WO1996008557A1 - Human inositol monophosphatase h1 - Google Patents

Human inositol monophosphatase h1 Download PDF

Info

Publication number
WO1996008557A1
WO1996008557A1 PCT/US1994/010465 US9410465W WO9608557A1 WO 1996008557 A1 WO1996008557 A1 WO 1996008557A1 US 9410465 W US9410465 W US 9410465W WO 9608557 A1 WO9608557 A1 WO 9608557A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
himp
polynucleotide
dna
sequence
Prior art date
Application number
PCT/US1994/010465
Other languages
French (fr)
Inventor
Paul S. Meissner
Jeannine D. Gocayne
Original Assignee
Human Genome Sciences, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences, Inc. filed Critical Human Genome Sciences, Inc.
Priority to EP94930440A priority Critical patent/EP0784672A4/en
Priority to PCT/US1994/010465 priority patent/WO1996008557A1/en
Priority to JP8510137A priority patent/JPH10505747A/en
Priority to AU79564/94A priority patent/AU7956494A/en
Publication of WO1996008557A1 publication Critical patent/WO1996008557A1/en
Priority to US09/002,072 priority patent/US5955339A/en
Priority to US09/314,198 priority patent/US6403310B1/en
Priority to US09/314,199 priority patent/US6130051A/en
Priority to US09/440,113 priority patent/US6709653B1/en
Priority to US10/732,271 priority patent/US20040126377A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/02—Drugs for disorders of the urinary system of urine or of the urinary tract, e.g. urine acidifiers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/24—Antidepressants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/26—Psychostimulants, e.g. nicotine, cocaine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is human Inositol Monophosphatase HI, sometimes hereinafter referred to as "hIMP-Hl". The invention also relates to inhibiting the action of such polypeptides.
  • Inositol lipid metabolism plays a key role in intracellular signalling.
  • Agonist- induced stimulation of cells releases the signalling molecules diacylglycerol and inositol polyphosphates via phospholipase C hydrolysis of phosphoinositides.
  • Diacylglycerol functions to stimulate protein kinase C (Nishizuka, Y., Science. 233:305-312 (1986), and several inositol polyphosphates, most notably inositol 1, 4, 5- triphosphate evoke the release of intracellular and intercellular calcium (Berridge, M.J. and Irvine, R.F., Nature. (London), 312, 315-321 (1984).
  • Inositol monophosphatase plays an important role in the pho ⁇ phatidylinositol signalling pathway by catalyzing the hydrolysis of inositol monophosphates.
  • IMP'S are believed to be the molecular site of action for lithium therapy for manic-depressive illness. Lithium inhibits inositol monophosphatase and prevents the accumulation of free inositol from inositol-1-phosphate.
  • Lithium carbonate was shown to be an effective antimanic compound by John Cade in 1949, and this compound was approved for wide-spread use in 1969.
  • treatment of manic- depressive patients with lithium is associated with certain deleterious side effects. These include tremor, weight gain, diarrhea, skin rash, transient leukocyto ⁇ i ⁇ , hypothyroidi ⁇ m, and polyuria-polydipsia.
  • Additional clinical ailments associated with chronic lithium therapy are structural lesions in the kidney (including tubular atrophy, glomerular sclero ⁇ i ⁇ and interstitial fibrosis). These side effects are directly due to lithium toxicity.
  • the phosphoinositide (PI) cycle is a likely target for lithium action, since it has been demonstrated that a profound elevation of inositol-1-phosphate and a corresponding decrease in free inositol in the brains of rats occurred when treated systemically with lithium. This was attributed to inhibition of inositol-1-phosphate phosphatase and led to the hypothe ⁇ i ⁇ that lithium was able to damp down the activity of the PI cycle in overstimulated cells, thus explaining its effectivenes ⁇ in controlling mania.
  • Provi ⁇ ion of inositol for the PI cycle can come from hydrolysis of inositol phosphates, by de novo synthesis from glucose, or from the diet.
  • the former proces ⁇ e ⁇ are dependent on the operation of inositol-1-phosphate phosphatase and are, therefore, inhibited by lithium.
  • Dietary inositol can bypass lithium blockade in peripheral tissues but not in the CNS, since inositol does not cross the blood brain barrier.
  • the increase in inositol-1- pho ⁇ phate in brain is accompanied by an equivalent decrease in free inositol.
  • divalent ions i.e., calcium and manganese
  • Lithium inhibits inositol monophosphate phosphatase uncompetitively.
  • IMP liberates inositol from the substrates INS (1) P, INS (3) P and INS (4) P.
  • IMP is also capable of hydrolyzing various non-inositol containing substrates including but not limited to those disclosed by Sherman, J. Biol. Chem.. 224:10896-10901 (1980), Takimoto, J. Bio. Chem. (Tokyo), 98:363-370 (1985) and by Gee, Bio. Chem J.. 249:883-889 (1988).
  • the first human IMP cDNA was isolated and is disclosed by McAllister et al., (WO 93/25692 (1993)).
  • polypeptide of the present invention has been putatively identified as a human inositol monophosphatase polypeptide. This identification has been made as a re ⁇ ult of amino acid sequence homology.
  • a novel putative mature polypeptide which is hIMP-Hl, as well as fragments, analogs and derivatives thereof.
  • the polypeptide of the present invention is of human origin.
  • polynucleotides (DNA or RNA) which encode such polypeptides.
  • a proces ⁇ for utilizing ⁇ uch polypeptides, or polynucleotides encoding such polypeptides for therapeutic purposes for example, for screening and designing compounds capable of inhibiting this class of enzymes, and for the treatment of psychiatric di ⁇ orders.
  • antagonists against ⁇ uch polypeptides which may be used to inhibit the action of such polypeptides, for example, in the treatment of psychotic and depressive disorders (bipolar and non-bipolar) .
  • Figure 1 discloses the cDNA sequence and corresponding deduced amino acid sequence of the mature form of hIMP-Hl.
  • the amino acids DPIDGT have been shown to be essential at the active site of IMP enzymes and are shown bolded and underlined.
  • Figure 2 shows the complete nucleotide sequence of hlMP- Hl cDNA.
  • the positions of the synthetic BamHl (position 1) and Xhol linker (position 1308) used to clone the cDNA are shown underlined.
  • Figure 3 is an amino acid comparison between hIMP-Hl and hIMP. The boxed areas indicate identical amino acids.
  • Figure 4 is a Northern Blot Analy ⁇ is of hIMP-Hl.
  • sequence of Figure 1 is based on several sequencing run ⁇ and the sequencing accuracy is considered to be at least 97%.
  • an isolated nucleic acid (polynucleotide) which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75753 on April 25, 1994.
  • a polynucleotide encoding a polypeptide of the present invention may be obtained from human brain, lymphocytes and placenta.
  • the polynucleotide of this invention was discovered in a cDNA library derived from human brain tissue. It is structurally related to the inositol phosphatase family. It contains an open reading frame encoding a protein of about 265 amino acid residues. The protein exhibits the highest degree of homology to human inositol monophosphatase with 55 % identity and 65 % similarity over a 265 amino acid stretch. It is al ⁇ o important that the amino acid sequence DPIDGT is conserved in the polypeptide of the present invention, since this region has been shown to be essential at the active site of IMP enzymes.
  • the polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
  • the DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
  • the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same, mature polypeptide as the DNA of Figure 1 or the deposited cDNA.
  • the polynucleotide which encodes for the mature polypeptide of Figure 1 or for the mature polypeptide encoded by the depo ⁇ ited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding ⁇ equence.
  • the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone.
  • the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
  • the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone.
  • Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
  • the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 or of the coding sequence of the deposited clone.
  • an allelic variant i ⁇ an alternate, form of a polynucleotide ⁇ equence which may have a ⁇ ub ⁇ titution, deletion or addition of one or more nucleotide ⁇ , which does not substantially alter the function of the encoded polypeptide.
  • the polynucleotides of the present invention may al ⁇ o have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention.
  • the marker sequence may be a hexa- histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
  • the present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at lea ⁇ t 50% and preferably 70% identity between the sequences.
  • the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides .
  • stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
  • polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNA of Figure 1 or the deposited cDNA.
  • the present invention further relates to a hIMP-Hl polypeptide which has the deduced amino acid sequence of Figure 1 or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of ⁇ uch polypeptide.
  • fragment when referring to the polypeptide of Figure 1 or that encoded by the deposited cDNA, mean ⁇ a polypeptide which retains essentially the same biological function or activity as such polypeptide.
  • an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • the polypeptide of the pre ⁇ ent invention may be a recombinant polypeptide, a natural polypeptide or a ⁇ ynthetic polypeptide, preferably a recombinant polypeptide.
  • the fragment, derivative or analog of the polypeptide of Figure 1 or that encoded by the depo ⁇ ited cDNA may be (i) one in which one or more of the amino acid residues are sub ⁇ tituted with a con ⁇ erved or non-con ⁇ erved amino acid re ⁇ idue (preferably a con ⁇ erved amino acid re ⁇ idue) and such sub ⁇ tituted amino acid re ⁇ idue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid re ⁇ idue ⁇ include ⁇ a sub ⁇ tituent group, or (iii) one in which the mature polypeptide i ⁇ fu ⁇ ed with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which i ⁇ employed for purification of the
  • polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring).
  • a naturally- occurring polynucleotide or polypeptide present in a living animal i ⁇ not i ⁇ olated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, i ⁇ i ⁇ olated.
  • Such polynucleotide ⁇ could be part of a vector and/or ⁇ uch polynucleotides or polypeptides could be part of a compo ⁇ ition, and ⁇ till be isolated in that such vector or composition i ⁇ not part of it ⁇ natural environment.
  • the present invention also relates to vectors which include polynucleotide ⁇ of the present invention, host cell ⁇ which are genetically engineered with vector ⁇ of the invention and the production of polypeptide ⁇ of the invention by recombinant technique ⁇ .
  • Ho ⁇ t cell ⁇ are genetically engineered (tran ⁇ duced or transformed or tran ⁇ fected) with the vector ⁇ of thi ⁇ invention which may be, for example, a cloning vector or an expre ⁇ sion vector.
  • the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
  • the engineered ho ⁇ t cells can be cultured in conventional nutrient media modified as appropriate for activating promoter ⁇ , ⁇ electing transformants or amplifying the hIMP-Hl gene ⁇ .
  • the culture condition ⁇ such as temperature, pH and the like, are those previously used with the host cell ⁇ elected for expre ⁇ ion, and will be apparent to the ordinarily skilled artisan.
  • polynucleotides of the present invention may be employed for producing polypeptides by recombinant PCI7US94/10465
  • the polynucleotide may be included in any one of a variety of expre ⁇ ion vector ⁇ for expressing a polypeptide.
  • vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of pla ⁇ mid ⁇ and phage DNA, viral DNA ⁇ uch a ⁇ vaccinia, adenovirus, fowl pox virus, and pseudorabies.
  • any other vector may be used as long a ⁇ it i ⁇ replicable and viable in the host.
  • the appropriate DNA sequence may be inserted into the vector by a variety of procedure ⁇ .
  • the DNA sequence i ⁇ inserted into an appropriate restriction endonuclea ⁇ e ⁇ ite( ⁇ ) by procedure ⁇ known in the art.
  • procedure ⁇ and other ⁇ are deemed to be within the scope of those skilled in the art.
  • the DNA sequence in the expression vector is operatively linked to an appropriate expre ⁇ ion control ⁇ equence( ⁇ ) (promoter) to direct mRNA ⁇ ynthe ⁇ i ⁇ .
  • ⁇ equence( ⁇ ) promoter
  • a ⁇ representative examples of such promoters there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda P L promoter and other promoters known to control expres ⁇ ion of genes in prokaryotic or eukaryotic cell ⁇ or their viru ⁇ e ⁇ .
  • the expre ⁇ ion vector also contains a ribosome binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expres ⁇ ion.
  • expre ⁇ ion vector ⁇ preferably contain one or more selectable marker gene ⁇ to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin re ⁇ i ⁇ tance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
  • selectable marker gene ⁇ to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin re ⁇ i ⁇ tance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
  • the vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
  • bacterial cells such as E. coli. Streptomyces. Salmonella typhimurium: fungal cell ⁇ , such as yeast; insect cells such as Drosophila and Sf9: animal cells such a ⁇ CHO, COS or Bowes melanoma; plant cells, etc.
  • Salmonella typhimurium fungal cell ⁇ , such as yeast
  • insect cells such as Drosophila and Sf9
  • animal cells such a ⁇ CHO, COS or Bowes melanoma
  • plant cells etc.
  • the selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.
  • the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.
  • the constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
  • the con ⁇ truct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
  • suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example.
  • Bacterial pQE70, pQE60, pQE-9 (Qiagen), pb ⁇ , pDIO, phage ⁇ cript, p ⁇ iX174, pblue ⁇ cript SK, pb ⁇ ks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia).
  • Eukaryotic pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia).
  • any other plasmid or vector may be u ⁇ ed a ⁇ long as they are replicable and viable in the host.
  • Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
  • Two appropriate vectors are PKK232-8 and PCM7.
  • Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , P L and trp.
  • Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retroviru ⁇ . and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
  • the present invention relates to host cells containing the above-described construct ⁇ .
  • the host cell can be a higher eukaryotic cell, ⁇ uch a ⁇ a mammalian cell, or a lower eukaryotic cell, ⁇ uch a ⁇ a yea ⁇ t cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium pho ⁇ phate tran ⁇ feetion, DEAE- Dextran mediated tran ⁇ fection, or electroporation. (Davi ⁇ , L., Dibner, M. , Battey, I., Ba ⁇ ic Method ⁇ in Molecular Biology, (1986)).
  • the con ⁇ truct ⁇ in host cell ⁇ can be used in a conventional manner to produce the gene product encoded by the recombinant ⁇ equence.
  • the polypeptide ⁇ of the invention can be synthetically produced by conventional peptide synthesizer ⁇ .
  • Mature protein ⁇ can be expre ⁇ ed in mammalian cell ⁇ , yea ⁇ t, bacteria, or other cell ⁇ under the control of appropriate promoters.
  • Cell-free translation system ⁇ can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
  • Appropriate cloning and expression vector ⁇ for u ⁇ e with prokaryotic and eukaryotic ho ⁇ ts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the di ⁇ clo ⁇ ure of which is hereby incorporated by reference.
  • Enhancers are cis-acting element ⁇ of DNA, u ⁇ ually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma ' enhancer on the late ⁇ ide of the replication origin, and adenoviru ⁇ enhancers.
  • recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
  • promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinasie (PGK), ⁇ -factor, acid phosphatase, or heat shock proteins, among others.
  • the heterologou ⁇ ⁇ equence can encode a fu ⁇ ion protein including an N-terminal identification peptide imparting de ⁇ ired characteri ⁇ tic ⁇ , e.g., ⁇ tabilization or ⁇ implified purification of expre ⁇ sed recombinant product.
  • Useful expres ⁇ ion vector ⁇ for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with ⁇ uitable tran ⁇ lation initiation and termination signals in operable reading phase with a functional promoter.
  • the vector will comprise one or more phenotypic selectable markers and an origin of replication to en ⁇ ure maintenance of the vector and to, if de ⁇ irable, provide amplification within the ho ⁇ t.
  • Suitable prokaryotic host ⁇ for transformation include E. coli. Bacillus subtili ⁇ . Salmonella typhimurium and variou ⁇ ⁇ pecie ⁇ within the genera P ⁇ eudo ona ⁇ , Streptomyces, and Staphylococcu ⁇ , although other ⁇ may al ⁇ o be employed a ⁇ a matter of choice.
  • useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available pla ⁇ id ⁇ compri ⁇ ing genetic element ⁇ of the well known cloning vector pBR322 (ATCC 37017).
  • Such commercial vector ⁇ include, for example, pKK223-3 (Pharmacia Fine Chemical ⁇ , Upp ⁇ ala, Sweden) and GEM1 (Promega Biotec, Madi ⁇ on, WI, USA).
  • the ⁇ e pBR322 "backbone" ⁇ ection ⁇ are combined with an appropriate promoter and the ⁇ tructural sequence to be expressed.
  • the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cell ⁇ are cultured for an additional period.
  • Cell ⁇ are typically harve ⁇ ted by centrifugation, di ⁇ rupted by physical or chemical means, and the resulting crude extract retained for further purification.
  • Microbial cells employed in expres ⁇ ion of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
  • mammalian cell culture sy ⁇ tem ⁇ can al ⁇ o be employed to express recombinant protein.
  • mammalian expression systems include the COS-7 lines of monkey kidney fibroblast ⁇ , described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expre ⁇ ing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell line ⁇ .
  • Mammalian expre ⁇ sion vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding site ⁇ , polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontran ⁇ cribed ⁇ equence ⁇ .
  • DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic element ⁇ .
  • the hIMP-Hl polypeptide ⁇ can be recovered and purified from recombinant cell culture ⁇ by method ⁇ including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulo ⁇ e chromatography, hydrophobic interaction chromatography, affinity chromatography hydroxylapatite chromatography and lectin chromatography. It is preferred to have low concentrations (approximately 0.15-5 mM) of calcium ion present during purification. (Price et al., J. Biol. Chem., 244:917 (1969)). Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • the polypeptide ⁇ of the pre ⁇ ent invention may be a naturally purified product, or a product of chemical ⁇ ynthetic procedure ⁇ , or produced by recombinant technique ⁇ from a prokaryotic or eukaryotic ho ⁇ t (for example, by bacterial, yea ⁇ t, higher plant, in ⁇ ect and mammalian cell ⁇ in culture) .
  • a prokaryotic or eukaryotic ho ⁇ t for example, by bacterial, yea ⁇ t, higher plant, in ⁇ ect and mammalian cell ⁇ in culture
  • the polypeptide ⁇ of the pre ⁇ ent invention may be glyco ⁇ ylated or may be non-glyco ⁇ ylated.
  • Polypeptide ⁇ of the invention may also include an initial methionine amino acid residue.
  • hIMP-Hl may be employed to design alternative therapeutic compounds, other than lithium, for manic- depre ⁇ ive illne ⁇ ses. hIMP-Hl is therefore useful for screening and designing compounds capable of inhibiting h
  • hIMP-Hl Another use for hIMP-Hl is the mapping of genetic diseases. For example, the exact genetic lesion( ⁇ ) responsible for some forms of hereditary manic-depressive illness are still unknown but are the subject of intense inve ⁇ tigation (York, et al., PNAS USA. 90:5833-5837, (1993)). One of the target ⁇ of this inve ⁇ tigation i ⁇ the IMP gene.
  • the hIMP-Hl cDNA can be used to isolate the chromosomal locus of the complete gene. This region of the chromosome can then be tested to determine if any mutations in families affected by manic depres ⁇ ion and po ⁇ ibly other p ⁇ ychiatric di ⁇ order ⁇ are localized in this region.
  • the polynucleotide of the present invention is also useful for identifying other molecules which have similar biological activity.
  • a portion of the coding region of the hIMP-Hl gene may be employed as an oligonucleotide probe.
  • Labeled oligonucleotides having a ⁇ equence complementary to that of the gene of the pre ⁇ ent invention are u ⁇ ed to ⁇ creen a library of human cDNA, genomic DNA or mRNA to determine which member ⁇ of the library the probe hybridizes to.
  • the present invention relates to an as ⁇ ay which identifie ⁇ compound ⁇ which block (antagoni ⁇ t ⁇ ) hIMP-Hl from functioning.
  • the purification, cloning and X-ray cry ⁇ tallization of hIMP-Hl is undertaken. From the cloned enzyme structural data is generated, especially X-ray crystallographic and structural data is obtained and used to screen for and design antagonist ⁇ to hIMP-Hl.
  • An example of such a screen includes mea ⁇ uring the release of [ 14 C]inositol from DL-Ins(l)P containing L-[U- I4 C]Ins(l)P a ⁇ label, as described in (Gumber et al., Plant Phy ⁇ iol., 76:40-44 (1989)).
  • One unit of enzyme activity repre ⁇ ent ⁇ 1 ⁇ ol of ⁇ ub ⁇ trate hydrolysed/min, at 37°C. Protein concentrations may be determined by the method of Bradford (Bradford, M. , Anal. Biochem., 72:248-252 (1976)).
  • phosphoinositol kina ⁇ e ⁇ which are enzymes involved in the phosphatidylino ⁇ itol ⁇ ignaling pathway, namely they catalyze the hydroly ⁇ i ⁇ of the 1 po ⁇ ition phosphate from inositol 1,3,4-triphosphate and inositol 1,4-biphosphate.
  • Potential antagonists include an antibody against the hIMP-Hl polypeptide which binds thereto making the hIMP-Hl polypeptide inaccessible to substrate.
  • Potential antagonists also include proteins which are mimetics of hIMP-Hl (a closely related protein which doe ⁇ not retain hIMP-Hl function) which recognize and bind to the receptor subtypes which hIMP-Hl normally binds. However, there is no second messenger response. In this manner, the function of the hIMP-Hl enzyme is prevented and the beneficial therapeutic effects of inhibiting hIMP-Hl are achieved.
  • proteins include, but are not limited to, oligonucleotides and ⁇ mall-peptide molecules.
  • Antisen ⁇ e technology may also be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
  • the 5' coding portion of the polynucleotide sequence which encodes for the mature polypeptide ⁇ of the pre ⁇ ent invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pair ⁇ in length.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the hIMP-Hl (antisense - Okano, J. Neurochem. , 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expres ⁇ ion, CRC Press, Boca Raton, FL (1988)).
  • the oligonucleotides described above can also be delivered to cells such that the anti ⁇ en ⁇ e RNA or DNA may be expressed in vivo to inhibit production of hIMP-Hl.
  • Another potential antagonist is a small molecule which binds to and occupies the catalytic site of the hIMP-Hl enzyme thereby making the catalytic site inaccessible to a substrate such that normal biological activity is prevented.
  • small molecules include but are not limited to small peptides or peptide-like molecules.
  • the antagonist ⁇ may be used to treat psychotic and depressive disorders (bipolar and non-bipolar) other than mania.
  • the antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.
  • the compounds which inhibit the action of hIMP-Hl may be employed in combination with a suitable pharmaceutical carrier.
  • a suitable pharmaceutical carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • the formulation should suit the mode of administration.
  • the pharmaceutical composition ⁇ may be administered in a convenient manner such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneou ⁇ , intranasal or intradermal route ⁇ .
  • the pharmaceutical compo ⁇ ition ⁇ are administered in an amount which is effective for treating and/or prophylaxis of the specific indication.
  • the amount administered is an amount of at least about 10 ⁇ g/kg body weight and in most cases they will be administered in an amount not in exces ⁇ of about 8 mg/Kg body weight per day.
  • the dosage is from about 10 ⁇ g/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
  • the compounds identified which inhibit hIMP-Hl and which are polypeptides may also be employed in accordance with the pre ⁇ ent invention by expre ⁇ ion of such polypeptides in vivo, which i ⁇ often referred to a ⁇ "gene therapy.”
  • cell ⁇ from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a 85 7 PC17US94/10465
  • cell ⁇ may be engineered by procedure ⁇ known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
  • cell ⁇ may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art.
  • a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo.
  • the expres ⁇ ion vehicle for engineering cell ⁇ may be other than a retroviru ⁇ , for example, an adenoviru ⁇ which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
  • sequences of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromosome ⁇ according to the present invention is an important first step in correlating those sequences with genes associated with disease.
  • sequences can be mapped to chromosome ⁇ by preparing PCR primer ⁇ (preferably 15-25 bp) from the cDNA.
  • Computer analysis of the cDNA is used to rapidly select primers that do not span more than one exon in the genomic PCIYUS94/10465
  • PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
  • sublocalization can be achieved with panels of fragment ⁇ from ⁇ pecific chromosomes or pools of large genomic clones in an analogous manner.
  • Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
  • Fluore ⁇ cence in situ hybridization (FISH) of a cDNA clone ⁇ to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
  • This technique can be used with cDNA as short as 500 or 600 bases; however, clones larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with ⁇ ufficient ⁇ ignal inten ⁇ ity for ⁇ imple detection.
  • FISH require ⁇ u ⁇ e of the clone ⁇ from which the EST wa ⁇ derived, and the longer the better.
  • chromosomal region are then identified through linkage analysi ⁇ (coinheritance of physically adjacent genes).
  • a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb).
  • polypeptide ⁇ , their fragment ⁇ or other derivative ⁇ , or analog ⁇ thereof, or cell ⁇ expre ⁇ sing them can be used as an immunogen to produce antibodies thereto.
  • These antibodies can be, for example, polyclonal or monoclonal antibodies.
  • the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expre ⁇ sion library. Variou ⁇ procedure ⁇ known in the art may be used for the production of ⁇ uch antibodie ⁇ and fragments.
  • Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptide ⁇ to an animal, preferably a nonhuman. The antibody ⁇ o obtained will then bind the polypeptide ⁇ itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
  • any technique which provide ⁇ antibodie ⁇ produced by continuou ⁇ cell line culture ⁇ can be used.
  • Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodie ⁇ (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Lies, Inc., pp. 77-96).
  • Antibodie ⁇ ⁇ pecific to the hIMP-Hl polypeptide could be used a ⁇ part of a diagnostic assay to detect the concentration of hIMP-Hl in a sample derived from a subject. Abnormal levels of hIMP-Hl, if detected, may therefore be indicative of an increase in free inositol in the ⁇ ubject' ⁇ brain and corre ⁇ ponding psychotic and/or other physiological disorder ⁇ .
  • Pla ⁇ mid ⁇ are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
  • the starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures.
  • equivalent pla ⁇ mid ⁇ to tho ⁇ e de ⁇ cribed are known in the art and will be apparent to the ordinarily ⁇ killed arti ⁇ an.
  • Digestion of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequence ⁇ in the DNA.
  • the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
  • plasmid or DNA fragment typically 1 ⁇ g is used with about 2 unit ⁇ of enzyme in about 20 ⁇ l of buffer ⁇ olution.
  • i ⁇ olating DNA fragment ⁇ for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 unit ⁇ of enzyme in a larger volume. Appropriate buffers and sub ⁇ trate amount ⁇ for particular re ⁇ triction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37 * C are ordinarily used, but may vary in accordance with the supplier' ⁇ instructions. After digestion the reaction i ⁇ electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
  • Oligonucleotides refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
  • Ligasion refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniati ⁇ , T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units to T4 DNA ligase PC17US94/10465
  • liga ⁇ e per 0.5 ⁇ g of approximately equimolar amount ⁇ of the DNA fragment ⁇ to be ligated.
  • the 5' oligonucleotide primer has the sequence 5' ACTTGCTACGGATCCATGTGCACCACAGGGGCG 3' contains a Bam HI re ⁇ triction enzyme ⁇ ite followed by 18 nucleotide ⁇ of hIMP-Hl coding ⁇ equence starting from the presumed terminal amino acid of the processed protein codon.
  • the 3' sequence 5' ACTTGCTACAAGCTTTCACTTCTCATCATCCCG 3' contains a Hind III site and is followed by 18 nucleotides of hIMP-Hl including the final stop codon.
  • the restriction enzymes ⁇ ites correspond to the restriction enzyme sites on the bacterial expres ⁇ ion vector pQE-9 (Qiagen, Inc.
  • pQE-9 encodes antibiotic resistance (Amp r ) , a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/O), a ribosome binding site (RBS), a 6-Hi ⁇ tag and restriction enzyme site ⁇ .
  • pQE-9 wa ⁇ then dige ⁇ ted with Bam HI and Hind III. The amplified sequences were ligated into pQE-9 and were inserted in frame with the sequence encoding for the histidine tag and the RBS. The ligation mixture wa ⁇ then u ⁇ ed to tran ⁇ form E.
  • M15/rep4 contains multiple copies of the plasmid pREP4, which expresse ⁇ the lad repressor and also confer ⁇ kanamycin resistance (Kan 1 ) .
  • Transformant ⁇ are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysis.
  • Clones containing the de ⁇ ired con ⁇ truct ⁇ were grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml).
  • the O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250.
  • the cells were grown to an optical den ⁇ ity 600 (O.D.* 00 ) of between 0.4 and 0.6.
  • IPTG I ⁇ opropyl-B-D-thiogalacto pyranoside
  • IPTG induce ⁇ by inactivating the lad repressor, clearing the P/O leading to increased gene expression.
  • Cells were grown an extra 3 to 4 hours.
  • hIMP-Hl wa ⁇ purified from thi ⁇ ⁇ olution by chromatography on a Nickel- Chelate column under condition ⁇ that allow for tight binding by protein ⁇ containing the 6-Hi ⁇ tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984).
  • hIMP-Hl (95 % pure) wa ⁇ eluted from the column in 6 molar guanidine HCI pH 5.0 and for the purpo ⁇ e of renaturation adjusted to 3 molar guanidine HCI, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in this solution for 12 hour ⁇ the protein wa ⁇ dialyzed to 10 mmolar sodium phosphate.
  • the 5' primer has the sequence 5' CCGG ⁇ TCCGCCACC ATGTGCACCACAGGGGCGGGG 3' and contains a Bam HI restriction enzyme site (in bold) followed by 6 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (Kozak, M. , J. Mol. Biol., 196:947-950 (1987) and is just behind the first 21 nucleotides of the hIMP-Hl gene (the initiation codon for tran ⁇ lation "ATG" i ⁇ underlined) .
  • the 3' primer has the sequence 5' CACAGGTACCCAGCTT TGCCTCAGCCGCAG 3' contain ⁇ the cleavage site for the restriction endonuclea ⁇ e Asp718 and 20 nucleotides complementary to the 3' non-tran ⁇ lated ⁇ equence of the hlMP- Hl gene.
  • the amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.). The fragment was then digested with the endonuclease ⁇ Bam HI and A ⁇ p718 and then purified again on a 1% agarose gel. This fragment is designated F2.
  • the vector pRGl (modification of pVL941 vector, discu ⁇ sed below) is used for the expression of the hIMP-Hl protein using the baculoviru ⁇ expre ⁇ ion ⁇ ystem (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vector ⁇ and in ⁇ ect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555).
  • This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedro ⁇ i ⁇ viru ⁇ (AcMNPV) followed by the recognition ⁇ ite ⁇ for the restriction endonucleases Bam HI and Asp718.
  • the polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation.
  • SV simian virus
  • the polyhedrin sequences are flanked at both side ⁇ by viral ⁇ equence ⁇ for the cell-mediated homologous recombination of cotransfected wild-type viral DNA.
  • baculovirus vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31-39).
  • the plasmid was digested with the restriction enzymes Bam HI and Asp718 then dephosphorylated using calf intestinal phosphatase by procedures known in the art.
  • the DNA was then isolated from a 1% agarose gel u ⁇ ing the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated V2.
  • Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase.
  • E.coli HB101 cell ⁇ were then tran ⁇ formed and bacteria identified that contained the pla ⁇ mid (pBachlMP-Hl) with the hIMP-Hl gene u ⁇ ing the enzymes Bam HI and A ⁇ p718.
  • the sequence of the cloned fragment was confirmed by DNA sequencing.
  • the plate wa ⁇ rocked back and forth to mix the newly added ⁇ olution.
  • the plate wa ⁇ then incubated for 5 hour ⁇ at 27°C.
  • the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum was added.
  • the plate was put back into an incubator and cultivation continued at 27°C for four days.
  • plaque assay performed similar as described by Summers and Smith (supra). As a modification an agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) was used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque as ⁇ ay” can al ⁇ o be found in the user's guide for in ⁇ ect cell culture and baculovirology di ⁇ tributed by Life Technologies Inc., Gaithersburg, page 9- 10) .
  • Sf9 cell ⁇ were grown in Grace's medium supplemented with 10% heat-inactivated FBS.
  • the cells were infected with the recombinant baculoviru ⁇ V-hlMP-Hl at a multiplicity of infection (MOI) of 2.
  • MOI multiplicity of infection
  • the medium wa ⁇ removed and replaced with SF900 II medium minu ⁇ methionine and cy ⁇ teine (Life Technologie ⁇ Inc., Gaither ⁇ burg) .
  • the cells were further incubated for 16 hours before they were harve ⁇ ted by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
  • telomere sequence a DNA sequence encoding the entire hIMP-Hl precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter.
  • the HA tag correspond ⁇ to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767).
  • the infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the plasmid construction strategy is de ⁇ cribed a ⁇ follows:
  • the DNA sequence encoding hIMP-Hl was constructed by PCR on the original EST cloned using two primers: the 5' primer 5' 5' CCGGATCCGCCACC ATGTGCACCACAGGGGCGGGG 3' and contains a Bam HI restriction enzyme site (in bold), and 18 nucleotides of hIMP-Hl starting from the initiation codon (underlined); the 3' sequence CGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATGGGTACTT
  • CTCATCATCCCGCCC which contains complementary sequences to an Xbal restriction site, translation ⁇ top codon, HA tag and the la ⁇ t 18 nucleotide ⁇ of the hIMP-Hl coding ⁇ equence (not including the ⁇ top codon). Therefore, the PCR product contains a hIMP-Hl coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and a Bam HI and Xbal site.
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp were digested with Bam HI and Xba I restriction enzymes and ligated. The ligation mixture was transformed into E.
  • RNAzolTM B ⁇ ystem Biotecx Laboratorie ⁇ , Inc. 6023 South Loop East, Houston, TX 77033. About lO ⁇ g of total RNA isolated from each human tissue specified was ⁇ eparated on 1% agaro ⁇ e gel and blotted onto a nylon filter. (Sambrook, Frit ⁇ ch, and Maniati ⁇ , Molecular Cloning, Cold Spring Harbor Pre ⁇ , (1989)). The labeling reaction wa ⁇ done according to the Stratagene Prime- It kit with 50ng DNA fragment.
  • the labeled DNA was purified with a Select-G-50 column. (5 Prime - 3 Prime, Inc. 5603 Arapahoe Road, Boulder, CO 80303).
  • the filter was then hybridized with radioactive labeled full length hIMP-Hl gene at 1,000,000 cpm/ml in 0.5 M NaP0 4 , pH 7.4 and 7% SDS overnight at 65 * C. After wash twice at room temperature and twice at 60 * C with 0.5 x SSC, 0.1% SDS, the filter was then exposed at -70 * C overnight with an intensifying screen.
  • the message RNA for hIMP-Hl is abundant in several tis ⁇ ue ⁇ . ( Figure 4) .
  • ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN,
  • CTCCCAAGGC CTCCCTGGGC TGCTGTGGGC TCCTGGGGAG GTGGCCCTCG TGGCCCACGC 960
  • ATGTGCACCA CAGGGGCGGG GCTGGAGATC ATCAGAAAAG CCCTTACTGA GGAAAAACGT 60
  • Glu Phe Gly Val lie Tyr Hi ⁇ Cy ⁇ Thr Glu Glu Arg Leu Tyr Thr
  • 140 145 150 lie Gly Pro Ly ⁇ Arg A ⁇ p Pro Ala Thr Leu Ly ⁇ Leu Phe Leu Ser

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Zoology (AREA)
  • Psychiatry (AREA)
  • Wood Science & Technology (AREA)
  • Endocrinology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Urology & Nephrology (AREA)
  • Microbiology (AREA)
  • Reproductive Health (AREA)
  • Pain & Pain Management (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

Human inositol monophosphatase H1 polynucleotide and DNA (RNA) encoding such polypeptides and a procedure for producing such polypeptide by recombinant techniques and utilizing such polypeptide for therapeutic purposes, for example, screening and designing compounds capable of inhibiting hIMP-H1 and mapping genetic diseases are disclosed. Also disclosed are antagonists against such polypeptide along with procedures for using such antagonists for therapeutic purposes, for example, for treating psychotic and depressive disorders.

Description

HUMAN INOSITOL MONOPHOSPHATASE HI
This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is human Inositol Monophosphatase HI, sometimes hereinafter referred to as "hIMP-Hl". The invention also relates to inhibiting the action of such polypeptides.
Cells respond to extracellular stimuli through complicated networks of responses. Inositol lipid metabolism plays a key role in intracellular signalling. Agonist- induced stimulation of cells releases the signalling molecules diacylglycerol and inositol polyphosphates via phospholipase C hydrolysis of phosphoinositides. Diacylglycerol functions to stimulate protein kinase C (Nishizuka, Y., Science. 233:305-312 (1986), and several inositol polyphosphates, most notably inositol 1, 4, 5- triphosphate evoke the release of intracellular and intercellular calcium (Berridge, M.J. and Irvine, R.F., Nature. (London), 312, 315-321 (1984). Action of inositol phosphatases and kinases gives rise to a plethora of inositol phosphates (Majerus, P.W. et al., J. Biol. Che .. 263:3051- PCI7US94/10465
3054 (1988) in the cytosol that may also serve as signalling or regulatory molecules.
Inositol monophosphatase (IMP) plays an important role in the phoεphatidylinositol signalling pathway by catalyzing the hydrolysis of inositol monophosphates. IMP'S are believed to be the molecular site of action for lithium therapy for manic-depressive illness. Lithium inhibits inositol monophosphatase and prevents the accumulation of free inositol from inositol-1-phosphate.
Lithium carbonate was shown to be an effective antimanic compound by John Cade in 1949, and this compound was approved for wide-spread use in 1969. However, treatment of manic- depressive patients with lithium is associated with certain deleterious side effects. These include tremor, weight gain, diarrhea, skin rash, transient leukocytoεiε, hypothyroidiεm, and polyuria-polydipsia. Additional clinical ailments associated with chronic lithium therapy are structural lesions in the kidney (including tubular atrophy, glomerular scleroεiε and interstitial fibrosis). These side effects are directly due to lithium toxicity.
The phosphoinositide (PI) cycle is a likely target for lithium action, since it has been demonstrated that a profound elevation of inositol-1-phosphate and a corresponding decrease in free inositol in the brains of rats occurred when treated systemically with lithium. This was attributed to inhibition of inositol-1-phosphate phosphatase and led to the hypotheεiε that lithium was able to damp down the activity of the PI cycle in overstimulated cells, thus explaining its effectivenesε in controlling mania.
Proviεion of inositol for the PI cycle can come from hydrolysis of inositol phosphates, by de novo synthesis from glucose, or from the diet. The former procesεeε are dependent on the operation of inositol-1-phosphate phosphatase and are, therefore, inhibited by lithium. Dietary inositol can bypass lithium blockade in peripheral tissues but not in the CNS, since inositol does not cross the blood brain barrier. Thus, the increase in inositol-1- phoεphate in brain is accompanied by an equivalent decrease in free inositol.
Manganese supports catalysiε by inoεitol monophosphatase. On the other hand, divalent ions, i.e., calcium and manganese, are competitive inhibitors (Hallcher, L.M. and Sherman, W.R., J. Biol. Chem.. 255:10896-901 (1980)). Lithium inhibits inositol monophosphate phosphatase uncompetitively.
IMP liberates inositol from the substrates INS (1) P, INS (3) P and INS (4) P. IMP is also capable of hydrolyzing various non-inositol containing substrates including but not limited to those disclosed by Sherman, J. Biol. Chem.. 224:10896-10901 (1980), Takimoto, J. Bio. Chem. (Tokyo), 98:363-370 (1985) and by Gee, Bio. Chem J.. 249:883-889 (1988). The first human IMP cDNA was isolated and is disclosed by McAllister et al., (WO 93/25692 (1993)).
The polypeptide of the present invention has been putatively identified as a human inositol monophosphatase polypeptide. This identification has been made as a reεult of amino acid sequence homology.
In accordance with one aspect of the present invention, there is provided a novel putative mature polypeptide which is hIMP-Hl, as well as fragments, analogs and derivatives thereof. The polypeptide of the present invention is of human origin.
In accordance with another aspect of the present invention, there are provided polynucleotides (DNA or RNA) which encode such polypeptides.
In accordance with yet a further aspect of the present invention, there is provided a process for producing such polypeptides by recombinant techniques.
In accordance with yet a further aspect of the present invention, there is provided a procesε for utilizing εuch polypeptides, or polynucleotides encoding such polypeptides for therapeutic purposes, for example, for screening and designing compounds capable of inhibiting this class of enzymes, and for the treatment of psychiatric diεorders.
In accordance with yet a further aspect of the present invention, there is provided an antibody against such polypeptides.
In accordance with yet another aspect of the present invention, there are provided antagonists against εuch polypeptides, which may be used to inhibit the action of such polypeptides, for example, in the treatment of psychotic and depressive disorders (bipolar and non-bipolar) .
These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.
The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.
Figure 1 discloses the cDNA sequence and corresponding deduced amino acid sequence of the mature form of hIMP-Hl. The amino acids DPIDGT have been shown to be essential at the active site of IMP enzymes and are shown bolded and underlined.
Figure 2 shows the complete nucleotide sequence of hlMP- Hl cDNA. The positions of the synthetic BamHl (position 1) and Xhol linker (position 1308) used to clone the cDNA are shown underlined.
Figure 3 is an amino acid comparison between hIMP-Hl and hIMP. The boxed areas indicate identical amino acids.
Figure 4 is a Northern Blot Analyβis of hIMP-Hl.
Sequencing inaccuracies are a common problem when attempting to determine polynucleotide sequences. Accordingly, the sequence of Figure 1 is based on several sequencing runε and the sequencing accuracy is considered to be at least 97%. In accordance with an aspect of the present invention, there is provided an isolated nucleic acid (polynucleotide) which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75753 on April 25, 1994.
A polynucleotide encoding a polypeptide of the present invention may be obtained from human brain, lymphocytes and placenta. The polynucleotide of this invention was discovered in a cDNA library derived from human brain tissue. It is structurally related to the inositol phosphatase family. It contains an open reading frame encoding a protein of about 265 amino acid residues. The protein exhibits the highest degree of homology to human inositol monophosphatase with 55 % identity and 65 % similarity over a 265 amino acid stretch. It is alεo important that the amino acid sequence DPIDGT is conserved in the polypeptide of the present invention, since this region has been shown to be essential at the active site of IMP enzymes.
The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same, mature polypeptide as the DNA of Figure 1 or the deposited cDNA.
The polynucleotide which encodes for the mature polypeptide of Figure 1 or for the mature polypeptide encoded by the depoεited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding εequence.
The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone. The variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
As hereinabove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 or of the coding sequence of the deposited clone. As known in the art, an allelic variant iε an alternate, form of a polynucleotide εequence which may have a εubεtitution, deletion or addition of one or more nucleotideε, which does not substantially alter the function of the encoded polypeptide. O /08557 PC17US94/10465
The polynucleotides of the present invention may alεo have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention. The marker sequence may be a hexa- histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at leaεt 50% and preferably 70% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides . As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNA of Figure 1 or the deposited cDNA.
The deposit(s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. §112. The sequence of the polynucleotides contained in the deposited materials, as well aε the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequenceε herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.
The present invention further relates to a hIMP-Hl polypeptide which has the deduced amino acid sequence of Figure 1 or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of εuch polypeptide.
The terms "fragment," "derivative" and "analog" when referring to the polypeptide of Figure 1 or that encoded by the deposited cDNA, meanε a polypeptide which retains essentially the same biological function or activity as such polypeptide. Thus, an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
The polypeptide of the preεent invention may be a recombinant polypeptide, a natural polypeptide or a εynthetic polypeptide, preferably a recombinant polypeptide.
The fragment, derivative or analog of the polypeptide of Figure 1 or that encoded by the depoεited cDNA may be (i) one in which one or more of the amino acid residues are subεtituted with a conεerved or non-conεerved amino acid reεidue (preferably a conεerved amino acid reεidue) and such subεtituted amino acid reεidue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid reεidueε includeε a subεtituent group, or (iii) one in which the mature polypeptide iε fuεed with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which iε employed for purification of the mature polypeptide or a proprotein sequence. Such fragments. derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally- occurring polynucleotide or polypeptide present in a living animal iε not iεolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, iε iεolated. Such polynucleotideε could be part of a vector and/or εuch polynucleotides or polypeptides could be part of a compoεition, and εtill be isolated in that such vector or composition iε not part of itε natural environment.
The present invention also relates to vectors which include polynucleotideε of the present invention, host cellε which are genetically engineered with vectorε of the invention and the production of polypeptideε of the invention by recombinant techniqueε.
Hoεt cellε are genetically engineered (tranεduced or transformed or tranεfected) with the vectorε of thiε invention which may be, for example, a cloning vector or an expreεsion vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered hoεt cells can be cultured in conventional nutrient media modified as appropriate for activating promoterε, εelecting transformants or amplifying the hIMP-Hl geneε. The culture conditionε, such as temperature, pH and the like, are those previously used with the host cell εelected for expreεεion, and will be apparent to the ordinarily skilled artisan.
The polynucleotides of the present invention may be employed for producing polypeptides by recombinant PCI7US94/10465
techniqueε. Thuε, for example, the polynucleotide may be included in any one of a variety of expreεεion vectorε for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plaβmidε and phage DNA, viral DNA εuch aε vaccinia, adenovirus, fowl pox virus, and pseudorabies. However, any other vector may be used as long aε it iε replicable and viable in the host.
The appropriate DNA sequence may be inserted into the vector by a variety of procedureε. In general, the DNA sequence iε inserted into an appropriate restriction endonucleaεe εite(ε) by procedureε known in the art. Such procedureε and otherε are deemed to be within the scope of those skilled in the art.
The DNA sequence in the expression vector is operatively linked to an appropriate expreεεion control εequence(ε) (promoter) to direct mRNA εyntheεiε. Aε representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda PL promoter and other promoters known to control expresεion of genes in prokaryotic or eukaryotic cellε or their viruεeε. The expreεεion vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expresεion.
In addition, the expreεεion vectorε preferably contain one or more selectable marker geneε to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin reεiεtance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli. Streptomyces. Salmonella typhimurium: fungal cellε, such as yeast; insect cells such as Drosophila and Sf9: animal cells such aε CHO, COS or Bowes melanoma; plant cells, etc. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.
More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the conεtruct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pbε, pDIO, phageεcript, pεiX174, pblueεcript SK, pbεks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be uεed aε long as they are replicable and viable in the host.
Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are PKK232-8 and PCM7. Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda PR, PL and trp. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retroviruε. and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
In a further embodiment, the present invention relates to host cells containing the above-described constructε. The host cell can be a higher eukaryotic cell, εuch aε a mammalian cell, or a lower eukaryotic cell, εuch aε a yeaεt cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phoεphate tranεfeetion, DEAE- Dextran mediated tranεfection, or electroporation. (Daviε, L., Dibner, M. , Battey, I., Baεic Methodε in Molecular Biology, (1986)).
The conεtructε in host cellε can be used in a conventional manner to produce the gene product encoded by the recombinant εequence. Alternatively, the polypeptideε of the invention can be synthetically produced by conventional peptide synthesizerε.
Mature proteinε can be expreεεed in mammalian cellε, yeaεt, bacteria, or other cellε under the control of appropriate promoters. Cell-free translation systemε can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectorε for uεe with prokaryotic and eukaryotic hoεts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the diεcloεure of which is hereby incorporated by reference.
Transcription of the DNA encoding the polypeptides of the preεent invention by higher eukaryoteε iε increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elementε of DNA, uεually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma' enhancer on the late εide of the replication origin, and adenoviruβ enhancers.
Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinasie (PGK), α-factor, acid phosphatase, or heat shock proteins, among others. The heterologous εtructural εequence iε aεsembled in appropriate phaεe with tranεlation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic εpace or extracellular medium. Optionally, the heterologouε εequence can encode a fuεion protein including an N-terminal identification peptide imparting deεired characteriεticε, e.g., εtabilization or εimplified purification of expreεsed recombinant product.
Useful expresεion vectorε for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with εuitable tranεlation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to enεure maintenance of the vector and to, if deεirable, provide amplification within the hoεt. Suitable prokaryotic hostε for transformation include E. coli. Bacillus subtiliε. Salmonella typhimurium and variouε εpecieε within the genera Pεeudo onaε, Streptomyces, and Staphylococcuε, although otherε may alεo be employed aε a matter of choice.
Aε a representative but nonlimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plaε idε compriεing genetic elementε of the well known cloning vector pBR322 (ATCC 37017). Such commercial vectorε include, for example, pKK223-3 (Pharmacia Fine Chemicalε, Uppεala, Sweden) and GEM1 (Promega Biotec, Madiεon, WI, USA). Theεe pBR322 "backbone" εectionε are combined with an appropriate promoter and the εtructural sequence to be expressed.
Following transformation of a suitable hoεt εtrain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cellε are cultured for an additional period.
Cellε are typically harveεted by centrifugation, diεrupted by physical or chemical means, and the resulting crude extract retained for further purification.
Microbial cells employed in expresεion of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
Various mammalian cell culture syεtemε can alεo be employed to express recombinant protein. Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblastε, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expreεεing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lineε. Mammalian expreεsion vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding siteε, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranεcribed εequenceε. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elementε. The hIMP-Hl polypeptideε can be recovered and purified from recombinant cell cultureε by methodε including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocelluloεe chromatography, hydrophobic interaction chromatography, affinity chromatography hydroxylapatite chromatography and lectin chromatography. It is preferred to have low concentrations (approximately 0.15-5 mM) of calcium ion present during purification. (Price et al., J. Biol. Chem., 244:917 (1969)). Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
The polypeptideε of the preεent invention may be a naturally purified product, or a product of chemical εynthetic procedureε, or produced by recombinant techniqueε from a prokaryotic or eukaryotic hoεt (for example, by bacterial, yeaεt, higher plant, inεect and mammalian cellε in culture) . Depending upon the hoεt employed in a recombinant production procedure, the polypeptideε of the preεent invention may be glycoεylated or may be non-glycoεylated. Polypeptideε of the invention may also include an initial methionine amino acid residue. hIMP-Hl may be employed to design alternative therapeutic compounds, other than lithium, for manic- depreεεive illneεses. hIMP-Hl is therefore useful for screening and designing compounds capable of inhibiting hIMP- HI.
Another use for hIMP-Hl is the mapping of genetic diseases. For example, the exact genetic lesion(ε) responsible for some forms of hereditary manic-depressive illness are still unknown but are the subject of intense inveεtigation (York, et al., PNAS USA. 90:5833-5837, (1993)). One of the targetε of this inveεtigation iε the IMP gene. The hIMP-Hl cDNA can be used to isolate the chromosomal locus of the complete gene. This region of the chromosome can then be tested to determine if any mutations in families affected by manic depresεion and poεεibly other pεychiatric diεorderε are localized in this region.
The polynucleotide of the present invention is also useful for identifying other molecules which have similar biological activity. For example, a portion of the coding region of the hIMP-Hl gene may be employed as an oligonucleotide probe. Labeled oligonucleotides having a εequence complementary to that of the gene of the preεent invention are uεed to εcreen a library of human cDNA, genomic DNA or mRNA to determine which memberε of the library the probe hybridizes to.
The present invention relates to an asεay which identifieε compoundε which block (antagoniεtε) hIMP-Hl from functioning. In order to provide a εtructural baεiε from which to deεign alternative therapeutic compoundε which inhibit hIMP-Hl, the purification, cloning and X-ray cryεtallization of hIMP-Hl is undertaken. From the cloned enzyme structural data is generated, especially X-ray crystallographic and structural data is obtained and used to screen for and design antagonistε to hIMP-Hl. An example of such a screen includes meaεuring the release of [14C]inositol from DL-Ins(l)P containing L-[U-I4C]Ins(l)P aε label, as described in (Gumber et al., Plant Phyεiol., 76:40-44 (1989)). One unit of enzyme activity repreεentε 1 μ ol of εubεtrate hydrolysed/min, at 37°C. Protein concentrations may be determined by the method of Bradford (Bradford, M. , Anal. Biochem., 72:248-252 (1976)).
The above described asεay may also be used to block the other enzymes which are critical to the PI cycle, for example, phosphoinositol kinaεeε which are enzymes involved in the phosphatidylinoεitol εignaling pathway, namely they catalyze the hydrolyεiε of the 1 poεition phosphate from inositol 1,3,4-triphosphate and inositol 1,4-biphosphate. PCI7US94/10465
Potential antagonists include an antibody against the hIMP-Hl polypeptide which binds thereto making the hIMP-Hl polypeptide inaccessible to substrate.
Potential antagonists also include proteins which are mimetics of hIMP-Hl (a closely related protein which doeε not retain hIMP-Hl function) which recognize and bind to the receptor subtypes which hIMP-Hl normally binds. However, there is no second messenger response. In this manner, the function of the hIMP-Hl enzyme is prevented and the beneficial therapeutic effects of inhibiting hIMP-Hl are achieved. Examples of these proteins include, but are not limited to, oligonucleotides and βmall-peptide molecules.
Antisenεe technology may also be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature polypeptideε of the preεent invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairε in length. A DNA oligonucleotide iε designed to be complementary to a region of the gene involved in tranεcription (triple helix -see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al.. Science, 251: 1360 (1991)), thereby preventing transcription and the production of hIMP-Hl. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the hIMP-Hl (antisense - Okano, J. Neurochem. , 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expresεion, CRC Press, Boca Raton, FL (1988)). The oligonucleotides described above can also be delivered to cells such that the antiεenεe RNA or DNA may be expressed in vivo to inhibit production of hIMP-Hl.
Another potential antagonist is a small molecule which binds to and occupies the catalytic site of the hIMP-Hl enzyme thereby making the catalytic site inaccessible to a substrate such that normal biological activity is prevented. Examples of small molecules include but are not limited to small peptides or peptide-like molecules.
The antagonistε may be used to treat psychotic and depressive disorders (bipolar and non-bipolar) other than mania. The antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.
The compounds which inhibit the action of hIMP-Hl may be employed in combination with a suitable pharmaceutical carrier. Such compoεitions comprise a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.
The pharmaceutical compositionε may be administered in a convenient manner such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneouε, intranasal or intradermal routeε. The pharmaceutical compoεitionε are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, the amount administered is an amount of at least about 10 μg/kg body weight and in most cases they will be administered in an amount not in excesε of about 8 mg/Kg body weight per day. In moεt cases, the dosage is from about 10 μg/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
The compounds identified which inhibit hIMP-Hl and which are polypeptides may also be employed in accordance with the preεent invention by expreεεion of such polypeptides in vivo, which iε often referred to aε "gene therapy."
Thuε, for example, cellε from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a 85 7 PC17US94/10465
polypeptide ex vivo, with the' engineered cellε then being provided to a patient to be treated with the polypeptide. Such methodε are well-known in the art. For example, cellε may be engineered by procedureε known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
Similarly, cellε may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. As known in the art, a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo. These and other methodε for adminiεtering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the present invention. For example, the expresεion vehicle for engineering cellε may be other than a retroviruε, for example, an adenoviruε which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
The sequences of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of DNAs to chromosomeε according to the present invention is an important first step in correlating those sequences with genes associated with disease.
Briefly, sequences can be mapped to chromosomeε by preparing PCR primerε (preferably 15-25 bp) from the cDNA. Computer analysis of the cDNA is used to rapidly select primers that do not span more than one exon in the genomic PCIYUS94/10465
DNA, thuε complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome. Using the present invention with the same oligonucleotide primerε, sublocalization can be achieved with panels of fragmentε from εpecific chromosomes or pools of large genomic clones in an analogous manner. Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
Fluoreεcence in situ hybridization (FISH) of a cDNA cloneε to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 500 or 600 bases; however, clones larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with εufficient εignal intenεity for εimple detection. FISH requireε uεe of the cloneε from which the EST waε derived, and the longer the better. For example, 2,000 bp iε good, 4,000 iε better, and more than 4,000 iε probably not necessary to get good results a reasonable percentage of the time. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniqueε, Pergamon Press, New York (1988).
Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromoεome can be correlated with genetic map data. Such data are found, for example, in V. McKuεick, Mendelian Inheritance in Man (available on line through Johnε Hopkinε Univerεity Welch Medical Library). The relationεhip between geneε and diseases that have been mapped to the same PCIYUS94/10465
chromosomal region are then identified through linkage analysiε (coinheritance of physically adjacent genes).
Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.
With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb).
The polypeptideε, their fragmentε or other derivativeε, or analogε thereof, or cellε expreεsing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies. The present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expreεsion library. Variouε procedureε known in the art may be used for the production of εuch antibodieε and fragments.
Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptideε to an animal, preferably a nonhuman. The antibody εo obtained will then bind the polypeptideε itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique which provideε antibodieε produced by continuouε cell line cultureε can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodieε (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Lies, Inc., pp. 77-96).
Techniques described for the production of single chain antibodieε (U.S. Patent 4,946,778) can be adapted to produce εingle chain antibodieε to immunogenic polypeptide products of this invention.
Antibodieε εpecific to the hIMP-Hl polypeptide could be used aε part of a diagnostic assay to detect the concentration of hIMP-Hl in a sample derived from a subject. Abnormal levels of hIMP-Hl, if detected, may therefore be indicative of an increase in free inositol in the εubject'ε brain and correεponding psychotic and/or other physiological disorderε.*(
The present invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All partε or amounts, unless otherwise specified, are by weight.
In order to facilitate understanding of the following exampleε certain frequently occurring methodε and/or termε will be deεcribed.
"Plaεmidε" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plaεmidε to thoεe deεcribed are known in the art and will be apparent to the ordinarily εkilled artiεan. "Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequenceε in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 μg of plasmid or DNA fragment is used with about 2 unitε of enzyme in about 20 μl of buffer εolution. For the purpose of iεolating DNA fragmentε for plasmid construction, typically 5 to 50 μg of DNA are digested with 20 to 250 unitε of enzyme in a larger volume. Appropriate buffers and subεtrate amountε for particular reεtriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37*C are ordinarily used, but may vary in accordance with the supplier'ε instructions. After digestion the reaction iε electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
Size separation of the cleaved fragmentε iε performed uεing 8 percent polyacrylamide gel deεcribed by Goeddel, D. et al . , Nucleic Acidε Reε., 8:4057 (1980).
"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatiε, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units to T4 DNA ligase PC17US94/10465
("ligaεe") per 0.5 μg of approximately equimolar amountε of the DNA fragmentε to be ligated.
Unleεε otherwise stated, transformation was performed as described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).
Example 1 Bacterial Expression and Purification of hIMP-Hl
The DNA sequence encoding for hIMP-Hl, ATCC # 75753, iε initially amplified uεing PCR oligonucleotide primerε correεponding to the 5' end sequences of the proceεεed hlMP- Hl protein (minuε the εignal peptide εequence) and the vector sequences 3' to the hIMP-Hl gene. Additional nucleotides correεponding to hIMP-Hl were added to the 5' and 3' sequences respectively. The 5' oligonucleotide primer has the sequence 5' ACTTGCTACGGATCCATGTGCACCACAGGGGCG 3' contains a Bam HI reεtriction enzyme εite followed by 18 nucleotideε of hIMP-Hl coding εequence starting from the presumed terminal amino acid of the processed protein codon. The 3' sequence 5' ACTTGCTACAAGCTTTCACTTCTCATCATCCCG 3' contains a Hind III site and is followed by 18 nucleotides of hIMP-Hl including the final stop codon. The restriction enzymes εites correspond to the restriction enzyme sites on the bacterial expresεion vector pQE-9 (Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 91311). pQE-9 encodes antibiotic resistance (Ampr) , a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/O), a ribosome binding site (RBS), a 6-Hiε tag and restriction enzyme siteε. pQE-9 waε then digeεted with Bam HI and Hind III. The amplified sequences were ligated into pQE-9 and were inserted in frame with the sequence encoding for the histidine tag and the RBS. The ligation mixture waε then uεed to tranεform E. coli εtrain available from Qiagen under the trademark M15/rep 4 by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). M15/rep4 contains multiple copies of the plasmid pREP4, which expresseε the lad repressor and also conferε kanamycin resistance (Kan1) . Transformantε are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysis. Clones containing the deεired conεtructε were grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells were grown to an optical denεity 600 (O.D.*00) of between 0.4 and 0.6. IPTG ("Iεopropyl-B-D-thiogalacto pyranoside") was then added to a final concentration of 1 mM. IPTG induceε by inactivating the lad repressor, clearing the P/O leading to increased gene expression. Cells were grown an extra 3 to 4 hours. Cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HCI. After clarification, εolubilized hIMP-Hl waε purified from thiε εolution by chromatography on a Nickel- Chelate column under conditionε that allow for tight binding by proteinε containing the 6-Hiε tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984). hIMP-Hl (95 % pure) waε eluted from the column in 6 molar guanidine HCI pH 5.0 and for the purpoεe of renaturation adjusted to 3 molar guanidine HCI, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in this solution for 12 hourε the protein waε dialyzed to 10 mmolar sodium phosphate.
Example 2 Cloning and expression of hIMP-Hl using the baculovirus expreεεion system
The DNA sequence encoding the full length hIMP-Hl protein, ATCC # 75753, waε amplified uεing PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:
The 5' primer has the sequence 5' CCGGλTCCGCCACC ATGTGCACCACAGGGGCGGGG 3' and contains a Bam HI restriction enzyme site (in bold) followed by 6 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (Kozak, M. , J. Mol. Biol., 196:947-950 (1987) and is just behind the first 21 nucleotides of the hIMP-Hl gene (the initiation codon for tranεlation "ATG" iε underlined) .
The 3' primer has the sequence 5' CACAGGTACCCAGCTT TGCCTCAGCCGCAG 3' containε the cleavage site for the restriction endonucleaβe Asp718 and 20 nucleotides complementary to the 3' non-tranεlated εequence of the hlMP- Hl gene. The amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.). The fragment was then digested with the endonucleaseε Bam HI and Aεp718 and then purified again on a 1% agarose gel. This fragment is designated F2.
The vector pRGl (modification of pVL941 vector, discuεsed below) is used for the expression of the hIMP-Hl protein using the baculoviruε expreεεion εystem (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectorε and inεect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555). This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedroεiε viruε (AcMNPV) followed by the recognition εiteε for the restriction endonucleases Bam HI and Asp718. The polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation. For an easy selection of recombinant viruseε the beta-galactoεidaεe gene from E.coli iε inεerted in the εame orientation aε the polyhedrin promoter followed by the polyadenylation εignal of the polyhedrin gene. The polyhedrin sequences are flanked at both sideε by viral βequenceε for the cell-mediated homologous recombination of cotransfected wild-type viral DNA. Many other baculovirus vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31-39).
The plasmid was digested with the restriction enzymes Bam HI and Asp718 then dephosphorylated using calf intestinal phosphatase by procedures known in the art. The DNA was then isolated from a 1% agarose gel uεing the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase. E.coli HB101 cellε were then tranεformed and bacteria identified that contained the plaεmid (pBachlMP-Hl) with the hIMP-Hl gene uεing the enzymes Bam HI and Aεp718. The sequence of the cloned fragment was confirmed by DNA sequencing.
5 μg of the plasmid pBachlMP-Hl was cotransfected with 1.0 μg of a commercially available linearized baculovirus ("BaculoGold1" baculovirus DNA", Pharmingen, San Diego, CA. ) using the lipofection method (Feigner et al. Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)). lμg of BaculoGold1" viruε DNA and 5 μg of the plaεmid pBachlMP-Hl were mixed in a εterile well of a microtiter plate containing 50 μl of serum free Grace'ε medium (Life Technologieε Inc., Gaitherεburg, MD) . Afterwards 10 μl Lipofectin plus 90 μl Grace's medium were added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture waε added dropwiεe to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tisεue culture plate with 1ml Grace' medium without εeru . The plate waε rocked back and forth to mix the newly added εolution. The plate waε then incubated for 5 hourε at 27°C. After 5 hourε the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum was added. The plate was put back into an incubator and cultivation continued at 27°C for four days.
After four days the supernatant was collected and a plaque assay performed similar as described by Summers and Smith (supra). As a modification an agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) was used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque asεay" can alεo be found in the user's guide for inεect cell culture and baculovirology diεtributed by Life Technologies Inc., Gaithersburg, page 9- 10) .
Four dayε after the serial dilution of the viruses was added to the cells, blue stained plaqueε were picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses was then reεuεpended in an Eppendorf tube containing 200 μl of Grace's medium. The agar was removed by a brief centrifugation and the supernatant containing the recombinant baculoviruses was used to infect Sf9 cellε εeeded in 35 mm diεheε. Four dayε later the supernatants of these culture diεheε were harveεted and then εtored at 4°C.
Sf9 cellε were grown in Grace's medium supplemented with 10% heat-inactivated FBS. The cells were infected with the recombinant baculoviruε V-hlMP-Hl at a multiplicity of infection (MOI) of 2. Six hourε later the medium waε removed and replaced with SF900 II medium minuε methionine and cyεteine (Life Technologieε Inc., Gaitherεburg) . 42 hours later 5 μCi of 35S-methionine and 5 μCi 35S cysteine (Amersham) were added. The cells were further incubated for 16 hours before they were harveεted by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
Example 3 Expression of Recombinant hIMP-Hl in COS cells
The expression of plasmid, hIMP-Hl-HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resiεtance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A DNA fragment encoding the entire hIMP-Hl precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter. The HA tag correspondε to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767). The infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
The plasmid construction strategy is deεcribed aε follows:
The DNA sequence encoding hIMP-Hl, ATCC # 75753, was constructed by PCR on the original EST cloned using two primers: the 5' primer 5' 5' CCGGATCCGCCACC ATGTGCACCACAGGGGCGGGG 3' and contains a Bam HI restriction enzyme site (in bold), and 18 nucleotides of hIMP-Hl starting from the initiation codon (underlined); the 3' sequence CGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATGGGTACTT
CTCATCATCCCGCCC which contains complementary sequences to an Xbal restriction site, translation εtop codon, HA tag and the laεt 18 nucleotideε of the hIMP-Hl coding εequence (not including the εtop codon). Therefore, the PCR product contains a hIMP-Hl coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and a Bam HI and Xbal site. The PCR amplified DNA fragment and the vector, pcDNAI/Amp, were digested with Bam HI and Xba I restriction enzymes and ligated. The ligation mixture was transformed into E. coli εtrain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture was plated on ampicillin media plates and resiεtant colonies were selected. Plasmid DNA was iεolated from tranεformantε and examined by reεtriction analysis for the presence of the correct fragment. For expression of the recombinant hIMP-Hl, COS cells were transfected with the expresεion vector by DEAE-DEXTRAN method. (J. Sambrook, E. Fritεch, T. ManiatiSj Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Preεε, (1989)). The expreεεion of the hIMP-Hl HA protein waε detected by radiolabelling and immunoprecipitation method. (E. Harlow, D. Lane, Antibodieε: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells were labelled for 8 hours with 3SS-cysteine two days post transfection. Culture media were then collected and cells were lysed with detergent (RIPA buffer (150 mM NaCI, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5). (Wilεon, I. et al.. Id. 37:767 (1984)). Both cell lyεate and culture media were precipitated with a HA εpecific monoclonal antibody. Proteinε precipitated were analyzed on 15% SDS-PAGE gelε.
Example 4 Expreεεion pattern of hIMP-Hl in human tiεεue
Northern blot analyεiε waε carried out to examine the levelε of expression of hIMP-Hl in human tissues. Total cellular RNA samples were iεolated with RNAzol™ B εystem (Biotecx Laboratorieε, Inc. 6023 South Loop East, Houston, TX 77033). About lOμg of total RNA isolated from each human tissue specified was εeparated on 1% agaroεe gel and blotted onto a nylon filter. (Sambrook, Fritεch, and Maniatiε, Molecular Cloning, Cold Spring Harbor Preεε, (1989)). The labeling reaction waε done according to the Stratagene Prime- It kit with 50ng DNA fragment. The labeled DNA was purified with a Select-G-50 column. (5 Prime - 3 Prime, Inc. 5603 Arapahoe Road, Boulder, CO 80303). The filter was then hybridized with radioactive labeled full length hIMP-Hl gene at 1,000,000 cpm/ml in 0.5 M NaP04, pH 7.4 and 7% SDS overnight at 65*C. After wash twice at room temperature and twice at 60*C with 0.5 x SSC, 0.1% SDS, the filter was then exposed at -70*C overnight with an intensifying screen. The message RNA for hIMP-Hl is abundant in several tisεueε. (Figure 4) .
Numerouε modifications and variations of the present invention are posεible in light of the above teachings and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly described.
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: MEISSNER, ET AL.
(ϋ) TITLE OF INVENTION: Human Inositol Monophosphatase HI
(iii) NUMBER OF SEQUENCES:
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN,
CECCHI, STEWART & OLSTEIN
(B) STREET: 6 BECKER FARM ROAD
(C) CITY: ROSELAND
(D) STATE: NEW JERSEY
(E) COUNTRY: USA
(F) ZIP: 07068
(V) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: 3.5 INCH DISKETTE
(B) COMPUTER: IBM PS/2
(C) OPERATING SYSTEM: MS-DOS
(D) SOFTWARE: WORD PERFECT 5.1
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: concurrently
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(viii) ATTORNEY/AGENT INFORMATION: (A) NAME: FERRARO, GREGORY D.
(B) REGISTRATION NUMBER: 36,134
(C) REFERENCE/DOCKET NUMBER: 325800-127
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 201-994-1700
(B) TELEFAX: 201-994-1744
(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 1313 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: CDNA
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:
GGATCCAGGA GTTGGAGCCC GCCTGCGCGC TGCGGGACGG GGCACGGCGG AAGGGTTGGG 60
TCCGCCTCGA GCGGGGAGGG TAATGTGCAC CACAGGGGCG GGGCTGGAGA TCATCAGAAA 120
AGCCCTTACT GAGGAAAAAC GTGTCTCAAC AAAAACATCA GCTGCAGATC TTGTGACAGA 180
AACAGATCAC CTTGTGGAAG ATTTAATTAT TTCTGAGTTG CGAGAGAGGT TTCCTTCACA 240
CAGGTTCATT GCAGAAGAGG CCGCGGCTTC TGGGGCCAAG TGTGTGCTCA CCCACAGCCC 300
GACGTGGATC ATCGACCCCA TCGACGGCAC CTGCAATTTT GTGCACAGAT TCCCGACTGT 360
GGCGGTTAGC ATTGGATTTG CTGTTCGACA AGAGCTTGAA TTCGGAGTGA TTTACCACTG 420
CACAGAGGAG CGGCTGTACA CGGGCCGGCG GGGTCGGGGC GCCTTCTGCA ATGGCCAGCG 480
GCTCCGGGTC TCCGGGGAGA CAGATCTCTC AAAGGCCTTG GTTCTGACAG AAATTGGCCC 540
CAAACGTGAC CCTGCGACCC TGAAGCTGTT CCTGAGTAAC ATGGAGCGGC TGCTGCATGC 600
CAAGGCGCAT GGGGTCCGAG TGATTGGAAG CTCCACATTG GCACTCTGCC ACCTGGCCTC 660
AGGGGCCGCG GATGCCTATT ACCAGTTTGG CCTGCACTGC TGGGATCTGG CGGCTGCCAC 720
AGTCATCATC AGAGAAGCAG GCGGCATCGT GATAGACACT TCGGGTGGAC CCCTCGACCT 780
CATGGTTTGC AGAGTGGTTG CGGCCAGCAC CCGGGAGATG GCGATGCTCA TAGCTCAGGC 840
CTTACAGACG ATTAACTATG GGCGGGATGA TGAGAAGTGA CTGCGGCTGA GGCAAAGCTG 900
CTCCCAAGGC CTCCCTGGGC TGCTGTGGGC TCCTGGGGAG GTGGCCCTCG TGGCCCACGC 960
TCCATGCCAG TGGCTCACGC TCTGCTCCTG GCTACCCCAG AGGGAGTTGT CACGCTACAG 1020 TGAGTGGCTG GCCTTTTAAA TCGACGTCTC TCTCACCAGG ATTTGGTGTT TAGCTGTTTC 1080
TCTCTTTAAT CTCACGTAGC CCTTTTTCAG GTTAGTACGT GTTCTTCTGT CAGGGCAAAA 1140
CTCAAATCTC CTGTGAAATA CGTATTGATA ATCCAATCTT GATTTTTCCC CCCAGAATAT 1200
AAATCTCAGG TAATASAGGC TTTAGAACTG CTGATAAAGG GATCGTTCTC AGGCCTCCCC 1260
CCGGAGTACT TCAGAATGCA ATAAATCAAA ATATGGGAAA AAAAAAACTC GAG 1313
(2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 798 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: CDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
ATGTGCACCA CAGGGGCGGG GCTGGAGATC ATCAGAAAAG CCCTTACTGA GGAAAAACGT 60
GTCTCAACAA AAACATCAGC TGCAGATCTT GTGACAGAAA CAGATCACCT TGTGGAAGAT 120
TTAATTATTT CTGAGTTGCG AGAGAGGTTT CCTTCACACA GGTTCATTGC AGAAGAGGCC 180
GCGGCTTCTG GGGCCAAGTG TGTGCTCACC CACAGCCCGA CGTGGATCAT CGACCCCATC 240
GACGGCACCT GCAATTTTGT GCACAGATTC CCGACTGTGG CGGTTAGCAT TGGATTTGCT 300
GTTCGACAAG AGCTTGAATT CGGAGTGATT TACCACTGCA CAGAGGAGCG GCTGTACACG 360
GGCCGGCGGG GTCGGGGCβC CTTCTGCAAT GGCCAGCGGC TCCGGGTCTC CGGGGAGACA 420
GATCTCTCAA AGGCCTTGGT TCTGACAGAA ATTGGCCCCA AACGTGACCC TGCGACCCTG 480
AAGCTGTTCC TGAGTA CAT GGAGCGGCTG CTGCATGCCA AGGCGCATGG GGTCCGAGTG 540
ATTGGAAGCT CCACATTGGC ACTCTGCCAC CTGGCCTCAG GGGCCGCGGA TGCCTATTAC 600
CAGTTTGGCC TGCACTGCTG GGATCTGGCG GCTGCCACAG TCATCATCAG AGAAGCAGGC 660
GGCATCGTGA TAGACACTTC GGGTGGACCC CTCGACCTCA TGGTTTGCAG AGTGGTTGCG 720
GCCAGCACCC GGGAGATGGC GATGCTCATA GCTCAGGCCT TACAGACGAT TAACTATGGG 780
CGGGATGATG AGAAGTGA 798
(2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 265 AMINO ACIDS
(B) TYPE: AMINO ACID
(C) STRANDEDNESS:
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: PROTEIN
Met Cys Thr Thr Gly Ala Gly Leu Glu lie lie Arg Lys Ala Leu
5 10 15
Thr Glu Glu Lys Arg Val Ser Thr Lys Thr Ser Ala Ala Asp Leu
20 25 30
Val Thr Glu Thr Asp Hiε Leu Val Glu Aεp Leu lie lie Ser Glu
35 40 45
Leu Arg Glu Arg Phe Pro Ser His Arg Phe lie Ala Glu Glu Ala
50 55 60
Ala Ala Ser Gly Ala Lys Cys Val Leu Thr Hiε Ser Pro Thr Trp
65 70 75 lie lie Aεp Pro lie Aεp Gly Thr Cyε Aεn Phe Val Hiε Arg Phe
80 85 90
Pro Thr Val Ala Val Ser lie Gly Phe Ala Val Arg Gin Glu Leu
95 100 105
Glu Phe Gly Val lie Tyr Hiε Cyε Thr Glu Glu Arg Leu Tyr Thr
110 115 120
Gly Arg Arg Gly Arg Gly Ala Phe Cyε Aεn Gly Gin Arg Leu Arg
125 130 135
Val Ser Gly Glu Thr Aεp Leu Ser Lyε Ala Leu Val Leu Thr Glu
140 145 150 lie Gly Pro Lyε Arg Aεp Pro Ala Thr Leu Lyε Leu Phe Leu Ser
155 160 165
Aεn Met Gly Arg Leu Leu Hiε Ala Lyε Ala His Gly Val Arg Val
170 175 180 lie Gly Ser Ser Thr Leu Ala Leu Cys Hiε Leu Ala Ser Gly Ala
185 190 195 Ala Asp Ala Tyr Tyr Gin Phe Gly Leu Hiε Cys Trp Asp Leu Ala
200 205 210
Ala Ala Thr Val He He Arg Glu Ala Gly Gly He Val He Asp
215 220 225
Thr Ser Gly Gly Pro Leu Aεp Leu Met Val Cys Arg Val Val Ala
230 235 240
Ala Ser Thr Arg Glu Met Ala Met Leu He Ala Gin Ala Leu Gin
245 250 255
Thr He Asn Tyr Gly Arg Aεp Aεp Glu Lyε
260 265

Claims

WHAT IS CLAIMED IS:
1. An iεolated polynucleotide εelected from the group consisting of
(a) a polynucleotide encoding for the hIMP-Hl polypeptide having the deduced amino acid sequence of Figure 1 or a fragment, analog or derivative of said polypeptide;
(b) a polynucleotide encoding for the hIMP-Hl polypeptide having the amino acid sequence encoded by the cDNA contained in ATCC Deposit No. 75753 or a fragment, analog or derivative of said polypeptide.
2. The polynucleotide of Claim 1 wherein the polynucleotide is DNA.
3. The polynucleotide of Claim 1 wherein the polynucleotide is RNA.
4. The polynucleotide of Claim 1 wherein the polynucleotide iε genomic DNA.
5. The polynucleotide of Claim 2 wherein εaid polynucleotide encodeε for hIMP-Hl having the deduced amino acid sequence of Figure 1.
6. The polynucleotide of Claim 2 wherein said polynucleotide encodes the hIMP-Hl polypeptide encoded by the cDNA of ATCC Deposit No. 75753.
7. The polynucleotide of Claim 1 having the coding sequence for hIMP-Hl as shown in Figure 1.
8. The polynucleotide of Claim 2 having the coding sequence for hIMP-Hl deposited as ATCC Deposit No. 75753.
9. A vector containing the DNA of Claim 2.
10. A hoεt cell genetically engineered with the vector of Claim 9.
11. A proceεε for producing a polypeptide compriεing: expresεing from the hoεt cell of Claim 10 the polypeptide encoded by said DNA.
12. A process for producing cells capable of expressing a polypeptide comprising genetically engineering cells with the vector of Claim 9.
13. An iεolated DNA hybridizable to the DNA of Claim 2 and encoding a polypeptide having hIMP-Hl activity.
14. A polypeptide selected from the group consisting of (i) a hIMP-Hl polypeptide having the deduced amino acid sequence of Figure 1 and fragments, analogs and derivatives thereof and (ii) a hIMP-Hl polypeptide encoded by the cDNA of ATCC Deposit No. 75753 and fragmentε, analogs and derivatives of εaid polypeptide.
15. The polypeptide of Claim 14 wherein the polypeptide iε hIMP-Hl having the deduced amino acid sequence of Figure 1.
16. Antibodies against the polypeptide of claim 14.
17. Antagonists againβt the polypeptide of claim 14.
18. A method for the treatment of a patient having need to inhibit hIMP-Hl comprising: administering to the patient a therapeutically effective amount of the antagonist of Claim 17.
19. The method of Claim 18 wherein said antagonist iε a polypeptide and said therapeutically effective amount of the antagonist is administered by providing to the patient DNA encoding said polypeptide and expressing said polypeptide in vivo .
20. A procesε for detecting compoundε which inhibit the interaction of hIMP-Hl with inoεitol monophoεphate compriεing: contacting a compound with a cell line expreεεing hlMP- hl in the preεence of inoεitol monophoεphate; and meaεuring the hydrolyεiε of inoεitol monophoεphate by hIMP-Hl.
PCT/US1994/010465 1994-09-16 1994-09-16 Human inositol monophosphatase h1 WO1996008557A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
EP94930440A EP0784672A4 (en) 1994-09-16 1994-09-16 Human inositol monophosphatase h1
PCT/US1994/010465 WO1996008557A1 (en) 1994-09-16 1994-09-16 Human inositol monophosphatase h1
JP8510137A JPH10505747A (en) 1994-09-16 1994-09-16 Human inositol monophosphatase H1
AU79564/94A AU7956494A (en) 1994-09-16 1994-09-16 Human inositol monophosphatase h1
US09/002,072 US5955339A (en) 1994-09-16 1998-02-09 Human inositol monophosphatase H1
US09/314,198 US6403310B1 (en) 1994-09-16 1999-05-19 Human inositol monophosphatase H1
US09/314,199 US6130051A (en) 1994-09-16 1999-05-19 Human insoitol monophosphatase H1
US09/440,113 US6709653B1 (en) 1994-09-16 1999-11-15 Antibodies specific for human inositol monophosphatase H1
US10/732,271 US20040126377A1 (en) 1994-09-16 2003-12-11 Human inositol monophosphatase H1

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US1994/010465 WO1996008557A1 (en) 1994-09-16 1994-09-16 Human inositol monophosphatase h1

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US08/461,731 Continuation-In-Part US5716806A (en) 1994-09-16 1995-06-05 Human inositiol monophosphatase H1 polynucleotides

Publications (1)

Publication Number Publication Date
WO1996008557A1 true WO1996008557A1 (en) 1996-03-21

Family

ID=22242985

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1994/010465 WO1996008557A1 (en) 1994-09-16 1994-09-16 Human inositol monophosphatase h1

Country Status (4)

Country Link
EP (1) EP0784672A4 (en)
JP (1) JPH10505747A (en)
AU (1) AU7956494A (en)
WO (1) WO1996008557A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6458532B1 (en) * 1996-10-28 2002-10-01 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Polynucleotides encoding IMP.18p myo-inositol monophosphatase and methods of detecting said polynucleotides
US6709653B1 (en) 1994-09-16 2004-03-23 Human Genome Sciences, Inc. Antibodies specific for human inositol monophosphatase H1

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4981980A (en) * 1989-09-14 1991-01-01 Merck & Co., Inc. Drug for treating manic depression

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9024345D0 (en) * 1990-11-08 1990-12-19 Merck Sharp & Dohme Therapeutic agents
GB9212261D0 (en) * 1992-06-10 1992-07-22 Merck Sharp & Dohme Enzyme cloning

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4981980A (en) * 1989-09-14 1991-01-01 Merck & Co., Inc. Drug for treating manic depression

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BIOCHEMICAL JOURNAL, Vol. 284, issued 1992, McALLISTER et al., "cDNA Cloning of Human and Rat Brain Myo-Inositol Monophosphatase", pages 749-754. *
BIOLOGICAL PSYCHIATRY, Vol. 34, issued 1993, KOFMAN et al., "Biochemical, Behavioral and Clinical Studies of the Role of Inositol in Lithium Treatment and Depression", pages 839-852. *
BRAIN RESEARCH, Vol. 613, issued 1993, ATACK et al., "Characterization of Inositol Monophosphatase in Human Cerebrospinal Fluid", pages 305-308. *
CELL, Vol. 63, issued 02 November 1990, MAJERUS et al., "Recent Insights in Phosphatidylinositol Signaling", pages 459-465. *
See also references of EP0784672A4 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6709653B1 (en) 1994-09-16 2004-03-23 Human Genome Sciences, Inc. Antibodies specific for human inositol monophosphatase H1
US6458532B1 (en) * 1996-10-28 2002-10-01 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Polynucleotides encoding IMP.18p myo-inositol monophosphatase and methods of detecting said polynucleotides

Also Published As

Publication number Publication date
EP0784672A1 (en) 1997-07-23
AU7956494A (en) 1996-03-29
JPH10505747A (en) 1998-06-09
EP0784672A4 (en) 1999-03-17

Similar Documents

Publication Publication Date Title
CA2203655C (en) Tumor necrosis factor-gamma
WO1996013603A1 (en) INTERLEUKIN-1 β CONVERTING ENZYME LIKE APOPTOSIS PROTEASE-3 AND 4
WO1996018725A1 (en) Human tissue inhibitor of metalloproteinase-4
AU689492B2 (en) Connective tissue growth factor-2
US6709653B1 (en) Antibodies specific for human inositol monophosphatase H1
US6284504B1 (en) Human DNA ligase III
US5985601A (en) DNA encoding human cystatin E
US5955339A (en) Human inositol monophosphatase H1
EP0784672A1 (en) Human inositol monophosphatase h1
WO1996003415A1 (en) Human potassium channel 1 and 2 proteins
US6455274B1 (en) Human DNA Ligase IV
US6063376A (en) Human deoxycytidine kinase 2
WO1996023410A1 (en) UBIQUITIN CONJUGATING ENZYMES 7, 8 and 9
WO1996030524A1 (en) Human dna ligase iii
WO1997018224A1 (en) Human stem cell antigen 2
US5914258A (en) Human deoxycytidine kinase 2
EP0812360A1 (en) Human geranylgeranyl pyrophosphate synthetase
US5859200A (en) Human amine transporter
AU687484B2 (en) Human dna ligase IV
EP0815199A1 (en) Human deoxycytidine kinase 2
EP0804226A1 (en) Human choline acetyltransferase
US5945321A (en) Ubiquitin conjugating enzymes 7, 8 and 9
WO1996015222A1 (en) HUMAN MutT2
WO1996012501A1 (en) Human hypoxanthine-(guanine) phosphoribosyl transferase-2
CA2194765A1 (en) Connective tissue growth factor-2

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA CN JP KR NZ US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1994930440

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1994930440

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1994930440

Country of ref document: EP