EP0784672A1 - Human inositol monophosphatase h1 - Google Patents
Human inositol monophosphatase h1Info
- Publication number
- EP0784672A1 EP0784672A1 EP94930440A EP94930440A EP0784672A1 EP 0784672 A1 EP0784672 A1 EP 0784672A1 EP 94930440 A EP94930440 A EP 94930440A EP 94930440 A EP94930440 A EP 94930440A EP 0784672 A1 EP0784672 A1 EP 0784672A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- polypeptide
- himp
- polynucleotide
- dna
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/02—Drugs for disorders of the urinary system of urine or of the urinary tract, e.g. urine acidifiers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/24—Antidepressants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/26—Psychostimulants, e.g. nicotine, cocaine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is human Inositol Monophosphatase HI, sometimes hereinafter referred to as "hIMP-Hl". The invention also relates to inhibiting the action of such polypeptides.
- Inositol lipid metabolism plays a key role in intracellular signalling.
- Agonist- induced stimulation of cells releases the signalling molecules diacylglycerol and inositol polyphosphates via phospholipase C hydrolysis of phosphoinositides.
- Diacylglycerol functions to stimulate protein kinase C (Nishizuka, Y., Science. 233:305-312 (1986), and several inositol polyphosphates, most notably inositol 1, 4, 5- triphosphate evoke the release of intracellular and intercellular calcium (Berridge, M.J. and Irvine, R.F., Nature. (London), 312, 315-321 (1984).
- Inositol monophosphatase plays an important role in the pho ⁇ phatidylinositol signalling pathway by catalyzing the hydrolysis of inositol monophosphates.
- IMP'S are believed to be the molecular site of action for lithium therapy for manic-depressive illness. Lithium inhibits inositol monophosphatase and prevents the accumulation of free inositol from inositol-1-phosphate.
- Lithium carbonate was shown to be an effective antimanic compound by John Cade in 1949, and this compound was approved for wide-spread use in 1969.
- treatment of manic- depressive patients with lithium is associated with certain deleterious side effects. These include tremor, weight gain, diarrhea, skin rash, transient leukocyto ⁇ i ⁇ , hypothyroidi ⁇ m, and polyuria-polydipsia.
- Additional clinical ailments associated with chronic lithium therapy are structural lesions in the kidney (including tubular atrophy, glomerular sclero ⁇ i ⁇ and interstitial fibrosis). These side effects are directly due to lithium toxicity.
- the phosphoinositide (PI) cycle is a likely target for lithium action, since it has been demonstrated that a profound elevation of inositol-1-phosphate and a corresponding decrease in free inositol in the brains of rats occurred when treated systemically with lithium. This was attributed to inhibition of inositol-1-phosphate phosphatase and led to the hypothe ⁇ i ⁇ that lithium was able to damp down the activity of the PI cycle in overstimulated cells, thus explaining its effectivenes ⁇ in controlling mania.
- Provi ⁇ ion of inositol for the PI cycle can come from hydrolysis of inositol phosphates, by de novo synthesis from glucose, or from the diet.
- the former proces ⁇ e ⁇ are dependent on the operation of inositol-1-phosphate phosphatase and are, therefore, inhibited by lithium.
- Dietary inositol can bypass lithium blockade in peripheral tissues but not in the CNS, since inositol does not cross the blood brain barrier.
- the increase in inositol-1- pho ⁇ phate in brain is accompanied by an equivalent decrease in free inositol.
- divalent ions i.e., calcium and manganese
- Lithium inhibits inositol monophosphate phosphatase uncompetitively.
- IMP liberates inositol from the substrates INS (1) P, INS (3) P and INS (4) P.
- IMP is also capable of hydrolyzing various non-inositol containing substrates including but not limited to those disclosed by Sherman, J. Biol. Chem.. 224:10896-10901 (1980), Takimoto, J. Bio. Chem. (Tokyo), 98:363-370 (1985) and by Gee, Bio. Chem J.. 249:883-889 (1988).
- the first human IMP cDNA was isolated and is disclosed by McAllister et al., (WO 93/25692 (1993)).
- polypeptide of the present invention has been putatively identified as a human inositol monophosphatase polypeptide. This identification has been made as a re ⁇ ult of amino acid sequence homology.
- a novel putative mature polypeptide which is hIMP-Hl, as well as fragments, analogs and derivatives thereof.
- the polypeptide of the present invention is of human origin.
- polynucleotides (DNA or RNA) which encode such polypeptides.
- a proces ⁇ for utilizing ⁇ uch polypeptides, or polynucleotides encoding such polypeptides for therapeutic purposes for example, for screening and designing compounds capable of inhibiting this class of enzymes, and for the treatment of psychiatric di ⁇ orders.
- antagonists against ⁇ uch polypeptides which may be used to inhibit the action of such polypeptides, for example, in the treatment of psychotic and depressive disorders (bipolar and non-bipolar) .
- Figure 1 discloses the cDNA sequence and corresponding deduced amino acid sequence of the mature form of hIMP-Hl.
- the amino acids DPIDGT have been shown to be essential at the active site of IMP enzymes and are shown bolded and underlined.
- Figure 2 shows the complete nucleotide sequence of hlMP- Hl cDNA.
- the positions of the synthetic BamHl (position 1) and Xhol linker (position 1308) used to clone the cDNA are shown underlined.
- Figure 3 is an amino acid comparison between hIMP-Hl and hIMP. The boxed areas indicate identical amino acids.
- Figure 4 is a Northern Blot Analy ⁇ is of hIMP-Hl.
- sequence of Figure 1 is based on several sequencing run ⁇ and the sequencing accuracy is considered to be at least 97%.
- an isolated nucleic acid (polynucleotide) which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75753 on April 25, 1994.
- a polynucleotide encoding a polypeptide of the present invention may be obtained from human brain, lymphocytes and placenta.
- the polynucleotide of this invention was discovered in a cDNA library derived from human brain tissue. It is structurally related to the inositol phosphatase family. It contains an open reading frame encoding a protein of about 265 amino acid residues. The protein exhibits the highest degree of homology to human inositol monophosphatase with 55 % identity and 65 % similarity over a 265 amino acid stretch. It is al ⁇ o important that the amino acid sequence DPIDGT is conserved in the polypeptide of the present invention, since this region has been shown to be essential at the active site of IMP enzymes.
- the polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
- the DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
- the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same, mature polypeptide as the DNA of Figure 1 or the deposited cDNA.
- the polynucleotide which encodes for the mature polypeptide of Figure 1 or for the mature polypeptide encoded by the depo ⁇ ited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
- polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding ⁇ equence.
- the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone.
- the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
- the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone.
- Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
- the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 or of the coding sequence of the deposited clone.
- an allelic variant i ⁇ an alternate, form of a polynucleotide ⁇ equence which may have a ⁇ ub ⁇ titution, deletion or addition of one or more nucleotide ⁇ , which does not substantially alter the function of the encoded polypeptide.
- the polynucleotides of the present invention may al ⁇ o have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention.
- the marker sequence may be a hexa- histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used.
- the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
- the present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at lea ⁇ t 50% and preferably 70% identity between the sequences.
- the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides .
- stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
- polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNA of Figure 1 or the deposited cDNA.
- the present invention further relates to a hIMP-Hl polypeptide which has the deduced amino acid sequence of Figure 1 or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of ⁇ uch polypeptide.
- fragment when referring to the polypeptide of Figure 1 or that encoded by the deposited cDNA, mean ⁇ a polypeptide which retains essentially the same biological function or activity as such polypeptide.
- an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
- the polypeptide of the pre ⁇ ent invention may be a recombinant polypeptide, a natural polypeptide or a ⁇ ynthetic polypeptide, preferably a recombinant polypeptide.
- the fragment, derivative or analog of the polypeptide of Figure 1 or that encoded by the depo ⁇ ited cDNA may be (i) one in which one or more of the amino acid residues are sub ⁇ tituted with a con ⁇ erved or non-con ⁇ erved amino acid re ⁇ idue (preferably a con ⁇ erved amino acid re ⁇ idue) and such sub ⁇ tituted amino acid re ⁇ idue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid re ⁇ idue ⁇ include ⁇ a sub ⁇ tituent group, or (iii) one in which the mature polypeptide i ⁇ fu ⁇ ed with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which i ⁇ employed for purification of the
- polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
- isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring).
- a naturally- occurring polynucleotide or polypeptide present in a living animal i ⁇ not i ⁇ olated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, i ⁇ i ⁇ olated.
- Such polynucleotide ⁇ could be part of a vector and/or ⁇ uch polynucleotides or polypeptides could be part of a compo ⁇ ition, and ⁇ till be isolated in that such vector or composition i ⁇ not part of it ⁇ natural environment.
- the present invention also relates to vectors which include polynucleotide ⁇ of the present invention, host cell ⁇ which are genetically engineered with vector ⁇ of the invention and the production of polypeptide ⁇ of the invention by recombinant technique ⁇ .
- Ho ⁇ t cell ⁇ are genetically engineered (tran ⁇ duced or transformed or tran ⁇ fected) with the vector ⁇ of thi ⁇ invention which may be, for example, a cloning vector or an expre ⁇ sion vector.
- the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
- the engineered ho ⁇ t cells can be cultured in conventional nutrient media modified as appropriate for activating promoter ⁇ , ⁇ electing transformants or amplifying the hIMP-Hl gene ⁇ .
- the culture condition ⁇ such as temperature, pH and the like, are those previously used with the host cell ⁇ elected for expre ⁇ ion, and will be apparent to the ordinarily skilled artisan.
- polynucleotides of the present invention may be employed for producing polypeptides by recombinant PCI7US94/10465
- the polynucleotide may be included in any one of a variety of expre ⁇ ion vector ⁇ for expressing a polypeptide.
- vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of pla ⁇ mid ⁇ and phage DNA, viral DNA ⁇ uch a ⁇ vaccinia, adenovirus, fowl pox virus, and pseudorabies.
- any other vector may be used as long a ⁇ it i ⁇ replicable and viable in the host.
- the appropriate DNA sequence may be inserted into the vector by a variety of procedure ⁇ .
- the DNA sequence i ⁇ inserted into an appropriate restriction endonuclea ⁇ e ⁇ ite( ⁇ ) by procedure ⁇ known in the art.
- procedure ⁇ and other ⁇ are deemed to be within the scope of those skilled in the art.
- the DNA sequence in the expression vector is operatively linked to an appropriate expre ⁇ ion control ⁇ equence( ⁇ ) (promoter) to direct mRNA ⁇ ynthe ⁇ i ⁇ .
- ⁇ equence( ⁇ ) promoter
- a ⁇ representative examples of such promoters there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda P L promoter and other promoters known to control expres ⁇ ion of genes in prokaryotic or eukaryotic cell ⁇ or their viru ⁇ e ⁇ .
- the expre ⁇ ion vector also contains a ribosome binding site for translation initiation and a transcription terminator.
- the vector may also include appropriate sequences for amplifying expres ⁇ ion.
- expre ⁇ ion vector ⁇ preferably contain one or more selectable marker gene ⁇ to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin re ⁇ i ⁇ tance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
- selectable marker gene ⁇ to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin re ⁇ i ⁇ tance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
- the vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
- bacterial cells such as E. coli. Streptomyces. Salmonella typhimurium: fungal cell ⁇ , such as yeast; insect cells such as Drosophila and Sf9: animal cells such a ⁇ CHO, COS or Bowes melanoma; plant cells, etc.
- Salmonella typhimurium fungal cell ⁇ , such as yeast
- insect cells such as Drosophila and Sf9
- animal cells such a ⁇ CHO, COS or Bowes melanoma
- plant cells etc.
- the selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.
- the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.
- the constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
- the con ⁇ truct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
- suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example.
- Bacterial pQE70, pQE60, pQE-9 (Qiagen), pb ⁇ , pDIO, phage ⁇ cript, p ⁇ iX174, pblue ⁇ cript SK, pb ⁇ ks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia).
- Eukaryotic pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia).
- any other plasmid or vector may be u ⁇ ed a ⁇ long as they are replicable and viable in the host.
- Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
- Two appropriate vectors are PKK232-8 and PCM7.
- Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , P L and trp.
- Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retroviru ⁇ . and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
- the present invention relates to host cells containing the above-described construct ⁇ .
- the host cell can be a higher eukaryotic cell, ⁇ uch a ⁇ a mammalian cell, or a lower eukaryotic cell, ⁇ uch a ⁇ a yea ⁇ t cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
- Introduction of the construct into the host cell can be effected by calcium pho ⁇ phate tran ⁇ feetion, DEAE- Dextran mediated tran ⁇ fection, or electroporation. (Davi ⁇ , L., Dibner, M. , Battey, I., Ba ⁇ ic Method ⁇ in Molecular Biology, (1986)).
- the con ⁇ truct ⁇ in host cell ⁇ can be used in a conventional manner to produce the gene product encoded by the recombinant ⁇ equence.
- the polypeptide ⁇ of the invention can be synthetically produced by conventional peptide synthesizer ⁇ .
- Mature protein ⁇ can be expre ⁇ ed in mammalian cell ⁇ , yea ⁇ t, bacteria, or other cell ⁇ under the control of appropriate promoters.
- Cell-free translation system ⁇ can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
- Appropriate cloning and expression vector ⁇ for u ⁇ e with prokaryotic and eukaryotic ho ⁇ ts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the di ⁇ clo ⁇ ure of which is hereby incorporated by reference.
- Enhancers are cis-acting element ⁇ of DNA, u ⁇ ually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma ' enhancer on the late ⁇ ide of the replication origin, and adenoviru ⁇ enhancers.
- recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
- promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinasie (PGK), ⁇ -factor, acid phosphatase, or heat shock proteins, among others.
- the heterologou ⁇ ⁇ equence can encode a fu ⁇ ion protein including an N-terminal identification peptide imparting de ⁇ ired characteri ⁇ tic ⁇ , e.g., ⁇ tabilization or ⁇ implified purification of expre ⁇ sed recombinant product.
- Useful expres ⁇ ion vector ⁇ for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with ⁇ uitable tran ⁇ lation initiation and termination signals in operable reading phase with a functional promoter.
- the vector will comprise one or more phenotypic selectable markers and an origin of replication to en ⁇ ure maintenance of the vector and to, if de ⁇ irable, provide amplification within the ho ⁇ t.
- Suitable prokaryotic host ⁇ for transformation include E. coli. Bacillus subtili ⁇ . Salmonella typhimurium and variou ⁇ ⁇ pecie ⁇ within the genera P ⁇ eudo ona ⁇ , Streptomyces, and Staphylococcu ⁇ , although other ⁇ may al ⁇ o be employed a ⁇ a matter of choice.
- useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available pla ⁇ id ⁇ compri ⁇ ing genetic element ⁇ of the well known cloning vector pBR322 (ATCC 37017).
- Such commercial vector ⁇ include, for example, pKK223-3 (Pharmacia Fine Chemical ⁇ , Upp ⁇ ala, Sweden) and GEM1 (Promega Biotec, Madi ⁇ on, WI, USA).
- the ⁇ e pBR322 "backbone" ⁇ ection ⁇ are combined with an appropriate promoter and the ⁇ tructural sequence to be expressed.
- the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cell ⁇ are cultured for an additional period.
- Cell ⁇ are typically harve ⁇ ted by centrifugation, di ⁇ rupted by physical or chemical means, and the resulting crude extract retained for further purification.
- Microbial cells employed in expres ⁇ ion of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
- mammalian cell culture sy ⁇ tem ⁇ can al ⁇ o be employed to express recombinant protein.
- mammalian expression systems include the COS-7 lines of monkey kidney fibroblast ⁇ , described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expre ⁇ ing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell line ⁇ .
- Mammalian expre ⁇ sion vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding site ⁇ , polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontran ⁇ cribed ⁇ equence ⁇ .
- DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic element ⁇ .
- the hIMP-Hl polypeptide ⁇ can be recovered and purified from recombinant cell culture ⁇ by method ⁇ including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulo ⁇ e chromatography, hydrophobic interaction chromatography, affinity chromatography hydroxylapatite chromatography and lectin chromatography. It is preferred to have low concentrations (approximately 0.15-5 mM) of calcium ion present during purification. (Price et al., J. Biol. Chem., 244:917 (1969)). Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
- HPLC high performance liquid chromatography
- the polypeptide ⁇ of the pre ⁇ ent invention may be a naturally purified product, or a product of chemical ⁇ ynthetic procedure ⁇ , or produced by recombinant technique ⁇ from a prokaryotic or eukaryotic ho ⁇ t (for example, by bacterial, yea ⁇ t, higher plant, in ⁇ ect and mammalian cell ⁇ in culture) .
- a prokaryotic or eukaryotic ho ⁇ t for example, by bacterial, yea ⁇ t, higher plant, in ⁇ ect and mammalian cell ⁇ in culture
- the polypeptide ⁇ of the pre ⁇ ent invention may be glyco ⁇ ylated or may be non-glyco ⁇ ylated.
- Polypeptide ⁇ of the invention may also include an initial methionine amino acid residue.
- hIMP-Hl may be employed to design alternative therapeutic compounds, other than lithium, for manic- depre ⁇ ive illne ⁇ ses. hIMP-Hl is therefore useful for screening and designing compounds capable of inhibiting h
- hIMP-Hl Another use for hIMP-Hl is the mapping of genetic diseases. For example, the exact genetic lesion( ⁇ ) responsible for some forms of hereditary manic-depressive illness are still unknown but are the subject of intense inve ⁇ tigation (York, et al., PNAS USA. 90:5833-5837, (1993)). One of the target ⁇ of this inve ⁇ tigation i ⁇ the IMP gene.
- the hIMP-Hl cDNA can be used to isolate the chromosomal locus of the complete gene. This region of the chromosome can then be tested to determine if any mutations in families affected by manic depres ⁇ ion and po ⁇ ibly other p ⁇ ychiatric di ⁇ order ⁇ are localized in this region.
- the polynucleotide of the present invention is also useful for identifying other molecules which have similar biological activity.
- a portion of the coding region of the hIMP-Hl gene may be employed as an oligonucleotide probe.
- Labeled oligonucleotides having a ⁇ equence complementary to that of the gene of the pre ⁇ ent invention are u ⁇ ed to ⁇ creen a library of human cDNA, genomic DNA or mRNA to determine which member ⁇ of the library the probe hybridizes to.
- the present invention relates to an as ⁇ ay which identifie ⁇ compound ⁇ which block (antagoni ⁇ t ⁇ ) hIMP-Hl from functioning.
- the purification, cloning and X-ray cry ⁇ tallization of hIMP-Hl is undertaken. From the cloned enzyme structural data is generated, especially X-ray crystallographic and structural data is obtained and used to screen for and design antagonist ⁇ to hIMP-Hl.
- An example of such a screen includes mea ⁇ uring the release of [ 14 C]inositol from DL-Ins(l)P containing L-[U- I4 C]Ins(l)P a ⁇ label, as described in (Gumber et al., Plant Phy ⁇ iol., 76:40-44 (1989)).
- One unit of enzyme activity repre ⁇ ent ⁇ 1 ⁇ ol of ⁇ ub ⁇ trate hydrolysed/min, at 37°C. Protein concentrations may be determined by the method of Bradford (Bradford, M. , Anal. Biochem., 72:248-252 (1976)).
- phosphoinositol kina ⁇ e ⁇ which are enzymes involved in the phosphatidylino ⁇ itol ⁇ ignaling pathway, namely they catalyze the hydroly ⁇ i ⁇ of the 1 po ⁇ ition phosphate from inositol 1,3,4-triphosphate and inositol 1,4-biphosphate.
- Potential antagonists include an antibody against the hIMP-Hl polypeptide which binds thereto making the hIMP-Hl polypeptide inaccessible to substrate.
- Potential antagonists also include proteins which are mimetics of hIMP-Hl (a closely related protein which doe ⁇ not retain hIMP-Hl function) which recognize and bind to the receptor subtypes which hIMP-Hl normally binds. However, there is no second messenger response. In this manner, the function of the hIMP-Hl enzyme is prevented and the beneficial therapeutic effects of inhibiting hIMP-Hl are achieved.
- proteins include, but are not limited to, oligonucleotides and ⁇ mall-peptide molecules.
- Antisen ⁇ e technology may also be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
- the 5' coding portion of the polynucleotide sequence which encodes for the mature polypeptide ⁇ of the pre ⁇ ent invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pair ⁇ in length.
- the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the hIMP-Hl (antisense - Okano, J. Neurochem. , 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expres ⁇ ion, CRC Press, Boca Raton, FL (1988)).
- the oligonucleotides described above can also be delivered to cells such that the anti ⁇ en ⁇ e RNA or DNA may be expressed in vivo to inhibit production of hIMP-Hl.
- Another potential antagonist is a small molecule which binds to and occupies the catalytic site of the hIMP-Hl enzyme thereby making the catalytic site inaccessible to a substrate such that normal biological activity is prevented.
- small molecules include but are not limited to small peptides or peptide-like molecules.
- the antagonist ⁇ may be used to treat psychotic and depressive disorders (bipolar and non-bipolar) other than mania.
- the antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.
- the compounds which inhibit the action of hIMP-Hl may be employed in combination with a suitable pharmaceutical carrier.
- a suitable pharmaceutical carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
- a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
- the formulation should suit the mode of administration.
- the pharmaceutical composition ⁇ may be administered in a convenient manner such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneou ⁇ , intranasal or intradermal route ⁇ .
- the pharmaceutical compo ⁇ ition ⁇ are administered in an amount which is effective for treating and/or prophylaxis of the specific indication.
- the amount administered is an amount of at least about 10 ⁇ g/kg body weight and in most cases they will be administered in an amount not in exces ⁇ of about 8 mg/Kg body weight per day.
- the dosage is from about 10 ⁇ g/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
- the compounds identified which inhibit hIMP-Hl and which are polypeptides may also be employed in accordance with the pre ⁇ ent invention by expre ⁇ ion of such polypeptides in vivo, which i ⁇ often referred to a ⁇ "gene therapy.”
- cell ⁇ from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a 85 7 PC17US94/10465
- cell ⁇ may be engineered by procedure ⁇ known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
- cell ⁇ may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art.
- a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo.
- the expres ⁇ ion vehicle for engineering cell ⁇ may be other than a retroviru ⁇ , for example, an adenoviru ⁇ which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
- sequences of the present invention are also valuable for chromosome identification.
- the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
- Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
- the mapping of DNAs to chromosome ⁇ according to the present invention is an important first step in correlating those sequences with genes associated with disease.
- sequences can be mapped to chromosome ⁇ by preparing PCR primer ⁇ (preferably 15-25 bp) from the cDNA.
- Computer analysis of the cDNA is used to rapidly select primers that do not span more than one exon in the genomic PCIYUS94/10465
- PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
- sublocalization can be achieved with panels of fragment ⁇ from ⁇ pecific chromosomes or pools of large genomic clones in an analogous manner.
- Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
- Fluore ⁇ cence in situ hybridization (FISH) of a cDNA clone ⁇ to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
- This technique can be used with cDNA as short as 500 or 600 bases; however, clones larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with ⁇ ufficient ⁇ ignal inten ⁇ ity for ⁇ imple detection.
- FISH require ⁇ u ⁇ e of the clone ⁇ from which the EST wa ⁇ derived, and the longer the better.
- chromosomal region are then identified through linkage analysi ⁇ (coinheritance of physically adjacent genes).
- a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb).
- polypeptide ⁇ , their fragment ⁇ or other derivative ⁇ , or analog ⁇ thereof, or cell ⁇ expre ⁇ sing them can be used as an immunogen to produce antibodies thereto.
- These antibodies can be, for example, polyclonal or monoclonal antibodies.
- the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expre ⁇ sion library. Variou ⁇ procedure ⁇ known in the art may be used for the production of ⁇ uch antibodie ⁇ and fragments.
- Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptide ⁇ to an animal, preferably a nonhuman. The antibody ⁇ o obtained will then bind the polypeptide ⁇ itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
- any technique which provide ⁇ antibodie ⁇ produced by continuou ⁇ cell line culture ⁇ can be used.
- Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodie ⁇ (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Lies, Inc., pp. 77-96).
- Antibodie ⁇ ⁇ pecific to the hIMP-Hl polypeptide could be used a ⁇ part of a diagnostic assay to detect the concentration of hIMP-Hl in a sample derived from a subject. Abnormal levels of hIMP-Hl, if detected, may therefore be indicative of an increase in free inositol in the ⁇ ubject' ⁇ brain and corre ⁇ ponding psychotic and/or other physiological disorder ⁇ .
- Pla ⁇ mid ⁇ are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
- the starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures.
- equivalent pla ⁇ mid ⁇ to tho ⁇ e de ⁇ cribed are known in the art and will be apparent to the ordinarily ⁇ killed arti ⁇ an.
- Digestion of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequence ⁇ in the DNA.
- the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
- plasmid or DNA fragment typically 1 ⁇ g is used with about 2 unit ⁇ of enzyme in about 20 ⁇ l of buffer ⁇ olution.
- i ⁇ olating DNA fragment ⁇ for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 unit ⁇ of enzyme in a larger volume. Appropriate buffers and sub ⁇ trate amount ⁇ for particular re ⁇ triction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37 * C are ordinarily used, but may vary in accordance with the supplier' ⁇ instructions. After digestion the reaction i ⁇ electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
- Oligonucleotides refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
- Ligasion refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniati ⁇ , T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units to T4 DNA ligase PC17US94/10465
- liga ⁇ e per 0.5 ⁇ g of approximately equimolar amount ⁇ of the DNA fragment ⁇ to be ligated.
- the 5' oligonucleotide primer has the sequence 5' ACTTGCTACGGATCCATGTGCACCACAGGGGCG 3' contains a Bam HI re ⁇ triction enzyme ⁇ ite followed by 18 nucleotide ⁇ of hIMP-Hl coding ⁇ equence starting from the presumed terminal amino acid of the processed protein codon.
- the 3' sequence 5' ACTTGCTACAAGCTTTCACTTCTCATCATCCCG 3' contains a Hind III site and is followed by 18 nucleotides of hIMP-Hl including the final stop codon.
- the restriction enzymes ⁇ ites correspond to the restriction enzyme sites on the bacterial expres ⁇ ion vector pQE-9 (Qiagen, Inc.
- pQE-9 encodes antibiotic resistance (Amp r ) , a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/O), a ribosome binding site (RBS), a 6-Hi ⁇ tag and restriction enzyme site ⁇ .
- pQE-9 wa ⁇ then dige ⁇ ted with Bam HI and Hind III. The amplified sequences were ligated into pQE-9 and were inserted in frame with the sequence encoding for the histidine tag and the RBS. The ligation mixture wa ⁇ then u ⁇ ed to tran ⁇ form E.
- M15/rep4 contains multiple copies of the plasmid pREP4, which expresse ⁇ the lad repressor and also confer ⁇ kanamycin resistance (Kan 1 ) .
- Transformant ⁇ are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysis.
- Clones containing the de ⁇ ired con ⁇ truct ⁇ were grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml).
- the O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250.
- the cells were grown to an optical den ⁇ ity 600 (O.D.* 00 ) of between 0.4 and 0.6.
- IPTG I ⁇ opropyl-B-D-thiogalacto pyranoside
- IPTG induce ⁇ by inactivating the lad repressor, clearing the P/O leading to increased gene expression.
- Cells were grown an extra 3 to 4 hours.
- hIMP-Hl wa ⁇ purified from thi ⁇ ⁇ olution by chromatography on a Nickel- Chelate column under condition ⁇ that allow for tight binding by protein ⁇ containing the 6-Hi ⁇ tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984).
- hIMP-Hl (95 % pure) wa ⁇ eluted from the column in 6 molar guanidine HCI pH 5.0 and for the purpo ⁇ e of renaturation adjusted to 3 molar guanidine HCI, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in this solution for 12 hour ⁇ the protein wa ⁇ dialyzed to 10 mmolar sodium phosphate.
- the 5' primer has the sequence 5' CCGG ⁇ TCCGCCACC ATGTGCACCACAGGGGCGGGG 3' and contains a Bam HI restriction enzyme site (in bold) followed by 6 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (Kozak, M. , J. Mol. Biol., 196:947-950 (1987) and is just behind the first 21 nucleotides of the hIMP-Hl gene (the initiation codon for tran ⁇ lation "ATG" i ⁇ underlined) .
- the 3' primer has the sequence 5' CACAGGTACCCAGCTT TGCCTCAGCCGCAG 3' contain ⁇ the cleavage site for the restriction endonuclea ⁇ e Asp718 and 20 nucleotides complementary to the 3' non-tran ⁇ lated ⁇ equence of the hlMP- Hl gene.
- the amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.). The fragment was then digested with the endonuclease ⁇ Bam HI and A ⁇ p718 and then purified again on a 1% agarose gel. This fragment is designated F2.
- the vector pRGl (modification of pVL941 vector, discu ⁇ sed below) is used for the expression of the hIMP-Hl protein using the baculoviru ⁇ expre ⁇ ion ⁇ ystem (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vector ⁇ and in ⁇ ect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555).
- This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedro ⁇ i ⁇ viru ⁇ (AcMNPV) followed by the recognition ⁇ ite ⁇ for the restriction endonucleases Bam HI and Asp718.
- the polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation.
- SV simian virus
- the polyhedrin sequences are flanked at both side ⁇ by viral ⁇ equence ⁇ for the cell-mediated homologous recombination of cotransfected wild-type viral DNA.
- baculovirus vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31-39).
- the plasmid was digested with the restriction enzymes Bam HI and Asp718 then dephosphorylated using calf intestinal phosphatase by procedures known in the art.
- the DNA was then isolated from a 1% agarose gel u ⁇ ing the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated V2.
- Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase.
- E.coli HB101 cell ⁇ were then tran ⁇ formed and bacteria identified that contained the pla ⁇ mid (pBachlMP-Hl) with the hIMP-Hl gene u ⁇ ing the enzymes Bam HI and A ⁇ p718.
- the sequence of the cloned fragment was confirmed by DNA sequencing.
- the plate wa ⁇ rocked back and forth to mix the newly added ⁇ olution.
- the plate wa ⁇ then incubated for 5 hour ⁇ at 27°C.
- the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum was added.
- the plate was put back into an incubator and cultivation continued at 27°C for four days.
- plaque assay performed similar as described by Summers and Smith (supra). As a modification an agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) was used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque as ⁇ ay” can al ⁇ o be found in the user's guide for in ⁇ ect cell culture and baculovirology di ⁇ tributed by Life Technologies Inc., Gaithersburg, page 9- 10) .
- Sf9 cell ⁇ were grown in Grace's medium supplemented with 10% heat-inactivated FBS.
- the cells were infected with the recombinant baculoviru ⁇ V-hlMP-Hl at a multiplicity of infection (MOI) of 2.
- MOI multiplicity of infection
- the medium wa ⁇ removed and replaced with SF900 II medium minu ⁇ methionine and cy ⁇ teine (Life Technologie ⁇ Inc., Gaither ⁇ burg) .
- the cells were further incubated for 16 hours before they were harve ⁇ ted by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
- telomere sequence a DNA sequence encoding the entire hIMP-Hl precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter.
- the HA tag correspond ⁇ to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767).
- the infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
- the plasmid construction strategy is de ⁇ cribed a ⁇ follows:
- the DNA sequence encoding hIMP-Hl was constructed by PCR on the original EST cloned using two primers: the 5' primer 5' 5' CCGGATCCGCCACC ATGTGCACCACAGGGGCGGGG 3' and contains a Bam HI restriction enzyme site (in bold), and 18 nucleotides of hIMP-Hl starting from the initiation codon (underlined); the 3' sequence CGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATGGGTACTT
- CTCATCATCCCGCCC which contains complementary sequences to an Xbal restriction site, translation ⁇ top codon, HA tag and the la ⁇ t 18 nucleotide ⁇ of the hIMP-Hl coding ⁇ equence (not including the ⁇ top codon). Therefore, the PCR product contains a hIMP-Hl coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and a Bam HI and Xbal site.
- the PCR amplified DNA fragment and the vector, pcDNAI/Amp were digested with Bam HI and Xba I restriction enzymes and ligated. The ligation mixture was transformed into E.
- RNAzolTM B ⁇ ystem Biotecx Laboratorie ⁇ , Inc. 6023 South Loop East, Houston, TX 77033. About lO ⁇ g of total RNA isolated from each human tissue specified was ⁇ eparated on 1% agaro ⁇ e gel and blotted onto a nylon filter. (Sambrook, Frit ⁇ ch, and Maniati ⁇ , Molecular Cloning, Cold Spring Harbor Pre ⁇ , (1989)). The labeling reaction wa ⁇ done according to the Stratagene Prime- It kit with 50ng DNA fragment.
- the labeled DNA was purified with a Select-G-50 column. (5 Prime - 3 Prime, Inc. 5603 Arapahoe Road, Boulder, CO 80303).
- the filter was then hybridized with radioactive labeled full length hIMP-Hl gene at 1,000,000 cpm/ml in 0.5 M NaP0 4 , pH 7.4 and 7% SDS overnight at 65 * C. After wash twice at room temperature and twice at 60 * C with 0.5 x SSC, 0.1% SDS, the filter was then exposed at -70 * C overnight with an intensifying screen.
- the message RNA for hIMP-Hl is abundant in several tis ⁇ ue ⁇ . ( Figure 4) .
- ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN,
- CTCCCAAGGC CTCCCTGGGC TGCTGTGGGC TCCTGGGGAG GTGGCCCTCG TGGCCCACGC 960
- ATGTGCACCA CAGGGGCGGG GCTGGAGATC ATCAGAAAAG CCCTTACTGA GGAAAAACGT 60
- Glu Phe Gly Val lie Tyr Hi ⁇ Cy ⁇ Thr Glu Glu Arg Leu Tyr Thr
- 140 145 150 lie Gly Pro Ly ⁇ Arg A ⁇ p Pro Ala Thr Leu Ly ⁇ Leu Phe Leu Ser
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Zoology (AREA)
- Psychiatry (AREA)
- Wood Science & Technology (AREA)
- Endocrinology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Urology & Nephrology (AREA)
- Microbiology (AREA)
- Reproductive Health (AREA)
- Pain & Pain Management (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
Description
Claims
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PCT/US1994/010465 WO1996008557A1 (en) | 1994-09-16 | 1994-09-16 | Human inositol monophosphatase h1 |
Publications (2)
Publication Number | Publication Date |
---|---|
EP0784672A1 true EP0784672A1 (en) | 1997-07-23 |
EP0784672A4 EP0784672A4 (en) | 1999-03-17 |
Family
ID=22242985
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP94930440A Withdrawn EP0784672A4 (en) | 1994-09-16 | 1994-09-16 | Human inositol monophosphatase h1 |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP0784672A4 (en) |
JP (1) | JPH10505747A (en) |
AU (1) | AU7956494A (en) |
WO (1) | WO1996008557A1 (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6709653B1 (en) | 1994-09-16 | 2004-03-23 | Human Genome Sciences, Inc. | Antibodies specific for human inositol monophosphatase H1 |
AU736680B2 (en) * | 1996-10-28 | 2001-08-02 | Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The | Chromosomal markers and diagnostic tests for manic-depressive illness |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0485026A2 (en) * | 1990-11-08 | 1992-05-13 | MERCK SHARP & DOHME LTD. | Antimanic phenoxymethylene bisphosphonate derivatives |
WO1993025692A1 (en) * | 1992-06-10 | 1993-12-23 | Merck Sharp & Dohme Limited | cDNA CLONING OF INOSITOL MONOPHOSPHATASE |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4981980A (en) * | 1989-09-14 | 1991-01-01 | Merck & Co., Inc. | Drug for treating manic depression |
-
1994
- 1994-09-16 WO PCT/US1994/010465 patent/WO1996008557A1/en not_active Application Discontinuation
- 1994-09-16 AU AU79564/94A patent/AU7956494A/en not_active Abandoned
- 1994-09-16 EP EP94930440A patent/EP0784672A4/en not_active Withdrawn
- 1994-09-16 JP JP8510137A patent/JPH10505747A/en not_active Ceased
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0485026A2 (en) * | 1990-11-08 | 1992-05-13 | MERCK SHARP & DOHME LTD. | Antimanic phenoxymethylene bisphosphonate derivatives |
WO1993025692A1 (en) * | 1992-06-10 | 1993-12-23 | Merck Sharp & Dohme Limited | cDNA CLONING OF INOSITOL MONOPHOSPHATASE |
Non-Patent Citations (2)
Title |
---|
BONE R. ET AL.: "Structure of inositol monophosphatase, the putative target of lithium therapy" PNAS,U.S.A., vol. 89, no. 21, 1 November 1992, pages 10031-10035, XP002089705 * |
See also references of WO9608557A1 * |
Also Published As
Publication number | Publication date |
---|---|
AU7956494A (en) | 1996-03-29 |
WO1996008557A1 (en) | 1996-03-21 |
JPH10505747A (en) | 1998-06-09 |
EP0784672A4 (en) | 1999-03-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CA2203655C (en) | Tumor necrosis factor-gamma | |
WO1996013603A1 (en) | INTERLEUKIN-1 β CONVERTING ENZYME LIKE APOPTOSIS PROTEASE-3 AND 4 | |
WO1996018725A1 (en) | Human tissue inhibitor of metalloproteinase-4 | |
AU689492B2 (en) | Connective tissue growth factor-2 | |
US6709653B1 (en) | Antibodies specific for human inositol monophosphatase H1 | |
US6284504B1 (en) | Human DNA ligase III | |
US5985601A (en) | DNA encoding human cystatin E | |
US5955339A (en) | Human inositol monophosphatase H1 | |
EP0784672A1 (en) | Human inositol monophosphatase h1 | |
WO1996003415A1 (en) | Human potassium channel 1 and 2 proteins | |
US6455274B1 (en) | Human DNA Ligase IV | |
US6063376A (en) | Human deoxycytidine kinase 2 | |
WO1996023410A1 (en) | UBIQUITIN CONJUGATING ENZYMES 7, 8 and 9 | |
WO1996030524A1 (en) | Human dna ligase iii | |
WO1997018224A1 (en) | Human stem cell antigen 2 | |
US5914258A (en) | Human deoxycytidine kinase 2 | |
EP0812360A1 (en) | Human geranylgeranyl pyrophosphate synthetase | |
US5859200A (en) | Human amine transporter | |
AU687484B2 (en) | Human dna ligase IV | |
EP0815199A1 (en) | Human deoxycytidine kinase 2 | |
EP0804226A1 (en) | Human choline acetyltransferase | |
US5945321A (en) | Ubiquitin conjugating enzymes 7, 8 and 9 | |
WO1996015222A1 (en) | HUMAN MutT2 | |
WO1996012501A1 (en) | Human hypoxanthine-(guanine) phosphoribosyl transferase-2 | |
CA2194765A1 (en) | Connective tissue growth factor-2 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 19970416 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE |
|
RHK1 | Main classification (correction) |
Ipc: C12N 15/55 |
|
A4 | Supplementary search report drawn up and despatched |
Effective date: 19990129 |
|
AK | Designated contracting states |
Kind code of ref document: A4 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE |
|
17Q | First examination report despatched |
Effective date: 20010219 |
|
GRAP | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOSNIGR1 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20050108 |