EP0815199A1 - Human deoxycytidine kinase 2 - Google Patents
Human deoxycytidine kinase 2Info
- Publication number
- EP0815199A1 EP0815199A1 EP95908512A EP95908512A EP0815199A1 EP 0815199 A1 EP0815199 A1 EP 0815199A1 EP 95908512 A EP95908512 A EP 95908512A EP 95908512 A EP95908512 A EP 95908512A EP 0815199 A1 EP0815199 A1 EP 0815199A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- polypeptide
- polynucleotide
- hdck2
- dna
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotide ⁇ , the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is Human Deoxycytidine Kinase 2, sometimes hereinafter referred to as "hdCK2". The invention also relates to inhibiting the action of such polypeptides.
- Human deoxycytidine kinase 2 is responsible for the phosphorylation of several deoxyribonucleosides and their analogs. The enzyme has been shown to have broad substrate specificity and plays a physiological role in the maintenance of the normal deoxyribonucleotide pools. Deoxycytidine kinase is also a key enzyme in the phosphorylation of a variety of antineoplastic and antiviral nucleoside analogs including l- ⁇ -D-arabinofuranosylcytosine and dideoxycytidine (Ullman, B. et al, J.Biol.Che ⁇ n.
- the enzyme is allosterically regulated by several deoxyribonucleotides and preferentially uses ATP as a phosphate donor for the phosphorylization of deoxycytidine (Ikeda, S. et al. , Bio.Chem. , 27:8648-8652 (1988) ) .
- Deoxycytidine kinase isolated from a human lymphoblastic cultured T-cell line had an apparent molecular weight of 60,000 and a Stokes radius of 32 A. It is thought that the deoxycytidine kinase enzyme is composed of two identical subunits. The rate of deoxycytidine phosphorylation is essentially greatest at pH 7.0 but there is a broad pH optimum ranging from pH 6.5 to pH 9.0. The enzyme also has an absolute requirement for magnesium. In the absence of added divalent cation, deoxycytidine is phosphorylated at about 10% of the rate seen with 2.4 mM magnesium.
- the deoxycytidine kinase protein has a number of substrates including cytosine arabinoside, deoxyguanosine, deoxyadenosine, cytidine, 2-chloro-adenosine and dideoxycytidine. If deoxycytidine kinase is contaminated with uridine-cytidine kinase, cytidine phosphorylation should be inhibited by uridine. While ATP is the preferred phosphate donor, GTP, ITP and XTP had more than 80% of activity as compared to ATP.
- Deoxycytidine kinase has been partially purified from many sources (Baxter, A. et al. , Bio.Chem. . , 173:1005-1008
- Deoxycytidine kinase is the rate limiting step in the activation of the chemotherapeutic agent cytosine arabinoside to its 5' triphosphate (Mejer, J., Scand.J.Clin.Lab.Invest. , 42:401-406 (1982)).
- Other clinically important chemotherapeutic agents for which deoxycytidine kinase catalyzes the initial activation of is ara-C, 2-fluoro-9- ⁇ -D- arabinofuranosyladenine, and dideoxycytidine (Kufe, D.W. and Spriggs, D.R., Semin.Oncol. , 12:34-48 (1985)) .
- polypeptide of the present invention has been putatively identified as human deoxycytidine kinase 2. This identification has been made as a result of amino acid sequence homology to mouse deoxycytidine kinase 1.
- a novel mature polypeptide which is hdCK2, as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.
- isolated nucleic acid molecules encoding hdCK2 including mRNAs , D ⁇ As, cD ⁇ As, genomic D ⁇ As as well as analogs and biologically active and diagnostically or therapeutically useful fragments thereof.
- nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to hdCK2 sequences.
- a process for producing such polypeptide by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing a hdCK2 nucleic acid sequence, under conditions promoting expression of said protein and subsequent recovery of said protein.
- antagonists to such polypeptides which may be used to inhibit the action of such polypeptides, for example, in the treatment of immunodeficiency diseases.
- a method of diagnosing a disease or a susceptibility to a disease for example, abnormal DNA replication and translation, related to a mutation in hdCK2 nucleic acid sequences and the protein encoded by such nucleic acid sequences.
- Figure 1 illustrates the cDNA sequence and the corresponding deduced amino acid sequence of hdCK2 polypeptide.
- the standard 1 letter abbreviations for amino acids is used.
- Figure 2 illustrates the amino acid sequence homology between hdCKl, hdCK2 and mouse dCKl, wherein the shaded areas represent amino acid residues which are the same between the different sequences.
- Figure 3 is an illustration of a gel after bacterial expression and purification and SDS-PAGE analysis of hdCK2.
- nucleic acid which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID No. 2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75881 on August 31, 1994.
- a polynucleotide encoding a polypeptide of the present invention may be obtained from human ovary, testis, gall bladder, liver, lung, spleen, prostate and heart.
- the polynucleotide of this invention was discovered in a cDNA library derived from human cyclohexamide treated CEM cells. It is structurally related to the deoxycytidine kinase family. It contains an open reading frame encoding a protein of 172 amino acid residues. The protein exhibits the highest degree of homology to human deoxycytidine kinase 1 with 60 % identity and 70 % similarity over a 90 amino acid stretch. It is also important that the Gly-Xaa-Xaa-Gly-Xaa-Gly-Lys consensus sequence for ATP-binding is conserved.
- the polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
- the DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
- the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID No. l) or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID No. 1) or the deposited cDNA.
- the polynucleotide which encodes for the mature polypeptide of Figure 1 (SEQ ID No. 2) or for the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
- polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
- the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID No. 2) or the polypeptide encoded by the cDNA of the deposited clone.
- the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non- naturally occurring variant of the polynucleotide.
- the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (SEQ ID No. 2) or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO. 2) or the polypeptide encoded by the cDNA of the deposited clone.
- Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
- the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 (SEQ ID No. 1) or of the coding sequence of the deposited clone.
- an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
- the polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention.
- the marker sequence may be a hexa- histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a tuammalian host, e.g. COS-7 cells, is used.
- the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
- the present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 50% and preferably 70% identity between the sequences.
- the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
- the polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNA of Figure 1 (SEQ ID No. 1) or the deposited cDNA.
- the present invention further relates to a hdCK2 polypeptide which has the deduced amino acid sequence of Figure l (SEQ ID No. 2) or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.
- fragment when referring to the polypeptide of Figure l (SEQ ID No. 2) or that encoded by the deposited cDNA, means a polypeptide which retains essentially the same biological function or activity as such polypeptide.
- an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
- the fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID No. 2) or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) , or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide.
- Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
- polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
- isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) .
- a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
- Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
- the present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
- Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector.
- the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
- the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the hdCK2 genes.
- the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
- the polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques.
- the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide.
- Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids,- phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
- any other vector may be used as long as it is replicable and viable in the host.
- the appropriate DNA sequence may be inserted into the vector by a variety of procedures.
- the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
- the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis.
- promoter for example, LTR or SV40 promoter, the E. coli. lac or trp, the phage lambda P L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
- the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
- the vector may also include appropriate sequences for amplifying expression.
- the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
- the vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
- bacterial cells such as E. coli, Streptomyces, Salmonella tvphimurium
- fungal cells such as yeast
- insect cells such as Drosophila S2 and Spodoptera Sf9
- animal cells such as CHO, COS or Bowes melanoma
- adenovirus plant cells, etc.
- the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.
- the constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
- the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
- a promoter operably linked to the sequence.
- Bacterial pQE70, pQE60, pQE-9 (Qiagen) , pBS, pDlO, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene) ; ptrc99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia).
- Eukaryotic pWLNEO, PSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) .
- any other plasmid or vector may be used as long as they are replicable and viable in the host.
- Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
- Two appropriate vectors are PKK232-8 and PCM7.
- Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , P l and trp.
- Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
- the present invention relates to host cells containing the above-described constructs.
- the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
- Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation. (Davis, L., Dibner, M. , Battey, I., Basic Methods in Molecular Biology, (1986) ) .
- constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
- the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
- Mature proteins can be expressed in rr-ammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the D ⁇ A constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al. , Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, ⁇ .Y., (1989), the disclosure of which is hereby incorporated by reference.
- Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
- recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
- promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK) , ⁇ -factor, acid phosphatase, or heat shock proteins, among others.
- the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences.
- the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
- Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
- the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host.
- Suitable prokaryotic hosts for transformation include E. coli. Bacillus subtilis. Salmonella tvphimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
- useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017) .
- cloning vector pBR322 ATCC 37017
- Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEMl (Promega Biotec, Madison, WI, USA) .
- pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
- the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
- Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
- Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
- mammalian cell culture systems can also be employed to express recombinant protein.
- mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981) , and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines.
- Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
- the hdCK2 polypeptides can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
- HPLC high performance liquid chromatography
- polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture) .
- a prokaryotic or eukaryotic host for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture
- the polypeptides of the present invention may be glycosylated or may be non-glycosylated.
- Polypeptides of the invention may also include an initial methionine amino acid residue.
- hdCK2 polypeptides and agonists and antagonists which are polypeptides, discussed below, may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy.”
- cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
- a polynucleotide DNA or RNA
- Such methods are well-known in the art.
- cells may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
- cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art.
- a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo.
- the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
- hdCK2 Once the hdCK2 polypeptide is being expressed intra- cellularly via gene therapy, it may be employed to treat malignancies, e.g., tumors, cancer, leukemias and lymphomas and viral infections, since hdCK2 catalyzes the initial phosphorylation step in the formation of cytotoxic triphosphate derivatives of nucleoside ⁇ such as ara-C, 2- fluoro-9- ⁇ -D-arabinofuranosyladenine and dideoxycytidine. These compounds are widely used in the treatment of the above-stated disorders. hdCK2 may also be employed to maintain normal deoxyribonucleotide pools and therefore ensure correct DNA synthesis.
- malignancies e.g., tumors, cancer, leukemias and lymphomas and viral infections
- hdCK2 catalyzes the initial phosphorylation step in the formation of cytotoxic triphosphate derivatives of nucleoside ⁇ such as ara-C, 2- fluoro-9- ⁇
- Fragments of the full length hdCK2 gene may be used as a hybridization probe for a cDNA library to isolate the full length hdCK2 gene and to isolate other genes which have a high sequence similarity to the hdCK2 gene or similar biological activity.
- Probes of this type generally have at least 20 bases. Preferably, however, the probes have at least 30 bases and generally do not exceed 50 bases, although they may have a greater number of bases.
- the probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete hdCK2 gene including regulatory and promotor regions, exons, and introns.
- An example of a screen comprises isolating the coding region of the hdCK2 gene by using the known DNA sequence to synthesize an oligonucleotide probe.
- Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
- This invention is also related to the use of the hdCK2 gene as part of a diagnostic assay for detecting diseases or susceptibility to diseases related to the presence of mutated hdCK2, for example, resistance to anti-viral and anti- malignancy compounds.
- Nucleic acids for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material.
- the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al . , Nature, 324:163-166 (1986)) prior to analysis.
- RNA or cDNA may also be used for the same purpose.
- PCR primers complementary to the nucleic acid encoding hdCK2 can be used to identify and analyze hdCK2 mutations.
- deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
- Point mutations can be identified by hybridizing amplified DNA to radiolabeled hdCK2 RNA or alternatively, radiolabeled hdCK2 antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.
- DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al . , Science, 230:1242 (1985) ) .
- Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al., PNAS, USA, 85:4397-4401 (1985)).
- nuclease protection assays such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al., PNAS, USA, 85:4397-4401 (1985)).
- the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP) ) and Southern blotting of genomic DNA.
- restriction enzymes e.g., Restriction Fragment Length Polymorphisms (RFLP)
- mutations can also be detected by in si tu analysis.
- the present invention also relates to a diagnostic assay for detecting altered levels of hdCK2 protein in various tissues since an over-expression of the proteins compared to normal control tissue samples may detect the presence of a disease or susceptibility to a disease related to malignancy, for example, tumors.
- Assays used to detect levels of hdCK2 protein in a sample derived from a host are well-known to those of skill in the art and include a radioimmunoassay, competitive-binding assays, Western Blot analysis, ELISA assays and "sandwich" assay.
- An ELISA assay (Coligan, et al., Current Protocols in Immunology, 1(2) , Chapter 6, (1991) ) initially comprises preparing an antibody specific to the hdCK2 antigen, preferably a monoclonal antibody.
- a reporter antibody is prepared against the monoclonal antibody.
- a detectable reagent such as radioactivity, fluorescence or, in this example, a horseradish peroxidase enzyme.
- a sample is removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein like BSA.
- the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any hdCK2 proteins attached to the polystyrene dish. All unbound monoclonal antibody is washed out with buffer.
- the reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to hdCK2. Unattached reporter antibody is then washed out.
- Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of hdCK2 protein present in a given volume of patient sample when compared against a standard curve.
- a competition assay may be employed wherein antibodies specific to hdCK2 are attached to a solid support and labeled hdCK2 and a sample derived from the host are passed over the solid support and the amount of label detected, for example by liquid scintillation chromatography, can be correlated to a quantity of hdCK2 in the sample.
- a “sandwich” assay is similar to an ELISA assay.
- hdCK2 is passed over a solid support and binds to antibody attached to a solid support.
- a second antibody is then bound to the hdCK2.
- a third antibody which is labeled and specific to the second antibody is then passed over the solid support and binds to the second antibody and an amount can then be quantitated.
- hdCK2 polypeptides may also be employed in a method of screening compounds to identify those which enhance (agonists) or block (antagonists) the phosphorylation activity of hdCK2.
- An example of such a method comprises isolating hdCK2 from rnammalian cells or membrane preparations which express hdCK2, for example HL-60 cells, preparing a reaction mixture, hdCK2 enzyme and the compound to be screened. The reaction mixture is then incubated at elevated temperatures and the deoxycytidine monophosphates formed are detected by the DE-81 disk method (Cheng, Y.C. et al. , Biochem.BioPhvs.Acta. 481:481-492 (1977)). The hdCK2 activity can be calculated and expressed as f ol of dCMP/min/ ⁇ g of protein. The ability of the compound to enhance or block the hdCK2 activity as compared to standard activity in the absence of the compound can then be measured.
- Human dCK2 is produced and functions intra-cellularly, therefore, any antagonists must be intra-cellular.
- Potential antagonists to hdCK2 include antibodies which are produced intra-cellularly.
- an antibody identified as antagonizing hdCK2 may be produced intra-cellularly as a single chain antibody by procedures known in the art, such as transforming the appropriate cells with DNA encoding the single chain antibody to prevent the function of hdCK2.
- a potential hdCK2 antagonist also includes an antisense construct prepared using antisense technology.
- Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
- the 5' coding portion of the polynucleotide sequence which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
- a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix -see Lee et al., Nucl.
- the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the hdCK2 polypeptides (antisense - Okano, J. Neurochem. , 56:560 (1991) ; Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)).
- the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of hdCK2.
- Potential hdCK2 antagonists also include a small molecule, which are able to pass through the cell membrane, and bind to and occupy the catalytic site of the polypeptide thereby making the catalytic site inaccessible to substrate such that normal biological activity is prevented.
- small molecules include but are not limited to small peptides or peptide-like molecules.
- the antagonist may be employed to treat immunodeficiency diseases, since hdCK2 catalyzes a critical step in the synthesis of dATP or dGTP whose accumulation confers cytotoxicity on the T-cell precursors in these disorders. Accordingly, inhibition of the hdCK2 function can eliminate these disorders.
- the antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g. , as hereinafter described.
- compositions comprise a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipient.
- a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.
- the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
- a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
- Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
- the pharmaceutical compositions may be employed in conjunction with other therapeutic compounds.
- the pharmaceutical compositions may be administered in a convenient manner such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes.
- the pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, they are administered in an amount of at least about 10 ⁇ g/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 ⁇ g/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
- sequences of the present invention are also valuable for chromosome identification.
- the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
- Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
- the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
- sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
- PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
- sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner.
- Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
- Fluorescence in si tu hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
- This technique can be used with cDNA as short as 500 or 600 bases; however, clones larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection.
- FISH requires use of the clones from which the EST was derived, and the longer the better. For example, 2,000 bp is good, 4,000 is better, and more than 4,000 is probably not necessary to get good results a reasonable percentage of the time.
- a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb) .
- polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto.
- These antibodies can be, for example, polyclonal or monoclonal antibodies.
- the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
- Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhu an. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
- any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497) , the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72) , and the EBV- hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96) .
- Plasmids are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
- the starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures.
- equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
- “Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA.
- the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
- For analytical purposes typically 1 ⁇ g of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 ⁇ l of buffer solution.
- For the purpose of isolating DNA fragments for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37'C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
- Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D. et al . , Nucleic Acids Res., 8:4057 (1980) .
- Oligonucleotides refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
- Ligase refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al., Id., p. 146) . Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amounts of the DNA fragments to be ligated.
- ligase T4 DNA ligase
- the DNA sequence encoding hdCK2, ATCC # 75881 is initially amplified using PCR oligonucleotide primers corresponding to the 5' and 3' end sequences of the processed hdCK2 gene (minus the signal peptide sequence) and the vector sequences 3 ' to the hdCK2 gene. Additional nucleotides corresponding to hdCK2 were added to the 5' and 3' sequences respectively.
- the 5' oligonucleotide primer has the sequence 5' CGGGATCCATGGCCAAGAGCCCACTC 3' (SEQ ID No. 3) contains a BamHI restriction enzyme site followed by 18 nucleotides of hdCK2 coding sequence starting from the presumed terminal amino acid of the processed protein codon.
- the 3' sequence 5' GCTCTAGATTAC_AGA ⁇ CTTTACAAA 3' contains complementary sequences to an Xbal site and is followed by 18 nucleotides at the C-terminus of hdCK2.
- the restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth, CA) .
- pQE-9 encodes antibiotic resistance (Amp r ) , a bacterial origin of replication (ori) , an IPTG-regulatable promoter operator (P/O) , a ribosome binding site (RBS) , a 6- His tag and restriction enzyme sites.
- pQE-9 was then digested with BamHI and Xbal .
- the amplified sequences were ligated into pQE-9 and were inserted in frame with the sequence encoding for the histidine tag and the RBS.
- the ligation mixture was then used to transform E. coli strain ml5/pREP4 (Qiagen) by the procedure described in Sambrook, J. et al. , Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989) .
- M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lad repressor and also confers kanamycin resistance (Kan r ) .
- Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected.
- Plasmid DNA was isolated and confirmed by restriction analysis. Clones containing the desired constructs were grown overnight (0/N) in liquid culture in LB media supplemented with both Amp (100 ug/ l) and Kan (25 ug/ml) . The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells were grown to an optical density 600 (O.D. 600 ) of between 0.4 and 0.6. IPTG (“Isopropyl-B-D-thiogalacto pyranoside”) was then added to a final concentration of 1 Mm. IPTG induces by inactivating the la repressor, clearing the P/O leading to increased gene expression. Cells were grown an extra 3 to 4 hours.
- O.D. 600 optical density 600
- IPTG Isopropyl-B-D-thiogalacto pyranoside
- solubilized hdCK2 was purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al. , J. Chromatography 411:177-184 (1984)) .
- hdCK2 (99 % pure) was eluted from the column in 6 molar guanidine HC1 pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HC1, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in this solution for 12 hours the protein was dialyzed to 10 mmolar sodium phosphate.
- the DNA sequence encoding the full length hdCK2 protein, ATCC # 75881, is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:
- the 5' primer has the sequence 5' GCGGGATCCATGG CCAAGAGCCCACTC 3' (SEQ ID No. 5) and contains a BamHI restriction enzyme site (in bold) followed by 18 nucleotides of hdCK2 coding sequence (the initiation codon for translation "ATG" is underlined) .
- the 3' primer has the sequence 5' GCGGGTACCTT ACAGATTCTTTACAAAGG 3' (SEQ ID No. 6) and contains the cleavage site for the restriction endonuclease Asp718 and 20 nucleotides complementary to the 3' sequence of the hdCK2 gene.
- the amplified sequences are isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.) .
- the fragment is then digested with the endonucleases BamHI and Asp7l8 and then purified again on a 1% agarose gel. This fragment is designated F2.
- the vector pA2 (modification of pVL94l vector, discussed below) is used for the expression of the hdCK2 protein using the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555) .
- This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhidrosis virus (AcMNPV) followed by the recognition sites for the restriction endonucleases BamHI and Asp718.
- the polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation.
- the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene.
- the polyhedrin sequences are flanked at both sides by viral sequences for the cell-mediated homologous recombination of co-transfected wild-type viral DNA.
- Many other baculovirus vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D. , Virology, 170:31-39) .
- the plasmid is digested with the restriction enzymes BamHI and Asp718 and then dephosphorylated using calf intestinal phosphatase by procedures known in the art.
- the DNA is then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.) . This vector DNA is designated V2.
- Fragment F2 and the dephosphorylated plasmid V2 are ligated with T4 DNA ligase.
- E.coli HB101 cells are then transformed and bacteria identified that contained the plasmid (pBac hdCK2) with the hdCK2 gene using the enzymes BamHI and Asp7l8. The sequence of the cloned fragment is confirmed by DNA sequencing.
- 5 ⁇ g of the plasmid pBac hdCK2 is co-transfected with 1.0 ⁇ g of a commercially available linearized baculovirus ("BaculoGoldTM baculovirus DNA", Pharmingen, San Diego, CA.) using the lipofection method (Feigner et al. Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)) .
- l ⁇ g of BaculoGoldTM virus DNA and 5 ⁇ g of the plasmid pBac hdCK2 are mixed in a sterile well of a microtiter plate containing 50 ⁇ l of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD) .
- plaque assay After four days the supernatant is collected and a plaque assay performed similar as described by Summers and Smith (supra) . As a modification an agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) is used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque assay” can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9- 10) .
- the virus is added to the cells and blue stained plaques are picked with the tip of an Eppendorf pipette.
- the agar containing the recombinant viruses is then resuspended in an Eppendorf tube containing 200 ⁇ l of Grace's medium.
- the agar is removed by a brief centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes.
- the supernatants of these culture dishes are harvested and then stored at 4°C.
- Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS.
- the cells are infected with the recombinant baculovirus V-hdCK2 at a multiplicity of infection (MOD of 2.
- MOD multiplicity of infection
- the medium is removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later 5 ⁇ Ci of 3S S-methionine and 5 ⁇ Ci 35 S cysteine (Amersham) are added.
- the cells are further incubated for 16 hours before they are harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
- hdCK2 HA The expression of plasmid, hdCK2 HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site.
- a DNA fragment encoding the entire hdCK2 precursor and a HA tag fused in frame to its 3 ' end is cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter.
- the HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H.
- HA tag to our target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
- the plasmid construction strategy is described as follows:
- the DNA sequence encoding hdCK2, ATCC # 75881, is constructed by PCR using two primers: the 5' primer 5' GCGGGATCCATGGCCAAGAGCCCACTC 3' (SEQ ID No. 7) contains a BamHI site followed by 18 nucleotides of hdCK2 coding sequence starting from the initiation codon,- the 3' sequence 5' GCGTCTAGATCAAGCGTAGTCTGGGACGTCGTATGGGTACAGATT CTTTACAAAGGTG 3' (SEQ ID No. 8) contains complementary sequences to an Xbal site, translation stop codon, HA tag and the last 19 nucleotides of the hdCK2 coding sequence (not including the stop codon) .
- the PCR product contains a BamHI site, hdCK2 coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and an Xbal site.
- the PCR amplified DNA fragment and the vector, pcDNAI/Amp are digested with BamHI and Xbal restriction enzyme and ligated.
- the ligation mixture is transformed into E. coli strain SURE (Stratagene Cloning Systems, La Jolla, C ) the transformed culture is plated on ampicillin media plates and resistant colonies are selected. Plasmid DNA is isolated from transformants and examined by restriction analysis for the presence of the correct fragment.
- COS cells are transfected with the expression vector by DEAE-DEXTRAN method.
- the expression of the hdCK2 HA protein is detected by radiolabelling and immunoprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells are labelled for 8 hours with 35 S-cysteine two days post transfection.
- Culture media are then collected and cells are lysed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)). Both cell lysate and culture media are precipitated with a HA specific monoclonal antibody. Proteins precipitated are analyzed on 15% SDS-PAGE gels.
- RIPA buffer 150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5
- RNAzolTM B system Biotecx Laboratories, Inc. Houston, TX
- About 10 ⁇ g of total RNA isolated from each human tissue specified is separated on 1% agarose gel and blotted onto a nylon filter. (Sambrook, Fritsch, and Maniatis, Molecular Cloning, Cold Spring Harbor Press, (1989)) .
- the labeling reaction is done according to the Stratagene Prime-It kit with 50ng DNA fragment.
- the labeled DNA is purified with a Select-G-50 column. (5 Prime - 3 Prime, Inc. Boulder, CO) .
- the filter is then hybridized with radioactive labeled full length hdCK2 gene at 1,000,000 cpm/ml in 0.5 M NaP0 4 , pH 7.4 and 7% SDS overnight at 65 ° C. After washing twice at room temperature and twice at 60'C with 0.5 x SSC, 0.1% SDS, the filter is then exposed at -70 ° C overnight with an intensifying screen.
- ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN,
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Molecular Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PCT/US1995/000532 WO1996021724A1 (en) | 1995-01-13 | 1995-01-13 | Human deoxycytidine kinase 2 |
Publications (2)
Publication Number | Publication Date |
---|---|
EP0815199A1 true EP0815199A1 (en) | 1998-01-07 |
EP0815199A4 EP0815199A4 (en) | 2000-08-16 |
Family
ID=22248507
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP95908512A Withdrawn EP0815199A4 (en) | 1995-01-13 | 1995-01-13 | Human deoxycytidine kinase 2 |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP0815199A4 (en) |
JP (1) | JPH10512749A (en) |
AU (1) | AU1680495A (en) |
WO (1) | WO1996021724A1 (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5817482A (en) * | 1997-06-20 | 1998-10-06 | Incyte Pharmaceuticals, Inc. | Disease related nucleotide kinases |
WO2003100045A1 (en) * | 2002-05-23 | 2003-12-04 | Wolfgang Knecht | Plant thymidine kinases and their use |
-
1995
- 1995-01-13 AU AU16804/95A patent/AU1680495A/en not_active Abandoned
- 1995-01-13 WO PCT/US1995/000532 patent/WO1996021724A1/en not_active Application Discontinuation
- 1995-01-13 EP EP95908512A patent/EP0815199A4/en not_active Withdrawn
- 1995-01-13 JP JP8521623A patent/JPH10512749A/en not_active Ceased
Non-Patent Citations (2)
Title |
---|
See also references of WO9621724A1 * |
STEGMANN A P A ET AL.: "Cloning of the Dck gene encoding rat deoxycytidine kinase" GENE, vol. 150, 1994, pages 351-354, XP002139839 * |
Also Published As
Publication number | Publication date |
---|---|
AU1680495A (en) | 1996-07-31 |
EP0815199A4 (en) | 2000-08-16 |
WO1996021724A1 (en) | 1996-07-18 |
JPH10512749A (en) | 1998-12-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20080227110A1 (en) | Human Genes, Sequences and Expression Products | |
CA2210444C (en) | Keratinocyte growth factor-2 | |
US6284504B1 (en) | Human DNA ligase III | |
US20040126377A1 (en) | Human inositol monophosphatase H1 | |
US5928924A (en) | Human geranylgeranyl pyrophosphate synthetase | |
US5650313A (en) | Ubiquitin conjugating enzymes 8 and 9 | |
US6552174B2 (en) | Human MutT2 antibodies | |
US6403310B1 (en) | Human inositol monophosphatase H1 | |
US6319700B1 (en) | Human choline acetyltransferase | |
US6455274B1 (en) | Human DNA Ligase IV | |
US6063376A (en) | Human deoxycytidine kinase 2 | |
US5849286A (en) | Ubiquitin conjugating enzymes 7,8 and 9 | |
US5914258A (en) | Human deoxycytidine kinase 2 | |
WO1996023410A1 (en) | UBIQUITIN CONJUGATING ENZYMES 7, 8 and 9 | |
EP0815199A1 (en) | Human deoxycytidine kinase 2 | |
EP0812360A1 (en) | Human geranylgeranyl pyrophosphate synthetase | |
US5859200A (en) | Human amine transporter | |
AU687484B2 (en) | Human dna ligase IV | |
US5798223A (en) | Polynucleotides encoding human amine transporter and methods of using the same | |
US5945321A (en) | Ubiquitin conjugating enzymes 7, 8 and 9 | |
EP0815220A1 (en) | Human amine transporter | |
EP0787013A1 (en) | Human hypoxanthine-(guanine) phosphoribosyl transferase-2 | |
WO1996015806A1 (en) | Human choline acetyltransferase | |
CA2203651A1 (en) | Dna ligase iv | |
JP2002233366A (en) | Human deoxycytidine kinase 2 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 19970812 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE |
|
A4 | Supplementary search report drawn up and despatched |
Effective date: 20000705 |
|
AK | Designated contracting states |
Kind code of ref document: A4 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE |
|
17Q | First examination report despatched |
Effective date: 20020814 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20040411 |