WO2001094538A2 - Nouveau polypeptide, adn ligase 21, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, adn ligase 21, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2001094538A2 WO2001094538A2 PCT/CN2001/000870 CN0100870W WO0194538A2 WO 2001094538 A2 WO2001094538 A2 WO 2001094538A2 CN 0100870 W CN0100870 W CN 0100870W WO 0194538 A2 WO0194538 A2 WO 0194538A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- sequence
- ligase
- dna ligase
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide ⁇ DNA ligase 21 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
- DNA replication is an extremely complex process with many enzymes and proteins involved. These complex systems of enzymes and proteins are called “replicas.”
- the functions of the "replica” include: melting of the parental double-helix DNA, temporarily stabilizing the single-stranded state of DM, initiation, extension, and termination of daughter strand synthesis, energy supply during replication, correction of catalytic bases, and so on.
- Replicas are nucleoprotein complexes in which a DNA template on a replication fork is coupled with enzymes and proteins with a specific structure. Its components are gradually assembled to DM. The composition of replicas at different stages of replication is also different. More than 30 enzymes and proteins involved in the DM replication process have been found.
- DNA ligase is an enzyme that closes the DNA gap. It requires a MA template. The complementary single strand paired with the template has a gap of 5, -P and 3 '-0H ends. When no nucleotides are missing, the DNA can be supplied with energy by ATP to break the broken phosphodiester bond. Reconnect between 5 '-P and 3, -0H.
- Enzyme activation This requires an energy reaction. ATP or D combines with the enzyme to form an E-AMP intermediate. The AMP is transferred to the Lys-NH 2 group of E to form E-Lys-AMP and PPi.
- the DM ligase of eukaryotes, bacteria, viruses and phages is ATP-dependent. There is a conserved lysine residue in the DNA ligase, which is adenosine in the first step of the DM ligase process described above.
- Sites of acyl action Tomkinson AE, Totty N.F., Ginsburg M., Lindahl T. Proc. Na tl. Acad. Sci. USA 88: 400-404 (1991)); (Lindahl T., Barnes DE Annu. Rev. Biochem. 61: 25 Bu 281 (1992)).
- the amino acid sequence of DM ligase in almost all organisms contains the following two conservative Sequences: (1) [EDQH] -xKx- [DN] -GxR- [GACIVM], where K represents an active amino acid residue; (2) EG- [LIVMA]-[LIVM] (2)- [R] -x (5, 8)-[YW]-[QNEK]-x (2, 6)-[KRH] -x (3, 5) -K- [LIVMFY]-, human DM ligase specific For the structure, please refer to the related literature (Kletz in A. Nucl eic Aci ds Res. 20: 5389-5396 (1992)).
- Human DNA ligase plays an important role in the processes of DM replication, DM repair, and DNA recombination, especially for the synthesis of neutron strands in DM replication. Therefore, human DNA ligase has an indirect effect Important processes such as cell division of the human body.
- the DM ligase 21 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, more DMs involved in these processes have been identified in the art Ligase 21 protein, especially the amino acid sequence of this protein.
- the isolation of the new DM ligase 21 protein-encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding DNA ligase 21.
- Another object of the present invention is to provide a method for producing DNA ligase 21.
- Another object of the present invention is to provide antibodies against the polypeptide ⁇ DNA ligase 21 of the present invention. Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention ⁇ DM ligase 21. Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of DM ligase 21. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 270-854 in SEQ ID NO: 1; and (b) a sequence having 1-1311 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the DNA ligase 21 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of DM ligase 21 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a mutation in a biological sample.
- a method for detecting a disease or susceptibility to disease associated with abnormal expression of DM ligase 21 protein in vitro which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a mutation in a biological sample.
- the amount or biological activity of a polypeptide of the invention comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of DNA ligase 21.
- FIG. 1 is a comparison diagram of gene chip expression profiles of DM ligase 21 and DM ligase of the present invention.
- the upper graph is a histogram of the expression profile of DM ligase 21, and the lower graph is the histogram of the expression profile of DNA ligase 21.
- 1-bladder mucosa 2- PMA + Ecv304 cell line, 3-LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5-Fibroblast, growth factor stimulation, 1024NT.
- Figure 1 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated DNA ligase 21.
- 21kDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence or a polynucleotide sequence encoding it that has one or more amino acid or nucleotide changes. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- Class Similarly, the term “immunologically active” refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with DNA ligase 21, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate or any other molecule that can bind DNA ligase 21.
- Antagonist refers to a molecule that, when combined with DNA ligase 21, can block or regulate the biological or immunological activity of DM ligase 21.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind DM ligase 21.
- Regular refers to a change in the function of DNA ligase 21, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of DNA ligase 21.
- Substantially pure means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify DNA ligase 21 using standard protein purification techniques. Essentially pure DNA ligase 21 can generate a single main band on a non-reducing polyacrylamide gel. The purity of DNA ligase 21 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences based on different methods, such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method checks the distance between all pairs. The groups of sequences are arranged into clusters. The clusters are then assigned in pairs or groups. Two amino acid sequences such as The percent identity between sequence A and sequence B is calculated by the following formula: Number of residues matching between sequence 3 and sequence 3
- Residues sequence - the sequence number of residues in the interval ⁇ - s interval sequence x residues can be measured as Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J ., (1990) Methods in enzymo logy 183: 625-645) 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of DNA ligase 21.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated DM ligase 21 means that DM ligase 21 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can use standards Protein Purification Technology Purifies DNA Ligase 21. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the MA ligase 21 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a novel polypeptide DNA ligase 21, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of DNA ligase 21.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the DNA ligase 21 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted
- the amino acid may or may not be encoded by a genetic code; or ( ⁇ ) such that a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ⁇ ) like this
- the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1,311 bases in length, and its open reading frames 270-854 encode 194 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile as DNA ligase, and it can be inferred that this DNA ligase 21 has a similar function as DM ligase.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DM.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; The coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence (and optional additional coding sequences) of the mature polypeptide and non-coding sequences.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the present invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the present invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1 1 ⁇ 2 calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding DM ligase 21.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the DNA ligase 21 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DM of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of the CDM sequences.
- the standard method for isolating the cDNA of interest is to isolate the mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid Or phage CDM library. Methods for the extraction of mRNA have been developed using proven techniques, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, eta l., Molecular Cloning, A Labora tory Manua, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RNA hybridization; (2) the presence or loss of marker gene function; ( 3 ) measuring the level of DM ligase 21 transcripts; (4) passing Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of DM ligase 21 gene expression.
- ELISA enzyme-linked immunosorbent assay
- a method using DNA technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DM / RM fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using the DNA ligase 21 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.
- a polynucleotide sequence encoding the DNA ligase 21 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, Bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus such as adenovirus, retrovirus or other vectors.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Na thans, J Bio Chem.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
- promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the replication initiation point, polyoma enhancers and adenovirus enhancers on the late side of the replication initiation point.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding DM ligase 21 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the ( 12 method, the steps used are well known in the art.
- MgCl 2 can be used.
- transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant DNA ligase 21 (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- DM ligase is an enzyme that blocks the DM gap. It requires a DNA template. The complementary single strand paired with the template has gaps in the 5'-P and 3, -0H termini. When no nucleotides are missing, the DNA can be powered by ATP to break the broken phosphodiester bond. Reconnect between 5 '-P and 3'-0H. It is of great significance to the correct replication of DM and to ensure the correctness of genetic information. DNA ligase-specific sequence domains are necessary for its activity.
- the abnormal expression of the specific DM ligase mot if will cause abnormal function of the polypeptide containing this mot if, resulting in the loss of the DM replication and repair function and further the transmission of the genetic code. This can lead to errors and related diseases such as tumors, embryonic developmental disorders, growth and development disorders, and inflammation. It can be seen that the abnormal expression of the DNA ligase 21 of the present invention will produce various diseases, especially tumors, embryonic developmental disorders, growth disorders, and inflammation.
- These diseases include, but are not limited to: tumors of various tissues: gastric cancer , Liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, colon cancer, malignant histiocytosis , Melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymic tumor, nasal cavity and sinus tumor, Nasopharyngeal carcinoma, Laryngeal carcinoma, Tracheal tumor, Pleural mesothelioma, Fibroid, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma
- Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, suburethral Fissure, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
- the abnormal expression of the DM ligase 21 of the present invention will also produce certain hereditary, hematological and immune system diseases.
- the present invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) DNA ligase 21.
- Agonists enhance biological functions such as DNA ligase 21 to stimulate cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing DNA ligase 21 can be cultured with labeled DNA ligase 21 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of DM ligase 21 include antibodies, compounds, receptor deletions, and the like that have been screened.
- An antagonist of DNA ligase 21 can bind to DNA ligase 21 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions can.
- DNA ligase 21 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between DM ligase 21 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to DM ligase 21 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, DNA ligase 21 molecules should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the DNA ligase 21 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- polyclonal antibodies can be obtained by direct injection of DNA ligase 21 into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies for DNA ligase 21 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, BBV -Hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PMS, 1985, 81: 6851).
- the existing technology for producing single-chain antibodies (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against DM ligase 21.
- Antibodies against DM ligase 21 can be used in immunohistochemistry to detect DNA ligase 21 in biopsy specimens.
- Monoclonal antibodies that bind to DNA ligase 21 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies are also used to design immunotoxins that target a particular part of the body.
- DNA ligase 21 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill DM ligase 21 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to DNA ligase 21.
- Administration of an appropriate amount of antibody can stimulate or block the production or activity of DNA ligase 21.
- the invention also relates to a diagnostic test method for quantitative and localized detection of DM ligase 21 levels.
- Assays are well known in the art and include FISH assays and radioimmunoassays.
- the level of DNA ligase 21 detected in the test can be used to explain the importance of DM ligase 21 in various diseases and to diagnose diseases in which DNA ligase 21 functions.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding DM ligase 21 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of DM ligase 21.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant DM ligase 21 to inhibit endogenous DM ligase 21 activity.
- a mutated DNA ligase 21 may be a shortened DNA ligase 21 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of DNA ligase 21.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding DNA ligase 21 into a cell.
- Methods for constructing a recombinant viral vector carrying a polynucleotide encoding DNA ligase 21 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding DNA ligase 21 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DM
- ribozymes that inhibit DM ligase 21 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RM molecule that can specifically decompose a specific MA. The mechanism is that the ribozyme molecule specifically hybridizes with a complementary target A and performs endonucleation.
- Antisense RNA and DNA and ribozymes can be obtained by any of the existing RNA or DNA synthesis techniques, such as the solid-phase phosphate amide chemical synthesis technique for the synthesis of oligonucleotides has been widely used.
- Antisense A molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
- the polynucleotide encoding DNA ligase 21 can be used for the diagnosis of diseases related to DNA ligase 21.
- the polynucleotide encoding DM ligase 21 can be used to detect the expression of DM ligase 21 or the abnormal expression of DNA ligase 21 in a disease state.
- the DNA sequence encoding DNA ligase 21 can be used to hybridize biopsy specimens to determine the expression status of DM ligase 21.
- Hybridization techniques include Southern Blotting, Northern blotting, in situ hybridization, etc. These techniques and methods are publicly available and mature, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissue.
- DNA ligase 21 specific primers can be used to detect RM-polymerase chain reaction (RT-PCR) in vitro amplification to detect DM ligase 21 transcription products.
- Detecting mutations in the DM ligase 21 gene can also be used to diagnose DM ligase 21-related diseases.
- the forms of DNA ligase 21 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type DM ligase 21 DM sequence. Mutations can be detected using existing techniques such as Southern imprinting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.
- Fluorescent in situ hybridization (FISH) of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If at A mutation is observed in some or all of the affected individuals, and the mutation is not observed in any normal individuals, then the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for changes in scabs in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use or sell pharmaceuticals or biological products, which reminders authorize them to be administered to the human body by government agencies that manufacture, use or sell them.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- DNA ligase 21 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of DNA ligase 21 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RM using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) raRNA forms cDNA by reverse transcription.
- the Smart cDM cloning kit purchased from Clontech was used to insert the 00 fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ , and the bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 An automatic sequencer (Perkin-Elmer) determined the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0930d05 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results show that the full-length cDNA contained in the 0930d05 clone is 1311bp (as shown in Seq ID N0: l).
- CDNA was synthesized using fetal brain total RM as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Pr imer2 5'- AGTTCTTAGTTTTATTATAACCTT -3 '(SEQ ID NO: 4)
- Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Conditions for the amplification reaction 50 ⁇ l / L KC1 in a 50 ⁇ l reaction volume ; 10 mmol / L Tri s-HC1, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1/1 dNTP, 1 Opmol primer, 1U Taq DM polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55. C 30sec; 72 ° C 2min.
- RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
- DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-1311bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of DNA ligase 21 gene expression
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- the 32P- labeled probe (approximately 2 X 10 6 cpm / ml) and transferred to a nitrocellulose membrane RM is hybridized overnight at 42 ° C in a solution, the solution contains 50 »/» carboxamide - 25fflM KH 2 P0 4 (pH7. 4) -5 x SSC- 5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0. 1% SDS at 55 ° C for 30 min Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant DM ligase 21
- Pr imer3 5 '-CCCCATATGATGCGGCAGCCCTTTGCTGACAGC-3' (Seq ID No: 5)
- Pr imer4 5 '-CATGGATCCTCACCTTTTCTTCACAAACTTCTT-3' (Seq ID No: 6)
- the 5 'ends of these two primers contain Ndel and BamHI digestion sites, respectively Points, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
- the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
- the PCR reaction was performed using pBS-0930 (105 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were: 10 pg of plasmid containing pBS-0930d05 in a total volume of 50 ⁇ 1, Primer-3 and Primer-4 were 1 Opmol, respectively.
- Advantage Polymerase Mix (Clontech) 1 ⁇ 1.
- Cycle parameters 94. C 20s, 60. C 30s, 68. C 2 rain, 25 cycles.
- Ndel and BamHI were used to analyze the amplified product and plasmid pET-28 ( +) Digestion with two enzymes to recover large fragments and ligate them with T4 ligase.
- the ligation product was transformed into E.
- coli DH5a by calcium chloride method and cultured on LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1) After overnight, the positive clones were screened by colony PCR method and sequenced. The positive clones (pET-0930d05) with the correct sequence were selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (Nova g en) by the calcium chloride method.
- the host bacteria BL21 (pET-0930d05) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L. Continue Incubate for 5 hours. The body was sonicated and centrifuged to collect the supernatant. Chromatography was performed using an affinity column His. Bind Quick Cartr idge (product of Novagen) capable of binding to 6 histidines (6His-Tag). The purified target protein DM ligase 21. After SDS-PAGE electrophoresis, a single band was obtained at 21 kDa ( Figure 2).
- a peptide synthesizer (product of PE company) was used to synthesize the following DNA ligase 21-specific peptides:
- polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex.
- hemocyanin and bovine serum albumin For the method, see: Avrameas, et al. Imtnunochemis try, 1969; 6: 43.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides; 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
- the sample membrane was placed in a plastic bag and 3-1 Omg pre-hybridization solution (lOxDenhardt's; 6xSSC, 0.1rag / ml CT DNA (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
- 3-1 Omg pre-hybridization solution lOxDenhardt's; 6xSSC, 0.1rag / ml CT DNA (calf thymus DNA)
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance is 280pm. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the DNA was fixed on the glass slide to prepare a chip. The specific method steps have been reported in the literature. The post-sampling processing steps of this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified by Ol igotex mRNA Midi Kit (purchased from QiaGen), and another 1 J was separated by reverse transcription.
- Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5--triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech), a fluorescent reagent, was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino- Propargyl- 2'- deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
- Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5-
- the probes from the above two tissues and the chips were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (1 SSC, 0.2 ° / oSDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are the bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 102 letter, scar into fc growth Factor stimulation, 1013HT, scar into fc without stimulation with growth factor, 1013HC, bladder cancer cell EL, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Draw a graph based on these 17 Cy3 / Cy5 ratios ( Figure 1). It can be seen from the figure that the expression profiles of DNA ligase 21 and DNA ligase according to the present invention are very similar.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Enzymes And Modification Thereof (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU89500/01A AU8950001A (en) | 2000-05-26 | 2001-05-28 | A novel polypeptide, dna ligase 21 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115881 CN1325961A (zh) | 2000-05-26 | 2000-05-26 | 一种新的多肽——dna连接酶21和编码这种多肽的多核苷酸 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001094538A2 true WO2001094538A2 (fr) | 2001-12-13 |
WO2001094538A3 WO2001094538A3 (fr) | 2002-03-14 |
Family
ID=4585323
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000870 WO2001094538A2 (fr) | 2000-05-26 | 2001-05-28 | Nouveau polypeptide, adn ligase 21, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1325961A (zh) |
AU (1) | AU8950001A (zh) |
WO (1) | WO2001094538A2 (zh) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996030524A1 (en) * | 1995-03-31 | 1996-10-03 | Human Genome Sciences, Inc. | Human dna ligase iii |
US5858705A (en) * | 1995-06-05 | 1999-01-12 | Human Genome Sciences, Inc. | Polynucleotides encoding human DNA ligase III and methods of using these polynucleotides |
-
2000
- 2000-05-26 CN CN 00115881 patent/CN1325961A/zh active Pending
-
2001
- 2001-05-28 WO PCT/CN2001/000870 patent/WO2001094538A2/zh active Application Filing
- 2001-05-28 AU AU89500/01A patent/AU8950001A/en not_active Abandoned
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996030524A1 (en) * | 1995-03-31 | 1996-10-03 | Human Genome Sciences, Inc. | Human dna ligase iii |
US5858705A (en) * | 1995-06-05 | 1999-01-12 | Human Genome Sciences, Inc. | Polynucleotides encoding human DNA ligase III and methods of using these polynucleotides |
Also Published As
Publication number | Publication date |
---|---|
WO2001094538A3 (fr) | 2002-03-14 |
CN1325961A (zh) | 2001-12-12 |
AU8950001A (en) | 2001-12-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002006337A1 (fr) | Nouveau polypeptide, hydroxyindole-o-methyl transferase humaine 12.43, et polynucleotide codant ce polypeptide | |
WO2001094538A2 (fr) | Nouveau polypeptide, adn ligase 21, et polynucleotide codant ce polypeptide | |
WO2001092515A1 (fr) | Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide | |
WO2001070956A1 (fr) | Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001090133A1 (fr) | Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide | |
WO2001079432A2 (en) | A novel polypeptide, a human cell differentiation transcription factor 58 and the polynucleotide encoding the polypeptide | |
WO2001090172A1 (fr) | Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide | |
WO2001092518A1 (fr) | Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide | |
WO2002012315A1 (fr) | Nouveau polypeptide, proteine mid1 10.56 du gene de type « ring finger », et polynucleotide codant ce polypeptide | |
WO2001092329A1 (fr) | Nouveau polypeptide, sous-unite $g(a) d'atp-synthetase 9.9, et polynucleotide codant ce polypeptide | |
WO2001046409A1 (fr) | Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide | |
WO2001090352A1 (fr) | Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide | |
WO2001072796A1 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide | |
WO2001090177A1 (fr) | Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide | |
WO2002006470A1 (fr) | Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide | |
WO2001047975A1 (en) | A novel polypeptide-protein 10 containing chromo domain and the polynucleotide encoding said polypeptide | |
WO2001079434A2 (fr) | Nouveau polypeptide, signal peptidase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001094407A1 (fr) | Nouveau polypeptide, enzyme de conjugaison de l'ubiquitine humaine 10.01, et polynucleotide codant ce polypeptide | |
WO2001090379A1 (fr) | Nouveau polypeptide, nucleoproteine basophile humaine 22.55, et polynucleotide codant ce polypeptide | |
WO2001094532A2 (fr) | Nouveau polypeptide, proteine ribosomale l39 9, et polynucleotide codant ce polypeptide | |
WO2001087975A1 (fr) | Nouveau polypeptide, adn ligase humaine 9, et polynucleotide codant ce polypeptide | |
WO2001094534A2 (fr) | Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide | |
WO2001092324A1 (fr) | Nouveau polypeptide, nucleoproteine humaine 10.78 basophile, et polynucleotide codant ce polypeptide | |
WO2001092516A1 (fr) | Nouveau polypeptide, proteine ribosomale s19e 13, et polynucleotide codant ce polypeptide | |
WO2001090173A1 (fr) | Nouveau polypeptide, chaperonine humaine cpn60 10, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |