EP0795006A1 - HUMAN MutT2 - Google Patents

Abstract

A human hMutT2 polypeptide and DNA (RNA) encoding such polypeptide and a procedure for producing such polypeptide by recombinant techniques is disclosed. Also disclosed are methods for utilizing such polypeptide for hydrolyzing and eliminating oxidized guanine nucleotides from the nucleotide pool to ensure correct DNA synthesis. Diagnostic assays are also disclosed which detect the presence of a mutated form of hMutT2 and over-expression of the hMutT2 protein.

Description

HUMAN MutT2

This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is human MutT2, sometimes hereinafter referred to as "hMutT2. " The invention also relates to inhibiting the action of such polypeptides.

Errors in DNA replication lead to spontaneous mutations. Elevated spontaneous mutations lead directly to abnormal cell growth and disorders, such as tumors. A certain portion of spontaneous mu agenesis is caused by endogenous free radicals which are generated by normal cellular metabolism. The free radicals cause oxidative damage to DNA and may be an important determinant in longevity (Ames, B.N. and Gold, .S., Mutat. Res., 250:3-16 (1991)) .

Oxygen radicals damage chromosomal DNA, causing cell death and inducing mutations. One type of DNA damage caused by oxygen radicals is an oxidized form of the guanine base (8-oxoguanine) (Shibutani, S., et al. , Nature, 349:431-4 (1991) ) . This oxidized orm of guanine can pair with cytosine and adenine, and G:C to T:A transversions follow (T eshelashvili, L.K., et al . , J. Biol. Chem. , 266:6401-6406 (1991)). Thus, active oxygen species produced by cellular metabolic intermediates are sufficient to oxidize the guanine base of the DNA, even in normally growing cells.

Oxidation of guanine proceeds also in a form of free nucleotide, and an oxidized form of dGTP, 8-oxo-dGTP, is a potent mutagenic substrate for DNA synthesis (Maki, H. and Sekiguchi, M., Nature, 355:273-275 (1992)). In contrast with the consequence of 8-oxoguanine arising in DNA, 8-oxo-dGTP can induce A:T to C:G as well as G:C to T:A transversions (Cheng, K.C., et al . , J. Biol. Chem. , 267:166-172 (1992)).

In E. coli there are mechanisms that prevent mutations caused by oxidation of the guanine base in both DNA and free nucleotide forms. Oxidized DNA is repaired by the MutM protein, which possesses activity to remove the 8-oxoguanine base from the damaged DNA. On the other hand, 8-oxo-dGTP can be eliminated from the nucleotide pool by the mutT protein, which hydrolyses the mutagenic nucleotide to 8-oxo-dGMP (Maki, H. and Sekiguchi, M. , Nature, 355:273-275 (1992)). In the mutT mutant, 8-oxo-dGMP miεincorporated opposite to dA residues of template may be removed by the mutM protein before the next round of DNA replication. The mutT protein, therefore, degrades the potent mutagenic substrate, 8-oxo- dGTP to the harmless monophosphate substrate to ensure proper DNA synthesis. Mutations in the E. coli mutT gene cause an increase of the occurrence of A:T to C:G transversions 100- 10,000-fold over the wild-type level (Akiyama, M. , et al . , Mol. and Gen. Genet., 206:9-16 (1987)).

Eukaryotes and mammals also have an enzyme which hydrolyses oxidized nucleotides. The enzyme is homologous to the E. coli mutT gene. A significant amount of 8-oxoguanine is formed in the chromosome DNA of mammalian cells and most of the damaged nucleotides are excised from the DNA and excreted into the urine (Ames, B.N. and Gold, L.S., Mutat. Res., 250:3-16 (1991) and Shigenaga, M.K., et al . , PNAS, 86:9697-9701 (1989)) . The spontaneous oxidation of dGTP forms 8-oxo-dGTP which can be inserted opposite dA and dC residues of template PNA with almost equal efficiency, and the mutT protein specifically degrades 8-oxo-dGTP to the monophosphate. Thus, elimination of the oxidized form of guanine nucleotide from a nucleotide pool is importεmt for the high fidelity of DNA synthesis.

The polypeptide of the present invention corresponds in size and amino acid sequence homology to human MutT and has, therefore, been preliminarily characterized as human MutT2.

In accordance with one aspect of the present invention, there is provided a novel mature polypeptide which is hMutT2, as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.

In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules encoding hMutT2, including mRNAs, DNAs, cDNAs, genomic DNA as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.

In accordance with yet a further aspect of the present invention, there is provided a process for producing such polypeptide by recombinant techniques which comprises culturing recombinant prokaryotic and/or eukaryotic host cells, containing a hMutT2 nucleic acid sequence, under conditions promoting expression of said protein and subsequent recovery of said protein.

In accordance with yet a further aspect of the present invention, there is provided a process for utilizing such polypeptide, or polynucleotide encoding such polypeptide for therapeutic purposes, for example, to prevent and treat diseases associated with errors in DNA replication and abnormal cell growth, for example that present in a tumor and a cancer, by specifically hydrolyzing oxidized nucleoside triphosphates, in particular, 8-oxo-dGTP, to the corresponding monophosphate for high fidelity of DNA synthesis.

In accordance with another aspect of the present invention there are provided nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to hMutT2 sequences.

In accordance with yet a further aspect of the present invention, there are provided antibodies against such polypeptides.

In accordance with another aspect of the present invention there is provided a method of diagnosing a disease or a susceptibility to a disease, for example, abnormal cellular growth, related to a mutation in hMutT2 nucleic acid sequences and the protein encoded by such nucleic acid sequences.

In accordance with yet another aspect of the present invention, there are provided antagonists to such polypeptides, which may be used to inhibit the action of such polypeptides, for example, in the treatment of tumors.

In accordance with yet a further aspect of the present invention, there is provided a process for utilizing such polypeptides, or polynucleotides encoding such polypeptides, for in vi tro purposes related to scientific research, synthesis of DNA and manufacture of DNA vectors.

These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.

The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.

Figure 1 shows the cDNA sequence and the corresponding deduced amino acid sequence of hMutT2 polypeptide. The standard one-letter abbreviation for amino acids are used. Figure 2 illustrates the amino acid homology between E. coli MutT, human MutTl and hMutT2, wherein the shaded areas represent amino acid residues which are the same between the different sequences. hMutT2 of the present invention has a higher amino acid homology to E. coli MutT than human MutTl.

Figure 3 is an illustration of a gel after bacterial expression and purification of hMutT2, wherein hMutT2 is electrophoresed through the gel. Lane 1 is a molecular weight marker, lane 2 is an E. coli. extract, noninduced, lane 3 is an E. coli extract, IPTG-induced and lane 4 is a nickel column purified example of lane 3. Two protein bands were induced in lane 3 and 4 with molecular weight 34 kD and 31 kD with the 31 kD protein being presumably the degradation product of the 34 kD human MutT2.

Figure 4 is a gel showing human tissue distribution of hMutT2. Lane 1, thymus; lane 2, testis; lane 3, gall bladder; lane 4, kidney,- lane 5, liver; lane 6, lung; lane 7, spleen; lane 8, prostate; lane 9, brain; lane 10, heart; lane 11, placenta. hMutT2 is ubiquitously expressed in most human tissues.

In accordance with an aspect of the present invention, there are provided isolated nucleic acids (polynucleotide) which encode for the mature polypeptide having the deduced amino acid sequence of Figure 1 or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75882 on August 31, 1994.

A polynucleotide encoding a polypeptide of the present invention may be obtained from most human tissues, such as thymus, liver, spleen and prostate. The polynucleotide of this invention was discovered in a cDNA library derived from a human 8 week old embryo. It is structurally related to the hMutT family. It contains an open reading frame encoding a protein of 219 amino acid residues. The protein exhibits the highest degree of homology to E.coli MutT with 62% identity and 77% similarity over a 27 amino acid stretch. It is also important that GETXE and RELQ/EEE are conserved among E.coli MutT, human MutTl and hMutT2.

The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 or the deposited cDNA.

The polynucleotide which encodes for the mature polypeptide of Figure 1 or for the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non- coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.

Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.

The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone. The variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.

Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.

As hereinabove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 or of the coding sequence of the deposited clone. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.

The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention. The marker sequence may be a hexa- histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).

The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 50% and preferably 70% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNA of Figure 1 or the deposited cDNA.

The deposit(s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. §112. The sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.

The present invention further relates to a hMutT2 polypeptide which has the deduced amino acid sequence of Figure 1 or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.

The terms "fragment, " "derivative" and "analog" when referring to the polypeptide of Figure 1 or that encoded by the deposited cDNA, means a polypeptide which retains essentially the same biological function or activity as such polypeptide.

The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.

The fragment, derivative or analog of the polypeptide of Figure 1 or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) , or (iv) one in which the additional amino acids are fused to the mature polypeptide. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.

The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.

The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) . For example, a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.

The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.

Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the hMutT2 genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

The polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmidε; phage DNA; baculovirus; yeast plaεmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenoviruε, fowl pox virus, and pseudorabies. However, any other vector may be used as long as it is replicable and viable in the host.

The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.

The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence (s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or. trp. the phage lambda P_L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. Tne vector may also include appropriate sequences for amplifying expression.

In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.

The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.

As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli. Streptomyces. Salmonella typhimurium; fungal cells, such as yeast; insect cells such as Drosophila S2 and Sf9; animal cells such as CHO, COS or Bowes melanoma,- adenoviruses,- plant cells, etc. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.

More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen) , pBS, pDIO, phagescript, psiX174, pBluescript SK, pBSKS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene) ; ptrc99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) . However, any other plasmid or vector may be used as long as they are replicable and viable in the host.

Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are pKK232-8 and pCM7. Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P_R, P_L and trp. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.

In a further embodiment, the present invention relates to host cells containing the above-described constructs. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation. (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986) ) .

The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.

Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al. , Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.

Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK) , α-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.

Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts for transformation include E. coli. Bacillus subtilis. Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyceε, and Staphylococcus, although others may alεo be erφloyed aε a matter of choice.

As a representative but nonlimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017) . Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA) . These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.

Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.

Cells are typically harvested by centrifugation, diεrupted by phyεical or chemical meanε, and the reεulting crude extract retained for further purification.

Microbial cells employed in expression of proteinε can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.

Various mammalian cell culture syεtemε can alεo be employed to express recombinant protein. Exampleε of mammalian expreεsion systems include the COS-7 lines of monkey kidney fibroblaεtε, deεcribed by Gluzman, Cell, 23:175 (1981) , and other cell lineε capable of expreεεing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lineε. Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor siteε, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation siteε may be used to provide the required nontranscribed genetic elements.

The hMutT2 polypeptides can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.

The hMutT2 polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniqueε from a prokaryotic or eukaryotic hoεt (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture) . Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include an initial methionine amino acid residue.

The hMutT2 polypeptides and agonists and antagonists which are polypeptides may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which iε often referred to aε "gene therapy." Thus, for example, cellε from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide. Such methods are well-known in the art. For example, cells may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.

Similarly, cells may be engineered in vivo for expresεion of a polypeptide in vivo by, for example, procedureε known in the art. Aε known in the art, a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the preεent invention may be adminiεtered to a patient for engineering cellε in vivo and expression of the polypeptide in vivo. These and other methods for administering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the present invention. For example, the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.

Once the hMutT2 polypeptide is being expreεεed intra- cellularly via gene therapy, it hydrolyses the oxidized form of nucleoside triphoεphates and haε a εtrong affinity for the oxidized form of guanine nucleotide, therefore eliminating them from the nucleotide pool and ensuring the high fidelity of DNA synthesiε. In the abεence of the hMutT2 polypeptide, there would be a significant increase in errors in DNA replication which would lead to mutagenesiε. Mutageneεiε iε known to cause numerous disorders, including abnormal cell growth, for example that present in a tumor and a cancer. Accordingly, administration of the polypeptide of the present invention may be uεed to treat or prevent mutageneεiε. In accordance with yet a further aspect of the present invention, there is provided a procesε for utilizing such polypeptides, or polynucleotides encoding such polypeptides, for in vi tro purposes related to scientific research, synthesis of DNA and manufacture of DNA vectors.

Fragments of the full length hMutT2 gene may be used as a hybridization probe for a cDNA library to isolate the full length gene and to isolate other genes which have a high sequence similarity to the gene or similar biological activity. Probes of this type can be, for example, between 20 and 2000 bases. Preferably, however, the probes have between 30 and 50 base pairs. The probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete hMutT2 gene including regulatory and promotor regions, exons, and intronε. An example of a screen comprises isolating the coding region of the hMutT2 gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.

Thiε invention iε alεo related to the use of the hMutT2 gene aε part of a diagnostic asεay for detecting diseases or susceptibility to diseaseε related to the presence of mutated hMutT2. Such diseases are related to errors in DNA replication, for example, such as those which lead to tumorε and cancers.

Individualε carrying rautationε in the hMutT2 gene may be detected at the DNA level by a variety of techniques. Nucleic acids for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tisεue biopsy and autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by uεing PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to analyεis. RNA or cDNA may also be used for the same purpose. As an example, PCR primers complementary to the nucleic acid encoding hMutT2 can be used to identify and analyze hMutT2 mutations. For example, deletions and insertionε can be detected by a change in εize of the amplified product in compariεon to the normal genotype. Point mutationε can be identified by hybridizing amplified DNA to radiolabeled hMutT2 RNA or alternatively, radiolabeled hMutT2 antiεense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.

Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragmentε in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high reεolution gel electrophoreεiε. DNA fragmentε of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragmentε are retarded in the gel at different poεitions according to their specific melting or partial melting temperatures (see, e.g., Myers et al . , Science, 230:1242 (1985)).

Sequence changes at specific locations may also be revealed by nuclease protection assays, such aε RNase and SI protection or the chemical cleavage method (e.g., Cotton et al . , PNAS, USA, 85:4397-4401 (1985)).

Thuε, the detection of a εpecific DNA εequence may be achieved by methodε εuch aε hybridization, RNaεe protection, chemical cleavage, direct DNA εequencing or the use of restriction enzymes, (e.g., Restriction Fragment Length Polymorphiεms (RFLP) ) and Southern blotting of genomic DNA.

In addition to more conventional gel-electrophoresis and DNA εequencing, mutationε can alεo be detected by in situ analyεiε. The present invention also relates to a diagnostic assay for detecting altered levels of hMutT2 protein in various tissues εince an over-expression of the proteins compared to normal control tissue samples may detect the presence of a diseaεe or εuεceptibility to a diεeaεe related to errorε in DNA replication, for example, a tumor. Assays used to detect levels of hMutT2 protein in a sample derived from a host are well-known to those of skill in the art and include radioimmunoassayε, competitive-binding assays, Western Blot analysis, ELISA assays and "sandwich" assay. An ELISA assay (Coligan, et al., Current Protocolε in Immunology, 1(2), Chapter 6, (1991)) initially compriεes preparing an antibody specific to the hMutT2 antigen, preferably a monoclonal antibody. In addition a reporter antibody is prepared against the monoclonal antibody. To the reporter antibody is attached a detectable reagent such as radioactivity, fluorescence or, in this example, a horseradiεh peroxidaεe enzyme. A sample iε removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein like BSA. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any hMutT2 proteins attached to the polystyrene dish. All unbound monoclonal antibody is washed out with buffer. The reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to hMutT2. Unattached reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a meaεurement of the amount of hMutT2 protein present in a given volume of patient sample when compared against a standard curve. A competition asεay may be employed wherein antibodieε εpecific to hMutT2 are attached to a εolid support and labeled hMutT2 and a sample derived from the host are passed over the solid support and the amount of label detected, for example by liquid scintillation chromatography, can be correlated to a quantity of hMutT2 in the sample.

A "sandwich" asεay is similar to an ELISA asεay. In a "sandwich" assay hMutT2 is passed over a εolid support and binds to antibody attached to a solid support. A second antibody is then bound to the hMutT2. A third antibody which is labeled and specific to the second antibody is then pasεed over the solid εupport and bindε to the second antibody and an amount can then be quantitated.

The invention alεo relateε to a method of εcreening compounds to identify those which enhance (agonists) or block (antagonists) the functions of hMutT2. An example of such an assay comprises measuring the hydrolysis of 8-oxo-dGTP to 8- oxo-dGMP in the presence of hMutT2 and the compound to be screened. The reaction mixture (12.5 μl) contains 20 mM Tris-HCl, pH 8.0, 4 mm MgCl₂, 40 mM NaCl, 20 μM 8-oxo-dGTP, 80 μg/ml bovine serum albumin, 8 mM DTT, 10% glycerol, hMutT2 and the compound to be screened. The reaction iε run at 30°C for 20 minuteε and stopped by adding 2.0 μl of 50 mm EDTA. An aliquot (2 μl) of the reaction mixture waε spotted on a polyethyleneimine-cellulose plate, and the product iε separated from the subεtrate by TLC with 1 M LiCl for one hour and quantitated by autoradiographic analysis with a Fujix Bio-image analyzer (Fuji Photofilm Company Limited Tokyo) . The ability of the compound to inhibit or enhance the action of hMutT2 is then analyzed.

Human MutT2 is produced and functions intra-cellularly, therefore, any antagonists must be intra-cellular. Potential antagonists to hMutT2 include antibodies which are produced intra-cellularly. For example, an antibody identified as antagonizing hMutT2 may be produced intra-cellularly as a single chain antibody by procedures known in the art, such as transforming the appropriate cells with DNA encoding the single chain antibody to prevent the function of hMutT2.

Another potential hMutT2 antagonist is an antiεense construct prepared using antiεenεe technology. Antiεense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix -see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)), thereby preventing transcription and the production of hMutT2. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the hMutT2 polypeptide (antisense - Okano, J. Neurochem. , 56:560 (1991); 01igodeoxynucleotides aε Antisense Inhibitors of Gene Expression, CRC Presε, Boca Raton, FL (1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of hMutT2.

Potential hMutT2 antagonists also include a small molecule, which are able to pasε through the cell membrane, and bind to and occupy the catalytic εite of the polypeptide thereby making the catalytic εite inacceεsible to substrate such that normal biological activity is prevented. Examples of small moleculeε include but are not limited to εmall peptides or peptide-like molecules.

The antagonists may be employed to target undesired cellε, e.g., abnormally differentiating cellε such aε in tumors and cancerε, εince the prevention of hMutT2 activity prevent corrections in DNA replication errors, and may lead to the destruction of the cell.

The antagonistε may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.

The small molecule agonistε and antagoniεts of the present invention may be employed in combination with a suitable pharmaceutical carrier. Such compositionε compriεe a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipient. Such a carrier includeε but iε not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.

The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositionε of the invention. Associated with such container(s) can be a notice in the form preεcribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, the pharmaceutical compositions may be employed in conjunction with other therapeutic compounds.

The pharmaceutical compositions may be administered in a convenient manner such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routeε. The pharmaceutical compoεitionε are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, they are administered in an amount of at least about 10 μg/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most caseε, the doεage is from about 10 μg/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.

The sequences of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular siteε on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with diseaεe.

Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.

PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome. Using the present invention with the same oligonucleotide primers, εublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner. Other mapping εtrategieε that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.

Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be uεed to provide a precise chromosomal location in one step. This technique can be uεed with cDNA aε short aε 500 or 600 bases,- however, cloneε larger than 2,000 bp have a higher likelihood of binding to a unique chromoεomal location with εufficient signal intensity for simple detection. FISH requires use of the clones from which the EST was derived, and the longer the better. For example, 2,000 bp is good, 4,000 is better, and more than 4,000 iε probably not necessary to get good resultε a reaεonable percentage of the time. For a review of thiε technique, εee Verma et al. , Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988) .

Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins Univerεity Welch Medical Library) . The relationεhip between geneε and diseases that have been mapped to the same chromosomal region are then identified through linkage analyεis (coinheritance of physically adjacent genes) .

Next, it iε neceεεary to determine the differenceε in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.

With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This aεsumes 1 megabase mapping resolution and one gene per 20 kb) .

The polypeptides, their fragments or other derivativeε, or analogs thereof, or cells expreεεing them can be used aε an immunogen to produce antibodieε thereto. Theεe antibodieε can be, for example, polyclonal or monoclonal antibodieε. The present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expresεion library. Variouε procedureε known in the art may be uεed for the production of such antibodies and fragments.

Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptideε. Such antibodieε can then be uεed to iεolate the polypeptide from tiεsue expressing that polypeptide.

For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodieε (Cole, et al., 1985, in Monoclonal Antibodieε and Cancer Therapy, Alan R. Liεs, Inc., pp. 77-96).

Techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Also, transgenic mice may be used to expresε humanized antibodieε to immunogenic polypeptide productε of thiε invention.

The preεent invention will be further described with reference to the following examples; however, it is to be understood that the present invention iε not limited to such examples. All parts or amounts, unless otherwise specified, are by weight. In order to facilitate understanding of the following examples certain frequently occurring methodε and/or terms will be described.

"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmidε in accord with publiεhed procedureε. In addition, equivalent plaε idε to those described are known in the art and will be apparent to the ordinarily skilled artisan.

"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The variouε reεtriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 μg of plasmid or DNA fragment iε uεed with about 2 units of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragmentε for plaεmid construction, typically 5 to 50 μg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymeε are εpecified by the manufacturer. Incubation timeε of about l hour at 37°C are ordinarily used, but may vary in accordance with the supplier's instructionε. After digeεtion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.

Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D. et al . , Nucleic Acids Res., 8:4057 (1980).

"Oligonucleotides" refers to either a εingle εtranded polydeoxynucleotide or two complementary polydeoxynucleotide εtrandε which may be chemically εyntheεized. Such εynthetic oligonucleotideε have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.

"Ligation" referε to the process of forming phosphodieεter bonds between two double stranded nucleic acid fragmentε (Maniatiε, T. , et al., Id., p. 146). Unleεs otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 μg of approximately equimolar amounts of the DNA fragmentε to be ligated.

Unless otherwise stated, transformation was performed as described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).

Example l Bacterial Expression and Purification of hMutT2

The DNA sequence encoding hMutT2, ATCC # 75882, is initially amplified using PCR oligonucleotide primers corresponding to the 5' sequence of the hMutT2 protein (minus the signal peptide sequence) and the vector sequences 3' to the hMutT2 gene. Additional nucleotides corresponding to hMutT2 were added to the 5' and 3' sequences respectively. The 5' oligonucleotide primer has the sequence 5' GCGGTO^CATGAGCCAAGAACCAACG 3' contains a Sail reεtriction enzyme εite followed by 21 nucleotideε of hMutT2 coding sequence starting from the presumed terminal amino acid of the processed protein. The 3' sequence 5' GCGTCTAGAT AAAATTTCAAGAAGGGCAC 3' contains complementary sequences to Xbal site and is followed by 21 nucleotides of hMutT2. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expresεion vector pQE-9 (Qiagen, Inc. 9259 Eton Avenue, Chatεworth, CA, 91311). pQE-9 encodes antibiotic resiεtance (Amp^r) , a bacterial origin of replication (ori) , an IPTG-regulatable promoter operator (P/0) , a riboεome binding εite (RBS) , a 6-Hiε tag and reεtriction enzyme sites. pQE-9 was then digested with Sail and Xbal. The amplified sequences were ligated into pQE-9 and were inserted in frame with the sequence encoding for the histidine tag and the RBS. The ligation mixture waε then used to transform E. coli strain ml5/REP4 (Qiagen) by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Presε,

(1989) . ml5/REP4 contains multiple copies of the plasmid pREP4, which expreεses the lad repressor and alεo conferε kanamycin reεiεtance (Kan^r) . Tranεformantε are identified by their ability to grow on LB plates and ampicillin/kanamycin resiεtant colonies were selected. Plasmid DNA was isolated and confirmed by reεtriction analysis. Clones containing the desired constructε were grown overnight (0/N) in liquid culture in LB media εupplemented with both Amp (100 ug/ml) and Kan (25 ug/ml) . The O/N culture iε used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells were grown to an optical density 600 (O.D,⁶⁰⁰) of between 0.4 and 0.6. IPTG (ⁿIsopropyl-B-D-thiogalacto pyranoside") was then added to a final concentration of 1 mM. IPTG induces by inactivating the la repreεεor, clearing the P/0 leading to increased gene expression. Cells were grown an extra 3 to 4 hourε. Cells were then harvested by centrifugation. The cell pellet was εolubilized in the chaotropic agent 6 Molar Guanidine HC1. After clarification, εolubilized hMutT2 waε purified from thiε solution by chromatography on a Nickel- Chelate column under conditionε that allow for tight binding by proteinε containing the 6-Hiε tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984)) . hMutT2 (more than 80% pure) waε eluted from the column in 6 molar guanidine HC1 pH 5.0 and for the purpoεe of renaturation adjuεted to 3 molar guanidine HC1, lOOmM εodium phoεphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in this solution for 12 hours the protein was dialyzed to 10 mmolar sodium phosphate (Figure 3) .

Example 2 Cloninσ and expression of hMutT2 using the baculovirus expression system

The DNA sequence encoding the full length hMutT2 protein, ATCC # 75882, was amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:

The 5' primer has the sequence 5' GCGCCCGGGATAAGCCAAGAACCAACG 3' and contains a Smal restriction enzyme site (underlined) followed by 21 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (J. Mol. Biol. 1987, 196. 947-950, Kozak, M.) .

The 3' primer has the sequence 5' GCGGGTACCT AAAATTTCAAGAAGGGCAC 3' and contains the cleavage site for the restriction endonuclease Aεp718 and 21 nucleotideε complementary to the 3' non-tranεlated sequence of the hMutT2 gene. The amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.) . The fragment was then digested with the endonucleaseε Smal and Aεp7l8 and then purified again on a 1% agarose gel. Thiε fragment iε designated F2.

The vector pA2 (modification of pVL941 vector, diεcussed below) is used for the expression of the hMutT2 protein using the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texaε Agricultural Experimental Station Bulletin No. 1555) . Thiε expreεεion vector containε the εtrong polyhedrin promoter of the Autographa californica nuclear polyhedroεiε viruε (AcMNPV) followed by the recognition sites for the restriction endonucleaseε Smal and Aεp7l8. The polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation. For an easy selection of recombinant viruses the beta-galactosidase gene from E.coli iε inserted in the same orientation aε the polyhedrin promoter followed by the polyadenylation εignal of the polyhedrin gene. The polyhedrin εequences are flanked at both εideε by viral εequenceε for the cell-mediated homologouε recombination of cotransfected wild-type viral DNA. Many other baculovirus vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D. , Virology, 170:31-39).

The plasmid was digested with the restriction enzymes Smal and Asp718 and then dephoεphorylated using calf intestinal phosphatase by procedures known in the art. The DNA was then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.) . Thiε vector DNA iε designated V2.

Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase. E. coli HB101 cells were then transformed and bacteria identified that contained the plasmid (pBac hMutT2) with the hMutT2 gene using the enzymes Smal and Asp718. The sequence of the cloned fragment was confirmed by DNA sequencing.

5 μg of the plasmid pBac hMutT2 was cotransfected with 1.0 μg of a commercially available linearized baculovirus ("BaculoGold™ baculovirus DNA", Pharmingen, San Diego, CA.) uεing the lipofection method (Feigner et al. Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)). lμg of BaculoGold™ viruε DNA and 5 μg of the plasmid pBac hMutT2 were mixed in a sterile well of a microtiter plate containing 50 μl of serum free Grace's medium (Life Technologieε Inc., Gaitherεburg, MD) . Afterwards 10 μl Lipofectin plus 90 μl Grace's medium were added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture was added dropwise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace' medium without serum. The plate was rocked back and forth to mix the newly added solution. The plate waε then incubated for 5 hours at 27°C. After 5 hours the transfection solution was removed from the plate and 1 ml of Grace'ε insect medium supplemented with 10% fetal calf serum was added. The plate was put back into an incubator and cultivation continued at 27°C for four days.

After four days the supernatant was collected and a plaque assay performed similar as described by Summers and Smith (supra) . As a modification an agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) waε used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque assay" can also be found in the user's guide for ineect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9- 10) .

Four days after the serial dilution of the viruses was added to the cells, blue stained plaques were picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses was then resuspended in an Eppendorf tube containing 200 μl of Grace's medium. The agar was removed by a brief centrifugation and the supernatant containing the recombinant baculoviruses was used to infect Sf9 cells seeded in 35 m dishes. Four days later the supernatants of these culture dishes were harvested and then stored at 4°C.

Sf9 cellε were grown in Grace'ε medium supplemented with 10% heat-inactivated FBS. The cells were infected with the recombinant baculovirus V-hMutT2 at a multiplicity of infection (MOD of 2. Six hours later the medium waε removed and replaced with SF900 II medium minuε methionine and cyεteine (Life Technologieε Inc. , Gaitherεburg) . 42 hourε later 5 μCi of ³⁵S-methionine and 5 μCi ³⁵S cysteine (A ersham) were added. The cells were further incubated for 16 hours before they were harveεted by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.

Example 3 Expression of Recombinant hMutT2 in COS cells

The expression of plasmid, hMutT2 HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E. coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A DNA fragment encoding the entire hMutT2 precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter. The HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767) . The infusion of HA tag to our target protein allows easy detection of the recombinant protein with an antibody that recognizeε the HA epitope.

The plaεmid conεtruction εtrategy iε deεcribed as follows:

The DNA sequence encoding hMutT2, ATCC # 75882, was constructed by PCR on the original EST cloned using two primers: the 5' primer 5' GCGGAATTCATGGAGAGCCAAGAACCAACG 3' contains a EcoRI site followed by 21 nucleotides of hMutT2 coding εequence εtarting from the initiation codon; the 3' εequence 5' GCGCTCGAGTCAAGCGTAGTCTGGGACGTCGTATGGGTAAAA TTTCAAGAAGGGCAC 3' contains complementary εequenceε to Xhol site, translation stop codon, HA tag and the last 18 nucleotides of the hMutT2 coding sequence (not including the stop codon) . Therefore, the PCR product contains a EcoRI εite, hMutT2 coding εequence followed by HA tag fuεed in frame, a translation termination stop codon next to the HA tag, and an Xhol site. The PCR amplified DNA fragment and the vector, pcDNAI/Amp, were digested with EcoRI and Xhol restriction enzyme and ligated. The ligation mixture was transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture was plated on ampicillin media plates and resistant colonies were selected. Plasmid DNA was isolated from transformantε and examined by restriction analysiε for the presence of the correct fragment. For expression of the recombinant hMutT2, COS cells were transfected with the expression vector by DEAE- DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)). The expression of the hMutT2 HA protein was detected by radiolabelling and immunoprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells were labelled for 8 hours with ³⁵S-cysteine two days post transfection. Culture media were then collected and cells were lysed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5) (Wilεon, I. et al., Id. 37:767 (1984)). Both cell lyεate and culture media were precipitated with a HA εpecific monoclonal antibody. Proteinε precipitated were analyzed on 15% SDS-PAGE gels.

Example 4 Expression pattern of hMutT2 in human tissue

Northern blot analysiε waε carried out to examine the levels of expresεion of hMutT2 in human tiεεues. Total cellular RNA samples were isolated with RNAzol™ B syεtem (Biotecx Laboratorieε, Inc. 6023 South Loop Eaεt, Houεton, TX 77033) . About 15μg of total RNA isolated from each human tisεue specified waε separated on 1% agarose gel and blotted onto a nylon filter. (Sambrook, Fritsch, and Maniatis, Molecular Cloning, Cold Spring Harbor Press, (1989)). The labeling reaction waε done according to the Stratagene Prime- It kit with 50ng DNA fragment. The labeled DNA waε purified with a Select-G-50 column. (5 Prime - 3 Prime, Inc. 5603 Arapahoe Road, Boulder, CO 80303) . The filter waε then hybridized with radioactive labeled full length hMutT2 gene at 1,000,000 cpm/ml in 0.5 M NaP0₄, pH 7.4 and 7% SDS overnight at 65^*C. The filter waε then waεhed twice at room temperature and twice at 60^*C with 0.5 x SSC, 0.1% SDS, and then exposed at -70^*C overnight with an intensifying screen. The meεεage RNA for hMutT2 iε abundant in thymuε, teεtis, gall bladder, kidney, liver, lung, spleen, prostate, placenta (Figure 4) .

Numerous modificationε and variationε of the preεent invention are poεεible in light of the above teachingε and, therefore, within the εcope of the appended claimε, the invention may be practiced otherwise than as particularly described.

SEQUENCE LISTING

(1) GENERAL INFORMATION: (i) APPLICANT: WEI, ET AL.

(ii) TITLE OF INVENTION: Human MutT2

(iii) NUMBER OF SEQUENCES: 2

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN,

CECCHI, STEWART & OLSTEIN

(B) STREET: 6 BECKER FARM ROAD

(C) CITY: ROSELAND

(D) STATE: NEW JERSEY

(E) COUNTRY: USA

(F) ZIP: 07068

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: 3.5 INCH DISKETTE

(B) COMPUTER: IBM PS/2

(C) OPERATING SYSTEM: MS-DOS

(D) SOFTWARE: WORD PERFECT 5.1

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE: Submitted herewith

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA

(A) APPLICATION NUMBER:

(B) FILING DATE: (viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: FERRARO, GREGORY D.

(B) REGISTRATION NUMBER: 36,134

(C) REFERENCE/DOCKET NUMBER: 325800-245

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 201-994-1700

(B) TELEFAX: 201-994-1744

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 1129 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: cDNA

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

TGGCACCGGC ATCGGCTGAC ACTGCTGCCT CCAGC AGTT ATTTCGTCCT CTTCCGTTCT 60

TCACCCCTAC ACCTTGGAGG TGAACTTCTC ACCTGAGGGC TGTAAAGACT CGTTTGAAAA 120

TGGAGAGCCA AGAACCAACG GAATCTTCTC AGAATGGCAA ACAGTATATC ATTTCAGAGG 180

AGTTAATTTC AGAAGGAAAA TGGGTCAAGC TTGAAAAAAC AACGTACATG GATCCTACTG 240

GTAAAACTAG AACTTGGGAA TCAGTGAACG TACCAACCAG GAAAGAGCAG ACTGCGGATG 300

GTGTCGCGGT CATCCCCGTG CTGCAGAGAA CACTTCACTA TGAGTGTATC GTTCTGGTGA 360

AACAGTTCCG ACCACCAATG GGGGGCTACT GCATAGAGTT CCCTGCAGGT CTCATAGATG 420

ATGGTGAAAC CCCAGAAGCA GCTGCTCTCC GGGAGCTTGA AGAAGAAACT GGCTACAAAG 480

GGGACATTGC CGAATGTTCT CCAGCGGTCT GTATGGACCC AGGCTTGTCA AACTGTACTA 540

TACACATCGT GACAGTCACC ATTAACGGAG ATGATGCCGA AAACGCAAGG CCGAAGCCAA 600

AGCCAGGGGA TGGAGAGTTT GTGGAAGTCA TTTCTTTACC CAAGAATGAC CTGCTGCAGA 660

GACTTGATGC TCTGGTAGCT GAAGAACATC TCACAGTGGA CGCCAGGGTC TATTCCTACG 720

CTCTAGCGCT GAAACATGCA AATGCAAAGC CATTTGAAGT GCCCTTCTTG AAATTTTAAG 780

CCCAAATATG ACACTGGCCA TTTTTGTAAA CGAGACCACC AGGCCTTCTT CACTAAGACT 840

TTGTATTCAA CTTAGTTTAA TGTAGATTTG CCATTAGCTT TTTCGTAAAA TAAAAGCACA 900

GAACAGATGT GGTGGTGGTA TGGAATTGTA ATTACAGGTA GGTTGTGACC TTCCTTTAAA 960

TTTGTTATAA CTCCAGCTAA AATTAACAAA GAATATAAAT GCAAGTATGT TTACTCCAAT 1020 TTTTTTAAAG CTCAACAGAG TTAACTACAG CTCAGTTACT TTTCTAGTCC AGTCTGGAAC 1080 ACAGGGGTAT TTGGTATTGA GAAATAGACC TGAGTTCTCA ATTAGGTCA 1129

(2 ) INFORMATION FOR SEQ ID NO : 2 :

(i) SEQUENCE CHARACTERISTICS

(A) LENGTH : 219 AMINO ACIDS

(B) TYPE : AMINO ACID

(C) STRANDEDNESS :

(D) TOPOLOGY : LINEAR

(ii) MOLECULE TYPE: PROTEIN

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Met Glu Ser Gin Glu Pro Thr Glu Ser Ser Gin Aεn Gly Lyε Gin

5 10 15

Tyr lie lie Ser Glu Glu Leu lie Ser Glu Gly Lyε Trp Val Lyε

20 25 30

Leu Glu Lyε Thr Thr Tyr Met Aεp Pro Thr Gly Lyε Thr Arg Thr

35 40 45

Trp Glu Ser Val Aεn Val Pro Thr Arg Lyε Glu Gin Thr Ala Aεp

50 55 60

Gly Val Ala Val lie Pro Val Leu Gin Arg Thr Leu Hiε Tyr Glu

65 70 75

Cys lie Val Leu Val Lys Gin Phe Arg Pro Pro Met Gly Gly Tyr

80 85 90

Cys lie Glu Phe Pro Ala Gly Leu lie Asp Asp Gly Glu Thr Pro

95 100 105

Glu Ala Ala Ala Leu Arg Glu Leu Glu Glu Glu Thr Gly Tyr Lys

110 115 120

Gly Asp lie Ala Glu Cys Ser Pro Ala Val Cys Met Asp Pro Gly

125 130 135

Leu Ser Aεn Cys Thr lie Hiε lie Val Thr Val Thr lie Asn Gly

140 145 150

Asp Asp Ala Glu Asn Ala Arg Pro Lys Pro Lys Pro Gly Asp Gly

155 160 165 Glu Phe Val Glu Val lie Ser Leu Pro Lys Asn Asp Leu Leu Gin

170 175 180

Arg Leu Asp Ala Leu Val Ala Glu Glu His Leu Thr Val Aεp Ala

185 190 195

Arg Val Tyr Ser Tyr Ala Leu Ala Leu Lyε Hiε Ala Aεn Ala Lyε

200 205 210

Pro Phe Glu Val Pro Phe Leu Lyε Phe

215

Claims

WHAT IS CLAIMED IS:

1. An isolated polynucleotide selected from the group consiεting of:

(a) a polynucleotide encoding a polypeptide having the deduced amino acid sequence of Figure 1 or a fragment, analog or derivative of said polypeptide;

(b) a polynucleotide encoding a polypeptide having the amino acid sequence encoded by the cDNA contained in ATCC Deposit No. 75882 or a fragment, analog or derivative of said polypeptide.

2. The polynucleotide of Claim 1 wherein the polynucleotide is DNA.

3. The polynucleotide of Claim 1 wherein the polynucleotide iε RNA.

4. The polynucleotide of Claim 1 wherein the polynucleotide iε genomic DNA.

5. The polynucleotide of Claim 2 wherein said polynucleotide encodes a polypeptide having the deduced amino acid sequence of Figure 1.

6. The polynucleotide of Claim 2 wherein said polynucleotide encodes a polypeptide encoded by the cDNA of ATCC Deposit No. 75882.

7. The polynucleotide of Claim l having the coding sequence aε εhown in Figure 1.

8. A vector containing the DNA of Claim 2.

9. A hoεt cell genetically engineered with the vector of Claim 8.

10. A proceεε for producing a polypeptide comprising: expresεing from the hoεt cell of Claim 9 the polypeptide encoded by εaid DNA.

11. A proceεε for producing cellε capable of expressing a polypeptide comprising genetically engineering cellε with the vector of Claim 8.

12. An isolated DNA hybridizable to the DNA of Claim 2 and encoding a polypeptide having hMutT2 activity.

13. A polypeptide εelected from the group consisting of (i) a polypeptide having the deduced amino acid εequence of Figure 1 and fragmentε, analogε and derivatives thereof and (ii) a polypeptide encoded by the cDNA of ATCC Depoεit No. 75882 and fragmentε, analogs and derivatives of said polypeptide.

14. The polypeptide of Claim 14 wherein the polypeptide has the deduced amino acid sequence of Figure 1.

15. An antibody against the polypeptide of claim 13.

16. A compound which inhibits the polypeptide of claim 13.

17. A compound which activates the polypeptide of claim 13.

18. A method for the treatment of a patient having need of hMutT2 comprising: administering to the patient a therapeutically effective amount of the polypeptide of claim 14, wherein the polypeptide is administered by providing to the patient DNA encoding said polypeptide and e-xpreεεing εaid polypeptide in vivo.

19. A method for the treatment of a patient having need to inhibit hMutT2 comprising: administering to the patient a therapeutically effective amount of the compound of Claim 16.

20. A pharmaceutical composition comprising the compound of Claim 16 and a pharmaceutically acceptable carrier.

21. A process for identifying antagonistε and agoniεtε to hMutT2 compriεing: contacting hMutT2 with 8-oxo-dGTP in the preεence of a compound to be εcreened under conditionε where 8-oxo- dGTP is hydrolyzed,- determining the extent of hydrolysiε of 8-oxo- dGTP; and identifying if the compound enhanceε or blockε the hydrolysis of 8-oxo-dGTP by hMutT2.

22. A procesε for diagnoεing a susceptibility to errors in DNA replication comprising: isolating a nucleic acid sequence encoding a - hMutT2 from a sample derived from a host; and determining a mutation in the hMutT2 nucleic acid sequence.

23. A diagnostic process comprising: analyzing for the presence of the polypeptide of claim 13 in a sample derived from a host.