, translation initiation codon, and translation and transcription termination sequences, and an insertion site for introducing the insert into the vector.
- Translational control elements have been reviewed by M. Kozak (e.g., Kozak, M., Mamm. Genome 7(8):563-574, 1996; Kozak, M., Biochimie 76(9):815-821, 1994; Kozak, M., J Cell Biol 108(2):229-241, 1989; Kozak, M., and Shatkin, A.J., Methods Enzymol 60:360-375, 1979).
- vaccinia virus expression has several advantages including the following: (i) its wide host range; (ii) faithful post-transcriptional modification, processing, folding, transport, secretion, and assembly of recombinant proteins; (iii) high level expression of relatively soluble recombinant proteins; and (iv) a large capacity to accommodate foreign DNA.
- the recombinantly expressed polypeptides from synthetic HIV polypeptide-encoding expression cassettes are typically isolated from lysed cells or culture media. Purification can be carried out by methods known in the art including salt fractionation, ion exchange chromatography, gel filtration, size-exclusion chromatography, size-fractionation, and affinity chromatography. Immunoaffinity chromatography can be employed using antibodies generated based on, for example, HIV antigens.
- Advantages of expressing the proteins of the present invention using mammalian cells include, but are not limited to, the following: well-established protocols for scale-up production; the ability to produce VLPs; cell lines are suitable to meet good manufacturing process (GMP) standards; culture conditions for mammalian cells are known in the art.
- GMP good manufacturing process
- the group-specific antigens (Gag) of human immunodeficiency virus type-1 (HIV-1) self-assemble into noninfectious virus-like particles (VLP) that are released from various eucaryotic cells by budding (reviewed by Freed, E.O., Virology 251:1-15, 1998).
- the synthetic expression cassettes of the present invention provide efficient means for the production of HEV-Gag virus-like particles (VLPs) using a variety of different cell types, including, but not limited to, mammalian cells.
- Viral particles can be used as a matrix for the proper presentation of an antigen entrapped or associated therewith to the immune system of the host.
- VLPs can be produced in enhanced quantity making isolation and purification of the VLPs easier.
- VLPs can be produced in a variety of cell types using the synthetic expression cassettes, in particular, mammalian cell lines can be used for VLP production, for example, CHO cells.
- mammalian cell lines can be used for VLP production, for example, CHO cells.
- Production using CHO cells provides (i) VLP formation; (ii) correct myristoylation and budding; (iii) absence of non-mamallian cell contaminants (e.g., insect viruses and/or cells); and (iv) ease of purification.
- the synthetic expression cassettes of the present invention are also useful for enhanced expression in cell-types other than mammalian cell lines. For example, infection of insect cells with baculovirus vectors encoding the synthetic expression cassettes results in higher levels of total Gag protein yield and higher levels of VLP production (relative to wild-type coding sequences). Further, the final product from insect cells infected with the baculo virus-Gag synthetic expression cassettes consistently contains lower amounts of contaminating insect proteins than
- VLPs can spontaneously form when the particle-forming polypeptide of interest is recombinantly expressed in an appropriate host cell.
- the VLPs produced using the synthetic expression cassettes of the present invention are conveniently prepared using recombinant techniques.
- the Gag polypeptide encoding synthetic expression cassettes of the present invention can include other polypeptide coding sequences of interest (for example, HEV protease, HIV polymerase, HCV core; Env; synthetic Env; see, Example 1). Expression of such synthetic expression cassettes yields VLPs comprising the Gag polypeptide, as well as, the polypeptide of interest.
- coding sequences for the desired particle-forming polypeptides can be cloned into any suitable vector or replicon for expression.
- Numerous cloning vectors are known to those of skill in the art, and the selection of an appropriate cloning vector is a matter of choice. See, generally, Sambrook et al, supra. The vector is then used to transform an appropriate host cell.
- Suitable recombinant expression systems include, but are not limited to, bacterial, mammalian, baculovirus/insect, vaccinia, Semliki Forest virus (SFV), Alphaviruses (such as, Sindbis, Venezuelan Equine Encephalitis (VEE)), mammalian, yeast and Xenopus expression systems, well known in the art.
- Particularly preferred expression systems are mammalian cell lines, vaccinia, Sindbis, insect and yeast systems.
- mammalian cell lines include immortalized cell lines available from the American Type Culture Collection (A.T.C.C), such as, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), as well as others.
- immortalized cell lines available from the American Type Culture Collection (A.T.C.C), such as, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), as well as others.
- bacterial hosts such as E. coli, Bacillus subtilis, and Streptococcus spp., will find use with the present expression constructs.
- Yeast hosts useful in the present invention include inter alia, Saccharomyces cerevisiae, Candida albicans, Candida maltosa, Hansenula polymorpha, Kluyveromyces fragilis, Kluyveromyces lactis, Pichia guillerimondii, Pichia pastoris, Schizosaccharomyces pombe and Yarrowia lipolytica.
- Insect cells for use with baculovirus expression vectors include, inter alia, Aedes aegypti, Autographa californica, Bombyx mori, Drosophila melanogaster, Spodoptera frugiperda, and Trichoplusia ni. See, e.g., Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987).
- Viral vectors can be used for the production of particles in eucaryotic cells, such as those derived from the pox family of viruses, including vaccinia virus and avian poxvirus.
- a vaccinia based infection/transfection system as described in Tomei et al., J Virol (1993) 67:4017-4026 and Selby et al, J. Gen. Virol. (1993) 74:1103-1113, will also find use with the present invention.
- cells are first infected in vitro with a vaccinia virus recombinant that encodes the bacteriophage T7 RNA polymerase. This polymerase displays vibrant specificity in that it only transcribes templates bearing T7 promoters.
- T7 can be added as a purified protein or enzyme as in the "Progenitor" system (Studier and Moffatt, J. Mol. Biol. (1986) 189:113- 130). The method provides for high level, transient, cytoplasmic production of large quantities of RNA and its translation product(s).
- the VLPS are produced by growing host cells transformed by an expression vector under conditions whereby the particle-forming polypeptide is expressed and VLPs can be formed.
- the selection of the appropriate growth conditions is within the skill of the art. If the VLPs are formed intracellularly, the cells are then disrupted, using chemical, physical or mechanical means, which lyse the cells yet keep the VLPs substantially intact.
- Such methods are known to those of skill in the art and are described in, e.g., Protein Purification Applications: A Practical Approach, (E.L.V. Harris and S. Angal, Eds., 1990).
- the particles are then isolated (or substantially purified) using methods that preserve the integrity thereof, such as, by gradient centrifugation, e.g., cesium chloride (CsCl) sucrose gradients, pelleting and the like (see, e.g., Kirnbauer et al. J. Virol. (1993) 67:6929-6936), as well as standard purification techniques including, e.g., ion exchange and gel filtration chromatography.
- gradient centrifugation e.g., cesium chloride (CsCl) sucrose gradients, pelleting and the like
- CsCl cesium chloride
- NLPs produced by cells containing the synthetic expression cassettes of the present invention can be used to elicit an immune response when administered to a subject.
- One advantage of the present invention is that NLPs can be produced by mammalian cells carrying the synthetic expression cassettes at levels previously not possible.
- the NLPs can comprise a variety of antigens in addition to the Gag polypeptide (e.g., Gag-protease, Gag-polymerase, Env, synthetic Env, etc.).
- Purified NLPs, produced using the synthetic expression cassettes of the present invention can be administered to a vertebrate subject, usually in the form of vaccine compositions.
- Combination vaccines may also be used, where such vaccines contain, for example, an adjuvant subunit protein (e.g., Env).
- Administration can take place using the NLPs formulated alone or formulated with other antigens.
- the VLPs can be administered prior to, concurrent with, or subsequent to, delivery of the synthetic expression cassettes for D ⁇ A immunization (see below) and/or delivery of other vaccines.
- the site of VLP administration may be the same or different as other vaccine compositions that are being administered.
- Gene delivery can be accomplished by a number of methods including, but are not limited to, immunization with D ⁇ A, alphavirus vectors, pox virus vectors, and vaccinia virus vectors.
- VLP immune-stimulating (or vaccine) compositions can include various excipients, adjuvants, carriers, auxiliary substances, modulating agents, and the like.
- the immune stimulating compositions will include an amount of the VLP/antigen sufficient to mount an immunological response.
- An appropriate effective amount can be determined by one of skill in the art. Such an amount will fall in a relatively broad range that can be determined through routine trials and will generally be an amount on the order of about 0.1 ⁇ g to about 1000 ⁇ g, more preferably about 1 ⁇ g to about 300 ⁇ g, of VLP/antigen.
- a carrier is optionally present which is a molecule that does not itself induce the production of antibodies harmful to the individual receiving the composition.
- Suitable carriers are typically large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycollic acids, polymeric amino acids, amino acid copolymers, lipid aggregates (such as oil droplets or liposomes), and inactive virus particles.
- particulate carriers include those derived from polymethyl methacrylate polymers, as well as microparticles derived from poly(lactides) and poly(lactide-co- glycolides), known as PLG. See, e.g., Jeffery et al., Pharm. Res.
- the antigen may be conjugated to a bacterial toxoid, such as toxoid from diphtheria, tetanus, cholera, etc., as well as toxins derived from E. coli.
- Adjuvants may also be used to enhance the effectiveness of the compositions.
- adjuvants include, but are not limited to: (1) aluminum salts (alum), such as aluminum hydroxide, aluminum phosphate, aluminum sulfate, etc.; (2) oil-in-water emulsion formulations (with or without other specific immunostimulating agents such as muramyl peptides (see below) or bacterial cell wall components), such as for example (a) MF59 (International Publication No.
- WO 90/14837 containing 5% Squalene, 0.5% Tween 80, and 0.5%) Span 85 (optionally containing various amounts of MTP-P ⁇ (see below), although not required) formulated into submicron particles using a microfluidizer such as Model HOY microfluidizer (Microfluidics, Newton, MA), (b) SAF, containing 10%o Squalane, 0.4% Tween 80, 5% pluronic-blocked polymer L121, and thr-MDP (see below) either microfluidized into a submicron emulsion or vortexed to generate a larger particle size emulsion, and (c) RibiTM adjuvant system (RAS), (Ribi Immunochem, Hamilton, MT) containing 2% Squalene, 0.2% Tween 80, and one or more bacterial cell wall components from the group consisting of monophosphory lipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (
- RNA and DNA double and single stranded RNA and DNA, and backbone modifications thereof, for example, methylphosphonate linkages; or (7) detoxified mutants of a bacterial ADP-ribosylating toxin such as a cholera toxin (CT), a pertussis toxin (PT), or an E.
- CT cholera toxin
- PT pertussis toxin
- coli heat-labile toxin particularly LT-K63 (where lysine is substituted for the wild-type amino acid at position 63)
- LT-R72 where arginine is substituted for the wild-type amino acid at position 72
- CT-S109 where serine is substituted for the wild-type amino acid at position 109
- PT-K9/G129 where lysine is substituted for the wild-type amino acid at position 9 and glycine substituted at position 129)
- polymeric molecules include alternative polymer backbone structures such as, but not limited to, polyvinyl backbones (Pitha, Biochem Biophys Ada, 204:39. 1970a; Pitha, Biopolymers, 9:965, 1970b), and morpholino backbones (Summerton, J., et al, U.S. Patent No. 5,142,047, issued 08/25/92; Summerton, J., et al, U.S. Patent No. 5,185,444 issued 02/03/93). A variety of other charged and uncharged polynucleotide analogs have been reported.
- Muramyl peptides include, but are not limited to, N-acetyl-muramyl-L-threonyl-D- isoglutamine (thr-MDP), N-acteyl-normuramyl-L-alanyl-D-isogluatme (nor-MDP), N- acetylmuramyl-L-alanyl-D-isogluatmmyl-L-alanine-2-(r-2'-dipalmitoyl-s «-glycero-3- huydroxyphosphoryloxy)-ethylamine (MTP-PE), etc.
- thr-MDP N-acetyl-muramyl-L-threonyl-D- isoglutamine
- nor-MDP N-acteyl-normuramyl-L-alanyl-D-isogluatme
- MTP-PE N-acetylmuramyl-L-
- Dosage treatment with the VLP composition may be a single dose schedule or a multiple dose schedule.
- a multiple dose schedule is one in which a primary course of vaccination may be with 1-10 separate doses, followed by other doses given at subsequent time intervals, chosen to maintain and/or reinforce the immune response, for example at 1-4 months for a second dose, and if needed, a subsequent dose(s) after several months.
- the dosage regimen will also, at least in part, be determined by the need of the subject and be dependent on the judgment of the practitioner. If prevention of disease is desired, the antigen carrying VLPs are generally administered prior to primary infection with the pathogen of interest. If treatment is desired, e.g., the reduction of symptoms or recurrences, the VLP compositions are generally administered subsequent to primary infection.
- retroviruses in particular, lentiviral vectors
- retroviruses provide a convenient platform for gene delivery systems.
- a coding sequence of interest for example, a sequence useful for gene therapy applications
- Recombinant virus can then be isolated and delivered to cells of the subject either in vivo or ex vivo.
- a number of refroviral systems have been described, including, for example, the following: (U.S. Patent No. 5,219,740; Miller et al. (1989) BioTechniques 7:980; Miller, A.D.
- gene transfer vectors can be constructed to encode a cytokine or other immunomodulatory molecule.
- nucleic acid sequences encoding native IL-2 and gamma-interferon can be obtained as described in US Patent Nos.
- IL-1 and EL-2 are examples of suitable immunomodulatory molecules for use herein.
- suitable immunomodulatory molecules for use herein include the following: IL-1 and EL-2 (Karupiah et al. (1990) J. Immunology 144:290-298, Weber et al. (1987) J. Exp. Med. 166:1716-1733, Gansbacher et al. (1990) J. Exp. Med. 172:1217-1224, and U.S. Patent No. 4,738,927); IL-3 and IL-4 (Tepper et al. (1989) Cell 57:503-512, Golumbek et al. (1991) Science 254:713-716, and U.S.
- Immunomodulatory factors may also be agonists, antagonists, or ligands for these molecules.
- soluble forms of receptors can often behave as antagonists for these types of factors, as can mutated forms of the factors themselves.
- Nucleic acid molecules that encode the above-described substances, as well as other nucleic acid molecules that are advantageous for use within the present invention may be readily obtained from a variety of sources, including, for example, depositories such as the American Type Culture Collection, or from commercial sources such as British Bio- Technology Limited (Cowley, Oxford England). Representative examples include BBG 12 (containing the GM-CSF gene coding for the mature protein of 127 amino acids), BBG 6
- A.T.C.C. Deposit No. 39656 which contains sequences encoding TNF
- A.T.C.C. Deposit No. 20663 which contains sequences encoding alpha-interferon
- A.T.C.C. Deposit Nos. 31902, 31902 and 39517 which contain sequences encoding beta-interferon
- A.T.C.C. Deposit No. 67024 which contains a sequence which encodes Interleukin- lb
- A.T.C.C. Deposit Nos. 39405, 39452, 39516, 39626 and 39673 which contain sequences encoding Interleukin-2), A.T.C.C.
- Plasmids containing cytokine genes or immunomodulatory genes can be digested with appropriate restriction enzymes, and DNA fragments containing the particular gene of interest can be inserted into a gene transfer vector using standard molecular biology techniques. (See, e.g., Sambrook et al., supra., or Ausbel et al. (eds) Current Protocols in Molecular Biology, Greene Publishing and Wiley-Interscience).
- Polynucleotide sequences coding for the above-described molecules can be obtained using recombinant methods, such as by screening cDNA and genomic libraries from cells expressing the gene, or by deriving the gene from a vector known to include the same.
- plasmids which contain sequences that encode altered cellular products may be obtained from a depository such as the A.T.C.C, or from commercial sources.
- Plasmids containing the nucleotide sequences of interest can be digested with appropriate restriction enzymes, and DNA fragments containing the nucleotide sequences can be inserted into a gene transfer vector using standard molecular biology techniques.
- cDNA sequences for use with the present invention may be obtained from cells which express or contain the sequences, using standard techniques, such as phenol extraction and PCR of cDNA or genomic DNA. See, e.g., Sambrook et al., supra, for a description of techniques used to obtain and isolate DNA. Briefly, mRNA from a cell which expresses the gene of interest can be reverse transcribed with reverse transcriptase using oligo-dT or random primers. The single stranded cDNA may then be amplified by PCR (see U.S. Patent Nos.
- the synthetic expression cassettes of the present invention can be employed in the construction of packaging cell lines for use with refroviral vectors.
- MMV murine leukemia virus
- Lentiviral vectors typically, comprise a 5' lentiviral LTR, a tRNA binding site, a packaging signal, a promoter operably linked to one or more genes of interest, an origin of second strand DNA synthesis and a 3' lentiviral LTR, wherein the lentiviral vector contains a nuclear transport element.
- the nuclear transport element may be located either upstream (5') or downstream (3') of a coding sequence of interest (for example, a synthetic Gag or Env expression cassette of the present invention).
- the nuclear transport element is not RRE.
- the packaging signal is an extended packaging signal.
- the promoter is a tissue specific promoter, or, alternatively, a promoter such as CMN.
- the lentiviral vector further comprises an internal ribosome entry site.
- lentiviruses may be utilized within the context of the present invention, including for example, lentiviruses selected from the group consisting of HIN, HIV-1 , HIV-2, FIN and SIN.
- synthetic Gag-polymerase expression cassettes comprising a promoter and a sequence encoding synthetic Gag- polymerase and at least one of vpr, vpu, nef or vif, wherein the promoter is operably linked to Gag-polymerase and vpr, vpu, nef or vif.
- host cells e.g., packaging cell lines
- any of the expression cassettes described herein are provided which contain any of the expression cassettes described herein.
- packaging cell line comprising an expression cassette that comprises a sequence encoding synthetic Gag-polymerase, and a nuclear transport element, wherein the promoter is operably linked to the sequence encoding Gag-polymerase.
- Packaging cell lines may further comprise a promoter and a sequence encoding tat, rev, or an envelope, wherein the promoter is operably linked to the sequence encoding tat, rev, Env or sequences encoding modified versions of these proteins.
- the packaging cell line may further comprise a sequence encoding any one or more of nef, vif, vpu or vpr (wild-type or synthetic).
- the expression cassette (carrying, for example, the synthetic Gag- polymerase) is stably integrated.
- the packaging cell line upon introduction of a lentiviral vector, typically produces particles.
- the promoter regulating expression of the synthetic expression cassette may be inducible.
- the packaging cell line upon introduction of a lentiviral vector, produces particles that are essentially free of replication competent virus.
- Packaging cell lines are provided comprising an expression cassette which directs the expression of a synthetic Gag-polymerase gene or comprising an expression cassette which directs the expression of a synthetic Env genes described herein.
- a lentiviral vector is introduced into the packaging cell line to produce a vector producing cell line.
- lentiviral vectors can be designed to carry or express a selected gene(s) or sequences of interest.
- Lentiviral vectors may be readily constructed from a wide variety of lentiviruses (see R A Tumor Viruses, Second Edition, Cold Spring Harbor Laboratory, 1985).
- Representative examples of lentiviruses included HIN, HEV-1, HEV-2, FEV and SEV.
- Such lentiviruses may either be obtained from patient isolates, or, more preferably, from depositories or collections such as the American Type Culture Collection, or isolated from known sources using available techniques.
- LTRs may be derived from an HEV, a packaging signal from SIV, and an origin of second strand synthesis from HrV-2.
- Lentiviral vector constructs may comprise a 5' lentiviral LTR, a tRNA binding site, a packaging signal, one or more heterologous sequences, an origin of second strand DNA synthesis and a 3' LTR, wherein said lentiviral vector contains a nuclear transport element that is not RRE.
- LTRs Long Terminal Repeats
- LTRs may be readily identified in the provirus (integrated DNA form) due to their precise duplication at either end of the genome.
- a 5' LTR should be understood to include a 5' promoter element and sufficient LTR sequence to allow reverse transcription and integration of the DNA form of the vector.
- the 3' LTR should be understood to include a polyadenylation signal, and sufficient LTR sequence to allow reverse transcription and integration of the DNA form of the vector.
- the tRNA binding site and origin of second strand DNA synthesis are also important for a retrovirus to be biologically active, and may be readily identified by one of skill in the art.
- refroviral tRNA binds to a tRNA binding site by Watson-Crick base pairing, and is carried with the retrovirus genome into a viral particle.
- the tRNA is then utilized as a primer for DNA synthesis by reverse transcriptase.
- the tRNA binding site may be readily identified based upon its location just downstream from the 5'LTR.
- the origin of second strand DNA synthesis is, as its name implies, important for the second strand DNA synthesis of a retrovirus. This region, which is also referred to as the poly-purine tract, is located just upstream of the 3'LTR.
- recombinant refroviral vector constructs may also comprise a packaging signal, as well as one or more genes or coding sequences of interest.
- the lentiviral vectors have a nuclear transport element which, in preferred embodiments is not RRE.
- Suitable nuclear transport elements include the element in Rous sarcoma virus (Ogert, et al., J ViroL 70, 3834-3843, 1996), the element in Rous sarcoma virus (Liu & Mertz, Genes & Dev., 9, 1766-1789, 1995) and the element in the genome of simian retrovirus type I (Zolotiikhin, et al, J Virol. 68, 7944-7952, 1994).
- Other potential elements include the elements in the histone gene (Kedes, Annu. Rev. Biochem.
- Recombinant lentiviral vector constructs typically lack both Gag-polymerase and Env coding sequences.
- Recombinant lentiviral vector typically contain less than 20, preferably 15, more preferably 10, and most preferably 8 consecutive nucleotides found in Gag- polymerase and Env genes.
- One advantage of the present invention is that the synthetic Gag- polymerase expression cassettes, which can be used to construct packaging cell lines for the recombinant refroviral vector constructs, have little homology to wild-type Gag-polymerase sequences and thus considerably reduce or eliminate the possibility of homologous recombination between the synthetic and wild-type sequences.
- Lentiviral vectors may also include tissue-specific promoters to drive expression of one or more genes or sequences of interest. Lentiviral vector constructs may be generated such that more than one gene of interest is expressed. This may be accomplished through the use of di- or oligo-cistronic cassettes (e.g., where the coding regions are separated by 80 nucleotides or less, see generally Levin et al., Gene 108:167-174, 1991), or through the use of Internal Ribosome Entry Sites ("ERES"). Packaging cell lines suitable for use with the above described recombinant refroviral vector constructs may be readily prepared given the disclosure provided herein.
- the parent cell line from which the packaging cell line is derived can be selected from a variety of mammalian cell lines, including for example, 293, RD, COS-7, CHO, BHK, VERO, HT1080, and myeloma cells.
- one or more expression cassettes are introduced into the cell line in order to complement or supply in trans components of the vector which have been deleted.
- suitable expression cassettes include synthetic Env, synthetic Gag, synthetic Gag-protease, and synthetic Gag- polymerase expression cassettes, which comprise a promoter and a sequence encoding, e.g., Gag-polymerase and at least one of vpr, vpu, nef or vif, wherein the promoter is operably linked to Gag-polymerase and vpr, vpu, nef or vif.
- the native and/or synthetic coding sequences may also be utilized in these expression cassettes.
- packaging cell line comprising an expression cassette that comprises a sequence encoding synthetic Gag- polymerase, and a nuclear transport element, wherein the promoter is operably linked to the sequence encoding Gag-polymerase.
- packaging cell lines comprising a promoter and a sequence encoding tat, rev, Env, or other HIV antigens or epitopes derived therefrom, wherein the promoter is operably linked to the sequence encoding tat, rev, Env, or the HIV antigen or epitope.
- the packaging cell line may comprise a sequence encoding any one or more of nef, vif, vpu or vpr.
- the packaging cell line may contain only nef, vif, vpu, or vpr alone, nef and vif, nef and vpu, nef and vpr, vif and vpu, vif and vpr, vpu and vpr, nef vif and vpu, nef vif and vpr, nef vpu and vpr, wir vpu and vpr, or, all four of nef, vif, vpu, and vpr.
- the expression cassette is stably integrated.
- the packaging cell line upon infroduction of a lentiviral vector, produces particles.
- the promoter is inducible.
- the packaging cell line upon introduction of a lentiviral vector, produces particles that are free of replication competent virus.
- the synthetic cassettes containing modified coding sequences are transfected into a selected cell line. Transfected cells are selected that (i) carry, typically, integrated, stable copies of the HIV coding sequences, and (ii) are expressing acceptable levels of these polypeptides (expression can be evaluated by methods known in the prior art, e.g., see Examples 1-4). The ability of the cell line to produce VLPs may also be verified.
- a sequence of interest is constructed into a suitable viral vector as discussed above.
- the packaging cell line provides the viral functions necessary for producing virus-like particles into which the defective viral genome, containing the sequence of interest, are packaged. These VLPs are then isolated and can be used, for example, in gene delivery or gene therapy. Further, such packaging cell lines can also be used to produce VLPs alone, which can, for example, be used as adjuvants for administration with other antigens or in vaccine compositions. Also, co-expression of a selected sequence of interest encoding a polypeptide (for example, an antigen) in the packaging cell line can also result in the entrapment and/or association of the selected polypeptide in with the VLPs.
- Various forms of the different embodiments of the present invention may be combined.
- HIV polypeptide antigens can be included in DNA immunization constructs containing, for example, a synthetic Gag expression cassette fused in-frame to a coding sequence for the polypeptide antigen (synthetic or wild-type), where expression of the construct results in VLPs presenting the antigen of interest.
- HTV antigens of particular interest to be used in the practice of the present invention include tat, rev, nef, vif, vpu, vpr, and other HIV antigens or epitopes derived therefrom. These antigens may be synthetic (as described herein) or wild-type.
- HIV-1 also known as HTLV-III, LAN, ARV, etc.
- antigens such as gpl20, gp41, gpl60 (both native and modified);
- DNA immunization using synthetic expression cassettes of the present invention can be performed, for instance as described in Example 4. Mice are immunized with both the Gag (and/or Env) synthetic expression cassette and the Gag (and/or Env) wild type expression cassette. Mouse immunizations with plasmid-DNAs will show that the synthetic expression cassettes provide a clear improvement of immunogenicity relative to the native expression cassettes.
- the second boost immunization will induce a secondary immune response, for example, after approximately two weeks.
- the results of CTL assays will show increased potency of synthetic Gag (and/or Env) expression cassettes for induction of cytotoxic T-lymphocyte (CTL) responses by DNA immunization.
- CTL cytotoxic T-lymphocyte
- Polynucleotide sequences coding for the above-described molecules can be obtained using recombinant methods, such as by screening cDNA and genomic libraries from cells expressing the gene, or by deriving the gene from a vector known to include the same. Furthermore, the desired gene can be isolated directly from cells and tissues containing the same, using standard techniques, such as phenol extraction and PCR of cDNA or genomic DNA. See, e.g., Sambrook et al., supra, for a description of techniques used to obtain and isolate DNA. The gene of interest can also be produced synthetically, rather than cloned.
- the nucleotide sequence can be designed with the appropriate codons for the particular amino acid sequence desired. In general, one will select preferred codons for the intended host in which the sequence will be expressed.
- the complete sequence is assembled from overlapping oligonucleotides prepared by standard methods and assembled into a complete coding sequence. See, e.g., Edge, Nature (1981) 292:756; Nambair et al, Science (1984) 223:1299; Jay et al., J. Biol. Chem. (1984) 259:6311; Stemmer, W.P.C., (1995) Gene 164:49- 53.
- the gene sequence encoding the desired antigen can be inserted into a vector containing a synthetic expression cassette of the present invention.
- the antigen is inserted into the synthetic Gag coding sequence such that when the combined sequence is expressed it results in the production of VLPs comprising the Gag polypeptide and the antigen of interest, e.g., Env (native or modified) or other antigen(s) (native or modified) derived from HEV. Insertions can be made within the coding sequence or at either end of the coding sequence (5', amino terminus of the expressed Gag polypeptide; or 3', carboxy terminus of the expressed Gag polypeptide)(Wagner, R., et al., Arch Virol.
- immunogenicity of the high level expressing synthetic Gag expression cassettes can be increased by the insertion of different structural or non- structural HEV antigens, multiepitope cassettes, or cytokine sequences into deleted regions of Gag sequence. Such deletions may be generated following the teachings of the present invention and information available to one of ordinary skill in the art.
- One possible advantage of this approach relative to using full-length sequences fused to heterologous polypeptides, can be higher expression/secretion efficiency of the expression product.
- the polynucletide can contain coding sequences at the 5' end that encode a signal for addition of a myristic moiety to the Gag-containing polypeptide (e.g., sequences that encode Met-Gly).
- coding sequences at the 5' end that encode a signal for addition of a myristic moiety to the Gag-containing polypeptide (e.g., sequences that encode Met-Gly).
- the ability of Gag-containing polypeptide constructs to form NLPs can be empirically determined following the teachings of the present specification.
- the synthetic expression cassettes can also include control elements operably linked to the coding sequence, which allow for the expression of the gene in vivo in the subject species.
- typical promoters for mammalian cell expression include the SN40 early promoter, a CMN promoter such as the CMN immediate early promoter, the mouse mammary tumor virus LTR promoter, the adenovirus major late promoter (Ad MLP), and the herpes simplex virus promoter, among others.
- Other nonviral promoters such as a promoter derived from the murine metallothionein gene, will also find use for mammalian expression.
- transcription termination and polyadenylation sequences will also be present, located 3' to the translation stop codon.
- a sequence for optimization of initiation of translation located 5' to the coding sequence, is also present.
- transcription terminator/polyadenylation signals include those derived from SN40, as described in Sambrook et al., supra, as well as a bovine growth hormone terminator sequence.
- Enhancer elements may also be used herein to increase expression levels of the mammalian constructs. Examples include the SN40 early gene enhancer, as described in Dijkema et al., EMBO J. (1985) 4:761, the enhancer/promoter derived from the long terminal repeat (LTR) of the Rous Sarcoma Virus, as described in Gorman et al., Proc. Natl. Acad. Sci. USA (1982b) 79:6777 and elements derived from human CMV, as described in Boshart et al., Cell (1985) 4_1:521, such as elements included in the CMV intron A sequence.
- LTR long terminal repeat
- plasmids can be constructed which include a chimeric antigen-coding gene sequences, encoding, e.g., multiple antigens/epitopes of interest, for example derived from more than one viral isolate.
- the antigen coding sequences precede or follow the synthetic coding sequence and the chimeric transcription unit will have a single open reading frame encoding both the antigen of interest and the synthetic coding sequences.
- multi-cistronic cassettes e.g., bi-cistronic cassettes
- constructs are used for nucleic acid immunization using standard gene delivery protocols.
- Methods for gene delivery are known in the art. See, e.g., U.S. Patent ⁇ os. 5,399,346, 5,580,859, 5,589,466.
- Genes can be delivered either directly to the vertebrate subject or, alternatively, delivered ex vivo, to cells derived from the subject and the cells reimplanted in the subject.
- refroviruses provide a convenient platform for gene delivery systems. Selected sequences can be inserted into a vector and packaged in refroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to cells of the subject either in vivo or ex vivo.
- refroviral systems have been described (U.S. Patent No.
- adenovirus vectors have also been described. Unlike refroviruses which integrate into the host genome, adenoviruses persist extrachromosomally thus minimizing the risks associated with insertional mutagenesis (Haj -Ahmad and Graham, J Virol. (1986) 57:267-274; Bett et al, J. Virol. (1993) 67:5911-5921; Mittereder et al, Human Gene Therapy (1994) 5:717-729; Seth et al., J Virol. (1994) 68:933-940; Barr et al., Gene Therapy (1994) 1:51-58; Berkner, K.L.
- AAV vector systems have been developed for gene delivery.
- AAV vectors can be readily constructed using techniques well known in the art. See, e.g., U.S. Patent Nos. 5,173,414 and 5,139,941; International Publication Nos. WO 92/01070 (published 23 January 1992) and WO 93/03769 (published 4 March 1993); Lebkowski et al., Molec. Cell. Biol.
- Another vector system useful for delivering the polynucleotides of the present invention is the enterically administered recombinant poxvirus vaccines described by Small, Jr., P.A., et al. (U.S. Patent No. 5,676,950, issued October 14, 1997).
- Additional viral vectors which will find use for delivering the nucleic acid molecules encoding the antigens of interest include those derived from the pox family of viruses, including vaccinia virus and avian poxvirus.
- vaccinia virus recombinants expressing the genes can be constructed as follows. The DNA encoding the particular synthetic HIV subtype C polypeptide coding sequence is first inserted into an appropriate vector so that it is adjacent to a vaccinia promoter and flanking vaccinia DNA sequences, such as the sequence encoding thymidine kinase (TK). This vector is then used to transfect cells which are simultaneously infected with vaccinia.
- TK thymidine kinase
- Homologous recombination serves to insert the vaccinia promoter plus the gene encoding the coding sequences of interest into the viral genome.
- the resulting TKrecombinant can be selected by culturing the cells in the presence of 5-bromodeoxyuridine and picking viral plaques resistant thereto.
- avipoxviruses such as the fowlpox and canarypox viruses
- Recombinant avipox viruses expressing immunogens from mammalian pathogens, are known to confer protective immunity when administered to non- avian species.
- the use of an avipox vector is particularly desirable in human and other mammalian species since members of the avipox genus can only productively replicate in susceptible avian species and therefore are not infective in mammalian cells.
- Methods for producing recombinant avipoxviruses are known in the art and employ genetic recombination, as described above with respect to the production of vaccinia viruses. See, e.g., WO 91/12882; WO 89/03429; and WO 92/03545.
- Molecular conjugate vectors such as the adenovirus chimeric vectors described in Michael et al., J Biol. Chem. (1993) 268:6866-6869 and Wagner et al., Proc. Natl. Acad. Sci. USA (1992) 89:6099-6103, can also be used for gene delivery.
- Members of the Alphavirus genus such as, but not limited to, vectors derived from the Sindbis, Semliki Forest, and Venezuelan Equine Encephalitis viruses, will also find use as viral vectors for delivering the polynucleotides of the present invention (for example, a synthetic Gag-polypeptide encoding expression cassette).
- Sindbis- virus derived vectors useful for the practice of the instant methods, see, Dubensky et al., J. Virol. (1996) 70:508-519; and International Publication Nos. WO 95/07995 and WO 96/17072; as well as, Dubensky, Jr., T.W., et al., U.S. Patent No. 5,843,723, issued December 1, 1998, and Dubensky, Jr., T.W., U.S. Patent No. 5,789,245, issued August 4, 1998.
- a vaccinia based infection/transfection system can be conveniently used to provide for inducible, transient expression of the coding sequences of interest in a host cell.
- cells are first infected in vitro with a vaccinia virus recombinant that encodes the bacteriophage T7 RNA polymerase.
- This polymerase displays extraordinar specificity in that it only transcribes templates bearing T7 promoters.
- cells are transfected with the polynucleotide of interest, driven by a T7 promoter.
- the polymerase expressed in the cytoplasm from the vaccima virus recombinant transcribes the transfected DNA into RNA which is then translated into protein by the host translational machinery.
- the method provides for high level, transient, cytoplasmic production of large quantities of RNA and its translation products. See, e.g., Elroy-Stein and Moss, Proc. Natl. Acad. Sci. USA (1990) 87:6743-6747; Fuerst et al., Proc. Natl. Acad. Sci. USA (1986) 83:8122-8126.
- an amplification system can be used that will lead to high level expression following introduction into host cells.
- a T7 RNA polymerase promoter preceding the coding region for T7 RNA polymerase can be engineered. Translation of RNA derived from this template will generate T7 RNA polymerase which in turn will transcribe more template. Concomitantly, there will be a cDNA whose expression is under the control of the T7 promoter. Thus, some of the T7 RNA polymerase generated from translation of the amplification template RNA will lead to transcription of the desired gene.
- T7 RNA polymerase can be introduced into cells along with the template(s) to prime the transcription reaction.
- the polymerase can be introduced as a protein or on a plasmid encoding the RNA polymerase.
- Synthetic expression cassettes of interest can also be delivered without a viral vector.
- the synthetic expression cassette can be packaged in liposomes prior to delivery to the subject or to cells derived therefrom.
- Lipid encapsulation is generally accomplished using liposomes which are able to stably bind or entrap and retain nucleic acid.
- the ratio of condensed DNA to lipid preparation can vary but will generally be around 1 : 1 (mg
- DNA:micromoles lipid DNA:micromoles lipid), or more of lipid.
- liposomes as carriers for delivery of nucleic acids, see, Hug and Sleight, Biochim. Biophys. Ada. (1991) 1097:1-17; Straubinger et al., inMethods of Enzymology (1983), Vol. 101, pp. 512-527.
- Liposomal preparations for use in the present invention include cationic (positively charged), anionic (negatively charged) and neutral preparations, with cationic liposomes particularly preferred.
- Cationic liposomes have been shown to mediate intracellular delivery of plasmid DNA (Feigner et al., Proc. Natl. Acad. Sci. USA (1987) 84:7413-7416); mRNA (Malone et al, Proc. Natl. Acad. Sci. USA (1989) 86:6077-6081); and purified transcription factors (Debs et al., J. Biol. Chem. (1990) 265:10189-10192), in functional form.
- Cationic liposomes are readily available. For example, N[l-2,3-dioleyloxy)propyTJ-
- N,N,N-triethylammonium (DOTMA) liposomes are available under the trademark Lipofectin, from GEBCO BRL, Grand Island, NY. (See, also, Feigner et al., Proc. Natl. Acad. Sci. USA (1987) 84:7413-7416).
- Other commercially available lipids include (DDAB/DOPE) and DOTAP DOPE (Boerhinger).
- Other cationic liposomes can be prepared from readily available materials using techniques well known in the art. See, e.g., Szoka et al., Proc. Natl. Acad. Sci. USA (1978) 75:4194-4198; PCT Publication No. WO 90/11092 for a description of the synthesis of DOTAP (l,2-bis(oleoyloxy)-3-(trimethylammonio)propane) liposomes.
- anionic and neutral liposomes are readily available, such as, from Avanti Polar Lipids (Birmingham, AL), or can be easily prepared using readily available materials.
- Such materials include phosphatidyl choline, cholesterol, phosphatidyl ethanolamine, dioleoylphosphatidyl choline (DOPC), dioleoylphosphatidyl glycerol (DOPG), dioleoylphoshatidyl ethanolamine (DOPE), among others.
- DOPC dioleoylphosphatidyl choline
- DOPG dioleoylphosphatidyl glycerol
- DOPE dioleoylphoshatidyl ethanolamine
- the liposomes can comprise multilammelar vesicles (MLVs), small unilamellar vesicles (SUVs), or large unilamellar vesicles (LUVs).
- MLVs multilammelar vesicles
- SUVs small unilamellar vesicles
- LUVs large unilamellar vesicles
- the various liposome-nucleic acid complexes are prepared using methods known in the art. See, e.g., Straubinger et al., in METHODS OF IMMUNOLOGY (1983), Vol. 101, pp. 512-527; Szoka et al., Proc. Natl. Acad. Sci. USA (1978) 75:4194-4198; Papahadjopoulos et al., Biochim. Biophys.
- DNA and/or protein antigen(s) can also be delivered in cochleate lipid compositions similar to those described by Papahadjopoulos et al., Biochem. Biophys. A a. (1975) 394:483-491. See, also, U.S. Patent Nos. 4,663,161 and 4,871,488.
- the synthetic expression cassette of interest may also be encapsulated, adsorbed to, or associated with, particulate carriers.
- particulate carriers present multiple copies of a selected antigen to the immune system and promote trapping and retention of antigens in local lymph nodes.
- the particles can be phagocytosed by macrophages and can enhance antigen presentation through cytokine release.
- particulate carriers include those derived from polymethyl methacrylate polymers, as well as microparticles derived from poly(lactides) and poly(lactide-co-glycolides), known as PLG. See, e.g., Jeffery et al.,
- microparticles may also be manufactured in the presence of charged detergents, such as anionic or cationic detergents, to yield microparticles with a surface having a net negative or a net positive charge.
- anionic detergents such as hexadecyllrimethylammomum bromide (CTAB), i.e. CTAB-PLG microparticles, adsorb negatively charged macromolecules, such as DNA. (see, e.g., Int'l Application Number PCT/US99/17308).
- particulate systems and polymers can be used for the in vivo or ex vivo delivery of the gene of interest.
- polymers such as polylysine, polyarginine, polyornithine, spermine, spermidine, as well as conjugates of these molecules, are useful for transferring a nucleic acid of interest.
- DEAE dextran-mediated transfection, calcium phosphate precipitation or precipitation using other insoluble inorganic salts, such as strontium phosphate, aluminum silicates including bentonite and kaolin, chromic oxide, magnesium silicate, talc, and the like, will find use with the present methods. See, e.g.,
- Peptoids Zucke ⁇ nan, R.N., et al., U.S. Patent No. 5,831,005, issued November 3, 1998) may also be used for delivery of a construct of the present invention.
- biolistic delivery systems employing particulate carriers such as gold and tungsten, are especially useful for delivering synthetic expression cassettes of the present invention.
- the particles are coated with the synthetic expression cassette(s) to be delivered and accelerated to high velocity, generally under a reduced atmosphere, using a gun powder discharge from a "gene gun.”
- a gun powder discharge from a "gene gun” for a description of such techniques, and apparatuses useful therefore, see, e.g., U.S. Patent Nos. 4,945,050; 5,036,006; 5,100,792; 5,179,022; 5,371,015; and 5,478,744.
- needle-less injection systems can be used (Davis, H.L., et al, Vaccine 12:1503-1509, 1994; Bioject, Inc., Portland, OR).
- compositions for delivery to the vertebrate subject are formulated into compositions for delivery to the vertebrate subject.
- compositions may either be prophylactic (to prevent infection) or therapeutic (to treat disease after infection).
- the compositions will comprise a "therapeutically effective amount" of the gene of interest such that an amount of the antigen can be produced in vivo so that an immune response is generated in the individual to which it is administered. The exact amount necessary will vary depending on the subject being treated; the age and general condition of the subject to be treated; the capacity of the subject's immune system to synthesize antibodies; the degree of protection desired; the severity of the condition being treated; the particular antigen selected and its mode of administration, among other factors. An appropriate effective amount can be readily determined by one of skill in the art.
- compositions will generally include one or more "pharmaceutically acceptable excipients or vehicles” such as water, saline, glycerol, polyethyleneglycol, hyaluronic acid, ethanol, etc. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles. Certain facilitators of nucleic acid uptake and/or expression can also be included in the compositions or coadministered, such as, but not limited to, bupivacaine, cardiotoxin and sucrose.
- pharmaceutically acceptable excipients or vehicles such as water, saline, glycerol, polyethyleneglycol, hyaluronic acid, ethanol, etc.
- auxiliary substances such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles.
- Certain facilitators of nucleic acid uptake and/or expression can also be included in the compositions or coadministered, such as
- compositions of the invention can be administered directly to the subject (e.g., as described above) or, alternatively, delivered ex vivo, to cells derived from the subject, using methods such as those described above.
- methods for the ex vivo delivery and reimplantafion of transformed cells into a subject are known in the art and can include, e.g., dextran-mediated transfection, calcium phosphate precipitation, polybrene mediated transfection, lipofectamine and LT-1 mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide(s) (with or without the corresponding antigen) in liposomes, and direct microinjection of the DNA into nuclei.
- Direct delivery of synthetic expression cassette compositions in vivo will generally be accomplished with or without viral vectors, as described above, by injection using either a conventional syringe or a gene gun, such as the Accell® gene delivery system (PowderJect Technologies, Inc., Oxford, England).
- the constructs can be injected either subcutaneously, epidermally, intradermally, intramucosally such as nasally, rectally and vaginally, intraperitoneally, intravenously, orally or intramuscularly. Delivery of DNA into cells of the epidermis is particularly preferred as this mode of adminisfration provides access to skin- associated lymphoid cells and provides for a transient presence of DNA in the recipient.
- Dosage treatment may be a single dose schedule or a multiple dose schedule.
- Administration of nucleic acids may also be combined with administration of peptides or other substances.
- T cells and related cell types (including but not limited to antigen presenting cells, such as, macrophage, monocytes, lymphoid cells, dendritic cells, B- cells, T-cells, stem cells, and progenitor cells thereof), can be used for ex vivo delivery of the synthetic expression cassettes of the present invention.
- T cells can be isolated from peripheral blood lymphocytes (PBLs) by a variety of procedures known to those skilled in the art. For example, T cell populations can be "enriched" from a population of PBLs through the removal of accessory and B cells.
- T cell enrichment can be accomplished by the elimination of non-T cells using anti-MHC class II monoclonal antibodies.
- other antibodies can be used to deplete specific populations of non-T cells.
- anti-Ig antibody molecules can be used to deplete B cells and anti-Mad antibody molecules can be used to deplete macrophages.
- T cells can be further fractionated into a number of different subpopulations by techniques known to those skilled in the art. Two major subpopulations can be isolated based on their differential expression of the cell surface markers CD4 and CD8.
- CD4 + cells can be enriched using antibodies specific for CD4 (see Coligan et al., supra). The antibodies may be coupled to a solid support such as magnetic beads.
- CD8+ cells can be enriched through the use of antibodies specific for CD4 (to remove CD4 + cells), or can be isolated by the use of CD8 antibodies coupled to a solid support.
- CD4 lymphocytes from HIV-l infected patients can be expanded ex vivo, before or after transduction as described by Wilson et. al. (1995) J. Infect. Pis. 172:88.
- T cells Following purification of T cells, a variety of methods of genetic modification known to those skilled in the art can be performed using non- viral or viral-based gene transfer vectors constructed as described herein. For example, one such approach involves transduction of the purified T cell population with vector-containing supernatant of cultures derived from vector producing cells. A second approach involves co-cultivation of an irradiated monolayer of vector-producing cells with the purified T cells. A third approach involves a similar co-cultivation approach; however, the purified T cells are pre-stimulated with various cytokines and cultured 48 hours prior to the co-cultivation with the irradiated vector producing cells. Pre-stimulation prior to such transduction increases effective gene transfer (Nolta et al.
- T cells are collected from the vector producing cell monolayer, expanded, and frozen in liquid nitrogen.
- Gene transfer vectors containing one or more synthetic expression cassette of the present invention (associated with appropriate control elements for delivery to the isolated T cells) can be assembled using known methods.
- a marker can be used which imparts to a mammalian cell transduced with the gene transfer vector resistance to a cytotoxic agent.
- the cytotoxic agent can be, but is not limited to, neomycin, aminoglycoside, tefracycline, chloramphenicol, sulfonamide, actinomycin, nefropsin, distamycin A, anthracycline, or pyrazinamide.
- neomycin phosphotransferase II imparts resistance to the neomycin analogue geneticin (G418).
- the T cells can also be maintained in a medium containing at least one type of growth factor prior to being selected.
- growth factors are known in the art which sustain the growth of a particular cell type. Examples of such growth factors are cytokine mitogens such as rIL-2, IL-10, IL-12, and IL-15, which promote growth and activation of lymphocytes. Certain types of cells are stimulated by other growth factors such as hormones, including human chorionic gonadotropin (hCG) and human growth hormone.
- hCG human chorionic gonadotropin
- the selection of an appropriate growth factor for a particular cell population is readily accomplished by one of skill in the art.
- white blood cells such as differentiated progenitor and stem cells are stimulated by a variety of growth factors. More particularly, IL-3, IL-4, IL-5, IL-6, IL-9, GM-CSF, M-CSF, and G-CSF, produced by activated T H and activated macrophages, stimulate myeloid stem cells, which then differentiate into pluripotent stem cells, granulocyte-monocyte progenitors, eosinophil progenitors, basophil progenitors, megakaryocytes, and erythroid progenitors. Differentiation is modulated by growth factors such as GM-CSF, IL-3, IL-6, IL-11, and EPO.
- growth factors such as GM-CSF, IL-3, IL-6, IL-11, and EPO.
- Pluripotent stem cells then differentiate into lymphoid stem cells, bone marrow stromal cells, T cell progenitors, B cell progenitors, thymocytes, T H Cells, T c cells, and B cells. This differentiation is modulated by growth factors such as IL-3, IL-4, IL-6, IL-7, GM- CSF, M-CSF, G-CSF, IL-2, and IL-5.
- growth factors such as IL-3, IL-4, IL-6, IL-7, GM- CSF, M-CSF, G-CSF, IL-2, and IL-5.
- Granulocyte-monocyte progenitors differentiate to monocytes, macrophages, and neutrophils. Such differentiation is modulated by the growth factors GM-CSF, M-CSF, and IL-8. Eosinophil progenitors differentiate into eosinophils. This process is modulated by GM-CSF and IL-5.
- T cells can also be contacted with a mitogen, for example a cytokine such as IL-2.
- a cytokine such as IL-2.
- the IL-2 is added to the population of T cells at a concentration of about 50 to 100 ⁇ g/ml. Activation with the CD3-binding agent can be carried out for 2 to 4 days.
- the T cells are genetically modified by contacting the same with a suitable gene transfer vebtor under conditions that allow for transfection of the vectors into the T cells. Genetic modification is carried out when the cell density of the T cell population is between about 0.1 x 10 6 and 5 x 10 6 , preferably between about 0.5 x 10 6 and 2 x 10 6 .
- a suitable viral and nonviral-based gene transfer vectors have been described for use herein. After transduction, transduced cells are selected away from non-transduced cells using known techniques.
- the cells can be contacted with the appropriate cytotoxic agent, whereby non-transduced cells can be negatively selected away from the transduced cells.
- the selectable marker is a cell surface marker
- the cells can be contacted with a binding agent specific for the particular cell surface marker, whereby the transduced cells can be positively selected away from the population.
- the selection step can also entail fluorescence-activated cell sorting (FACS) techniques, such as where FACS is used to select cells from the population containing a particular surface marker, or the selection step can entail the use of magnetically responsive particles as retrievable supports for target cell capture and/or background removal.
- FACS fluorescence-activated cell sorting
- a FACS cell sorter e.g. a FACSNantageTM Cell Sorter, Becton Dickinson Immunocytometry Systems, San Jose, CA
- FACS cell sorter e.g. a FACSNantageTM Cell Sorter, Becton Dickinson Immunocytometry Systems, San Jose, CA
- the cells are stained with fluorescent-labeled antibody molecules directed against the particular cell surface marker.
- the amount of bound antibody on each cell can be measured by passing droplets containing the cells through the cell sorter.
- By imparting an electromagnetic charge to droplets containing the stained cells the transduced cells can be separated from other cells.
- the positively selected cells are then harvested in sterile collection vessels.
- Positive selection of the transduced cells can also be performed using magnetic separation of cells based on expression or a particular cell surface marker.
- cells to be positively selected are first contacted with specific binding agent (e.g., an antibody or reagent the interacts specifically with the cell surface marker).
- the cells are then contacted with retrievable particles (e.g., magnetically responsive particles) which are coupled with a reagent that binds the specific binding agent (that has bound to the positive cells).
- the cell-binding agent-particle complex can then be physically separated from non- labeled cells, for example using a magnetic field.
- the labeled cells can be retained in a container using a magnetic filed while the negative cells are removed.
- Expression of the vector in the selected transduced cells can be assessed by a number of assays known to those skilled in the art. For example, Western blot or Northern analysis can be employed depending on the nature of the inserted nucleotide sequence of interest.
- the invention includes a kit for genetic modification of an ex vivo population of primary mammalian cells.
- the kit typically contains a gene transfer vector coding for at least one selectable marker and at least one synthetic expression cassette contained in one or more containers, ancillary reagents or hardware, and instructions for use of the kit.
- any of the polynucleotides e.g., expression cassettes
- polypeptides described herein delivered by any of the methods described above
- Non-limiting examples include co-administration of these molecules, for example, in prime-boost methods where one or more molecules are delivered in a "priming" step and, subsequently, one or more molecules are delivered in a "boosting" step.
- the delivery of one or more nucleic acid-containing compositions and is followed by delivery of one or more nucleic acid-containing compositions and/or one or more polypeptide-containing compositions e.g., polypeptides comprising HIV antigens
- multiple nucleic acid "primes” can be followed by multiple polypeptide "boosts” (of the same or different polypeptides).
- Other examples include multiple nucleic acid administrations and multiple polypeptide administrations.
- the various compositions can be delivered in any order.
- the nucleic acids need not be all delivered before the polypeptides.
- the priming step may include delivery of one or more polypeptides and the boosting comprises delivery of one or more nucleic acids and/or one more polypeptides.
- Multiple polypeptide administrations can be followed by multiple nucleic acid administrations or polypeptide and nucleic acid administrations can be performed in any order.
- the nucleic acid molecules can encode all, some or none of the polypeptides.
- nucleic acid molecules e.g., expression cassettes
- polypeptides described herein can be co-administered in any order and via any administration routes. Therefore, any combination of polynucleotides and/or polypeptides described herein can be used to generate elicit an immune reaction.
- the Pol coding sequences were selected from Type C strain AFl 10975.
- the Gag coding sequences were selected from the Type C strains AFl 10965 and AFl 10967.
- the Env coding sequences were selected from Type C strains AFl 10968 and AFl 10975. These sequences were manipulated to maximize expression of their gene products.
- the HIV-1 codon usage pattern was modified so that the resulting nucleic acid coding sequence was comparable to codon usage found in highly expressed human genes.
- the HTV codon usage reflects a high content of the nucleotides A or T of the codon-triplet.
- HEV-1 codon usage is a high AT content in the DNA sequence that results in a decreased translation ability and instability of the mRNA.
- highly expressed human codons prefer the nucleotides G or C.
- the coding sequences were modified to be comparable to codon usage found in highly expressed human genes.
- INS inhibitory (or instability) elements located within the coding sequences of the Gag and Gag-protease coding sequences
- RRE is a secondary RNA structure that interacts with the HIV encoded Rev-protein to overcome the expression down-regulating effects of the INS.
- the instability elements are inactivated by introducing multiple point mutations that do not alter the reading frame of the encoded proteins.
- Figures 5 and 6 show the location of some remaining ENS in synthetic sequences derived from strains AFl 10965 and AFl 10967.
- sequences encoding Pol-polypeptides are included with the synthetic Gag or Env sequences in order to increase the number of epitopes for virus-like particles expressed by the synthetic, modified Gag/Env expression cassette.
- synthetic HTV-1 Pol expresses the functional enzymes reverse transcriptase (RT) and integrase (INT) (in addition to the structural proteins and protease), it may be helpful in some instances to inactivate RT and INT functions.
- RT and INT integrase
- Several deletions or mutations in the RT and INT coding regions can be made to achieve catalytic nonfunctional enzymes with respect to their RT and TNT activity.
- selected B- and/or T-cell epitopes can be added to the Pol constructs (e.g., 3' of the truncated INT or within the deletions of the RT- and INT-coding sequence) to replace and augment any epitopes deleted by the functional modifications of RT and INT.
- selected B- and T-cell epitopes (including CTL epitopes) from RT and INT can be included in a minimal VLP formed by expression of the synthetic Gag or synthetic Pol cassette, described above.
- the resulting modified coding sequences are presented as a synthetic Env expression cassette; a synthetic Gag expression cassette; a synthetic Pol expression cassette.
- a common Gag region extends from nucleotide position 844 to position 903 (SEQ ID NO:l), relative to AFl 10965 (or from approximately amino acid residues 282 to 301 of SEQ ED NO: 17) and from nucleotide position 841 to position 900 (SEQ ID NO:2), relative to AFl 10967 (or from approximately amino acid residues 281 to 300 of SEQ ID NO:22).
- Env region extends from nucleotide position 1213 to position 1353 (SEQ ID NO:5) and amino acid positions 405 to 451 of SEQ ID NO:23, relative to AFl 10968 and from nucleotide position 1210 to position 1353 (SEQ ID NO:l 1) and amino acid positions 404-451 (SEQ ID NO :24), relative to AF 110975.
- the synthetic DNA fragments for Pol, Gag and Env are cloned into the following eucaryotic expression vectors: pCMVKm2, for transient expression assays and DNA immunization studies, the pCMVKn ⁇ 2 vector is derived from pCMV6a (Chapman et al., Nuc. Acids Res.
- the pCMVKm2 vector differs from the pCMV-link vector only in that a polylinker site is inserted into pCMNKm2 to generate pCMV-link; pES ⁇ 2dhfr and pCMVPLEdhfr, for expression in Chinese Hamster Ovary (CHO) cells; and, pAcC13, a shuttle vector for use in the Baculovirus expression system (pAcC13, is derived from pAcC12 which is described by Munemitsu S., et al., Mol Cell Biol. 10(ll):5977-5982, 1990). Briefly, construction of pCMVPLEdhfr was as follows.
- the EMCV RES (internal ribosome entry site) leader was PCR-amplified from pCite-4a+ (Novagen, Inc., Milwaukee, WI) and inserted into pET- 23d (Novagen, Inc., Milwaukee, WI) as an Xba-Nco fragment to give pET-EMCV.
- the dhfr gene was PCR-amplified from pESN2dhfr to give a product with a Gly-Gly-Gly-Ser spacer in place of the translation stop codon and inserted as an Nco-BamHl fragment to give pET-E- DHFR.
- the attenuated neo gene was PCR amplified from a pSV2Neo (Clontech, Palo Alto, CA) derivative and inserted into the unique BamTTl site of pET-E-DHFR to give pET- E-DHFR/Neo (m2) .
- the bovine growth hormone terminator from pCDNA3 (Invitrogen, Inc., Carlsbad, CA) was inserted downstream of the neo gene to give pET-E- DHFR/Neo (m2) BGHt.
- the EMCV-dhfr/neo selectable marker cassette fragment was prepared by cleavage of pET-E-DHFR/Neo (m2) BGHt.
- the CMV enhancer/promoter plus Intron A was transferred from pCMV6a (Chapman et al, Nuc. Acids Res. (1991) 19:3979-3986) as a Hin ⁇ TT -Sall fragment into pUC19 (New England Biolabs, Inc., Beverly, MA).
- the vector backbone of pUC19 was deleted from the Ndel to the Sapl sites.
- the above described DHFR cassette was added to the construct such that the EMCV ERES followed the CMV promoter.
- the vector also contained an amp r gene and an SV40 origin of replication.
- the Major Homology Region (MHR) of HIV-1 p55Gag is located in the p24-CA sequence of Gag. It is a conserved stretch of approximately 20 amino acids.
- the position in the wild type AFl 10965 Gag protein is from 282-301 (SEQ ID NO:25) and spans a region from 844-903 (SEQ ED NO:26) for the Gag DNA-sequence.
- the position in the synthetic Gag protein is also from 282-301 (SEQ TD NO:25) and spans a region from 844-903 (SEQ ED NO:l) for the synthetic Gag DNA-sequence.
- the position in the wild type and synthetic AFl 10967 Gag protein is from 281-300 (SEQ ID NO:27) and spans a region from 841-900 (SEQ ID NO:2) for the modified Gag DNA-sequence. Mutations or deletions in the MHR can severely impair particle production (Borsetti, A., et al., J Virol. 72(11):9313-9317, 1998; Mammano, F., et al., J Virol 68(8):4927-4936, 1994). Percent identity to this sequence can be determined, for example, using the Smith-
- Env It is a conserved stretch of approximately 47 amino acids.
- the position in the wild type and synthetic AFl 10968 Env protein is from approximately amino acid residue 405 to 451 (SEQ ED NO:28) and spans a region from 1213 to 1353 (SEQ ID NO:5) for the Env DNA-sequence.
- the position in the wild type and synthetic AFl 10975 Env protein is from approximately amino acid residue 404 to 451 (SEQ TD NO:29) and spans a region from 1210 to 1353 (SEQ ID NO:l 1) for the Env DNA-sequence.
- Exemplary HIV Sequences Derived from South African HIV Type C Strains HTV coding sequences of novel Type C isolates were obtained. Polypeptide-coding sequences were manipulated to maximize expression of their gene products.
- the HIV-1 codon usage pattern was modified so that the resulting nucleic acid coding sequence was comparable to codon usage found in highly expressed human genes.
- the HIV codon usage reflects a high content of the nucleotides A or T of the codon-triplet.
- the effect of the HIV-1 codon usage is a high AT content in the DNA sequence that results in a decreased translation ability and instability of the mRNA.
- highly expressed human codons prefer the nucleotides G or C.
- the coding sequences were modified to be comparable to codon usage found in highly expressed human genes. Shown below in Table C are exemplary wild-type and synthetic sequences derived from a novel South African HIV Type C isolate, clone 8_5_TV1_CZA.
- Table D shows exemplary synthetic Env sequences derived from a novel South African HIV Type C isolate, clone 8_2_TV1_C.ZA.
- Table E shows wild-type and synthetic sequences derived from South African HIV Type C strain 12-5_1_TV2_CZA.
- Env-encoding constructs can be prepared using any of the full-length of gpl60 constructs.
- a gpl40 form (SEQ ID NO: 132) was made by truncating g ⁇ l60 (SEQ TD NO: 126) at nucleotide 2064;
- gpl20 was made by truncating g ⁇ l60 (SEQ ED NO:126) at nucleotide 1551 (SEQ ED NO:126).
- Additional gpl40 and gpl20 forms can be made using the methods described herein.
- One or more stop codons are typically added (e.g., nucleotides 2608 to 2610 of SEQ ID NO:126).
- the wild-type leader sequence can be modified and/or replaced with other leader sequences (e.g, TPA1 leader sequences).
- the polypeptide gpl60 includes the coding sequences for gpl20 and gp41.
- the polypeptide g ⁇ 41 is comprised of several domains including an oligomerization domain (OD) and a transmembrane spanning domain (TM).
- OD oligomerization domain
- TM transmembrane spanning domain
- the oligomerization domain is required for the non-covalent association of three gp41 polypeptides to form a trimeric structure: through non-covalent interactions with the gp41 trimer (and itself), the gpl20 polypeptides are also organized in a trimeric structure.
- a cleavage site exists approximately between the polypeptide sequences for gpl20 and the polypeptide sequences corresponding to gp41. This cleavage site(s) can be mutated to prevent cleavage at the site.
- the resulting gpl40 polypeptide corresponds to a truncated form of gpl60 where the transmembrane spanning domain of g ⁇ 41 has been deleted.
- This gpl40 polypeptide can exist in both monomeric and oligomeric (i. e. trimeric) forms by virtue of the presence of the oligomerization domain in the gp41 moiety.
- the cleavage site In the situation where the cleavage site has been mutated to prevent cleavage and the transmembrane portion of gp41 has been deleted the resulting polypeptide product is designated "mutated" gpl40 (e.g., gpl40.mut).
- the cleavage site can be mutated in a variety of ways.
- the mutation in the gpl20/gp41 cleavage site changes the wild-type amino acid sequence KRRWQREKR (SEQ ID NO:129) to ISSVVQSEKS (SEQ ID NO:130).
- hypervariable region(s) were deleted, N-glycosylation sites were removed and/or cleavage sites mutated.
- the relative locations of VI and/or N2 regions can also be readily determined by alignment to the regions shown in Table A.
- Table E shows wild-type and synthetic sequences derived from South African HIN Type C strain 12-5_1_TV2__CZA.
- polyproteins can be constructed by fusing in-frame two or more polynucleotide sequences encoding polypeptide or peptide products.
- polycisfronic coding sequences may be produced by placing two or more polynucleotide sequences encoding polypeptide products adjacent each other, typically under the control of one promoter, wherein each polypeptide coding sequence may be modified to include sequences for internal ribosome binding sites.
- sequences of the present invention may be modified by deletions, point mutations, substitutions, frame-shifts, and/or further genetic modifications (for example, mutations leading to inactivation of an activity associated with a polypeptide, e.g., mutations that inactivate protease, tat, or reverse transcriptase activity).
- modifications are taught generally in the art and may be applied in the context of the teachings of the present invention.
- sites corresponding to the "Regions of the HEV Genome" listed in Table A may be modified in the corresponding regions of the novel sequences disclosed herein in order to achieve desirable modifications.
- modified (synthetic) polynucleotide sequences of the present invention can be combined for use, e.g., in an composition for generating an immune response in a subject, in a variety of ways, including but not limited to the following ways: multiple individual expression cassettes each comprising one polynucleotide sequence of the present invention (e.g., a gag-expression cassette, an env expression cassette, and a rev expression cassette, or a pol-expression cassette, a vif expression cassette, and a vpr expression cassette, etc.); polyproteins produced by in-frame fusions of multiple polynucleotides of the present invention, and polycisfronic polynucleotides produced using multiple polynulcleotides of the present invention.
- multiple individual expression cassettes each comprising one polynucleotide sequence of the present invention e.g., a gag-expression cassette, an env expression cassette, and a rev expression cassette, or a pol-expression cassette, a
- the wild-type Subtype C HIV coding (for example from AFl 10965, AFl 10967, AFl 10968, AFl 10975, as well as novel South African strains 8_5_TV1_CZA, 8_2_TV1_C.ZA and 12-5_1_TN2_CZA) sequences are cloned into expression vectors having the same features as the vectors into which the synthetic sequences are cloned. Expression efficiencies for various vectors carrying the wild-type and synthetic sequences are evaluated as follows.
- Cells from several mammalian cell lines (293, RD, COS- 7, and CHO; all obtained from the American Type Culture Collection, 10801 University Boulevard, Manassas, NA 20110-2209) are transfected with 2 ⁇ g of D ⁇ A in transfection reagent LTl (PanNera Corporation, 545 Science Dr., Madison, WI). The cells are incubated for 5 hours in reduced serum medium (Opti-MEM, Gibco-BRL, Gaithersburg, MD).
- the medium is then replaced with normal medium as follows: 293 cells, EMDM, 10% fetal calf serum, 2% glutamine (BioWhittaker, WalkersviUe, MD); RD and COS-7 cells, D-MEM, 10% fetal calf serum, 2%. glutamine (Opti-MEM, Gibco-BRL, Gaithersburg, MD); and CHO cells, Ham's F-12, 10% fetal calf serum, 2% glutamine (Opti-MEM, Gibco-BRL, Gaithersburg, MD). The cells are incubated for either 48 or 60 hours. Cell lysates are collected as described below in Example 3. Supernatants are harvested and filtered through 0.45 ⁇ m syringe filters.
- Supernatants are evaluated using the using 96-well plates coated with a murine monoclonal antibody directed against HIN antigen, for example a Coulter p24-assay (Coulter Corporation, Hialeah, FL, US).
- HIN-1 antigen binds to the coated wells.
- Biotinylated antibodies against HIN recognize the bound antigen.
- Conjugated strepavidin- horseradish peroxidase reacts with the biotin. Color develops from the reaction of peroxidase with TMB substrate. The reaction is terminated by addition of 4 ⁇ H 2 SO 4 .
- the intensity of the color is directly proportional to the amount of HIV antigen in a sample.
- Synthetic HTV Type C expression cassettes provides dramatic increases in production of their protein products, relative to the native (wild-type Subtype C) sequences, when expressed in a variety of cell lines.
- 293 cells were transiently transfected using standard methods with native and sequence-modified constructs encoding the gpl20 and gpl40 forms of the 8_2_TV1_C.ZA (TNlc8.2) envelope.
- Env protein was measure in cell lysates and supernatants using an in- house Env capture ELISA. Results are shown in Table 5 below and indicate that the wild- type signal peptide leader sequence of the TVlc8.2 can be used to efficiently express the encoded envelope protein to levels that are better or comparable to those observed using the heterologous tpa leader sequences.
- the TVlc8.2 leader works in its native or sequence-modified forms and can be used with native or sequence-modified env genes. All constructs were tested after cloning of the gene cassettes into the EcoRI and Xhol sites of the pCMVlink expression vector.
- the sequence-modified TVlc8.2 envelope variant gene cassettes were subcloned into a Chiron pCMV expression vector for the derivation of stable mammalian cell lines.
- Stable CHO cell lines expressing the TVlc8.2 envelope proteins were derived using standard methods of transfection, methotrexate amplification, and screening. These cell lines were found to secrete levels of envelope protein that were comparable to those observed for proteins expressed using the tpa leader sequences. Representative results are shown in Table 6 for two cell line clone expressing the TVlc8.2 gpl20; they are compared to two reference clones expressing SF162 subtype B gpl20 derived in a similar fashion but using the tpa leader. Protein concentrations were determined following densitometry of scanned gels of semi-purified proteins. Standard curves were generated using a highly purified and well- characterized preparation of SF2 gpl20 protein and the concentrations of the test proteins were determined.
- Human 293 cells are transfected as described in Example 2 with pCMV-based vectors containing native or synthetic HIV Type C expression cassettes. Cells are cultivated for 60 hours post-transfection. Supernatants are prepared as described. Cell lysates are prepared as follows. The cells are washed once with phosphate-buffered saline, lysed with detergent [1% NP40 (Sigma Chemical Co., St. Louis, MO) in 0.1 M Tris-HCl, pH 7.5], and the lysate transferred into fresh tubes. SDS-polyacrylamide gels (pre-cast 8-16%; Novex, San Diego, CA) are loaded with 20 ⁇ l of supernatant or 12.5 ⁇ l of cell lysate.
- NP40 Sigma Chemical Co., St. Louis, MO
- a protein standard is also loaded (5 ⁇ l, broad size range standard; BioRad Laboratories, Hercules, CA). Electrophoresis is carried out and the proteins are transferred using a BioRad Transfer Chamber (BioRad Laboratories, Hercules, CA) to Immobilon P membranes (Millipore Corp., Bedford, MA) using the transfer buffer recommended by the manufacturer (Millipore), where the transfer is performed at 100 volts for 90 minutes. The membranes are exposed to HIV-1- positive human patient serum and immunostained using o-phenylenediamine dihydrochloride (OPD; Sigma).
- OPD o-phenylenediamine dihydrochloride
- Immunoblotting analysis shows that cells containing the synthetic expression cassette produce the expected protein at higher per-cell concentrations than cells containing the native expression cassette.
- the proteins are seen in both cell lysates and supernatants.
- the levels of production are significantly higher in cell supernatants for cells transfected with the synthetic expression cassettes of the present invention.
- supernatants from the transfected 293 cells are fractionated on sucrose gradients. Aliquots of the supernatant are transferred to PolyclearTM ultra-centrifuge tubes (Beckman Instruments, Columbia, MD), under-laid with a solution of 20% (wt/wt) sucrose, and subjected to 2 hours centrifugation at 28,000 rpm in a Beckman SW28 rotor. The resulting pellet is suspended in PBS and layered onto a 20-60%> (wt/wt) sucrose gradient and subjected to 2 hours centrifugation at 40,000 rpm in a Beckman SW41ti rotor.
- the plasmid DNA, pCMVKM2 carrying the synthetic Gag expression cassette is diluted to the following final concenfrations in a total injection volume of 100 ⁇ l: 20 ⁇ g, 2 ⁇ g, 0.2 ⁇ g, 0.02 and 0.002 ⁇ g.
- the total DNA concentration in each sample is brought up to 20 ⁇ g using the vector (pCMVKM2) alone.
- plasmid DNA of the native Gag expression cassette is handled in the same manner. Twelve groups of four to ten Balb/c mice (Charles River, Boston, MA) are intramuscularly immunized (50 ⁇ l per leg, intramuscular injection into the tibialis anterior) according to the schedule in Table 1.
- Groups 1-5 and 11-15 are bled at week 0 (before immunization), week 4, week 6, week 8, and week 12.
- Groups 6-20 and 16-20 are bled at week 0 (before immunization) and at week 4.
- the humoral immune response is checked with an anti-HIV antibody ELISAs (enzyme-linked immunosorbent assays) of the mice sera 0 and 4 weeks post immunization (groups 5-12) and, in addition, 6 and 8 weeks post immunization, respectively, 2 and 4 weeks post second immunization (groups 1-4).
- the antibody titers of the sera are determined by using the appropriate anti-HEV polypeptide (e.g., anti-Pol, anti-Gag, anti-Env, anti-Vif, anti-Vpu, etc.) antibody ELISA.
- HEV proteins e.g., p55 Gag protein, an Env protein, e.g., gpl60 or gpl20 or a Pol protein, e.g., p6, prot or RT, etc.
- ELISA microtiter plates are coated with 0.2 ⁇ g of HIN protein per well overnight and washed four times; subsequently, blocking is done with PBS-0.2%o Tween (Sigma) for 2 hours. After removal of the blocking solution, 100 ⁇ l of diluted mouse serum is added. Sera are tested at 1/25 dilutions and by serial 3-fold dilutions, thereafter.
- Microtiter plates are washed four times and incubated with a secondary, peroxidase-coupled anti-mouse IgG antibody (Pierce, Rockford, IL).
- ELISA plates are washed and 100 ⁇ l of 3, 3', 5, 5'- tetramethyl benzidine (TMB; Pierce) is added per well. The optical density of each well is measured after 15 minutes.
- TMB peroxidase-coupled anti-mouse IgG antibody
- the optical density of each well is measured after 15 minutes.
- the titers reported are the reciprocal of the dilution of serum that gave a half-maximum optical density (O.D.).
- Synthetic expression cassettes will provide a clear improvement of immunogenicity relative to the native expression cassettes.
- cytotoxic T-lymphocytes The frequency of specific cytotoxic T-lymphocytes (CTL) is evaluated by a standard chromium release assay of peptide pulsed mouse (Balb/c, CB6F1 and/or C3H) CD4 cells.
- HIV polypeptide e.g., Pol, Gag or Env
- spleen cells E
- E spleen cells
- Cytotoxic T-cell (CTL) activity is measured in splenocytes recovered from the mice immunized with HIV Gag or Env D ⁇ A. Effector cells from the Gag or Env D ⁇ A- immunized animals exhibit specific lysis of HIV polypeptide-pulsed SV-BALB (MHC matched) targets cells, indicative of a CTL response. Target cells that are peptide-pulsed and derived from an MHC-unmatched mouse strain (MC57) are not lysed. Thus, synthetic expression cassettes exhibit increased potency for induction of cytotoxic T-lymphocyte (CTL) responses by DNA immunization.
- CTL Cytotoxic T-cell
- Non-human primates are immunized multiple times (e.g., weeks 0, 4, 8 and 24) intradermally, mucosally or bilaterally, intramuscular, into the quadriceps using various doses (e.g., 1-5 mg) and various combinations of synthetic HIV Type C plasmids.
- the animals are bled two weeks after each immunization and ELISA is performed with isolated plasma.
- the ELISA is performed essentially as described in Example 4 except the second antibody-conjugate is an anti-human IgG, g-chain specific, peroxidase conjugate (Sigma Chemical Co., St. Louis, MD 63178) used at a dilution of 1 :500.
- Fifty ⁇ g/ml yeast extract is added to the dilutions of plasma samples and antibody conjugate to reduce non-specific background due to preexisting yeast antibodies in the non-human primates.
- lymphoproliferative responses to antigen can also be evaluated post- immunization, indicative of induction of T-helper cell functions.
- Synthetic plasmid DNA are expected to be immunogenic in non-human primates.
- the selected synthetic expression cassette is subcloned into both plasmid DNA-based and recombinant vector particle-based Sindbis virus vectors.
- a cDNA vector construct for in vitro transcription of Sindbis virus RNA vector replicons (pRSEN-luc; Dubensky, et al., J Virol. 70:508-519, 1996) is modified to contain a Pmel site for plasmid linearization and a polylinker for insertion of heterologous genes.
- a polylinker is generated using two oligonucleotides that contain the sites Xhol, PmR, Apal, Narl, Xbal, and Not! (XPANXNF, and XPANXNR).
- the plasmid pRSIN-luc (Dubensky et al, supra) is digested with Xhol and Not! to remove the luciferase gene insert, blunt-ended using Klenow and dNTPs, and purified from an agarose get using GeneCleanll (BiolOl, Vista, CA).
- the oligonucleotides are annealed to each other and ligated into the plasmid.
- the resulting construct is digested with Notl and Sacl to remove the minimal Sindbis 3'-end sequence and A 40 tract, and ligated with an approximately 0.4 kbp fragment from PKSSEN1-BV (WO 97/38087).
- This 0.4 kbp fragment is obtained by digestion of pKSSINl-BV with Notl and iS ⁇ cI, and purification after size fractionation from an agarose gel.
- the fragment contains the complete Sindbis virus 3'-end, an A 40 tract and a Prnel site for linearization.
- This new vector construct is designated SI ⁇ BVE.
- the synthetic HTV coding sequences are obtained from the parental plasmid by digestion with EcoRI, blunt-ending with Klenow and d ⁇ TPs, purification with GeneCleanll, digestion with Sail, size fractionation on an agarose gel, and purification from the agarose gel using GeneCleanll.
- the synthetic HIV polypeptide-coding fragment is ligated into the SI ⁇ B VE vector that is digested with Xhol and Pmtl.
- the resulting vector is purified using GeneCleanll and is designated SINBVGag.
- Vector RNA replicons may be transcribed in vitro (Dubensky et al., supra) from SINBVGag and used directly for transfection of cells. Alternatively, the replicons may be packaged into recombinant vector particles by co- transfection with defective helper RNAs or using an alphavirus packaging cell line.
- the DNA-based Sindbis virus vector pDCMVSIN-beta-gal (Dubensky, et al., J Virol. 70:508-519, 1996) is digested with Sail andXba ⁇ , to remove the beta-galactosidase gene insert, and purified using GeneCleanll after agarose gel size fractionation.
- the HTV Gag or Env gene is inserted into the pDCMVSTN-beta-gal by digestion of SINBVGag with Sai and Xhol, purification using GeneCleanll of the Gag-containing fragment after agarose gel size fractionation, and ligation.
- the resulting construct is designated pDSIN-Gag, and may be used directly for in vivo administration or formulated using any of the methods described herein.
- BHK and 293 cells are transfected with recombinant Sindbis RNA and DNA, respectively.
- the supernatants and cell lysates are tested with the Coulter capture ELISA (Example 2).
- BHK cells are transfected by electroporation with recombinant Sindbis RNA.
- 293 cells are transfected using LT-1 (Example 2) with recombinant Sindbis DNA.
- Synthetic Gag- and/or Env-containing plasmids are used as positive controls. Supernatants and lysates are collected 48h post transfection. Type C HTV proteins can be efficiently expressed from both DNA and RNA-based Sindbis vector systems using the synthetic expression cassettes.
- Example 7 In Vivo Immunogenicity of recombinant Sindbis Replicon Vectors containing synthetic Pol. Gag and/or Env Expression Cassettes A. Immunization
- Sindbis virus DNA vector carrying synthetic expression cassettes (Example 6), is diluted to the following final concentrations in a total injection volume of 100 ⁇ l: 20 ⁇ g, 2 ⁇ g, 0.2 ⁇ g, 0.02 and 0.002 ⁇ g.
- the total DNA concentration in each sample is brought up to 20 ⁇ g using the Sindbis replicon vector DNA alone.
- Sindbis viral particles are prepared at the following doses: 10 3 pfu, 10 5 pfu and 10 7 pfu in 100 ⁇ l, as shown in Table 3. Sindbis HEV polypeptide particle preparations are administered to mice using intramuscular and subcutaneous routes (50 ⁇ l per site).
- Groups are bled and assessment of both humoral and cellular (e.g., frequency of specific CTLs) is performed, essentially as described in Example 4.
- Example 8 Identification and Sequencin of a Novel HIV Type C Variants
- a full-length clone, called 8_5_TV1_CZA, encoding an HIV Type C was isolated and sequenced. Briefly, genomic DNA from HIV-1 subtype C infected South African patients was isolated from PBMC (peripheral blood mononuclear cells) by alkaline lysis and anion-exchange columns (Quiagen). To get the genome of full-length clones two halves were amplified, that could later be joined together in frame within the Pol region using an unique Sal 1 site in both fragments. For the amplification, 200-800 ng of genomic DNA were added to the buffer and enzyme mix of the Expand Long Template PCR System after the protocol of the manufacturer (Boehringer Mannheim).
- the primer were designed after alignments of known full length sequences. For the 5 'half a primer mix of 2 forward primers containing either thymidine (S lFCSacTA 5 '-GTTTCTTGAGCTCTGGAAGGGTTAATTTAC TCCAAGAA-3', SEQ TD NO:38) or cytosine on position 20 (SlFTSacTA 5'- GTTTCTTGAGCTCTGGAAGGGTTAATTTACTCTAAGAA, SEQ ED NO:39) plus Sal 1 site, were used.
- thymidine S lFCSacTA 5 '-GTTTCTTGAGCTCTGGAAGGGTTAATTTAC TCCAAGAA-3', SEQ TD NO:38
- cytosine on position 20 SlFTSacTA 5'- GTTTCTTGAGCTCTGGAAGGGTTAATTTACTCTAAGAA, SEQ ED NO:39
- the reverse primer were also a mix of two primers with either thymidine or cytosine on position 13 (S145RTSalTA 5'- GTTTCTTGTCGACTTGTCCATGTATGGCTTCCCC T-3 ', SEQ ID NO:40 and
- S145RCSalTA 5'-GTTTCTTGTCGACTTGTCCATGCATGGCTTCCCT-3' SEQ ID NO:41 contained a Sal 1 site.
- the forward primer for the 3 'half was also a mixture of two primers (S245FASalTA 5'-GTTTCTTGTCGACTGTAGTCCAGGaATATGGCAAT TAG-3' SEQ ID NO:42 and S245FGSalTA 5'- GTTTCTTGTCGACTGTAGTCCAGGgATATG GCAA TTAG-3 ' SEQ ID NO:43) with Sal 1 site and adenine or guanine on position 12.
- the reverse primer had a Not 1 site (S2_FullNotTA 5'-GTTTCTTGCGGCCGCTGCTAGA GATTTTCCACACTACCA-3' SEQ ID NO:44).
- S2_FullNotTA 5'-GTTTCTTGCGGCCGCTGCTAGA GATTTTCCACACTACCA-3' SEQ ID NO:44 After amplification the PCR products were purified using a 1% agarose gel and cloned into the pCR-XL-TOPO vector via TA cloning (Invitrogen). Colonies were checked by restriction analysis and sequence verified. For the full length sequence the sequences of the 5'- and 3 'half were combined. The sequence is shown in SEQ ID NO:33. Furthermore, important domains are shown in Table A.
- Another clone, designated 12-5_1_TV2_CZA was also sequenced and is shown in SEQ ID NO:45.
- the domains can be readily determined in view of the teachings of the specification, for example by aligning the sequence to those shown in Table A to find the corresponding regions in clone 12-5_1_TV2_CZA.
- synthetic expression cassettes were generated using one or more polynucleotide sequences obtained from 8_5_TN1_C.ZA or 12- 5_1_TN2_CZA.
- the polynucleotides described herein have all been deposited at Chiron Corporation, Emeryville, CA.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Immunology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Oncology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Communicable Diseases (AREA)
- AIDS & HIV (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Tropical Medicine & Parasitology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2414374A CA2414374C (en) | 2000-07-05 | 2001-07-05 | Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof |
| JP2002509356A JP2004502445A (ja) | 2000-07-05 | 2001-07-05 | 抗原性hivc型ポリペプチドをコードするポリヌクレオチド、ポリペプチドおよびその使用 |
| EP01952426A EP1339738B1 (en) | 2000-07-05 | 2001-07-05 | Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof |
| AU2001273179A AU2001273179A1 (en) | 2000-07-05 | 2001-07-05 | Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof |
| DE60142922T DE60142922D1 (de) | 2000-07-05 | 2001-07-05 | Für antigene polypeptide des hiv type c kodierende nukleinsäuren, entsprechende polypeptide und verwendungen davon |
| AT01952426T ATE478955T1 (de) | 2000-07-05 | 2001-07-05 | Für antigene polypeptide des hiv type c kodierende nukleinsäuren, entsprechende polypeptide und verwendungen davon |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US09/610,313 | 2000-07-05 | ||
| US09/610,313 US7935805B1 (en) | 1998-12-31 | 2000-07-05 | Polynucleotides encoding antigenic HIV Type C polypeptides, polypeptides and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2002004493A2 true WO2002004493A2 (en) | 2002-01-17 |
| WO2002004493A3 WO2002004493A3 (en) | 2003-06-26 |
Family
ID=24444529
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2001/021241 Ceased WO2002004493A2 (en) | 2000-07-05 | 2001-07-05 | Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof |
Country Status (10)
| Country | Link |
|---|---|
| US (4) | US7935805B1 (https=) |
| EP (3) | EP2311958B1 (https=) |
| JP (2) | JP2004502445A (https=) |
| AT (1) | ATE478955T1 (https=) |
| AU (1) | AU2001273179A1 (https=) |
| CA (1) | CA2414374C (https=) |
| DE (1) | DE60142922D1 (https=) |
| ES (1) | ES2553575T3 (https=) |
| WO (1) | WO2002004493A2 (https=) |
| ZA (2) | ZA200403143B (https=) |
Cited By (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003037919A2 (en) | 2001-10-31 | 2003-05-08 | The South African Medical Research Council | Hiv-1 subtype isolate regulatory/accessory genes, and modifications and derivatives thereof |
| WO2003020876A3 (en) * | 2001-08-31 | 2004-01-08 | Chiron Corp | Polynucleotides encoding antigenic hiv type b polypeptides, polypeptides and uses thereof |
| WO2004032860A2 (en) | 2002-10-07 | 2004-04-22 | Chiron Corporation | Hiv vaccine formulations |
| US6783939B2 (en) | 2000-07-07 | 2004-08-31 | Alphavax, Inc. | Alphavirus vectors and virosomes with modified HIV genes for use in vaccines |
| EP1301637A4 (en) * | 2000-07-14 | 2005-06-01 | Univ Pennsylvania | DNA VACCINES ENCODING HIV PROTEINS ACCESSORIES |
| JP2005523679A (ja) * | 2001-07-05 | 2005-08-11 | カイロン コーポレイション | 抗原性c型hivポリペプチドをコードするポリヌクレオチド、ポリペプチドおよびそれらの使用 |
| US7045335B2 (en) | 2001-09-06 | 2006-05-16 | Alphavax, Inc. | Alphavirus replicon vector systems |
| EP1652857A3 (en) * | 2002-05-16 | 2007-03-14 | Bavarian Nordic A/S | Fusion protein of HIV regulatory/accessory proteins |
| EP1628680A4 (en) * | 2003-05-15 | 2008-08-06 | Novartis Vaccines & Diagnostic | HIV POLYNUCLEOTIDES AND POLYPEPTIDES OF BOTSWANA MJ4 |
| US7419674B2 (en) | 2003-07-11 | 2008-09-02 | Alpha Vax, Inc. | Alpha virus-based cytomegalovirus vaccines |
| WO2008122811A3 (en) * | 2007-04-10 | 2009-01-22 | Isis Innovation | Adenoviral vectors encoding a pathogen or tumour antigen |
| US7622125B2 (en) | 2004-05-05 | 2009-11-24 | Novartis Vaccines And Diagnostics, Inc. | Polycistronic HIV vector constructs |
| US7850977B2 (en) | 2007-06-21 | 2010-12-14 | Alphavax, Inc. | Promoterless cassettes for expression of alphavirus structural proteins |
| EP2266602A2 (en) | 2004-11-01 | 2010-12-29 | Novartis Vaccines and Diagnostics, Inc. | Combination approaches for generating immune responses |
| EP2292772A1 (en) | 2001-07-05 | 2011-03-09 | Novartis Vaccines and Diagnostics, Inc. | HIV vaccination with a DNA encoding a HIV polypeptide and a HIV polypeptide |
| WO2011106705A2 (en) | 2010-02-26 | 2011-09-01 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Dna-protein vaccination protocols |
| US8168418B2 (en) | 1998-12-31 | 2012-05-01 | Susan W Barnett | Expression of HIV polypeptides and production of virus-like particles |
| EP2368985A3 (en) * | 2002-03-08 | 2012-05-30 | Emory University | Compositions and methods for generating an immune response |
| WO2013074696A1 (en) | 2011-11-14 | 2013-05-23 | Novartis Ag | Immunogenic complexes of polyanionic carbomers and env polypeptides and methods of manufacture and use thereof |
| EP3178842A1 (en) * | 2008-08-14 | 2017-06-14 | Los Alamos National Security, LLC | Polyvalent vaccine |
| WO2019069273A1 (en) * | 2017-10-04 | 2019-04-11 | University Of Cape Town | RECOMBINANT MVA WITH MODIFIED HIV-1 ENV |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2260291T3 (es) * | 2000-09-28 | 2006-11-01 | Chiron Corporation | Microparticulas para la administracion de acidos nucleicos heterologos. |
| GB0118367D0 (en) * | 2001-07-27 | 2001-09-19 | Glaxosmithkline Biolog Sa | Novel use |
| US20030228327A1 (en) * | 2001-11-05 | 2003-12-11 | Lasher Alfred W. | DNA-based plasmid formulations and vaccines and prophylactics containing the same |
| US7442381B2 (en) | 2003-03-20 | 2008-10-28 | Alphavax, Inc. | Alphavirus replicons and helper constructs |
| DK2975139T3 (da) * | 2004-09-30 | 2019-12-09 | Gen Probe Inc | Assay til at detektere og kvantificere hiv-1 |
| AU2011253599B2 (en) * | 2004-09-30 | 2013-12-12 | Gen-Probe Incorporated | Assay for detecting and quantifying HIV-1 |
| US20150140068A1 (en) | 2012-07-06 | 2015-05-21 | Novartis Ag | Immunogenic compositions and uses thereof |
| WO2016196471A1 (en) | 2015-06-02 | 2016-12-08 | Cooper Human Systems Llc | Methods and compositions for treatment of hiv infection |
| KR20240137107A (ko) | 2019-07-16 | 2024-09-19 | 길리애드 사이언시즈, 인코포레이티드 | Hiv 백신, 및 이의 제조 및 사용 방법 |
| US12053517B2 (en) | 2021-01-14 | 2024-08-06 | Gilead Sciences, Inc. | HIV vaccines and methods of using |
Family Cites Families (179)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US604763A (en) * | 1898-05-31 | Brooch | ||
| US5326859A (en) | 1979-10-30 | 1994-07-05 | Juridical Foundation, Japanese Foundation For Cancer Research | DNA and recombinant plasmid |
| US4405712A (en) | 1981-07-01 | 1983-09-20 | The United States Of America As Represented By The Department Of Health And Human Services | LTR-Vectors |
| AU561343B2 (en) | 1981-10-19 | 1987-05-07 | Genentech Inc. | Human immune interferon by recombinant dna |
| US5364773A (en) | 1991-03-07 | 1994-11-15 | Virogenetics Corporation | Genetically engineered vaccine strain |
| DE3377363D1 (en) | 1982-03-31 | 1988-08-18 | Ajinomoto Kk | Gene coding for interleukin-2 polypeptide, recombinant dna carrying said gene, cell lines possessing the recombinant dna,and method for producing interleukin-2 using said cells |
| US4652639A (en) | 1982-05-06 | 1987-03-24 | Amgen | Manufacture and expression of structural genes |
| US4853332A (en) | 1982-10-19 | 1989-08-01 | Cetus Corporation | Structural genes, plasmids and transformed cells for producing cysteine depleted muteins of biologically active proteins |
| US4966843A (en) | 1982-11-01 | 1990-10-30 | Cetus Corporation | Expression of interferon genes in Chinese hamster ovary cells |
| US4876197A (en) | 1983-02-22 | 1989-10-24 | Chiron Corporation | Eukaryotic regulatable transcription |
| US4518584A (en) | 1983-04-15 | 1985-05-21 | Cetus Corporation | Human recombinant interleukin-2 muteins |
| US4892743A (en) | 1983-12-21 | 1990-01-09 | Schering Corporation | Novel hybrid interferon species |
| EP0165942A1 (en) | 1983-12-23 | 1986-01-02 | Monash University | PRODUCTION OF HUMAN INTERFERON-$g(a) |
| AU594014B2 (en) | 1984-03-21 | 1990-03-01 | Research Corporation Technologies, Inc. | Recombinant DNA molecules |
| US6858712B1 (en) | 1984-08-22 | 2005-02-22 | The United States Of America As Represented By The Department Of Health And Human Services | Cloning and expression of HTLV-III DNA |
| US5032510A (en) | 1984-09-26 | 1991-07-16 | Eli Lilly And Company | Method for expression and secretion in bacillus |
| CA1341423C (en) | 1984-10-31 | 2003-03-04 | Paul A. Luciw | Recombinant proteins of viruses associated with lymphadenopathy syndrome and/or acquired immune deficiency syndrome |
| US5036006A (en) | 1984-11-13 | 1991-07-30 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| US4945050A (en) | 1984-11-13 | 1990-07-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| US5100792A (en) | 1984-11-13 | 1992-03-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues |
| EP0203177A4 (en) | 1984-11-29 | 1987-04-28 | Scripps Clinic Res | POLYPEPTIDES AND ANTIBODIES ASSOCIATED WITH VIRAL GLUCOPROTEINS WITHOUT GLUCOSE. |
| DE3588134T2 (de) | 1984-12-24 | 1997-03-20 | Genentech Inc | Fusionen von AIDS-verwandten Polypeptiden |
| US4847201A (en) | 1985-02-05 | 1989-07-11 | Cetus Corporation | DNA encoding for CSF-1 and accompanying recombinant systems |
| US5185444A (en) | 1985-03-15 | 1993-02-09 | Anti-Gene Deveopment Group | Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages |
| WO1986005519A1 (en) | 1985-03-15 | 1986-09-25 | James Summerton | Polynucleotide assay reagent and method |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| FI861626A7 (fi) | 1985-04-19 | 1986-10-20 | Hoffmann La Roche | Foervaervat immunbristsyndrom (aids) -relaterat viralt rekombinant hoeljeprotein samt ett testfoerfarande foer aids. |
| US4871488A (en) | 1985-04-22 | 1989-10-03 | Albany Medical College Of Union University | Reconstituting viral glycoproteins into large phospholipid vesicles |
| US4663161A (en) | 1985-04-22 | 1987-05-05 | Mannino Raphael J | Liposome methods and compositions |
| US4810643A (en) | 1985-08-23 | 1989-03-07 | Kirin- Amgen Inc. | Production of pluripotent granulocyte colony-stimulating factor |
| JPS63500636A (ja) | 1985-08-23 | 1988-03-10 | 麒麟麦酒株式会社 | 多分化能性顆粒球コロニー刺激因子をコードするdna |
| US4777127A (en) | 1985-09-30 | 1988-10-11 | Labsystems Oy | Human retrovirus-related products and methods of diagnosing and treating conditions associated with said retrovirus |
| ATE108022T1 (de) | 1985-10-24 | 1994-07-15 | Southwest Found Biomed Res | Synthetische peptide und deren verwendung zur diagnose und impfung für aids und arc. |
| US5139941A (en) | 1985-10-31 | 1992-08-18 | University Of Florida Research Foundation, Inc. | AAV transduction vectors |
| US5017691A (en) | 1986-07-03 | 1991-05-21 | Schering Corporation | Mammalian interleukin-4 |
| US4800159A (en) | 1986-02-07 | 1989-01-24 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences |
| EP0242216A1 (en) | 1986-04-16 | 1987-10-21 | THE UNITED STATES OF AMERICA as represented by the Secretary United States Department of Commerce | Non-cytopathic clone of Human T-Cell Lymphotropic Virus type III |
| US4861719A (en) | 1986-04-25 | 1989-08-29 | Fred Hutchinson Cancer Research Center | DNA constructs for retrovirus packaging cell lines |
| US4879227A (en) | 1986-05-06 | 1989-11-07 | Genetics Institute, Inc. | Production of a recombinant human colony stimulating factor |
| JPH01500432A (ja) | 1986-07-21 | 1989-02-16 | サウスウェスト・ファウンデーション・フォー・バイオメディカル・リサーチ | Aidsおよびarcのウィルス原因物質に対して免疫化するための組成物および方法 |
| US5135855A (en) | 1986-09-03 | 1992-08-04 | The United States Of America As Represented By The Department Of Health And Human Services | Rapid, versatile and simple system for expressing genes in eukaryotic cells |
| US4861707A (en) | 1987-02-02 | 1989-08-29 | E. I. Du Pont De Nemours And Company | Human immunodeficiency virus antigen |
| GB8702816D0 (en) | 1987-02-07 | 1987-03-11 | Al Sumidaie A M K | Obtaining retrovirus-containing fraction |
| US5219740A (en) | 1987-02-13 | 1993-06-15 | Fred Hutchinson Cancer Research Center | Retroviral gene transfer into diploid fibroblasts for gene therapy |
| US4980289A (en) | 1987-04-27 | 1990-12-25 | Wisconsin Alumni Research Foundation | Promoter deficient retroviral vector |
| US5256767A (en) | 1987-06-10 | 1993-10-26 | The Immune Response Corporation | Retroviral antigens |
| EP0300213A1 (en) | 1987-06-22 | 1989-01-25 | Hexal-Pharma Gentechnik GmbH & Co. KG | Hepatitis a viral peptide particle immunogens |
| US5637677A (en) | 1987-07-16 | 1997-06-10 | The Trustees Of The University Of Pennsylvania | Biologically active compounds and methods of constructing and using the same |
| DE10399032I1 (de) | 1987-08-28 | 2004-01-29 | Health Research Inc | Rekombinante Viren. |
| WO1989002277A2 (en) | 1987-08-28 | 1989-03-23 | Board Of Regents, The University Of Texas System | Prophylaxis and therapy of acquired immunodeficiency syndrome |
| US5128319A (en) | 1987-08-28 | 1992-07-07 | Board Of Regents, The University Of Texas System | Prophylaxis and therapy of acquired immunodeficiency syndrome |
| JPH02501192A (ja) | 1987-09-04 | 1990-04-26 | バイオジェン インコーポレイテッド | 可溶性t4蛋白を製造するためのdna配列、組換dna分子および方法 |
| ATE117375T1 (de) | 1987-09-11 | 1995-02-15 | Whitehead Biomedical Inst | Transduktionsveränderte fibroblasten und ihre anwendung. |
| US5879907A (en) | 1987-09-14 | 1999-03-09 | Skandigen Ab | Artificial gene coding for authentic human serum albumin, use thereof and method |
| PT88641B (pt) | 1987-10-02 | 1993-04-30 | Genentech Inc | Metodo para a preparacao de uma variante de adesao |
| IL87902A0 (en) | 1987-10-08 | 1989-03-31 | Dana Farber Cancer Inst Inc | Soluble human cd4 fragments and applications thereof |
| US4965195A (en) | 1987-10-26 | 1990-10-23 | Immunex Corp. | Interleukin-7 |
| US5683864A (en) | 1987-11-18 | 1997-11-04 | Chiron Corporation | Combinations of hepatitis C virus (HCV) antigens for use in immunoassays for anti-HCV antibodies |
| US5714596A (en) | 1987-11-18 | 1998-02-03 | Chiron Corporation | NANBV diagnostics: polynucleotides useful for screening for hepatitis C virus |
| US5712088A (en) | 1987-11-18 | 1998-01-27 | Chiron Corporation | Methods for detecting Hepatitis C virus using polynucleotides specific for same |
| WO1989005349A1 (en) | 1987-12-09 | 1989-06-15 | The Australian National University | Method of combating viral infections |
| US5179022A (en) | 1988-02-29 | 1993-01-12 | E. I. Du Pont De Nemours & Co. | Biolistic apparatus for delivering substances into cells and tissues in a non-lethal manner |
| WO1989009271A1 (en) | 1988-03-21 | 1989-10-05 | Viagene, Inc. | Recombinant retroviruses |
| US5204259A (en) * | 1988-05-06 | 1993-04-20 | Pharmacia Genetic Engineering, Inc. | Methods and systems for producing HIV antigens |
| AP129A (en) | 1988-06-03 | 1991-04-17 | Smithkline Biologicals S A | Expression of retrovirus gag protein eukaryotic cells |
| CA1340748C (en) | 1988-07-13 | 1999-09-14 | Stephen Oroszlan | Synthetic hiv protease gene and method for its expression |
| WO1990002806A1 (en) | 1988-09-01 | 1990-03-22 | Whitehead Institute For Biomedical Research | Recombinant retroviruses with amphotropic and ecotropic host ranges |
| ATE112687T1 (de) | 1988-09-13 | 1994-10-15 | Chiron Corp | Mutanten des hiv-1 hüllproteins mit fehlenden hypervariabelen domänen. |
| AU640619B2 (en) | 1988-10-03 | 1993-09-02 | Repligen Corporation | Hiv proteins and peptides useful in the diagnosis, prophylaxis or therapy of aids |
| CA2003383A1 (en) | 1988-11-23 | 1990-05-23 | Sushil G. Devare | Synthetic dna derived recombinant hiv antigens |
| PT92479A (pt) | 1988-12-01 | 1990-06-29 | Univ North Carolina | Processo de preparacao de genes recombinantes e suas proteinas de codificacao |
| WO1990007936A1 (en) | 1989-01-23 | 1990-07-26 | Chiron Corporation | Recombinant therapies for infection and hyperproliferative disorders |
| US5858646A (en) * | 1989-02-23 | 1999-01-12 | University Of Ottawa | Modified HIV-pol polypeptide having immunological activity for use as diagnostic reagent |
| US5082767A (en) | 1989-02-27 | 1992-01-21 | Hatfield G Wesley | Codon pair utilization |
| US6214804B1 (en) | 1989-03-21 | 2001-04-10 | Vical Incorporated | Induction of a protective immune response in a mammal by injecting a DNA sequence |
| US5703055A (en) | 1989-03-21 | 1997-12-30 | Wisconsin Alumni Research Foundation | Generation of antibodies through lipid mediated DNA delivery |
| CA2489769A1 (en) | 1989-03-21 | 1990-10-04 | Philip L. Felgner | Expression of exogenous polynucleotide sequences in a vertebrate |
| CA2017507C (en) | 1989-05-25 | 1996-11-12 | Gary Van Nest | Adjuvant formulation comprising a submicron oil droplet emulsion |
| US5399346A (en) | 1989-06-14 | 1995-03-21 | The United States Of America As Represented By The Department Of Health And Human Services | Gene therapy |
| AU648261B2 (en) | 1989-08-18 | 1994-04-21 | Novartis Vaccines And Diagnostics, Inc. | Recombinant retroviruses delivering vector constructs to target cells |
| GB8919607D0 (en) | 1989-08-30 | 1989-10-11 | Wellcome Found | Novel entities for cancer therapy |
| US5130247A (en) | 1989-09-19 | 1992-07-14 | Merck & Co., Inc. | Expression of fusion protein of HIV envelope and HBsAG |
| EP0424748B1 (en) | 1989-10-23 | 1995-05-10 | F. Hoffmann-La Roche Ag | Synthetic envelope peptides of HTLV-I |
| FR2658432B1 (fr) | 1990-02-22 | 1994-07-01 | Medgenix Group Sa | Microspheres pour la liberation controlee des substances hydrosolubles et procede de preparation. |
| US5876724A (en) | 1990-03-19 | 1999-03-02 | Institut Pasteur | Induction of neutralizing antibody against viral infection by synergy between virus envelope glycoprotein and peptides corresponding to neutralization epitopes of the glycoprotein |
| ATE183235T1 (de) | 1990-03-21 | 1999-08-15 | Wolf Hans Joachim Prof Dr | Für abgeänderte retrovirale gag-polypeptide kodierende dna-sequenzen und diese enthaltende impfstoffe oder aggregate davon |
| AU8200191A (en) | 1990-07-09 | 1992-02-04 | United States of America, as represented by the Secretary, U.S. Department of Commerce, The | High efficiency packaging of mutant adeno-associated virus using amber suppressions |
| WO1992001800A1 (en) | 1990-07-20 | 1992-02-06 | Chiron Corporation | Method for integrative transformation of yeast using dispersed repetitive elements |
| MY109299A (en) | 1990-08-15 | 1996-12-31 | Virogenetics Corp | Recombinant pox virus encoding flaviviral structural proteins |
| US5840313A (en) | 1990-09-27 | 1998-11-24 | Syntello Vaccine Development Kb | Peptides for use in vaccination and induction of neutralizing antibodies against human immunodeficiency virus |
| US5173414A (en) | 1990-10-30 | 1992-12-22 | Applied Immune Sciences, Inc. | Production of recombinant adeno-associated virus vectors |
| CA2095633C (en) | 1990-12-03 | 2003-02-04 | Lisa J. Garrard | Enrichment method for variant proteins with altered binding properties |
| PT100090A (pt) | 1991-02-04 | 1993-07-30 | Univ Saskatchewan | Metodo de preparacao de uma composicao capz de libertar um agente biologicamente activo para um alvo, e de encapsulacao do referido agente em esferas da proteina vp6 |
| CA2104958A1 (en) | 1991-03-07 | 1992-09-08 | Jean C. Nichols | Use of cell surface receptor targeted molecules for the treatment of viral diseases |
| US6139843A (en) | 1991-04-02 | 2000-10-31 | Albert Einstein College Of Medicine Of Yeshiva University | Peptide compositions for the treatment of HIV |
| IL101715A (en) | 1991-05-02 | 2005-06-19 | Amgen Inc | Recombinant dna-derived cholera toxin subunit analogs |
| DE69233013T2 (de) | 1991-08-20 | 2004-03-04 | The Government Of The United States Of America As Represented By The Secretary Of National Institute Of Health, Office Of Technology Transfer | Adenovirus vermittelter gentransfer in den gastrointestinaltrakt |
| US5665569A (en) | 1991-08-22 | 1997-09-09 | Nissin Shokuhin Kabushiki Kaisha | HIV immunotherapeutics |
| RU2212899C2 (ru) | 1991-09-13 | 2003-09-27 | Чирон Корпорейшн | Hcv иммунореактивные полипептидные композиции |
| WO1993010218A1 (en) | 1991-11-14 | 1993-05-27 | The United States Government As Represented By The Secretary Of The Department Of Health And Human Services | Vectors including foreign genes and negative selective markers |
| GB9125623D0 (en) | 1991-12-02 | 1992-01-29 | Dynal As | Cell modification |
| IT1253009B (it) | 1991-12-31 | 1995-07-10 | Sclavo Ricerca S R L | Mutanti immunogenici detossificati della tossina colerica e della tossina lt, loro preparazione ed uso per la preparazione di vaccini |
| US5174666A (en) * | 1992-02-12 | 1992-12-29 | Smith Corona Corporation | Printing device having printwheel coupling means |
| US6174666B1 (en) | 1992-03-27 | 2001-01-16 | The United States Of America As Represented By The Department Of Health And Human Services | Method of eliminating inhibitory/instability regions from mRNA |
| EP0650370A4 (en) | 1992-06-08 | 1995-11-22 | Univ California | METHODS AND COMPOSITIONS TARGETED ON SPECIFIC TISSUES. |
| CA2137361A1 (en) | 1992-06-10 | 1993-12-23 | W. French Anderson | Vector particles resistant to inactivation by human serum |
| WO1994002951A1 (en) | 1992-07-27 | 1994-02-03 | New York University | High field magnets for medical applications |
| GB2269175A (en) | 1992-07-31 | 1994-02-02 | Imperial College | Retroviral vectors |
| US5665720A (en) | 1992-08-07 | 1997-09-09 | Merck & Co., Inc. | Benzoxazinones as inhibitors of HIV reverse transcriptase |
| DE4228458A1 (de) | 1992-08-27 | 1994-06-01 | Beiersdorf Ag | Multicistronische Expressionseinheiten und deren Verwendung |
| US6004763A (en) | 1992-09-11 | 1999-12-21 | Institut Pasteur | Antigen-carrying microparticles and their use in the induction of humoral or cellular responses |
| FR2695563B1 (fr) | 1992-09-11 | 1994-12-02 | Pasteur Institut | Microparticules portant des antigènes et leur utilisation pour l'induction de réponses humorales ou cellulaires. |
| CA2105629A1 (en) | 1992-09-14 | 1994-03-15 | Robert S. Becker | Potentiation of immunogenic response |
| US5686078A (en) | 1992-09-14 | 1997-11-11 | Connaught Laboratories, Inc. | Primary and secondary immunization with different physio-chemical forms of antigen |
| US5831005A (en) | 1992-09-24 | 1998-11-03 | Chiron Corporation | Synthesis of N-substituted oligomers |
| US5304472A (en) | 1992-11-20 | 1994-04-19 | Genentech, Inc. | Method of controlling polypeptide production in bacterial cells |
| ES2156149T3 (es) | 1992-12-04 | 2001-06-16 | Medical Res Council | Proteinas de union multivalente y multiespecificas, su fabricacion y su uso. |
| WO1994016081A1 (de) | 1993-01-16 | 1994-07-21 | Manfred Schawaller | Verfahren zur gewinnung nativer domänen viraler membranproteine, deren verwendung, insbesondere als impfstoff gegen hiv |
| US5593972A (en) | 1993-01-26 | 1997-01-14 | The Wistar Institute | Genetic immunization |
| KR100325554B1 (ko) | 1993-03-26 | 2002-11-02 | 젠-프로브 인코포레이티드 | 사람의면역결핍 바이러스타입1의검출 |
| KR960701988A (ko) * | 1993-04-20 | 1996-03-28 | 윌리엄 에스. 로빈슨 | 세포내 감염원에 감염된 개체의 치료방법 및 치료물질(methods and materials for treatment of individuals infected with intracellular in-fectious agents) |
| US5591601A (en) | 1993-05-14 | 1997-01-07 | Ohio University Edison Animal Biotechnology Institute | DNA polymerase gene expression system utilizing an RNA polymerase co-delivered with the gene expression vector system |
| US5419900A (en) | 1993-05-19 | 1995-05-30 | The United States Of America As Represented By The Department Of Of Health And Human Services | Immunologic enhancement with intermittent interleukin-2 therapy |
| WO1994028929A1 (en) | 1993-06-07 | 1994-12-22 | Genentech, Inc. | Hiv envelope polypeptides |
| CN1111540C (zh) | 1993-06-09 | 2003-06-18 | 康诺特实验室有限公司 | 串联的合成hiv-1肽类 |
| US5614413A (en) | 1993-07-01 | 1997-03-25 | The Uab Research Foundation | Encapsidated recombinant poliovirus nucleic acid and methods of making and using same |
| CA2125344A1 (en) * | 1993-07-01 | 1995-01-02 | Casey D. Morrow | Encapsidated recombinant poliovirus nucleic acid and methods of making and using same |
| US5834441A (en) | 1993-09-13 | 1998-11-10 | Rhone-Poulenc Rorer Pharmaceuticals Inc. | Adeno-associated viral (AAV) liposomes and methods related thereto |
| US6015686A (en) | 1993-09-15 | 2000-01-18 | Chiron Viagene, Inc. | Eukaryotic layered vector initiation systems |
| US6291157B1 (en) | 1998-02-23 | 2001-09-18 | Connaught Laboratories Limited | Antigenically-marked non-infectious retrovirus-like particles |
| US5955342A (en) | 1994-08-15 | 1999-09-21 | Connaught Laboratories Limited | Non-infectious, replication-defective, self-assembling HIV-1 viral particles containing antigenic markers in the gag coding region |
| US6080408A (en) | 1994-08-22 | 2000-06-27 | Connaught Laboratories Limited | Human immunodeficiency virus type 1 nucleic acids devoid of long terminal repeats capable of encoding for non-infectious, immunogenic, retrovirus-like particles |
| US5786464C1 (en) | 1994-09-19 | 2012-04-24 | Gen Hospital Corp | Overexpression of mammalian and viral proteins |
| US5795737A (en) | 1994-09-19 | 1998-08-18 | The General Hospital Corporation | High level expression of proteins |
| US5676950A (en) | 1994-10-28 | 1997-10-14 | University Of Florida | Enterically administered recombinant poxvirus vaccines |
| US5550280A (en) | 1994-11-30 | 1996-08-27 | Uniroyal Chemical Ltd./ Uniroyal Chemical Ltee | Hindered aromatic ester compounds useful as anti-viral agents |
| AU4594996A (en) | 1994-11-30 | 1996-06-19 | Chiron Viagene, Inc. | Recombinant alphavirus vectors |
| ES2176360T3 (es) | 1994-12-30 | 2002-12-01 | Chiron Corp | Combinacion de vehiculos de administracion de genes. |
| CN1185811A (zh) | 1995-03-31 | 1998-06-24 | H·沃尔夫 | 依赖于逆转录病毒样颗粒的抗原呈递系统 |
| US5797870A (en) | 1995-06-07 | 1998-08-25 | Indiana University Foundation | Pericardial delivery of therapeutic and diagnostic agents |
| CU22559A1 (es) | 1996-01-17 | 1999-05-03 | Ct Ingenieria Genetica Biotech | Sistema de expresión de antígenos heterologos en e. coli como proteínas de fusión |
| US5741492A (en) | 1996-01-23 | 1998-04-21 | St. Jude Children's Research Hospital | Preparation and use of viral vectors for mixed envelope protein vaccines against human immunodeficiency viruses |
| US6087486A (en) | 1996-01-29 | 2000-07-11 | The Trustees Of The University Of Pennsylvania | Nucleotide sequences encoding vpr receptor protein |
| US6060587A (en) | 1996-01-29 | 2000-05-09 | The Trustees Of The University Of Pennsylvania | Cellular receptor for HIV-1 VPR essential for G2/M phase transition of the cell cycle |
| US5649652A (en) * | 1996-02-16 | 1997-07-22 | Sackett; Eleanor L. | Clothes hanger with storage hook |
| PL328730A1 (en) | 1996-02-22 | 1999-02-15 | Merck & Co Inc | Synthetic hiv genes |
| US6451592B1 (en) * | 1996-04-05 | 2002-09-17 | Chiron Corporation | Recombinant alphavirus-based vectors with reduced inhibition of cellular macromolecular synthesis |
| AU2800797A (en) | 1996-04-05 | 1997-10-29 | Chiron Corporation | Recombinant alphavirus-based vectors with reduced inhibition of cellular macromolecular synthesis |
| US5951975A (en) | 1996-06-28 | 1999-09-14 | University Of Pittsburgh | Induction of CTLs specific for natural antigens by cross priming immunization |
| WO1998010069A2 (en) | 1996-09-06 | 1998-03-12 | The Regents Of The University Of California | E25a PROTEIN, METHODS FOR PRODUCTION AND USE THEREOF |
| US6114148C1 (en) | 1996-09-20 | 2012-05-01 | Gen Hospital Corp | High level expression of proteins |
| US6139833A (en) | 1997-08-08 | 2000-10-31 | Lexicon Genetics Incorporated | Targeted gene discovery |
| FR2756843B1 (fr) * | 1996-12-09 | 1999-01-22 | Inst Nat Sante Rech Med | Souches de vih-1 non-m non-o, fragments et applications |
| US5830697A (en) * | 1997-01-21 | 1998-11-03 | The Board Of Trustees Of The Leland Stanford Junior University | P-glycoprotein mutant resistant to cyclosporin modulation |
| EE9900343A (et) | 1997-02-07 | 2000-02-15 | Merck & Co., Inc. | Sünteetiline polünukleotiid, immuunvastuste tekitamise meetod, immunogeenne kompositsioon, anti-HIV immuunvastuste indutseerimise meetod, meetod antigeeni tekitava raku indutseerimiseks ja farmatseutiline kompositsioon |
| US5990091A (en) | 1997-03-12 | 1999-11-23 | Virogenetics Corporation | Vectors having enhanced expression, and methods of making and uses thereof |
| US5858675A (en) | 1997-05-13 | 1999-01-12 | Incyte Pharmaceuticals, Inc. | Double-stranded RNA-binding protein |
| US6099847A (en) | 1997-05-15 | 2000-08-08 | The United States Of America As Represented By The Department Of Health And Human Services | Chimeric Gag pseudovirions |
| US5932442A (en) | 1997-09-23 | 1999-08-03 | Incyte Pharmaceuticals, Inc. | Human regulatory molecules |
| US5932445A (en) | 1997-11-07 | 1999-08-03 | Incyte Pharmaceuticals, Inc. | Signal peptide-containing proteins |
| US6228128B1 (en) * | 1997-11-10 | 2001-05-08 | Charlotte Johansen | Antimicrobial activity of laccases |
| GB9803351D0 (en) * | 1998-02-17 | 1998-04-15 | Oxford Biomedica Ltd | Anti-viral vectors |
| WO1999053046A2 (en) | 1998-04-14 | 1999-10-21 | Chiron Corporation | Noncloning technique for expressing a gene of interest |
| US6090388A (en) | 1998-06-20 | 2000-07-18 | United Biomedical Inc. | Peptide composition for prevention and treatment of HIV infection and immune disorders |
| WO2000015819A1 (en) * | 1998-09-11 | 2000-03-23 | The Children's Medical Center Corporation | Packaging cell lines for hiv-derived retroviral vector particles |
| US6489542B1 (en) * | 1998-11-04 | 2002-12-03 | Monsanto Technology Llc | Methods for transforming plants to express Cry2Ab δ-endotoxins targeted to the plastids |
| AU2221600A (en) * | 1998-12-31 | 2000-07-31 | Chiron Corporation | Improved expression of hiv polypeptides and production of virus-like particles |
| AU2487300A (en) * | 1998-12-31 | 2000-07-31 | Chiron Corporation | Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof |
| JP4776075B2 (ja) | 1998-12-31 | 2011-09-21 | ノバルティス バクシンズ アンド ダイアグノスティックス,インコーポレーテッド | 改変hivenvポリペプチド |
| US6280989B1 (en) | 1999-06-17 | 2001-08-28 | Dmitri Kapitonov | Sialyltransferases |
| US6316253B1 (en) | 1999-11-01 | 2001-11-13 | Chiron Corporation | Expression vectors, transfection systems, and method of use thereof |
| EP1274305A4 (en) * | 2000-02-18 | 2004-04-14 | Univ Washington | AID OF THE AIDS VIRUS AND VACCINE |
| ES2260291T3 (es) | 2000-09-28 | 2006-11-01 | Chiron Corporation | Microparticulas para la administracion de acidos nucleicos heterologos. |
| EP1411770A4 (en) | 2001-07-05 | 2006-05-10 | Chiron Corp | POLYNUCLEOTIDES CODING FOR ANTIGENIC C-TYPE HIV POLYPEPTIDES, POLYPEPTIDES AND THEIR USE |
| CA2458995C (en) * | 2001-08-31 | 2013-04-30 | Chiron Corporation | Polynucleotides encoding antigenic hiv type b polypeptides, polypeptides and uses thereof |
| US7800921B2 (en) | 2007-01-08 | 2010-09-21 | Continental Automotive Systems Us, Inc. | DC/DC converter |
| US8974986B2 (en) | 2007-07-06 | 2015-03-10 | M. Technique Co., Ltd. | Method for producing metal-supported carbon, method for producing crystals consisting of fullerene molecules and fullerene nanowhisker/nanofiber nanotubes, and apparatus for producing the same |
| EP2510962A1 (en) | 2011-04-12 | 2012-10-17 | F. Hoffmann-La Roche AG | Infusion pump device with re-filling scheme for cylinder-piston dosing unit |
-
2000
- 2000-07-05 US US09/610,313 patent/US7935805B1/en not_active Expired - Fee Related
-
2001
- 2001-04-23 ZA ZA200403143A patent/ZA200403143B/xx unknown
- 2001-07-05 AT AT01952426T patent/ATE478955T1/de active
- 2001-07-05 US US09/899,575 patent/US7618642B2/en not_active Expired - Fee Related
- 2001-07-05 ES ES10183206.1T patent/ES2553575T3/es not_active Expired - Lifetime
- 2001-07-05 EP EP10183206.1A patent/EP2311958B1/en not_active Expired - Lifetime
- 2001-07-05 DE DE60142922T patent/DE60142922D1/de not_active Expired - Lifetime
- 2001-07-05 EP EP01952426A patent/EP1339738B1/en not_active Expired - Lifetime
- 2001-07-05 EP EP10173861A patent/EP2281832A3/en not_active Withdrawn
- 2001-07-05 AU AU2001273179A patent/AU2001273179A1/en not_active Abandoned
- 2001-07-05 CA CA2414374A patent/CA2414374C/en not_active Expired - Fee Related
- 2001-07-05 WO PCT/US2001/021241 patent/WO2002004493A2/en not_active Ceased
- 2001-07-05 JP JP2002509356A patent/JP2004502445A/ja active Pending
-
2003
- 2003-01-30 ZA ZA200300839A patent/ZA200300839B/en unknown
-
2009
- 2009-11-17 US US12/620,511 patent/US20100316698A1/en not_active Abandoned
-
2011
- 2011-05-02 US US13/099,219 patent/US20110212164A1/en not_active Abandoned
-
2012
- 2012-03-29 JP JP2012076530A patent/JP2012147792A/ja active Pending
Non-Patent Citations (65)
| Title |
|---|
| AN ET AL.: "Binary Vectors", PLANT MOLECULAR BIOLOGY MANUAL, vol. A3, 1988, pages 1 - 19 |
| ANDRE ET AL., J. VIROL., vol. 72, no. 2, 1998, pages 1497 - 1503 |
| BABA, JNEUROSURG, vol. 79, 1993, pages 729 - 735 |
| BARR ET AL., GENE THERAPY, vol. 1, 1994, pages 51 - 58 |
| BARRE-SINOUSSI ET AL., SCIENCE, vol. 220, 1983, pages 868 - 871 |
| BERKNER, K.L., BIOTECHNIQUES, vol. 6, 1988, pages 616 - 629 |
| BETT ET AL., J VIROL., vol. 67, 1993, pages 5911 - 5921 |
| BORIS-LAWRIE ET AL., CUR. OPIN. GENET. DEVELOP., vol. 3, 1993, pages 102 |
| BORIS-LAWRIE; TEMIN, CUR. OPIN. GENET. DEVELOP., vol. 3, 1993, pages 102 - 109 |
| BRAKENHOF ET AL., J. IMMUNOL., vol. 139, 1987, pages 4116 - 4121 |
| BRUN-VEZINET ET AL., SCIENCE, vol. 233, 1986, pages 343 - 346 |
| BURNS ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 8033 |
| BURNS ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 8033 - 8037 |
| CANE, PROC NATL ACAD SCI USA, vol. 81, 1984, pages 6349 |
| CARTER, B.J., CURRENT OPINION IN BIOTECHNOLOGY, vol. 1, 1992, pages 533 - 539 |
| CHAPMAN ET AL., NUC. ACIDS RES., vol. 19, 1991, pages 3979 - 3986 |
| CLAVEL ET AL., NATURE, vol. 324, 1986, pages 691 - 695 |
| CYTOKINE BULLETIN, 1994 |
| FAMILLETTI ET AL., METHODS IN ENZ., vol. 78, 1981, pages 387 - 394 |
| FINTER ET AL., DRUGS, vol. 42, 1991, pages 749 - 765 |
| FREED, E.O., VIROLOGY, vol. 251, 1998, pages 1 - 15 |
| GANSBACHER ET AL., J. EXP. MED., vol. 172, 1990, pages 1217 - 1224 |
| GELLISSEN, G. ET AL., ANTONIE VAN LEEUWENHOEK, vol. 62, no. 1-2, 1992, pages 79 - 93 |
| GOEDDEL, D.V., METHODS IN ENZYMOLOGY, 1990, pages 185 |
| GOLUMBEK ET AL., SCIENCE, vol. 254, 1991, pages 713 - 716 |
| GUTHRIE, C.; G.R. FINK, METHODS IN ENZYMOLOGY, 1991, pages 194 |
| GUYADER ET AL., NATURE, vol. 326, 1987, pages 662 - 669 |
| HAAS ET AL., CURRENT BIOLOGY, vol. 6, no. 3, 1996, pages 315 - 324 |
| HAJ-AHMAD; GRAHAM, J VIROL., vol. 57, 1986, pages 267 - 274 |
| HAYNES, J. ET AL., NUC. ACID. RES., vol. 11, 1983, pages 687 - 706 |
| HOOD, E. ET AL., J. BACTERIOL., vol. 168, 1986, pages 1291 - 1301 |
| KARUPIAH ET AL., J. IMMUNOLOGY, vol. 144, 1990, pages 290 - 298 |
| KOTIN, R.M., HUMAN GENE THERAPY, vol. 5, 1994, pages 793 - 801 |
| LAU, Y.F. ET AL., MOL. CELL. BIOL., vol. 4, 1984, pages 1469 - 1475 |
| LEBKOWSKI ET AL., MOLEC. CELL. BIOL., vol. 8, 1988, pages 3988 - 3996 |
| LEVY ET AL., SCIENCE, vol. 225, 1984, pages 840 - 842 |
| MANN, CELL, vol. 33, 1983, pages 153 |
| MILLER ET AL., BIOTECHNIQUES, vol. 7, 1989, pages 980 |
| MILLER, A.D., HUMAN GENE THERAPY, vol. 1, 1990, pages 5 |
| MILLER, A.D., HUMAN GENE THERAPY, vol. 1, 1990, pages 5 - 14 |
| MILLER, HUMAN GENE THERAPY, 1990, pages 1 |
| MILLER; ROSMAN, BIOTECLMIQUES, vol. 7, 1989, pages 980 - 990 |
| MITTEREDER ET AL., HUMAN GENE THERAPY, vol. 5, 1994, pages 717 - 729 |
| MUNEMITSU S. ET AL., MOL CELL BIOL., vol. 10, no. 11, 1990, pages 5977 - 5982 |
| MUZYCZKA, N., CURRENT TOPICS IN MICROBIOL. AND IMMUNOL., vol. 158, 1992, pages 97 - 129 |
| MYERS ET AL., HUMAN RETROVIRUSES AND AIDS, 1997 |
| NAGATA ET AL., NATURE, vol. 284, 1980, pages 316 - 320 |
| NAGEL, R. ET AL., FEMS MICROBIOL. LETT., vol. 67, 1990, pages 325 |
| NOVITSKY ET AL., J VIROL., vol. 73, no. 5, 1999, pages 4427 - 4432 |
| POPOVIC ET AL., SCIENCE, vol. 224, 1984, pages 497 - 500 |
| RAM, CANCER RES, vol. 53, 1993, pages 83 - 88 |
| RICH ET AL., HUMAN GENE THERAPY, vol. 4, 1993, pages 461 - 476 |
| ROMANOS, M.A. ET AL., YEAST, vol. 8, no. 6, 1992, pages 423 - 488 |
| SCARPA ET AL., VIROLOGY, vol. 180, 1991, pages 849 |
| SCARPA ET AL., VIROLOGY, vol. 180, 1991, pages 849 - 852 |
| SETH ET AL., J VIROL., vol. 68, 1994, pages 933 - 940 |
| SHELLING; SMITH, GENE THERAPY, vol. 1, 1994, pages 165 - 169 |
| TAKAMIYA, JNEUROSCI RES, vol. 33, 1992, pages 493 - 503 |
| TEPPER ET AL., CELL, vol. 57, 1989, pages 503 - 512 |
| TWU ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 2046 - 2050 |
| VILE, CANCER RES, vol. 53, 1993, pages 3860 - 3864 |
| VILE, CANCERRES, vol. 53, 1993, pages 962 - 967 |
| VILMER ET AL., THE LANCET, vol. 1, 1984, pages 753 |
| WEBER ET AL., J. EXP. MED., vol. 166, 1987, pages 1716 - 1733 |
| ZHOU ET AL., J. EXP. MED., vol. 179, 1994, pages 1867 - 1875 |
Cited By (44)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8168418B2 (en) | 1998-12-31 | 2012-05-01 | Susan W Barnett | Expression of HIV polypeptides and production of virus-like particles |
| US6783939B2 (en) | 2000-07-07 | 2004-08-31 | Alphavax, Inc. | Alphavirus vectors and virosomes with modified HIV genes for use in vaccines |
| US7488484B2 (en) | 2000-07-14 | 2009-02-10 | The Trustees Of The University Of Pennsylvania | Nucleic acid expression cassette encoding an HIV polyprotein comprising the ancillary gene products Vif, Vpu, and Nef |
| EP1301637A4 (en) * | 2000-07-14 | 2005-06-01 | Univ Pennsylvania | DNA VACCINES ENCODING HIV PROTEINS ACCESSORIES |
| US7211659B2 (en) | 2001-07-05 | 2007-05-01 | Chiron Corporation | Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof |
| US8133494B2 (en) | 2001-07-05 | 2012-03-13 | Novartis Vaccine & Diagnostics Inc | Expression cassettes endcoding HIV-1 south african subtype C modified ENV proteins with deletions in V1 and V2 |
| JP2005523679A (ja) * | 2001-07-05 | 2005-08-11 | カイロン コーポレイション | 抗原性c型hivポリペプチドをコードするポリヌクレオチド、ポリペプチドおよびそれらの使用 |
| EP1411770A4 (en) * | 2001-07-05 | 2006-05-10 | Chiron Corp | POLYNUCLEOTIDES CODING FOR ANTIGENIC C-TYPE HIV POLYPEPTIDES, POLYPEPTIDES AND THEIR USE |
| EP2280074A3 (en) * | 2001-07-05 | 2011-06-22 | Novartis Vaccines and Diagnostics, Inc. | Polynucleotides encoding antigenic HIV type B and/or type C polypeptides, polypeptides and uses thereof |
| EP2292772A1 (en) | 2001-07-05 | 2011-03-09 | Novartis Vaccines and Diagnostics, Inc. | HIV vaccination with a DNA encoding a HIV polypeptide and a HIV polypeptide |
| EP2412242A2 (en) | 2001-07-05 | 2012-02-01 | Novartis Vaccines and Diagnostics, Inc. | Polynucleotides encoding antigenic HIV Type C polypeptides, polypeptides and uses thereof |
| WO2003020876A3 (en) * | 2001-08-31 | 2004-01-08 | Chiron Corp | Polynucleotides encoding antigenic hiv type b polypeptides, polypeptides and uses thereof |
| US7045335B2 (en) | 2001-09-06 | 2006-05-16 | Alphavax, Inc. | Alphavirus replicon vector systems |
| US7425337B2 (en) | 2001-09-06 | 2008-09-16 | Alphavax, Inc. | Alphavirus replicon vector systems |
| US7479547B2 (en) | 2001-10-31 | 2009-01-20 | The South African Medical Research Council | HIV-1 subtype isolate regulatory/accessory genes, and modifications and derivatives thereof |
| AP2696A (en) * | 2001-10-31 | 2013-07-17 | The South African Medical Res Council | HIV-1 subtype isolate regulatory/accessory genes, and modifications and derivatives thereof. |
| WO2003037919A3 (en) * | 2001-10-31 | 2004-01-22 | South African Medical Research Council | Hiv-1 subtype isolate regulatory/accessory genes, and modifications and derivatives thereof |
| WO2003037919A2 (en) | 2001-10-31 | 2003-05-08 | The South African Medical Research Council | Hiv-1 subtype isolate regulatory/accessory genes, and modifications and derivatives thereof |
| US7713530B2 (en) | 2001-10-31 | 2010-05-11 | The South African Medical Research Council | HIV-1 subtype isolate regulatory/accessory genes, and modification and derivatives thereof |
| EP2368985A3 (en) * | 2002-03-08 | 2012-05-30 | Emory University | Compositions and methods for generating an immune response |
| US8389275B2 (en) | 2002-05-16 | 2013-03-05 | Bavarian Nordic A/S | Fusion proteins of HIV regulatory/accessory proteins |
| US8147839B2 (en) | 2002-05-16 | 2012-04-03 | Bavarian Nordic A/S | Fusion proteins of HIV regulatory/accessory proteins |
| US8435535B2 (en) | 2002-05-16 | 2013-05-07 | Bavarian Nordic A/S | Fusion proteins of HIV regulatory/accessory proteins |
| EP1652857A3 (en) * | 2002-05-16 | 2007-03-14 | Bavarian Nordic A/S | Fusion protein of HIV regulatory/accessory proteins |
| US7569228B2 (en) | 2002-05-16 | 2009-08-04 | Bavarian Nordic A/S | Fusion proteins of non-attenuated HIV regulatory/accessory proteins |
| US8137931B2 (en) | 2002-05-16 | 2012-03-20 | Bavarian Nordic A/S | Fusion proteins of HIV regulatory/accessory proteins |
| US8143054B2 (en) | 2002-05-16 | 2012-03-27 | Bavarian Nordic A/S | Fusion protein of HIV regulatory/accessory proteins |
| WO2004032860A2 (en) | 2002-10-07 | 2004-04-22 | Chiron Corporation | Hiv vaccine formulations |
| EP1628680A4 (en) * | 2003-05-15 | 2008-08-06 | Novartis Vaccines & Diagnostic | HIV POLYNUCLEOTIDES AND POLYPEPTIDES OF BOTSWANA MJ4 |
| US7419674B2 (en) | 2003-07-11 | 2008-09-02 | Alpha Vax, Inc. | Alpha virus-based cytomegalovirus vaccines |
| US8173137B2 (en) | 2004-05-05 | 2012-05-08 | Novartis Vaccines And Diagnostics, Inc. | Polycistronic HIV vector constructs |
| US7622125B2 (en) | 2004-05-05 | 2009-11-24 | Novartis Vaccines And Diagnostics, Inc. | Polycistronic HIV vector constructs |
| EP2266602A2 (en) | 2004-11-01 | 2010-12-29 | Novartis Vaccines and Diagnostics, Inc. | Combination approaches for generating immune responses |
| US9821053B2 (en) | 2005-08-23 | 2017-11-21 | Duke University | Human Immunodeficiency Virus type 1 group M consensus and mosaic envelope glycoproteins |
| US9844590B2 (en) | 2005-08-23 | 2017-12-19 | Duke University | Mosaic clade M human immunodeficiency virus type 1 (HIV-1) gag immunogens |
| WO2008122811A3 (en) * | 2007-04-10 | 2009-01-22 | Isis Innovation | Adenoviral vectors encoding a pathogen or tumour antigen |
| US9017696B2 (en) | 2007-04-10 | 2015-04-28 | Isis Innovation Limited | Adenovirus vectors |
| US10124048B2 (en) | 2007-04-10 | 2018-11-13 | Oxford University Innovation Limited | Adenovirus vectors |
| US8460913B2 (en) | 2007-06-21 | 2013-06-11 | Alpha Vax, Inc. | Promoterless cassettes for expression of alpha virus structural proteins |
| US7850977B2 (en) | 2007-06-21 | 2010-12-14 | Alphavax, Inc. | Promoterless cassettes for expression of alphavirus structural proteins |
| EP3178842A1 (en) * | 2008-08-14 | 2017-06-14 | Los Alamos National Security, LLC | Polyvalent vaccine |
| WO2011106705A2 (en) | 2010-02-26 | 2011-09-01 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Dna-protein vaccination protocols |
| WO2013074696A1 (en) | 2011-11-14 | 2013-05-23 | Novartis Ag | Immunogenic complexes of polyanionic carbomers and env polypeptides and methods of manufacture and use thereof |
| WO2019069273A1 (en) * | 2017-10-04 | 2019-04-11 | University Of Cape Town | RECOMBINANT MVA WITH MODIFIED HIV-1 ENV |
Also Published As
| Publication number | Publication date |
|---|---|
| US7618642B2 (en) | 2009-11-17 |
| ATE478955T1 (de) | 2010-09-15 |
| DE60142922D1 (de) | 2010-10-07 |
| JP2012147792A (ja) | 2012-08-09 |
| ES2553575T3 (es) | 2015-12-10 |
| WO2002004493A3 (en) | 2003-06-26 |
| US20110212164A1 (en) | 2011-09-01 |
| AU2001273179A1 (en) | 2002-01-21 |
| CA2414374C (en) | 2014-01-21 |
| US20030223961A1 (en) | 2003-12-04 |
| ZA200403143B (en) | 2005-04-26 |
| JP2004502445A (ja) | 2004-01-29 |
| EP1339738B1 (en) | 2010-08-25 |
| ZA200300839B (en) | 2004-07-30 |
| US7935805B1 (en) | 2011-05-03 |
| EP1339738A2 (en) | 2003-09-03 |
| EP2281832A3 (en) | 2011-12-14 |
| EP2311958A3 (en) | 2011-08-10 |
| EP2311958B1 (en) | 2015-08-19 |
| US20100316698A1 (en) | 2010-12-16 |
| EP2311958A2 (en) | 2011-04-20 |
| EP2281832A2 (en) | 2011-02-09 |
| CA2414374A1 (en) | 2002-01-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7943375B2 (en) | Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof | |
| US8133494B2 (en) | Expression cassettes endcoding HIV-1 south african subtype C modified ENV proteins with deletions in V1 and V2 | |
| EP2311958B1 (en) | Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof | |
| US8263394B2 (en) | Polynucleotides encoding antigenic HIV type B polypeptides, polypeptides, and uses thereof | |
| US20080095833A1 (en) | Polynucleotides encoding antigenic hiv type b polypeptides, polypeptides, and uses thereof | |
| US20030198621A1 (en) | Polynucleotides encoding antigenic HIV type B and/or type C polypeptides, polypeptides and uses thereof | |
| EP1535995A1 (en) | Polynucleotides encoding the antigenic HIV type C env polypeptide and uses thereof | |
| ZA200400793B (en) | Polynucleotides encodin antigenic HIV type C polypeptides and uses thereof. | |
| HK1156662A (en) | Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| ENP | Entry into the national phase |
Ref document number: 2002 509356 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10/KOLNP/2003 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2414374 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2003/00839 Country of ref document: ZA Ref document number: 200300839 Country of ref document: ZA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2001952426 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2001952426 Country of ref document: EP |