WO1996030524A1

WO1996030524A1 - Human dna ligase iii

Info

Publication number: WO1996030524A1
Application number: PCT/US1995/003939
Authority: WO
Inventors: Ying-Fei Wei; Guo-Liang Yu; William A. Haseltine
Original assignee: Human Genome Sciences, Inc.
Priority date: 1995-03-31
Filing date: 1995-03-31
Publication date: 1996-10-03
Also published as: AU2201695A

Abstract

A human DNA Ligase III polypeptide and DNA (RNA) encoding such polypeptide and a procedure for producing such polypeptide by recombinant techniques is disclosed. Also disclosed are methods for utilizing such polypeptide via gene therapy for the treatment of disorders associated with a defect in DNA Ligase III. Antagonists against such polypetides and their use as a therapeutic to destroy unwanted cells are also disclosed. Diagnostic assays to detect mutant DNA Ligase III genes are also disclosed.

Description

HUMAN DNA LIGASE III

This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. The polypeptide of the present invention has been putatively identified as Human DNA Ligase III. The invention also relates to inhibiting the action of such polypeptides.

DNA strand breaks and gaps are generated transiently during replication, repair and recombination. In mammalian cell nuclei, rejoining of such strand breaks depends on several different DNA polymerases and DNA ligase enzymes.

The mechanism for joining of DNA strand interruptions by DNA ligase enzymes has been widely described. The reaction is initiated by the formation of a covalent enzyme-adenylate complex. Mammalian and viral DNA ligase enzymes employ ATP as cofactor, whereas bacterial DNA ligase enzymes use NAD to generate the adenylyl group. The ATP is cleaved to AMP and pyrophosphate with the adenylyl residue linked by a phosphoramidate bond to the e-amino group of a specific lysine residue at the active site of the protein (Gumport, R.I., et al . , PNAS. 68:2559-63 (1971)). Reactivated AMP residue of the DNA ligaβe-adenylate intermediate is transferred to the 5' phosphate terminus of a single strand break in double stranded DNA to generate a covalent DNA-AMP complex with a 5'-5' phosphoanhydride bond. This reaction intermediate has also been isolated for microbial and mammalian DNA ligase enzymes, but is more short lived than the adenylylated enzyme. In the final step of DNA ligation, unadenylylated DNA ligase enzymes required for the generation of a phosphodiester bond catalyze displacement of the AMP residue through attack by the adjacent 3'-hydroxyl group on the adenylylated site.

The occurrence of three different DNA ligase enzymes, DNA Ligase I, II and III, was established previously by biochemical and immunological characterization of purified enzymes (To kinson, A.E. et al . , J. Biol. Chem., 266:21728- 21735 (1991) and Roberts, E., et ai., J. Biol. Chem., 269:3789-3792 (1994)). However, the inter-relationship between these proteins was unclear as a cDNA clone has only been available for DNA Ligase I, the major enzyme of this type in proliferating cells (Barnes, D.E., et al . , PNAS USA, 87:6679-6683 (1990)). The main function of DNA Ligase I appears to be the joining of Okazaki fragments during lagging-strand DNA replication (Waga, S., et al . , J. Biol. Chem. 269:10923-10934 (1994); Li, C, et al . , Nucl. Acids Res., 22:632-638 (1994); and Prigent, C, et al . , Mol. Cell. Biol., 14:310-317 (1994)).

A full-length human cDNA encoding DNA Ligase I has been obtained by functional complementation of a S. cereviasiae cdc9 temperature-sensitive DNA ligase mutant (Barker, D.G., Eur. J. Biochem.. 162:659-67 (1987)). The full-length cDNA encodes a 102-kDa protein of 919 amino acid residues. There is no marked sequence homology to other known proteins except for microbial DNA ligase enzymes. The active site lysine residue is located at position 568. It also effectively seals single-strand breaks in DNA and joins restriction enzyme DNA fragments with staggered ends. The enzyme is also able to catalyze blunt-end joining of DNA. DNA Ligase I can join oligo (dT) molecules hydrogen-bonded to poly (dA), but the enzyme differs from T4 DNA Ligase II and III in being unable to ligate oligo (dT) with a poly (rA) complementary strand.

Human DNA Ligase III is more firmly associated with the cell nuclei. This enzyme is a labile protein, which is rapidly inactivated at 42°C. DNA Ligase III resembles other eukaryotic DNA Ligase enzymes in requiring ATP as cofactor, but the enzyme differs from DNA Ligase I in having a higher association for ATP. DNA Ligase III catalyzes the formation of phosphodiester bonds with an oligo (dT) • poly (rA) substrate, but not with an oligo (rA) • poly (dT) substrate, so it differs completely from DNA Ligase I in this regard (Arrand, J.E. et al . , J. Biol. Chem.. 261:9079-82 (1986)).

DNA Ligase III repairs single strand breaks in DNA efficiently, but it is unable to perform either blunt-end joining or AMP-dependent relaxation of super-coiled DNA (Elder, R.H. et al . , Eur. J. Biochem.. 203:53-58 (1992)).

Clues as to the physiological role of DNA Ligase III have come from its physical interaction in a high salt- resistant complex with another nuclear protein, the XRCC1 gene product (Caldecott, K.W., et al . , Mol. Cell. Biol.. 14:68-76 (1994) and Ljungquist, S., et al . , Mutat. Res.. 314:177-186 (1994)). The XRCC1 gene encodes a 70 kDa protein, that by itself does not appear to join DNA strand breaks (Caldecott, K.W., et al . , Mol. Cell. Biol.. 14:68-76 (1994); Ljungquist, S . , et al . , Muta . Res.. 314:177-186 (1994) and Thompson, L.H., et al . , Mol. Cell. Biol.. 10:6160- 6171 (1990)). However, mutant rodent cells deficient in XRCC1 protein exhibit reduced DNA Ligase III activity, defective strand break repair, an anomalously high level of sister chromatid exchanges, are hyper-sensitive to simple alkylating agents and ionizing radiation, and have an altered mutation spectrum after exposure to ethyl methanesulfonate (Caldecott, K.W., et al . , Mol. Cell. Biol.. 14:68-76 (1994); Ljungquist, S., et al . , Mutat. Res.. 314:177-186 (1994); Thompson, L.H., et al . , Mol. Cell. Biol.. 10:6160-6171 (1990); and Op het Veld, C.W., et al . , Cancer Res.. 54:3001- 3006 (1994)). These data indicate that XRCC1 mutant cells are defective in base excision-repair, and strongly suggest that both DNA Ligaβe III and XRCC1 are active in this process (Dianov, G., and Lindahl, T., Curr. Biol.. 4:1069-1076 (1994) ) .

A purified mammalian protein fraction active in repair and recombination processes in vitro was shown to contain a ligase with the properties of Human DNA Ligase III, but no detectable amounts of Human DNA Ligase I (Jessberger, R. , et al . , J. Biol. Chem.. 268:15070-15079 (1993)). The role of the distinct enzyme, DNA Ligase II, remains unclear, although an observed increase in DNA Ligase II activity during meiotic prophase suggests a role in meiotic recombination (Higashitani, A., et al . , Cell Struct. Funct., 15:67-72 (1990)). Comparison of ³²P-adenylylated DNA Ligase II and III by partial or complete proteolytic cleavage patterns indicated that these two enzymes share extensive amino acid sequence similarity or identity flanking their active sites, but that they are quite different from DNA Ligase I (Roberts, E., et al . , J. Biol. Chem.. 269:3789-3792 (1994)). Neither DNA Ligase I, II nor III is exclusively a mitochondrial enzyme.

The polynucleotide of the present invention and polypeptide encoded thereby have been putatively identified as human DNA Ligase III as a result of size, amino acid sequence homology to DNA Ligase II and ability to bind XRCC1 protein. Heretofore, the gene sequence of DNA Ligase III was not known.

In accordance with one aspect of the present invention, there are provided novel mature polypeptides which are human DNA Ligase III, as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.

In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules encoding human DNA Ligase III, including mRNAs, DNAs, cDNAs, genomic DNAs as well as analogs and biologically active and diagnostically or therapeutically useful fragments thereof.

In accordance with yet a further aspect of the present invention, there is provided a process for producing such polypeptides by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing a human DNA Ligase III nucleic acid sequence, under conditions promoting expression of said protein and subsequent recovery of said protein.

In accordance with yet a further aspect of the present invention, there is provided a process for utilizing such polypeptides, or polynucleotides encoding such polypeptides, for in vitro purposes related to scientific research, synthesis of DNA and manufacture of DNA vectors.

In accordance with another aspect of the present invention there is provided a method of treating conditions which are related to insufficient human DNA Ligase III activity via gene therapy comprising inserting the DNA Ligase III gene into a patient's cells either in vivo or ex vivo. The gene is expressed in transduced cells and as a result, the protein encoded by the gene may be used therapeutically, for example, to prevent disorders associated with defects in DNA, for example, abnormal cellular proliferation, for example cancers, leukemia and tumors, to treat severe immunosuppression, stunted growth and ly phoma, as well as cellular hypersensitivity to DNA-damaging agents.

In accordance with yet a further aspect of the present invention, there is also provided nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to human DNA Ligase III sequences which may be used diagnostically to detect a mutation in the gene encoding DNA Ligase III.

In accordance with yet another aspect of the present invention, there are provided antagonists to such polypeptides, which may be manufactured intracellularly or administered through gene therapy for inhibiting the action of such polypeptides, for example, to target and destroy undesired cells, e.g., cancer cells.

In accordance with still another aspect of the present invention, there are provided diagnostic assays for detecting mutations in the polynucleotide sequences of the present invention for detecting diseases related to a lack of Human DNA Ligase III activity.

These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.

The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.

Figure 1 shows the cDNA sequence and the corresponding deduced amino sequence of the DNA Ligase III polypeptide. The standard one letter abbreviation for amino acids is used. The vertical arrow indicates the active site lysine. F μre 2 illustrates the amino acid homology between human DNA Ligase III (upper line) and vaccinia virus DNA Ligase (lower line) .

Figure 3. In vitro transcription/translation of full length DNA Ligase III cDNA. The DNA Ligase III cDNA was transcribed with T7 RNA polymerase, the captive message translated in a rabbit reticulocyte lysate supplemented with t³⁵S] methionine, and radiolabeled products analyzed by SDS- PAGE and autoradiography. Identical translation reactions were carried out either with (lane 4) or without (lane 3) addition of the transcript. The major 100 kDa translation product is indicated by an arrow. DNA ligases partially purified from mammalian cells were labelled with [α-³²P] ATP and applied to the same gel to allow molecular mass comparisons: bovine DNA Ligase II (70 kDa, lane 1); Human DNA Ligase III and IV (100 kDa, lane 2). An active fragment (87 kDa) is also visible (lane 2). The positions of ^I4C methylated protein size markers (Amersham) are indicated.

Figure 4. Interaction of in vitro-translated DNA Ligase III with XRCC1. A to C. Affinity purification. The in vitro transcript of DNA Ligase III cDNA (A to C) was translated in the presence of [³⁵S] methionine and the protein product incubated with (A, B) or without (C) histidine-tagged recombinant XRCC1 protein. Recovery of [^3SS]-labelled protein during affinity purification of XRCCl-his on nickel-agarose beads was monitored by SDS-PAGE/autoradiography (B, C); recovery of XRCCl-His protein was monitored by Coomassie Blue-staining of a representative gel (A). Lane 1: load onto beads, lane 2: non-absorbed material, lane 3: 25 mM imidazole final wash, lane 4: first 200 mM imidazole eluate, lane 5: second 200 mM imidazole eluate.

D. Far Western Blotting. HeLa cell nuclear extract, or samples from in vitro transcription/translation of Human DNA Ligase III cDNA (lanes 1 to 4) were analyzed by SDS-PAGE, Far Western Blotting with ³P-phosphorylated XRCC1 probe and autoradiography. Lane 1: 10 microgram HeLa cell nuclear extract, lanes 3 and 4: 5 microliterε and 10 microliters samples of translation reactions with the transcript, lane 2: 10 microliter samples from negative (no added transcript) control reactions carried out in parallel with the cDNA.

Figure 5. Amino acid sequences encoded by the DNA Ligase III and IV cDNAs (DNA Ligase IV cDNA was previously disclosed by Applicant in PCT application No. PCT/US94/12922 on November 8, 1994) and their alignment with Human DNA Ligase I. The predicted amino acid sequences of DNA Ligase III (Liglll) and DNA Ligase IV (LiglV) were aligned with that of DNA Ligase I (Ligl) using the 'Pileup' and 'Bestfit' programs (Genetics Computer Group, Program Manual of the GCG package. Version 7, April 1991, Madison, WI, USA). Amino acid residues that are identical in at least two of the three sequences at optimal alignment are indicated in bold typeface; residues conserved in all three sequences are boxed. Solid lines denote peptides with partial homology to five motifs (I to V) that are conserved between ATP-dependent DNA Ligases and RNA capping enzymes (Shuman S. , et al . , PNAS USA in press (1994); motif I corresponds to the DNA ligase active site and the position of the reactive lysine residue is marked by a vertical arrow. The broken line denotes the conserved peptide found in ATP-dependent DNA ligases that was used to identify DNA ligase-specific partial sequences. Lowercase letters indicate the position of the putative zinc finger at residues 18 to 55 in the DNA ligase III cDNA.

In accordance with an aspect of the present invention, there is provided an isolated nucleic acid (polynucleotide) which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID No. 2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 97052 on February 6, 1995.

A polynucleotide encoding a polypeptide of the present invention may be obtained from testis, prostate, heart and thymus. The polynucleotide of this invention was discovered in a cDNA library derived from human testis. It is structurally related to the DNA ligase family. It contains an open reading frame encoding a protein of 922 amino acid residues. The protein exhibits the highest degree of homology to vaccine virus DNA ligase with 56 % identity and 73 % similarity over the entire protein. It is also important that there is a conserved active lysine residue at position 421 which is bordered on either side by a hydrophobic amino acid residue, and the sequence E-KYDG-R is also conserved and is common to enzymes from different sources such as mammalian cells, yeasts, vaccinia virus and bacteriophage T7.

The region flanking the conserved lysine residue is an active site motif that is essential for the formation of an enzyme-adenylate reaction intermediate (Tomkinson, A.E., et al . , PNAS USA. 88:400-404 (1991)). The conserved lysine residue is indicated by a vertical arrow and the active site motif is underlined in Figure 1. Further a putative zinc finger motif shown at residues 18 to 55 in Figure 1 is underlined by a broken line. The 100 kDa in vitro translation product of the DNA ligase III cDNA interacts with human XRCC1 protein which is a characteristic of DNA Ligase III (Caldecott, K.W., et al . , Mol. Cell. Biol.. 14:68-76 (1994)). Histidine-tagged recombinant XRCC1 protein was incubated with [³⁵S] methionine-labelled in vitro translation product of the cDNA to allow formation of XRCCl-protein complexes, after which NTA-agarose beads were added to affinity-bind XRCCl-His. The agarose beads were washed to remove non-specifically associated polypeptides prior to elution of XRCCl-His with 200 mM imidazole. XRCCl-his bound the product of the cDNA, as indicated by the partial depletion of radiolabeled polypeptides from the non-adsorbed fraction (Figure 4A, lane 2) and the recovery together with XRCCl-His in the imidazole eluate (Figure 4A, lanes 4 and 5). Recovery of radiolabeled polypeptides was dependent on addition of XRCCl-His (Figure 4B) . Approximately 50% of the full length 100 kDa translation product, and as much as 90% of some of the truncated polypeptides, were recovered with XRCCl-His. These results indicate that the cDNA clone encodes a 100 kDa polypeptide.

The longest open reading frame of the cDNA encoding DNA ligase III extends from 73 bp to 3099 bp within the cDNA clone and would encode a polypeptide of 1009 amino acids, approximately 150 kDa molecular mass. The next downstream ATG at 334 bp occurs in a typical translation start consensus and defines an open reading frame of 2766 bp (922 amino acids) . The protein produced in this case would be approximately 103 kDa, consistent with both the observed molecular mass of the in vitro translation product and the apparent molecular mass of authentic DNA Ligase III purified from HeLa cells by standard chromatographic procedures. This indicates that this cDNA represents a full length cDNA clone. Furthermore, a 5'-truncated cDNA clone lacking the first 78 bp (and the first ATG codon) produced an in vitro translation product of identical electrophoretic mobility to that encoded by the full length clone, in support of assignment of the ATG at 334 bp as the translation initiation codon.

The DNA Ligase III amino acid sequence shows extensive amino acid homology to Human DNA Ligase I. The DNA Ligase III sequence is identical at 8 of 12 residues flanking the active site lysine of DNA Ligase I, and both contain the minimum active site consensus for all ATP-dependent DNA ligases, -K-DG-R-, with lys₂₁ (DNA Ligase III) being the putative active lysine. The position of these two highly conserved motifs within the predicted amino acid sequences of human DNA Ligase I and III are indicated in Figure 5. Although their amino acid sequences are not colinear at optimum alignment, human DNA Ligase I and III differ by 9 amino acids in the size of the region between the two motifs (active lysine and minimum active site motifs).

The 3' flanking motif is located 37 amino acids from the C-terminus of DNA Ligase I, whereas the DNA Ligase III sequence extends a further 195 residues. The C-terminuε of the DNA Ligase III shows weak homology to several proteins, including approximately 20% identity to a 144 amino acid sequence within the C-terminal quarter of both human and murine XRCC1.

In their N-terminal regions, DNA Ligase I and III show very limited sequence homology beyond about "^"30 residues upstream of their active sites, and DNA Ligase I has an extended hydrophilic N-terminal region with no homology to DNA Ligase III (Figure 5).

The N-terminal 112 amino acids of the DNA Ligase III cDNA show approximately 30% identity to residues 3 to 107, and also residues 108 to 217, of human poly (ADP ribose) polymerase (PARP) . These same two regions contain two evolutionarily conserved zinc finger motifs within the DNA- binding domain of PARP. The position of the putative zinc finger in the open reading frame of the DNA Ligase III cDNA is indicated in (Figure 5).

The highly conserved motif flanking the 3' boundary of the region of homology between DNA Ligase I and III is unique to ATP-dependent DNA ligases and is not found in the RNA capping enzymes. Similarly to vaccinia virus DNA Ligase, Human DNA Ligase III does not contain the region 2 motif which is present in the capping enzymes, and Human DNA Ligase I (Shuman, S., et al . PNAS USA, in press (1994)).

There is near identity of peptides within the predicted amino acid sequence of the DNA Ligase III cDNA with sequenced tryptic peptides from the 70 kDa bovine DNA Ligase II protein (Wang, Y-C.J., et al . , J . Biol. Chem.. 269:31923-31928 (1994)). These tryptic peptides span the region between the active site and the conserved DNA Ligase-specific motif, and are also highly homologous to the corresponding region of the vaccinia virus DNA ligase. The sequence ₄₁₁- (K)CPNGMFSEIKYDGERVQVH(K)-₄₃₁ (SEQ ID No. 9) in the DNA ligase III cDNA, with Lys₄₂₁ the putative active lysine, is identical to the active site tryptic peptide identified in the purified bovine DNA Ligase II protein and different from that of DNA Ligase I (Tomkinson, A.E., et al . , PNAS USA. 88:400-404 (1991)).

The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID No. 1) or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID No. 1) or the deposited cDNA.

The polynucleotide which encodes for the mature polypeptide of Figure 1 (SEQ ID No. 2) or for the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.

Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.

The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID No. 2) or the polypeptide encoded by the cDNA of the deposited clone. The variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non- naturally occurring variant of the polynucleotide.

Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (SEQ ID No. 2) or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID No. 2) or the polypeptide encoded by the cDNA of the deposited clone. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.

As hereinabove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 (SEQ ID No. 1) or of the coding sequence of the deposited clone. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.

The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention. The marker sequence may be a hexa- histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al.. Cell. 37:767 (1984)).

The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 50% and preferably 70% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNA of Figure 1 or the deposited cDNA.

Alternatively, the polynucleotide may be a polynucleotide which has at least 20 bases, preferably 30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which has an identity thereto, as hereinabove described, and which does not retain activity. Such polynucleotides may be employed as probes for the polynucleotide of SEQ ID No. 1, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.

The deposit(s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. §112. The sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.

The present invention further relates to a DNA Ligase III polypeptide which has the deduced amino acid sequence of Figure 1 (SEQ ID No. 2) or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.

The terms "fragment," "derivative" and "analog" when referring to the polypeptide of Figure 1 (SEQ ID No. 2) or that encoded by the deposited cDNA, means a polypeptide which retains essentially the same biological function or activity as such polypeptide. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.

The fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID No. 2) or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, which is employed for purification of the mature polypeptide. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.

The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.

The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).

The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.

The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.

Hoεt cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered hoεt cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the DNA Ligase III genes. The culture conditions, βuch as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

The polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques. Thuε, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.

The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.

The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(ε) (promoter) to direct mRNA εynthesis. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda P_L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression.

In addition, the expression vectors preferably contain one or more εelectable marker geneε to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin reεiεtance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.

The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.

As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli. Streptomyces. Salmonella typhi urium: fungal cells, such as yeast; insect cells such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO, COS or Bowes melanoma; adenoviruses; plant cells, etc. The selection of an appropriate hoεt is deemed to be within the scope of those skilled in the art from the teachings herein.

More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pDIO, phagescript, psiX174, pbluescript SK, pbβks, pNHBA, pNHlβa, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plaεmid or vector may be used as long aε they are replicable and viable in the host.

Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markerε. Two appropriate vectors are pKK232-8 and pCM7. Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P_R, P_L and trp. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRε from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.

In a further embodiment, the present invention relates to host cells containing the above-described constructε. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the hoεt cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986) ). The conεtructs in hoεt cells Can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.

Mature proteins can be expresεed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free tranεlation εyεtemε can alεo be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al.. Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.

Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes iε increaεed by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenoviruε enhancers.

Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), α-factor, acid phosphataεe, or heat εhock proteinε, among otherε. The heterologouε εtructural sequence is assembled in appropriate phase with translation, initiation and termination sequences. Optionally, the heterologouε sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.

Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination εignalε in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hostε for transformation include E. coli. Bacillus subtilis. Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although otherε may also be employed as a matter of choice.

As a representative but nonlimiting example, useful expresεion vectorε for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017). Such commercial vectorε include, for example, pKK223-3 (Pharmacia Fine Chemicalε, Uppεala, Sweden) and GEM1 (Promega Biotec, Madiεon, WI, USA). Theεe pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.

Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.

Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification. Microbial cells employed in expresεion of proteinε can be diεrupted by any convenient method, including freeze-thaw cycling, εonication, mechanical diεruption, or use of cell lyεing agentε, such methods are well known to those skilled in the art.

Various mammalian cell culture systemε can also be employed to expresε recombinant protein. Exampleε of mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines. Mammalian expresεion vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequenceε derived from the SV40 εplice, and polyadenylation εiteε may be used to provide the required nontranscribed genetic elements.

The DNA Ligaεe III polypeptide can be recovered and purified from recombinant cell cultureε by methodε including ammonium εulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phoεphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification stepε.

The polypeptideε of the preεent invention may be a naturally purified product, or a product of chemical εynthetic procedureε, or produced by recombinant techniqueε from a prokaryotic or eukaryotic host (for example, by bacterial, yeaεt, higher plant, inεect and mammalian cells in culture). Depending upon the hoεt employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include an initial methionine amino acid residue.

The DNA Ligase III polypeptides and agonistε and antagoniεts which are polypeptides, described below, may be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy."

Thuε, for example, cellε from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cellε then being provided to a patient to be treated with the polypeptide. Such methodε are well-known in the art. For example, cellε may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the preεent invention.

Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. As known in the art, a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cellε in vivo and expression of the polypeptide in vivo. These and other methods for administering a polypeptide of the present invention by such method should be apparent to thoεe εkilled in the art from the teachingε of the present invention. For example, the expresεion vehicle for engineering cellε may be other than a retrovirus, for example, an adenoviruε which may be uεed to engineer cellε in vivo after combination with a suitable delivery vehicle.

Retroviruseε from which the retroviral plaεmid vectorε hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosiε viruε, gibbon ape leukemia viruε, human immunodeficiency viruε, adenoviruε, Myeloproliferative Sarcoma Viruε, and mammary tumor virus. In one embodiment, the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.

The vector includes one or more promoters. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniques. Vol. 7, No. 9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoterε including, but not limited to, the hiεtone, pol III, and 3-actin promoterε). Other viral promoterε which may be employed include, but are not limited to, adenoviruε promoters, thymidine kinase (TK) promoterε, and B19 parvoviruε promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.

The nucleic acid sequence encoding the polypeptide of the present invention is under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or hetorologouε promoterε, εuch as the cytomegalovirus (CMV) promoter; the respiratory εyncytial viruε (RSV) promoter; inducible promoterε, εuch aε the MMT promoter, the metallothionein promoter; heat εhock promoterε; the albumin promoter; the ApoAI promoter; human globin promoterε; viral thymidine kinaεe promoterε, εuch aε the Herpeε Simplex thymidine kinase promoter; retroviral LTRε (including the modified retroviral LTRs hereinabove described); the 3-actin promoter; and human growth hormone promoterε. The promoter alεo may be the native promoter which controls the gene encoding the polypeptide.

The retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines. Examples of packaging cellε which may be transfected include, but are not limited to, the PE501, PA317, ^-2, ^-AM, PA12, T19-14X, VT-19-17-H2, φCKE , ^CRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy. Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaP0₄ precipitation. In one alternative, the retroviral plasmid vector may be encapεulated into a lipoεome, or coupled to a lipid, and then administered to a hoεt.

The producer cell line generateε infectiouε retroviral vector particleε which include the nucleic acid sequence(s) encoding the polypeptideε. Such retroviral vector particleε then may be employed, to tranεduce eukaryotic cells, either in vitro or in vivo . The transduced eukaryotic cells will expresε the nucleic acid sequence(s) encoding the polypeptide. Eukaryotic cellε which may be transduced include, but are not limited to, embryonic εtem cellε, embryonic carcinoma cellε, aε well aε hematopoietic εtem cells, hepatocyteε, fibroblaεts, myoblastε, keratinocyteε , endothelial cells, and bronchial epithelial cells.

Once the DNA Ligase III polypeptide is being expressed intracellularly via gene therapy, it may be used to repair single-εtrand breakε in DNA which reεult from DNA-damaging agentε, e.g., UV radiation. Several human εyndromeε reεult from autoεomal receεsive inheritance for the DNA ligaεe gene. Theεe syndromes cause severe immunodeficiency and greatly increases the susceptibility of abnormal cellular differentiation due to the disrepair of DNA while at the cellular level they are characterized by chromosome inεtability and hyperεenεitivity to DNA-damaging agents. These syndromes include Fanconi's anemia and Blackfan-diamond anemia. The polypeptide of the present invention may also be employed to treat severe immunosuppreεεion which iε the reεult of a defect in the DNA Ligaεe III gene. DNA Ligase III may also be employed to treat stunted growth and lymphoma which result from defective rejoining of DNA.

Chromosome abnormalities in the 17qll-12 region, to which the DNA Ligase III gene has been mapped, are associated with several diseases including several neoplasias. The most common neoplastic chromosomal abnormality in this region is a translocation between chromosomes 15 and 17 seen in acute myeloid leukemia subtype m3 which involves the diεruption of the retinoic acid receptor α gene (Chomienne, H., et al . , Nature. 347:558-561 (1990)). However, chromosomal abnormalities in this region are frequently reported in both acute myeloid and lymphoblaεtic leukemias and are seen sporadically in several other cancers (Mitelman, F., Catalog of Chromosome Aberrationε in Cancer (Fourth Edition), Wiley Liεε, New York (1991)). Accordingly, the DNA Ligaεe III gene and gene product may be employed to treat these neoplasiaε.

Fragmentε of the full length Ligase III gene may be used aε a hybridization probe for a cDNA library to isolate other genes which have a high sequence εimilarity to the DNA Ligaεe III gene or have similar biological activity. Probes of this type have at least 20 bases. Preferably, however, the probes have at least 30 baseε and may contain, for example, 50 or more bases. The probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete DNA Ligase III gene including regulatory and promotor regions, exons, and introns.

An example of a εcreen comprises isolating the coding region of the DNA Ligase III gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labelled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.

The polypeptide and/or polynucleotide of the preεent invention may also be employed in relation to εcientific research, syntheεiε of DNA and for the manufacture of DNA vectors. The polypeptide and/or polynucleotide of the present invention may be sold into the research market. Thus, for example DNA Ligaεe III may be used for ligation of DNA εequenceε in vitro in a manner similar to other DNA ligase enzymes of the art.

Thiε invention alεo provideε a method of screening compounds to identify those which enhance or inhibit the DNA- joining reaction catalyzed by human DNA Ligase III. An example of such a method comprises combining ATP, DNA Ligaεe III and DNA having single-strand breaks with the compound under conditions where the DNA Ligase would normally cleave ATP to AMP and the AMP is tranεferred to the 5' phoεphate terminus of a single strand break in double-stranded DNA to generate a covalent DNA-AMP complex with the single strand break being subsequently repaired. The DNA having the single-εtrand breakε may be supplied in the above example by mutant cells which are deficient in proteins that are responsible for strand break repair, for example, mutant rodent cells deficient in XRCC1 and the cdc9 S. Cerevisiae DNA ligase mutant. The ability of the compound to enhance or block the catalysiε of this reaction could then be measured to determine if the compound is an effective agonist or antagonist.

Human DNA Ligase III is produced and functions intracellularly, therefore, any antagonist must be intra- cellular. Potential antagonistε to human DNA Ligase III include antibodies which are produced intracellularly. For example, an antibody identified as antagonizing DNA Ligase III may be produced intracellularly aε a single chain antibody by procedures known in the art, such as transforming the appropriate cellε with DNA encoding the single chain antibody to prevent the function of human DNA Ligase III.

Another potential antagonist is an antisense construct prepared using antisense technology. Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methodε are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in tranεcription (triple helix - see Lee et al. , Nucl. Acids Res., 6:3073 (1979); Cooney et al. Science, 241:456 (1988); and Dervan et al.. Science, 251: 1360 (1991)), thereby preventing tranεcription and the production of DNA Ligase III. The antisenεe RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the DNA Ligase III (antisenεe - Okano, J. Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Presε, Boca Raton, FL (1988)). The oligonucleotides deεcribed above can also be delivered to cells εuch that the antiεenεe RNA or DNA may be expreεεed in vivo to inhibit production of DNA Ligaεe III.

Yet another potential antagoniεt includes a mutated form, or mutein, of DNA Ligase III which recognizes DNA but does not repair single-εtrand breaks and, therefore, acts to prevent human DNA Ligase III from functioning.

The antagonists may be employed to target undesired cells, e.g., cancer cells and leukemic cells, εince the prevention of DNA Ligase III prevents repair of εingle-εtrand breakε in DNA and will eventually result in death of the cell. The small molecule agonists and antagonists of the present invention may be employed in combination with a εuitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the molecule and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but iε not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.

The invention also provideε a pharmaceutical pack or kit compriεing one or more containerε filled with one or more of the ingredientε of the pharmaceutical compoεitionε of the invention. Associated with such container(ε) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, the pharmaceutical compositions of the present invention may be employed in conjunction with other therapeutic compounds.

The pharmaceutical compositions may be administered in a convenient manner such aε by the oral, topical, intravenouε, intraperitoneal, intramuεcular, subcutaneous, intranasal or intradermal routeε. The pharmaceutical compoεitionε are adminiεtered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, they are administered in an amount of at least about 10 μg/kg body weight and in most caseε they will be adminiεtered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 g/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptomε, etc.

Thiε invention alεo provides the use of the human DNA Ligase III gene as a diagnostic. For example, some diseases result from inherited defective genes. These genes can be detected by comparing the sequence of the defective gene with that of a normal one. That is, a mutant gene would be asεociated with hyperεenεitivity to DNA-damaging agents and an elevated susceptibility to abnormal cell growth, for example, tumors, leukemia and cancer.

Individuals carrying mutations in the human DNA Ligase III gene may be detected at the DNA level by a variety of techniques. Nucleic acids used for diagnosis may be obtained from a patient's cellε, εuch aε from blood, urine, εaliva, tissue biopsy and autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al . , Nature. 324:163-166 (1986)) prior to analysis. RNA or cDNA may also be used for the same purpose. Deletions or insertionε can be detected by a change in εize of the amplified product in compariεon to the normal genotype. Point mutationε can be identified by hybridizing amplified DNA to radiolabeled DNA Ligaεe III RNA or alternatively, radiolabeled DNA Ligaεe III antiεenεe DNA εequenceε. Perfectly matched sequences can be distinguiεhed from miεmatched duplexeε by RNaεe A digestion or by differences in melting temperatures.

Genetic teεting based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small εequence deletions and inεertionε can be visualized by high resolution gel electrophoresiε. DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different poεitionε according to their specific melting or partial melting temperatures (see, e.g., Myers et al . , Science. 230:1242 (1985)).

Sequence changes at specific locations may also be revealed by nuclease protection assays, such aε RNase protection and SI protection or the chemical cleavage method (e.g.. Cotton et al . , PNAS. USA. 85:4397-4401 (1985)).

Thus, the detection of a specific DNA sequence may be achieved by methods εuch aε hybridization, RNaεe protection, chemical cleavage, direct DNA εequencing, or the use of restriction enzymes, e.g., restriction fragment length polymorphismε, and Southern blotting of genomic DNA. Also, mutations may be detected by in situ analysis.

In addition, εome diεeaseε are a result of, or are characterized by, changes in gene expression which can be detected by changes in the mRNA. Alternatively, the DNA Ligase III gene can be used aε a reference to identify individuals expresεing a decreased level of DNA Ligaεe III protein, e.g., by Northern blotting.

The sequences of the present invention are alβo valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular siteε on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphismε) are presently available for marking chromosomal location. The mapping of DNAs to chromoεomeε according to the preεent invention is an important first step in correlating those εequenceε with geneε aεεociated with diεease.

Briefly, εequenceε can be mapped to chromosomeε by preparing PCR primerε (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification proceεε. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment. PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromoεome. Uεing the present invention with the same oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomeε or poolε of large genomic cloneε in an analogouε manner. Other mapping εtrategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.

Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short aε 500 or 600 bases; however, clones larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection. FISH requires use of partial sequence clones and the longer the better. For example, 2,000 bp is good, 4,000 iε better, and more than 4,000 iε probably not necessary to get good reεultε a reasonable percentage of the time. For a review of this technique, see Verma et al.. Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Detailed analysis of 19 individual chromoεomeε uεing a combination of fractional length measurements and fluorescent binding combined with high-resolution image analysis indicated that Human DNA Ligase III is located within bands 17qll.2-12.

Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseaseε that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes). The gene of the present invention has been mapped to chromosome 13q33-34.

Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the diseaee.

With current reεolution of phyεical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the diseaεe could be one of between 50 and 500 potential cauεative geneε. (Thiε assumes 1 megabaεe mapping resolution and one gene per 20 kb).

The polypeptides, their fragments or other derivativeε, or analogs thereof, or cellε expreεεing them can be uεed aε an immunogen to produce antibodieε thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies. The present invention also includes chimeric, single chain, and humanized antibodies, aε well aε Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.

Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody eo obtained will then bind the polypeptides itself. In thiε manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptideε. Such antibodieε can then be used to isolate the polypeptide from tiεsue expressing that polypeptide. For preparation of monoclonal antibodieε, any technique which provideε antibodieε produced by continuouε cell line cultureε can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Lisε, Inc., pp. 77-96).

Techniqueε deεcribed for the production of εingle chain antibodieε (U.S. Patent 4,946,778) can be adapted to produce εingle chain antibodieε to immunogenic polypeptide products of this invention. Also, transgenic mice may be used to express humanized antibodies to immunogenic polypeptide products of this invention.

The present invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All partε or amountε, unleεε otherwiεe εpecified, are by weight.

In order to facilitate underεtanding of the following examples certain frequently occurring methods and/or terms will be described.

"Plaεmidε" are deεignated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmidε herein are either commercially available, publicly available on an unreεtricted baεiε, or can be constructed from available plasmidε in accord with publiεhed procedureε. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.

"Digestion" of DNA referε to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction 96/30524 PCI7US95/03939

conditions, cofactors and other requirements were used aε would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 μg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically 5 to 50 μg of DNA are digeεted with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37^*C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.

Size separation of the cleaved fragments iε performed using 8 percent polyacrylamide gel described by Goeddel, D. et al . , Nucleic Acids Res., 8:4057 (1980).

"Oligonucleotideε" referε to either a εingle εtranded polydeoxynucleotide or two complementary polydeoxynucleotide εtrands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A εynthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.

"Ligation" refers to the procesε of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al.. Id., p. 146). Unleεε otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 μg of approximately equimolar amounts of the DNA fragments to be ligated.

Unless otherwise stated, transformation was performed as described in the method of Graham, F. and Van "Tier Eb, A., Virology, 52:456-457 (1973). Example 1 Bacterial Expression and Purification of DNA Liσase III

The DNA sequence encoding DNA Ligase III, ATCC # 97052, iε initially amplified uεing PCR oligonucleotide primerε corresponding to the 5' and 3' end sequences of the processed DNA Ligase III gene. The 5' oligonucleotide primer has the εequence 5' CGCGGATCCATGGCTGAGCAACGGTTCTG 3' (SEQ ID No. 3) containε a Bam HI restriction enzyme site (underlined) followed by 20 nucleotides of DNA Ligase III coding sequence starting from the presumed terminal amino acid of the processed protein codon. The 3' sequence 5' GCGTCTAGACTAGCAGGGAGCTACCAG 3' (SEQ ID No. 4) contains complementary sequences to a Xbal site (underlined) and is followed by 18 nucleotides of DNA Ligase III at C-terminal of DNA Ligase III. The restriction enzyme siteε correεpond to the restriction enzyme sites on the bacterial expresεion vector pQE-9 (Qiagen, Inc. Chatεworth, CA) . pQE-9 encodeε antibiotic resistance (Amp^r) , a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/O), a ribosome binding εite (RBS), a 6-Hiε tag and reεtriction enzyme siteε. pQE-9 iε then digested with Bam HI and Pst I. The amplified sequences are ligated into pQE-9 and inserted in frame with the εequence encoding for the hiεtidine tag and the RBS. The ligation mixture iε then uεed to tranεform E. coli εtrain M15/rep 4 (Qiagen, Inc.) under the trademark M15/rep 4 by the procedure deεcribed in Sambrook, J. et al.. Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Preβs, (1989). M15/rep4 contains multiple copies of the plasmid pREP4, which expresseε the lad repressor and also confers kanamycin resistance (Kan^r) . Transformantε are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysiε. Cloneε containing the deεired constructs are grown overnight (0/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml) . The O/N culture is uεed to inoculate a large culture at a ratio of 1:100 to 1:250. The cellε are grown to an optical denεity 600 (O.D.⁶⁰⁰) of between 0.4 and 0.6. IPTG ("Isopropyl-B-D-thiogalacto pyranoside") iε then added to a final concentration of 1 mM. IPTG induceε by inactivating the lad repressor, clearing the P/0 leading to increased gene expression. Cellε are grown an extra 3 to 4 hourε. Cellε are then harvested by centrifugation. The cell pellet is solubilized in the chaotropic agent 6 Molar Guanidine HCI. After clarification, solubilized protein extract is purified from thiε εolution by chromatography on a Nickel-Chelate column under conditionε that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984)) and eluted from the column in 6 molar guanidine HCI pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCI, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized). After incubation in thiε solution for 12 hours the protein iε dialyzed to 10 mmolar εodium phoεphate.

Example 2

Cloning and expression gj βJJA. iggge III sin £__£ baculovirus expression system

A DNA sequence encoding full length DNA Ligase III protein, ATCC # 97052, is amplified using PCR oligonucleotide primers correεponding to the 5' and 3' sequenceε of the gene:

The 5 ' primer haε the sequence 5 ' CGCQAATCCATGGCTGAGCAACGGTTCTG 3' (SEQ ID No. 5) and contains a BamHI restriction enzyme site (in bold) followed first by 20 nucleotides of N-terminal sequence (the initiation codon for translation "ATG" is underlined) .

The 3 ' primer haε the sequence 5 ' GCGTCTAGACTAGCAGGGAGCTACCAG 3' (SEQ ID No. 6) and contains the cleavage site for the reεtriction endonucleaεe Xbal (in bold) and 18 nucleotides complementary to the C-terminal sequence of the DNA Ligase III gene. The amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.). The fragment was then digested with the endonucleases BamHI and Xbal and then purified again on a 1% agarose gel. Thiε fragment iε designated F2.

The vector pA2 (modification of pVL941 vector, diεcuεεed below) iε uεed for the expression of the DNA Ligase III protein using the baculovirus expression syεtem (for review eee: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectorε and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555). This expreεsion vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhidrosis virus (AcMNPV) followed by the recognition siteε for the reεtriction endonucleases BamHI and Xbal. The polyadenylation site of the simian viruε (SV)40 iε used for efficient polyadenylation. For an easy selection of recombinant viruses the beta-galactosidase gene from E.coli iε inserted in the same orientation aε the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequenceε are flanked at both εides by viral sequenceε for the cell-mediated homologouε recombination of co-tranεfected wild-type viral DNA. Many other baculoviruε vectorε could be used in place of pRGl such aε pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31-39).

The plasmid is digested with the restriction enzymes BamHI and Xbal and then dephosphorylated using calf intestinal phoεphataεe by procedureε known in the art. The DNA iε then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated V2. Fragment F2 and the dephoεphorylated plasmid V2 were ligated with T4 DNA ligaεe. E.coli HB101 cellε are then transformed and bacteria identified that contained the plasmid (pBac DNA Ligase III) with the DNA Ligaεe III gene using the enzymes BamHI and Xbal. The sequence of the cloned fragment is confirmed by DNA sequencing.

5 μg of the plasmid pBac DNA Ligase III was co- tranεfected with 1.0 μg of a commercially available linearized baculovirus ("BaculoGold™ baculovirus DNA", Pharmingen, San Diego, CA. ) uεing the lipofection method (Feigner et al. Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)) . lμg of BaculoGold™ viruε DNA and 5 μg of the plasmid pBac DNA Ligase III are mixed in a sterile well of a microtiter plate containing 50 μl of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD) . Afterwards 10 μl Lipofectin pluε 90 μl Grace's medium are added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture is added drop¬ wise to the Sf9 insect cellε (ATCC CRL 1711) seeded in a 35 mm tisεue culture plate with 1 ml Grace' medium without serum. The plate iε rocked back and forth to mix the newly added εolution. The plate iε then incubated for 5 hours at 27°C. After 5 hours the tranεfection solution is removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf εerum iε added. The plate iε put back into an incubator and cultivation continued at 27°C for four dayε.

After four days the supernatant is collected and a plaque assay performed similar aε deεcribed by Summerε and Smith (supra) . Aε a modification an agarose gel with "Blue Gal" (Life Technologieε Inc., Gaitherεburg) iε uεed which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque aεεay" can alεo be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaitherεburg, page 9- 10).

Four dayε after the εerial dilution, the viruεeε are added to the cellε and blue stained plaques are picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruseε iε then reεuεpended in an Eppendorf tube containing 200 μl of Grace'ε medium. The agar iε removed by a brief centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm disheε. Four dayε later the εupernatantε of theεe culture diεheε are harveεted and then stored at 4°C.

Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS. The cells are infected with the recombinant baculovirus V-DNA Ligase III at a multiplicity of infection (MOI) of 2. Six hours later the medium is removed and replaced with SF900 III medium minus methionine and cysteine (Life Technologies Inc., Gaitherεburg) . 42 hourε later 5 μCi of ³⁵S-methionine and 5 μCi ^3SS cyεteine (Amerεham) are added. The cells are further incubated for 16 hours before they are harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.

Example 3 Expreεεion of Recombinant DNA Ligase III in COS cells

The expresεion of plaεmid, DNA Ligaεe III HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A DNA fragment encoding the entire DNA Ligase III precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression iε directed under the CMV promoter. The HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R. Heighten, A Cherenεon, M. Connolly, and R. Lerner, Cell 37:767 (1984)). The infusion of HA tag to the target protein allows detection of the recombinant protein with an antibody that recognizes the HA epitope.

The plasmid construction strategy is described as follows:

The DNA sequence encoding DNA Ligase III, ATCC # 97052, is constructed by PCR using two primers: the 5' primer 5' CGCGAATCCATGGCTGAGCAACGGTTCTG 3' (SEQ ID No. 7) contains an BamHI site (underlined) followed by 20 nucleotides of DNA Ligase III coding sequence starting from the initiation codon; the 3' sequence 5' GCGTCTAGATCAAGCGTAGTCTGGGACGTC GTATGGGTAGCAGGGAGCTACCAGTC 3' (SEQ ID No. 8) contains complementary sequenceε to an Xbal εite (underlined), translation εtop codon, HA tag and the last 17 nucleotideε of the DNA Ligaεe III coding εequence (not including the stop codon). Therefore, the PCR product contains an BamHI site, DNA Ligase III coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and an Xbal site. The PCR amplified DNA fragment and the vector, pcDNAl/Amp, are digested with BamHI and Xbal restriction enzyme and ligated. The ligation mixture is transformed into E. coli strain SURE (Stratagene Cloning Syεtemε, La Jolla, CA) the transformed culture is plated on ampicillin media plates and resiεtant colonieε are εelected. Plaεmid DNA is isolated from transformants and examined by restriction analyεiε for the preεence of the correct fragment. For expression of the recombinant DNA Ligaβe III, COS cells are transfected with the expresεion vector by DEAE- DEXTRAN method (J. Sa brook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)). The expression of the DNA Ligase III HA protein is detected by radiolabeling and immunoprecipitation method (E. Harlow, D. Lane,"^"Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Presε, (1988)). Cells are labelled for 8 hours with ^3SS-cysteine two dayε poεt transfection. Culture media are then collected and cellε are lysed with detergent (RIPA buffer (150 mM NaCI, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5) (Wilson, I. et al.. Id. 37:767 (1984)). Both cell lysate and culture media are precipitated with a HA εpecific monoclonal antibody. Proteinε precipitated are analyzed on 15% SDS-PAGE gelε.

Example 4 Expresεion pattern of DNA Ligase III in human tissue

Northern blot analysis may be performed to examine the levels of expression of DNA Ligase III in human tisεueε. Total cellular RNA samples are isolated with RNAzol™ B syεtem (Biotecx Laboratorieε, Inc. Houεton, TX) About 15μg of total RNA iεolated from each human tiεεue specified is separated on 1% agarose gel and blotted onto a nylon filter (Sambrook, Fritsch, and Maniatis, Molecular Cloning, Cold Spring Harbor Press, (1989)). The labeling reaction is done according to the Stratagene Prime-It kit with 50ng DNA fragment. The labeled DNA iε purified with a Select-G-50 column (5 Prime - 3 Prime, Inc. Boulder, CO). The filter containing the particular RNA blot iε then hybridized with radioactive labeled full length DNA Ligaεe III gene at 1,000,000 cpm/ml in 0.5 M NaP0₄, pH 7.4 and 7% SDS overnight at 65"C. After waεh twice at room temperature and twice at 60^*C with 0.5 x SSC, 0.1% SDS, the filter iε then exposed at -70^*C overnight with an intensifying screen. The mesεage RNA for DNA Ligaεe III is abundant in the testis, prostate, heart, thymuε.

Example 5 In vitro transcription/translation of cDNA cloneε

Putative full-length cDNA clone waε subcloned as follows: DNA ligase III was subcloned aε a Sal I/Not I reεtriction fragment into the multiple cloning sire of pSPORT (Life Technologies), with the 5' end proximal to the T7 promoter; the DNA ligase III plasmid constructs (1 μg) was linearized with either. Not I or Xho I (New England Biolabs), downstream of the cDNA insert, then transcribed and capped at 36°C for 30 minutes with T7 polymerase and the mCAP RNA capping kit (Stratagene) . The reactions were terminated by incubation with 10 units RNase-free DNase at 37°C for 5 minutes. Following phenol/chloroform extraction and ethanol precipitation, the in vitro transcription products were resuspended in 20 μl 10 mM Tris-HCl/1 mM EDTA, pH 8.0 (TE). The transcript (0 to 5 μl, made up to a final volume of 5 μl with water) was translated in 20 μl rabbit reticulocyte lysate (Amersham) at 30°C for 90 minutes. In order to radiolabel the product of in vitro translation, reaction was supplemented with 20 μCi [^3SS]methionine (3000 Ci mmol¹, Amersham) . Translationε were terminated by incubation with 5 μl of 400 ml'¹ RNase A/50 mM EDTA at 37°C for 15 minuteε (30 μl final volume). Sampleε (5 μl) of tranεlations carried out in the presence of [³⁵S]methionine were analyzed by electrophoresiε in SDS-7.5% polyacrylamide gelε and autoradiography. Non-radiolabeled translation products were assayed for ability to form protein-adenylate complexes after removal of ATP by chromatography through spun 1 ml columnε of Sephadex G50 (Pharmacia) equilibrated with TE.

Example 6 DNA ligase assays

5 μl εampleε from in vitro translationε were adenylylated in reaction mixtures (30 μl) containing 60 mM Triε HCI (pH 8.0), 10 mM MgCl₂, 50 μg ml^"1 BSA, 5 mM DTT and 1 μCi [αr³²P] ATP (3000 Ci mmol¹, Amersham) at 20°C for 10 minuteε and then analyzed by electrophoreεiε in SDS-7.5% polyacrylamide gelε and autoradiography. In order to monitor transfer of [³²P]AMP from protein-adenylate to a nicked DNA substrate, 5 μl samples from adenylylation reactions were incubated for further time periods with or without the addition of 500 ng non-radiolabeled oligo(dT)₁₆-poly(dA), as described previously. The ability to tranεfer [³P]AMP from enzyme-adenylate to the hybrid εubεtrateε, oligo(dT)-poly(rA) or oligo(rA)-poly(dT), differentiateε DNA ligase I, II and III. However, both these latter substrateε were rapidly degraded by an RNase H activity upon incubation in the reticulocyte lyεate, even when mixtureε were used directly without termination of translation reactions by addition of RNase A.

Example 7 Expresεion of DNA Liσaεe III via Gene Therapy

Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tisεue are placed on a wet surface of a tissue culture flask, approximately ten pieceε are placed in each flaεk. The flaεk iε turned upεide down, cloεed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin, iε added. This is then incubated at 37°C for approximately one week. At this time, fresh media is added and subεequently changed every εeveral dayε. After an additional two weekε in culture, a monolayer of fibroblasts emerge. The monolayer is trypεinized and εcaled into larger flaεks.

Moloney murine leukemia virus is digested and treated with calf intestinal phosphataεe. The linear vector iε fractionated on agarose gel and purified, using glass beadε.

The DNA Ligaεe III cDNA (see Figure 1), iε iεolated and the endε of this fragment are treated with DNA polymerase in order to fill in the recessed ends and create blunt ends.

Equal quantities of the Moloney murine leukemia viruε linear backbone and the gene are added together, in the presence of T4 DNA ligase. The resulting mixture is maintained under conditionε appropriate for ligation of the two fragmentε. The ligation mixture waε used to transform bacteria HBlOl, which were then plated onto agar-containing kanamycin for the purpose of confirming that the vector had the DNA Ligase III gene properly inserted.

PE501 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagleε Medium (DMEM) with 10% calf serum (CS), penicillin and streptomycin. The Moloney murine leukemia virus vector containing the gene is then added to the media and the packaging cellε are transduced with the vector. The packaging cellε now produce infectiouε viral particleε containing the DNA Ligase III gene.

Fresh media is added to the transduced producer cells, and subsequently the media is harvested from a 10 cm plate of confluent producer cellε. The spent media, containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells. Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells.

The engineered fibroblastε are then injected into the into a host, for example, a rat, either alone or after having been grown to confluence on cytodex 3 microcarrier beads. The fibroblasts now produce the protein product and the biological actions of DNA Ligase III are conveyed to the host.

Numerous modifications and variations of the present invention are posεible in light of the above teachingε and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly described. SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: WEI, ET AL.

(ii) TITLE OF INVENTION: Human DNA Ligase III (iii) NUMBER OF SEQUENCES: 9 (iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN,

CECCHI, STEWART & OLSTEIN

(B) STREET: 6 BECKER FARM ROAD

(C) CITY: ROSELAND

(D) STATE: NEW JERSEY

(E) COUNTRY: USA

(F) ZIP: 07068

(V) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: 3.5 INCH DISKETTE

(B) COMPUTER: IBM PS/2

(C) OPERATING SYSTEM: MS-DOS

(D) SOFTWARE: WORD PERFECT 5.1

(Vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE: Concurrently

(C) CLASSIFICATION:

(Vii) PRIOR APPLICATION DATA

(A) APPLICATION NUMBER:

(B) FILING DATE:

(Viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: FERRARO, GREGORY D.

(B) REGISTRATION NUMBER: 36,134

(C) REFERENCE/DOCKET NUMBER: 325800-314

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 201-994-1700

(B) TELEFAX: 201-994-1744

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 3417 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l

CCACGCGTCC GGCAGCCTGT ATGAGCAAGT GCCGAGGCCT ACGGTGAGCG CCGGAGCCGG 60 AGAGGCAGCT ATATGTCTTT GGCTTTCAAG ATCTTCTTTC CACAAACCCT CCGTGCACTC 120 AGCCGAAAAG AACTGTGCCT ATTCCGAAAA CATCACTGGC GTGATGTAAG ACAATTCAGC 180 CAGTGGTCAG AAACAGATCT GCTTCATGGA CATCCCCTCT TCCTGAGAAG AAAGCCTGTT 240 C ATCAT CC AGGGAΛGCCA TCTAAGATCλ CGTGCCACCT ACCTTGTTTT CTTGCCAGGG 300 TTGCATGTGG GACTCTGCAG TGGCCCCTGT GAGATGGCTG AGCAACGGTT CTGTGTGGAC 360 TATGCCAAGC GTGGCACAGC TGGCTGCAAA AAATGCAAGG AAAAGATTGT GAAGGGCGTA 420 TGCCGAATTG GCAAAGTGGT GCCCAATCCC TTCTCAGAGT CTGGGGGTGA TATGAAAGAG 480 TGGTACCACA TTAAATGCAT GTTTGAGAAA CTAGAGCGGG CCCGGGCCAC CACAAAAAAA 540 ATCGAGGACC TCACAGAGCT GGAAGGCTGG GAAGAGCTGG AAGATAATGA GAAGGAACAG 600 ATAACCCAGC ACATTGCAGA TCTGTCTTCT AAGGCAGCAG GTACACCAAA GAAGAAAGCT 660 GTTGTCCAGG CTAAGTTGAC AACCACTGGC CAGGTGACTT CTCCAGTGAA AGGCGCCTCA 720 TTTGTCACCA GTACCAATCC CCGGAAATTT TCTGGCTTTT CAGCCAAGCC CAACAACTCT 780 GGGGAAGCCC CCTCGAGCCC CACCCCTAAG AGAAGTCTGT CTTCAAGCAA ATGTGACCCC 840 AGGCATAAGG ACTGTCTGCT ACGGGAGTTT CGAAAGTTAT GCGCCATGGT GGCCGATAAT 900 CCTAGCTACA ACACGAAGAC CCAGATCAGC CAGGACTTCC TTCGGAAAGG CTCAGCAGGA 960 GATGGTTTCC ACGGTGATGT GTACCTAACA GTGAAGCTGC TGCTGCCAGG AGTCATTAAG 1020 AC GTTTACA ACTTGAACGA TAAGCAGATT GTGAAGCTTT TCAGTCGCAT TTTTAACTGC 1080 AACCCAGATG ATATGGCACG GGACCTAGAG CAGCGTGACG TGTCAGAGAC AATCAGAGTC 1140 TTCTTTGAGC AGAGCAAGTC TTTCCCCCCA GCTGCCAAGA GCCTCCTTAC CATCCAGGAA 1200 GTGGATGAGT TCCTTCTGCG GCTGTCCAAG CTCACCAAGG AGGATGAGCA GCAACAGGCC 1260 CTACAGCACA TTGCCTCCAG GTGTACAGCC AATGACCTTA AATGCATCAT CAGGTTGATC 1320 AAACATGATC TGAAGATGAA CTCAGGTGCA AAACATGTGT TAGACGCCCT TGACCCCAAT 1380 GCCTATGAAG CCTTCAAAGC CTCGCGCAAC CTGCAGGATG TGGTGGAGCG GGTCCTTCAC 1440 AACGCGCAGG AGGTGGAGAA GGAGCCGGGC CAGAGACGAG CTCTGAGCGT CCAGGCCTCG 1500 CTGATGACAC CTGTGCAGCC CATGTTGGCG GAGGCCTGCA AGTCCGTTGA GTATGCAATG 1560 AAGAAATGTC CCAATGGCAT GTTCTCTGAG ATCAAGTACG ATGGAGAGCG AGTCCAGGTG 1620 CATAAGAATG GAGACCACTT CAGCTACTTC AGCCGCAGTC TCAAGCCCGT CCTTCCTCAC 1680 AAGGTGGCCC ACTTTAAGGA CTACATTCCC CAGGCTTTTC CTGGGGGCCA CAGCATGATC 1740 TTGGATTCTG AAGTGCTTCT GATTGACAAC AAGACAGGCA AACCACTGCC CTTTGGGACT 1800 CTGGGAGTCA CACCGAAAGC AGCCTTCCAG GATGCTAATG TCTGCCTGTT TGTTTTTGAT 1860 TGTATCTACT TTAATGATGT CAGCTTGATG GACAGACCTC TGTGTGAGCG GCGGAAGTTT 1920 CTTCATGACA ACATGGTTGA AATTCCAAAC CGGATCATGT TCTCAGAAAT GAAGCGAGTC 1980 ACAAAAGCTT TGGACTTGGC TGACATGATA ACCCGGGTGA TCCAGGAGGG ATTGGAGGGG 2040 CTGGTGCTGA AGGATGTGAA GGGTACATAT GAGCCTGGGA AGCGGCACTG GCTGAAAGTG 2100 AAGAAAGACT ATTTGAACGA GGGGGCCATG GCCGACACAG CTGACCTGGT GGTCCTTGGA 2160 GCCTTCTATG GGCAAGGGAG CAAAGGCGGC ATGATGTCAA TCTTCCTCAT GGGCTGCTAC 2220 GACCCTGGCA GCCAGAAGTG GTGCACAGTC ACCAAGTGTG CAGGAGGCCA TGATGATGCC 2280 ACGCTTGCCC GCCTGCAGAA TGAACTAGAC ATGGTGAAGA TCAGCAAGGA CCCCAGCAAA 2340 ATACCCAGCT GGTTGAAGGT CAACAAGATC TACTATCCTG ACTTCATCGT CCCAGACCCA 2400 AAGAAAGCTG CCGTGTGGGA GATCACAGGG GCTGAATTCT CCAAATCGGA GGCTCATACA 2460 GCTGACGGGA TCTCCATCCG ATTCCCTCGC TGCACCCGAA TCCGAGATGA TAAGGACTGG 2520 AAATCTGCCA CTAACCTTCC CCAACTCAAG GAACTGTACC AGTTGTCCAA GGAGAAGGCA 2580 GACTTCACTG TAGTGGCTGG AGATGAGGGG AGCTCCACTA CAGGGGGTAG CAGTGAAGAG 2640 AATAAGGGTC CCTCAGGGTC TGCTGTGTCC CGCAAGGCCC CCAGCAAGCC CTCAGCCAGT 2700 ACCAAGAAAG CAGAAGGGAA GCTGAGTAAC TCCAACAGCA AAGATGGCAA CATGCAGACT 2760 GCAAAGCCTT CCGCTATGAA GGTGGGGGAG AAGCTGGCCA CAAAGTCTTC TCCAGTGAAA 2820 GTAGGGGAGA AGCGGAAAGC TGCTGATGAG ACGCTGTGCC AAACAAAGGT ATTGCTGGAC 2880 ATCTTCACTG GGGTGCGGCT TTACTTGCCA CCCTCCACAC CAGACTTCAG CCGTCTCAGA 2940 CGCTACTTTG TGGCATTCGA CGGGGACCTG GTACAGGAAT TTGATATGAC TTCAGCCACG 3000 CACGTGCTGG GTAGCAGGGA CAAGAACCCT GCGGCCCAGC AGGTCTCCCC AGAGTGGATT 3060 TGGGCATGTA TCCGGAAACG GAGACTGGTA GCTCCCTGCT AGGTTTGCTG TCTTCCCTCT 3120 CCCTCAGGCC ATACTCTCCT TTACCATACT ATTGGACTGG ACTCAGGCTG GAGGCAGATA 3180 GACACAGTAT AGGGGGAATG GGCTTGCTTC TCCCAAACCC ACCAGTTCTC CACTGTCTCT 3240 TCTGGACCAG GAATTAGTTG CTGTGGGTGC CACAGCTGAA GTCAGTTTGT CTTGCTGGTT 3300 TAAATAGATC TTTCAGAGCT GGGTGCTGGG TTTGCCATCT TTTTGTTTTC TTTGAAAAGC 3360 AGCTTAGTTA CCCTTTTTAT AAATAAAATA TCTTGCAGTT AAAAAAAAAA AAAAAAA 3417 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 922 AMINO ACIDS

(B) TYPE: AMINO ACID

(C) STRANDEDNESS:

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: PROTEIN

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Met Ala Glu Gin Arg Phe Cys Val Asp Tyr Ala Lys Arg Gly Thr

5 10 15

Ala Gly Cys Lyε Lys Cys Lyε Glu Lyε lie Val Lyε Gly Val Cyε

20 25 30

Arg lie Gly Lyε Val Val Pro Asn Pro Phe Ser Glu Ser Gly Gly

35 40 45

Asp Met Lys Glu Trp Tyr His lie Lys Cys Met Phe Glu Lyε Leu

50 55 60

Glu Arg Ala Arg Ala Thr Thr Lys Lys lie Glu Asp Leu Thr Glu

65 70 75

Leu Glu Gly Trp Glu Glu Leu Glu Asp Asn Glu Lys Glu Gin lie

80 85 90

Thr Gin His lie Ala Asp Leu Ser Ser Lys Ala Ala Gly Thr Pro

95 100 105

Lys Lys Lys Ala Val Val Gin Ala Lys Leu Thr Thr Thr Gly Gin

110 115 120

Val Thr Ser Pro Val Lys Gly Ala Ser Phe Val Thr Ser Thr Aεn

124 130 135

Pro Arg Lyε Phe Ser Gly Phe Ser Ala Lyε Pro Aεn Aεn Ser Gly

140 145 150

Glu Ala Pro Ser Ser Pro Thr Pro Lyε Arg Ser Leu Ser Ser Ser

155 160 165

Lyε Cyε Asp Pro Arg His Lyε Asp Cys Leu Leu Arg Glu Phe Arg

170 175 180

Lyε Leu Cys Ala Met Val Ala Asp Asn Pro Ser Tyr Asn Thr Lys

185 190 195

Thr Gin lie lie Gin Asp Phe Leu Arg Lys Gly Ser Ala Gly Asp

200 205 210

Gly Phe His Gly Asp Val Tyr Leu Thr Val Lys Leu Leu Leu Pro

215 220 225

Gly Val lie Lys Thr Val Tyr Asn Leu Asn Aεp Lyε Gin lie Val

230 235 240

Lys Leu Phe Ser Arg lie Phe Asn Cyβ Asn Pro Asp Asp Met Ala

245 250 255

Arg Asp Leu Glu Gin Gly Asp Val Ser Glu Thr lie Arg Val Phe

260 265 270

Phe Glu Gin Ser Lys Ser Phe Pro Pro Ala Ala Lyε Ser Leu Leu

275 280 285

Thr lie Gin Glu Val Asp Glu Phe Leu Leu Arg Leu Ser Lyε Leu

290 295 300

Thr Lyε Glu Aεp Glu Gin Gin Gin Ala Leu Gin Aεp lie Ala Ser

305 310 315 Arg Cyε Thr Ala Aεn Aεp Leu Lyε Cyε lie lie Arg Leu lie Lyε

320 325 330

Hiε Asp Leu Lyε Met Aεn Ser Gly Ala Lyε His Val Leu Asp Ala

335 340 345

Leu Asp Pro Asn Ala Tyr Glu Ala Phe Lys Ala Ser Arg Asn Leu

350 355 360

Gin Asp Val Val Glu Arg Val Leu His Asn Ala Gin Glu Val Glu

365 370 375

Lys Glu Pro Gly Gin Arg Arg Ala Leu Ser Val Gin Ala Ser Leu

380 385 390

Met Thr Pro Val Gin Pro Met Leu Ala Glu Ala Cys Lys Ser Val

395 400 405

Glu Tyr Ala Met Lys Lys Cys Pro Asn Gly Met Phe Ser Glu lie

410 415 420

Lys Tyr Asp Gly Glu Arg Val Gin Val His Lys Asn Gly Asp His

425 430 435

Phe Ser Tyr Phe Ser Arg Ser Leu Lys Pro Val Leu Pro His Lyε

440 445 450

Val Ala His Phe Lyε Asp Tyr lie Pro Gin Ala Phe Pro Gly Gly

455 460 465

Hiε Ser Met lie Leu Aεp Ser Glu Val Leu Leu lie Aεp Aεn Lyε

470 475 480

Thr Gly Lyε Pro Leu Pro Phe Gly Thr Leu Gly Val Hiε Lys Lyε

485 490 495

Ala Ala Phe Gin Asp Ala Asn Val Cys Leu Phe Val Phe Asp Cys

500 505 510 lie Tyr Phe Asn Aεp Val Ser Leu Met Aεp Arg Pro Leu Cys Glu

515 520 525

Arg Arg Lys Phe Leu Hiε Aβp Aεn Met Val Glu lie Pro Aεn Arg

530 535 540 lie Met Phe Ser Glu Met Lys Arg Val Thr Lyε Ala Leu Aεp Leu

545 550 555

Ala Asp Met lie Thr Arg Val lie Gin Glu Gly Leu Glu Gly Leu

560 565 570

Val Leu Lyε Aεp Val Lys Gly Thr Tyr Glu Pro Gly Lyε Arg Hiε

575 580 585

Trp Leu Lys Val Lyε Lyε Aεp Tyr Leu Aεn Glu Gly Ala Met Ala

590 595 600

Aεp Thr Ala Aεp Leu Val Val Leu Gly Ala Phe Tyr Gly Gin Gly

605 610 615

Ser Lyε Gly Gly Met Met Ser lie Phe Leu Met Gly Cyε Tyr Aεp

620 625 630

Pro Gly Ser Gin Lyε Trp Cys Thr Val Thr Lys Cyε Ala Gly Gly

635 640 645

Hiε Aεp Aεp Ala Thr Leu Ala Arg Leu Gin Aεn Glu Leu Aεp Met

650 655 660

Val Lyε lie Ser Lyε Aεp Pro Ser Lyε lie Pro Ser Trp Leu Lyε

665 670 675

Val Aεn Lyε lie Tyr Tyr Pro Asp Phe lie Val Pro Asp Pro Lys

680 685 690

Lys Ala Ala Val Trp Glu He Thr Gly Ala Glu Phe Ser Lyε Ser

695 700 705

Glu Ala Hiε Thr Ala Asp Gly He Ser He Arg Phe Pro Arg Cyε 710 715 720 Thr Arg He Arg Asp Aεp Lyε Aεp Trp Lyε Ser Ala Thr Aεn Leu

725 730 735 Pro Gin Leu Lyε Glu Leu Tyr Gin Leu Ser Lys Glu Lys Ala Asp

740 745 750

Phe Thr Val Val Ala Gly Asp Glu Gly Ser Ser Thr Thr Gly Gly

755 760 765 Ser Ser Glu Glu Asn Lys Gly Pro Ser Gly Ser Ala Val Ser Arg

770 775 780

Lys Ala Pro Ser Lys Pro Ser Ala Ser Thr Lys Lys Ala Glu Gly

785 790 795

Lyε Leu Ser Aεn Ser Aεn Ser Lyε Aεp Gly Aεn Met Gin Thr Ala

800 805 810

Lyε Pro Ser Ala Met Lyε Val Gly Glu Lyε Leu Ala Thr Lyε Ser

815 820 825 Ser Pro Val Lyε Val Gly Glu Lys Arg Lys Ala Ala Asp Glu Thr

830 835 840

Leu Cys Gin Thr Lyε Val Leu Leu Asp He Phe Thr Gly Val Arg

845 850 855

Leu Tyr Leu Pro Pro Ser Thr Pro Asp Phe Ser Arg Leu Arg Arg

860 865 870

Tyr Phe Val Ala Phe Asp Gly Asp Leu Val Gin Glu Phe Aεp Met

875 880 885

Thr Ser Ala Thr Hiε Val Leu Gly Ser Arg Asp Lys Asn Pro Ala

890 895 900

Ala Gin Gin Val Ser Pro Glu Trp He Trp Ala Cys He Arg Lys

905 910 915 Arg Arg Leu Val Ala Pro Cys

920

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 29 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

CGCGGATCCA TGGCTGAGCA ACGGTTCTG 29

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 27 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

GCGTCTAGAC TAGCAGGGAG CTACCAG 27

(2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 29 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

CGCGAATCCA TGGCTGAGCA ACGGTTCTG 29

(2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 27 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

GCGTCTAGAC TAGCAGGGAG CTACCAG 27

(2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 29 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

CGCGAATCCA TGGCTGAGCA ACGGTTCTG 29

(2) INFORMATION FOR SEQ ID NO:8:

(i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 56 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR (ii) MOLECULE TYPE: Oligonucleotide ( i) SEQUENCE DESCRIPTION: SEQ ID NO:8:

GCGTCTAGAT CAAGCGTAGT CTGGGACGTC GTATGGGTAG CAGGGAGCTA CCAGTC 56

(2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 21 AMINO ACIDS

(B) TYPE: AMINO ACID

(C) STRANDEDNESS:

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: PEPTIDE

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

Lyε Cys Pro Aεn Gly Met Phe Ser Glu He Lyε Tyr Aεp Gly Glu

5 10 15

Arg Val Gin Val Hiε Lys

20

Claims

WHAT IS CLAIMED IS:

1. An isolated polynucleotide comprising a member selected from the group consisting of:

(a) a polynucleotide encoding the polypeptide comprising amino acid 1 to amino acid 922 of SEQ ID No. 2;

(b) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a) ,* and

(c) a polynucleotide fragment of the polynucleotide of (a) or (b) .

2. The polynucleotide of claim 1 encoding the polypeptide comprising amino acid 1 to amino acid 922 as set forth in SEQ ID No. 2.

3. The polynucleotide of Claim 1 wherein the polynucleotide is DNA.

4. The polynucleotide of Claim 1 wherein the polynucleotide is RNA.

5. The polynucleotide of Claim l wherein the polynucleotide is genomic DNA.

6. The polynucleotide of Claim 1 comprising from nucleotide l to nucleotide 3417 of SEQ ID No. 1.

7. The polynucleotide of claim 1 comprising from nucleotide 73 to nucleotide 3099 of SEQ ID No. 1.

8. The polynucleotide of claim 1 comprising from nucleotide 78 to nucleotide 3099 of SEQ ID No. 1.

9. The polynucleotide of claim 1 comprising from nucleotide 334 to nucleotide 3099 of SEQ ID No. 1.

10. The polynucleotide of claim 3 encoding the polypeptide comprising amino acid 1 to amino acid 922 as set forth in SEQ ID No. 2.

11. An isolated polynucleotide comprising a member selected from the group consisting of:

(a) a polynucleotide encoding the polypeptide having the amino acid sequence expressed by the DNA contained in ATCC Deposit No. 97052,*

(b) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a) ; and

(c) a polynucleotide fragment of the polynucleotide of (a) or (b) .

12. The polynucleotide of Claim 11 wherein said polynucleotide encodes a polypeptide having the amino acid sequence expressed by the DNA contained in ATCC Deposit No. 97052.

13. A vector containing the DNA of Claim 2.

14. A host cell genetically engineered with the vector of Claim 13.

15. A process for producing a polypeptide comprising: expressing from the host cell of Claim 14 the polypeptide encoded by said DNA.

16. A process for producing cells capable of expressing a polypeptide comprising genetically engineering cells with the vector of Claim 13.

17. A polypeptide selected from the group consisting of: (i) a polypeptide having the deduced amino acid sequence of SEQ ID No. 2 and fragments, analogs and derivatives thereof; and (ii) a polypeptide encoded by the DNA of ATCC Deposit No. 97052 and fragments, analogs and derivatives of said polypeptide.

18. The polypeptide of Claim 14 wherein the polypeptide comprises amino acid 1 to amino acid 922 of SEQ ID No. 2.

19. An antibody against the polypeptide of claim 17.

20. An antagonist against the polypeptide of claim 17.

21. A method for the treatment of a patient having need of DNA Ligase III activity comprising: administering to the patient a therapeutically effective amount of the polypeptide of claim 17 by providing to the patient DNA encoding said polypeptide and expressing said polypeptide in vivo.

22. A method for the treatment of a patient having need to inhibit DNA Ligase III comprising: administering to the patient a therapeutically effective amount of the antagonist of Claim 20.

23. The method of claim 22 wherein said antagonist is administered by providing to the patient DNA encoding said antagonist and expressing said antagonist in vivo.

24. A method or identifying antagonists and agonists comprising: combining DNA Ligase III, DNA having single-strand breaks and a compound to be screened under conditions where the single-strand break would normally be repaired by the DNA Ligase III; and determining if the compound enhances or blocks the repair.

25. A method for diagnosing abnormal cellular proliferation or a susceptibility to abnormal cellular proliferation in a patient comprising: detecting in a sample derived from a host a nutation in the nucleic acid sequence of claim 1.