WO2001081393A1 - Nouveau polypeptide, proteine kinase ysk1 humaine 20, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, proteine kinase ysk1 humaine 20, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001081393A1 WO2001081393A1 PCT/CN2001/000597 CN0100597W WO0181393A1 WO 2001081393 A1 WO2001081393 A1 WO 2001081393A1 CN 0100597 W CN0100597 W CN 0100597W WO 0181393 A1 WO0181393 A1 WO 0181393A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- protein kinase
- human
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human YSK1 protein kinase 20, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
- Mitogen-activated protein kinase mediates mitogenic signals transmitted from cell surface receptors into cells (Davis, 1994).
- MAPK mitogen-activated protein kinase
- ERK extracel luar sign l-related k inase
- JNK c-Jun NH2-termina 1 kinase
- SAPK stress-activated protein kinase pathway
- p38 / Mpk2 Pathways which mediate a large number of physiological response processes (David, 1994; Deri jard et al., 1994; Rouse et al., 1994).
- MAPK is activated by successive protein phosphorylation reactions.
- YSK1 yeast Spsl / Ste20-related kinase 1
- YSK1 transcripts can be found in many tissues and cells. During immunoprecipitation, YSK1 showed protein kinase activity.
- YSK1 is not a regulator of the MAPK pathway, but may be involved in the regulation of a new intracellular signaling pathway similar to the MAPK pathway.
- YSK1 shows protein kinase activity, which is similar in structure and evolution to all Ste20-related kinases currently isolated, but lacks the Cdc42 / Racl binding region, and it does not activate any known MAPK pathway. Nonetheless, there are indications that YSK1 still plays an important role in intracellular signaling pathways.
- YSK1-related kinases YSK2, YSK3, and YSK4 have also been isolated to form a new intracellular signaling pathway protein kinase family.
- the human YSK 1 protein kinase 20 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more involved in these processes
- the human YSK 1 protein kinase 20 protein identifies the amino acid sequence of this protein. Isolation of the new YSK 1 protein kinase 20 protein-encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human YSK 1 protein kinase 20.
- Another object of the present invention is to provide a method for producing human YSK 1 protein kinase 20.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human YSK 1 protein kinase 20.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the human YSK 1 protein kinase 20 of the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of human YSK 1 protein kinase 20.
- the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- the sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 A sequence of positions 1290-1841; and (b) a sequence of positions 1-2035 in SEQ ID NO: 1.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human YSK1 protein kinase 20 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human YSK1 protein kinase 20 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
- the amount or biological activity of a polypeptide of the invention comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of malignant tumors, hematological diseases, developmental disorders, H IV infection, immune diseases and various inflammations or other abnormal expressions of human YSK1 protein kinase 20. Use of medicines that cause disease.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. "Insertion” or “addition” means that an alteration in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with human YSK1 protein kinase 20, causes the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human YSK1 protein kinase 20.
- Antagonist refers to a molecule that, when combined with human YSK1 protein kinase 20, can block or regulate the biological or immunological activity of human YSK1 protein kinase 20.
- Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that binds human YSK1 protein kinase 20.
- Regular refers to a change in the function of human YSK1 protein kinase 20, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human YSK1 protein kinase 20.
- substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human YSK1 protein kinase 20 using standard protein purification techniques. Essentially pure human YSK1 protein kinase 20 produces a single main band on a non-reducing polyacrylamide gel. The purity of human YSK1 protein kinase 20 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
- Percent identity means the sequence is the same in two or more amino acid or nucleic acid sequence comparisons Similar percentages.
- the percent identity can be determined electronically, such as by the MEGALIGN program-(Lasergene software package, DNASTAR, Inc., Madison Wis.).
- the MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244).
- the 0 C 1 us ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. Two amino acid sequences such as
- Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the epitope of human YSK1 protein kinase 20.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not Components of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human YSK1 protein kinase 20 means that human YSK1 protein kinase 20 is essentially free of other proteins, lipids, sugars, or other substances that are naturally associated with it. Those skilled in the art can purify human YSK1 protein kinase 20 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human YSK1 protein kinase 20 peptide can be analyzed by amino acid sequence analysis.
- the present invention provides a new polypeptide, human YSK1 protein kinase 20, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human YSK1 protein kinase 20.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human YSK1 protein kinase 20 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2035 bases in length and its open reading frame 1290-1841 encodes 183 Amino acid.
- this peptide has a similar expression profile to human YSK1 protein kinase, and it can be deduced that the human YSK1 protein kinase 20 has similar functions to human YSK1 protein kinase.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DM, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50% (v / v) formamide, 0.1 lj, bovine serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95 % Or more, preferably 97% or more.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human YSK1 protein kinase 20.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human YSK1 protein kinase 20 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (DDNA-DNA or DNA-RM hybridization; (2) the presence or absence of a marker gene function; (3) determination of the level of the human YSK1 protein kinase 20 transcript; (4) immunity Technology or measuring biological activity to detect protein products expressed by genes. The above methods can be used alone or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human YSK1 protein kinase 20 gene expression.
- ELISA enzyme-linked immunosorbent assay
- a method using PCR to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- Polynucleotide sequences of the gene of the present invention obtained as described above, or various DNA fragments can be used It is determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human YSK1 protein kinase 20 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
- a polynucleotide sequence encoding human YSK1 protein kinase 20 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human YSK1 protein kinase 20 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture. And green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture.
- GFP green fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human YSK1 protein kinase 20 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as insect cells such as Fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DM may be in exponential growth phase were harvested after the treatment with (Method 12, using the procedure well known in the art. Alternatively, it is a MgCl 2. If If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging Wait.
- polynucleotide sequence of the present invention can be used to express or produce recombinant human YSK1 protein kinase 20 (Science, 1984; 224: 1431). Generally, the following steps are taken:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
- FIG. 1 is a comparison diagram of gene chip expression profiles of the inventors YSK1 protein kinase 20 and human YSK1 protein kinase.
- the upper graph is a graph of the expression profile of human YSK1 protein kinase 20, and the lower graph is the graph of the expression profile of human YSK1 protein kinase 20.
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates non-starved L02
- 8 indicates L02 +, lhr, As 3+
- 9 indicates ECV304 PMA-
- 10 means ECV304 PMA +
- 11 means fetal liver
- 12 means normal liver
- 13 means thyroid
- 14 means skin
- 15 means fetal lung
- 16 means lung
- 17 means lung cancer
- 18 means fetal spleen
- 19 means spleen
- 20 Indicates prostate
- 21 indicates fetal heart
- 22 indicates heart
- 23 indicates muscle
- 24 indicates testis
- 25 indicates fetal thymus
- 26 indicates thymus.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human YSK1 protein kinase 20 isolated.
- 20KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band. The best way to implement the invention
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from CI on tech). The 0 ⁇ fragment was inserted into the multiple cloning site of pBSK (+) vector (Clontech), and transformed into DH5a. The bacteria formed a cDNA library.
- Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0052e01 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the 0052e01 clone contains a full-length cDNA of 2035bp (as shown in Seq IDN0: l), and has a 552bp open reading frame (0RF) from 1290bp to 1841bp, encoding a new protein (such as Seq ID NO: 2).
- this clone pBS-0052e01 the encoded egg White matter was named human YSKl protein kinase 20.
- Example 2 Cloning of a gene encoding human YSK1 protein kinase 20 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
- Primerl 5'- AAATTACAGCCATTCCCGGGCTGA -3, (SEQ ID NO: 3)
- Primer 2 5'- AAAAAGCCCCCACCCAAAACTACG -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at Ibp at the 5 ′ end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 ⁇ l of KC1, 10 mmol / L Tris- in a reaction volume of 50 ⁇ 1
- This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25 ⁇ M sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA probe was the PCR-encoded human YSK1 protein kinase 20 coding region sequence (1290bp to 1841bp) shown in FIG. 1.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25iiiM KH 2 P0 4 ( P H7.4)-5 x SSC- 5 x Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filters were placed in IxSSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human YSK1 protein kinase 20 According to SEQ ID NO: 1 and the coding region sequence shown in FIG. 1, a pair of specific amplification primers was designed. The sequence is as follows:
- Primer3 5'- CATGCTAGCATGGTGGGGCAGCTTGTGTTTCTG -3 (Seq ID No: 5)
- Priraer4 5'- CATGGATCCTCACAGGTTCAGTGCGCCTCCCCCTC-3-(Seq ID No: 6)
- the 5 'ends of these two primers contain Nhel and BamHI restriction sites, respectively.
- the Nhel and BamHI restriction sites correspond to the selective endonucleases on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Site.
- the pBS-0052e01 plasmid containing the full-length target gene was used as a template for the PCR reaction.
- the PCR reaction conditions are as follows: a total volume of 50 ⁇ l contains 10 pg of pBS- 0052e01 plasmid, primers Primer-3 and Primer- 4 points, and 1 j is lOpmol Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligated product was transformed into E. coli DH5cc by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive clones were screened by colony PCR method and sequenced. Correct positive clone (pET- 0052e01) The recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
- NH2-Met-V l-Gly-Gln-Leu-Val-Phe-Leu-Arg-Pro-Leu-Ala-Arg-Ala-Leu- COOH SEQ ID NO: 7
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- Rabbits were immunized with 4 mg of the above-mentioned jk cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose.
- the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and the total IgG Anti-peptide antibodies were isolated.
- the immunoprecipitation method proved that the purified antibody could specifically bind to human YSK1 protein kinase 20.
- Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Sou thern imprinting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention;
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements Region for homology comparison, if the homology with non-target molecular region is greater than 85% After 15 consecutive bases are identical, the primary probe should not be used in general;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe for subsequent experiments.
- the film is washed with high-strength conditions and strength conditions, respectively.
- the 32 P-Probe (the second peak is free ⁇ - 32P -dATP) is prepared.
- pre-hybridization solution 10xDenhardf s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).
- Gene microarrays or DNA microarrays are currently used in many national laboratories and pharmaceutical companies.
- the companies are starting to develop and develop a new technology. It refers to arranging a large number of target gene fragments in an orderly and high density on a carrier such as glass and silicon, and then using fluorescence detection and computer software to compare and analyze the data.
- a carrier such as glass and silicon
- fluorescence detection and computer software to compare and analyze the data.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions and functions; search for and screen new tissue-specific new genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as inheritance Sexually transmitted diseases.
- the specific method steps have been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ !. The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP 5- Amino- propargy 2'- deoxyuridine 5'- triphate coupled to Cy3 fluorescent dye (Beers from Amersham Phamacia Biotech) labeled mRNA of human mixed tissues
- Cy5dUTP (5- Amino- propargyl- 2'- Deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
- Cy3dUTP 5- Amino- propargy 2'- deoxyuridine 5'- triphate coupled to Cy3 fluorescent dye (Beers from Amersham Phamacia Biotech) labeled mRNA of human mixed tissues
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
- MAPK Mitogen-activated protein kinase
- YSK1 protein The sequence of the catalytic region of YSK1 protein is similar to that of yeast Spsl and Ste20 protein kinases, showing protein kinase activity.
- YSK1 transcription products can be found in many tissues and cells. May be involved in the regulation of a new intracellular signaling pathway similar to the MAPK pathway.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of the YSK1 protein, and both have similar biological functions. It participates in the regulation of a new intracellular signal pathway similar to the MAPK pathway in vivo, and regulates the transport of various proteins and substances in the body. Its abnormal expression is usually associated with embryonic developmental disorders, growth and development. Fertility disorders, abnormal inflammatory processes, immune system disorders, tumorigenesis are closely related, and related diseases occur.
- the abnormal expression of the human YSK 1 protein kinase 20 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, growth and development disorders, inflammation, and immune diseases. These diseases include, but are not limited to :
- Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
- Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- Abnormal expression of the human YSK 1 protein kinase 20 of the present invention will also cause certain hereditary, hematological diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, immunity Sexual diseases, certain hereditary, blood diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human YSK 1 protein kinase 20.
- Agonists enhance biological functions such as human YSK 1 protein kinase 20 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or a membrane preparation expressing human YSK 1 protein kinase 20 can be cultured with labeled human YSK 1 protein kinase 20 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human YSK 1 protein kinase 20 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human YSK 1 protein kinase 2 0 can bind to human YSK 1 protein kinase 20 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide does not Can play biological functions.
- human YSK1 protein kinase 20 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human YSK1 protein kinase 20 and its receptor. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.
- Peptide molecules capable of binding to human YSK1 protein kinase 20 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human YSK1 protein kinase 20 molecule should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the human YSK1 protein kinase 20 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human YSK1 protein kinase 20 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to human YSK1 protein kinase 20 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridization Tumor technology, etc.
- Embedding antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against human YSK1 protein kinase 20.
- Antibodies to human YSK1 protein kinase 20 can be used in immunohistochemistry to detect human YSK1 protein kinase 20 in biopsy specimens.
- Monoclonal antibodies that bind to human YSK1 protein kinase 20 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human YSK1 protein kinase 20 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human YSK1 protein kinase 20-positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to human YSK1 protein kinase 20.
- Administration of an appropriate dose of antibody can stimulate or block the production or activity of human YSK1 protein kinase 20.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human YSK1 protein kinase 20. These tests are well known in the art and include FI SH assays and radioimmunoassays.
- the levels of human YSK 1 protein kinase 20 detected in the test can be used to explain the importance of human YSK 1 protein kinase 20 in various diseases and to diagnose diseases in which human YSK 1 protein kinase 20 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human YSK 1 protein kinase 20 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human YSK 1 protein kinase 20. Recombinant gene therapy vectors (such as viral vectors) can be designed to express the variant human YSK 1 protein kinase 20 to inhibit endogenous human YSK 1 protein kinase 20 activity.
- a mutated human YSK 1 protein kinase 20 may be a shortened human YSK1 protein kinase 20 lacking a signaling domain.
- the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human YSK1 protein kinase 20.
- Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding human YSK 1 protein kinase 20 into cells. Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human YSK 1 protein kinase 20 can be found in the existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human YSK 1 protein kinase 20 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human YSK 1 protein kinase 20 raRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
- Polynucleotide encoding human YSK 1 protein kinase 20 can be used in connection with human YSK 1 protein kinase 20 Diagnosis of the disease.
- the polynucleotide encoding human YSKl protein kinase 20 can be used to detect the expression of human YSKl protein kinase 20 or the abnormal expression of human YSK1 protein kinase 20 in a disease state.
- the DNA sequence encoding human YSK1 protein kinase 20 can be used to hybridize biopsy specimens to determine the expression of human YSK1 protein kinase 20.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization.
- a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a DM chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human YSK1 protein kinase 20-specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human YSK1 protein kinase 20 transcription products.
- Human YSK1 protein kinase 20 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human YSK1 protein kinase 20 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect the expression of proteins, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be To correlate with genetic map data. These data can be found, for example, in V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceutical or biological products, which prompts permission for administration on the human body by government agencies that manufacture, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human YSK1 protein kinase 20 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human YSK1 protein kinase 20 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Enzymes And Modification Thereof (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU65744/01A AU6574401A (en) | 2000-04-27 | 2001-04-23 | A novel polypeptide - human ysk1 protein kinase 20 and a polynucleotide sequenceencoding the same |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00115467.2 | 2000-04-27 | ||
CN 00115467 CN1320693A (zh) | 2000-04-27 | 2000-04-27 | 一种新的多肽——人ysk1蛋白激酶20和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001081393A1 true WO2001081393A1 (fr) | 2001-11-01 |
Family
ID=4584913
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000597 WO2001081393A1 (fr) | 2000-04-27 | 2001-04-23 | Nouveau polypeptide, proteine kinase ysk1 humaine 20, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1320693A (zh) |
AU (1) | AU6574401A (zh) |
WO (1) | WO2001081393A1 (zh) |
-
2000
- 2000-04-27 CN CN 00115467 patent/CN1320693A/zh active Pending
-
2001
- 2001-04-23 WO PCT/CN2001/000597 patent/WO2001081393A1/zh active Application Filing
- 2001-04-23 AU AU65744/01A patent/AU6574401A/en not_active Abandoned
Non-Patent Citations (3)
Title |
---|
ARCH. BIOCHEM. BIOPHYS., vol. 340, no. 2, 1997, pages 201 - 207 * |
J. BIOL. CHEM., vol. 271, no. 49, 1996, pages 31607 - 31611 * |
ONCOGENE, vol. 14, no. 17, 1997, pages 2047 - 2057 * |
Also Published As
Publication number | Publication date |
---|---|
AU6574401A (en) | 2001-11-07 |
CN1320693A (zh) | 2001-11-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001083688A2 (fr) | Nouveau polypeptide, sous-unite humaine 13 phosphatidylinositol-4-phosphate-5-kinase ii beta, et polynucleotide codant pour ce polypeptide | |
WO2001068689A1 (fr) | Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide | |
WO2001068684A1 (fr) | Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001068688A1 (fr) | Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide | |
WO2001046240A1 (fr) | Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide | |
WO2001081393A1 (fr) | Nouveau polypeptide, proteine kinase ysk1 humaine 20, et polynucleotide codant pour ce polypeptide | |
WO2001068873A1 (fr) | Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide | |
WO2001075023A2 (fr) | Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001090376A1 (fr) | Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide | |
WO2001075021A2 (fr) | Nouveau polypeptide, proteine humaine associee au transport de glucose 10, et polynucleotide codant pour ce polypeptide | |
WO2001087972A1 (fr) | Nouveau polypeptide, proteine dpc4 humaine 9 du facteur d'inhibition de la croissance tumorale, et polynucleotide codant ce polypeptide | |
WO2001072790A1 (fr) | Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide | |
WO2001075085A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide | |
WO2001081536A2 (fr) | Nouveau polypeptide, proteine kinase ysk1 humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001075002A2 (fr) | Nouveau polypeptide, gène de regulation du cycle cellulaire humain 28, et polynucléotide codant pour ce polypeptide | |
WO2001074887A1 (fr) | Nouveau polypeptide, proteine humaine 9 humsiah, et polynucleotide codant pour ce polypeptide | |
WO2001075029A2 (fr) | Nouveau polypeptide, facteur humain 11 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001081592A1 (fr) | Nouveau polypeptide, proteine humaine 11 contenant un fragment de sequence particulier d'une signal peptidase i, et polynucleotide codant pour ce polypeptide | |
WO2001073061A1 (fr) | Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide | |
WO2001064917A1 (fr) | Nouveau polypeptide, proteine kinase humaine de transduction de signal 11, et polynucleotide codant pour ce polypeptide | |
WO2001081392A1 (fr) | Nouveau polypeptide, phosphoproteine nucleolaire humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001078755A2 (en) | A novel polypeptide - human ataxia-telangiectasia mutant protein 9 and a polynucleotide encoding the same | |
WO2001075024A2 (fr) | Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001075014A2 (fr) | Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase 35 humaine, et polynucleotide codant pour ce polypeptide | |
WO2001064732A1 (fr) | Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |